JP2017099311A - Dna aptamer binding to chronic myelocytic leukemia cell (k562) - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel DNA aptamer that is useful for diagnosis, treatment, prevention or the like of chronic myelocytic leukemia.SOLUTION: There is provided a DNA aptamer specifically binding to a chronic myelocytic leukemia cell which is selected from a DNA pool having a random sequence by using a Cell-SELEX method, a composition including the DNA aptamer for detecting a chronic myelocytic leukemia cell, a kit for detecting a chronic myelocytic leukemia cell, a method for detecting chronic myelocytic leukemia using the DNA aptamer, a chronic myelocytic leukemia therapeutic drug composition containing the DNA aptamer, use of the DNA aptamer for producing a pharmaceutical composition for treating chronic myelocytic leukemia, and a drug delivery system containing the DNA aptamer for treating chronic myelocytic leukemia. In the DNA aptamer, the chronic myelocytic cell is a K562 cell. The DNA aptamer includes chemical modification in one or more portions selected from a sugar chain portion, phosphoric acid ester portion or nucleic acid base portion.SELECTED DRAWING: Figure 1

Description

  An object of the present invention is to provide a DNA aptamer that can specifically bind to chronic myeloid leukemia, and a composition containing the DNA aptamer.

Chronic myelogenous leukemia still accounts for a high rate of death from disease, and the development of diagnostic agents and detection methods for early diagnosis of chronic myelogenous leukemia is the most important in the interdisciplinary field including medicine and biology. It is a difficult task. All cells, including chronic myeloid leukemia, are covered on the surface by the proteins they produce. Numerous literatures have already introduced that nucleic acids having specific sequences adsorb to these expressed proteins. (For example, Non-Patent Documents 1 and 2; Patent Documents 1 and 2) Nucleic acid sequences that can be specifically adsorbed to these specific targets are called aptamers. Since these aptamers can be produced by a chemical synthesis method, they do not have to be synthesized in vivo like antibodies that have been representative of those that specifically adsorb to a pathogenic protein. When these aptamers are used for diagnosis, they are often fluorescently labeled and detected with a fluorescence microscope. (For example, Non-Patent Document 2)

  The in vitro evolution method (IN VITRO SELECTION method) is used as the most effective means for searching for new aptamers that specifically adsorb to these target targets. In particular, the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method is roughly divided into two steps: selection of the target nucleic acid molecule and amplification of the selected aptamer. (For example, Patent Document 3) By repeating this selection and amplification while increasing the selection pressure, a nucleic acid fragment having high affinity can be obtained. In addition, various improvements have been made in recent years, and aptamers can be recovered with fewer cycles. The method is excellent in efficiency and selectivity, and not only small molecules and proteins but also cells and tissues (exactly on the surface) A technique for obtaining an aptamer that binds to (molecule) (Cell-SELEX method; for example, Non-Patent Document 3) has been reported. Compared to the conventional SELEX method, this method requires no protein analysis, can simultaneously select aptamers of various membrane proteins present on the cell surface, and can select aptamers that bind more specifically to the target cell. There is a feature that said. These aptamers can be synthesized chemically in a short time, not to mention the high affinity and specificity for the target, which is also a characteristic of antibodies that have been used for diagnosis and treatment in the past. Can be performed inexpensively, has a simple mechanism of action, and has few advantages over antibodies that have little immunogenicity.

On the other hand, the incidence of leukemia in Japan is on the rise. According to 2009 statistics, 6.3 people per 100,000 population developed and about 8,000 people died annually.
The incidence of leukemia is high in children and adolescents, and the cause of death among adolescents is the second largest after traffic accidents and has a great social impact.
The pathological condition of leukemia generally refers to a state in which leukemia cells occupy the bone marrow and suppress normal hematopoietic function, making it difficult for normal blood cells to be produced. As a result, red blood cell decrease, anemia, normal white blood cell decrease (especially infection state due to neutropenia), and bleeding symptoms due to thrombocytopenia. As the disease progresses, leukemia cells infiltrate the spleen, liver, and lymph nodes, and the swelling of each organ becomes significant. Carcinogenesis of blood cells occurs at the stage of hematopoietic stem cells, where differentiation stops during the process of blood cell differentiation and maturation, and undifferentiated blast cells proliferate to constitute a tumor, and the ability to regulate the living body In some cases, it shows a deviating autonomous growth, but retains differentiation / maturity. The former is called acute leukemia and the latter is called chronic leukemia or myelogenesis syndrome. Acute leukemia generally progresses acutely and dies within a few months if untreated. Chronic leukemia may follow a chronic course over several years even if untreated.

These leukemia cells are divided into myeloid and lymphoid types by cell lineage, and related diseases are classified into dozens of types including related diseases. In the FAB classification, out of all cells in the bone marrow, those with leukemia cells (blasts) of 30% or more are classified as acute leukemia, and those with less than 30% are classified as myelodysplastic syndrome. On the other hand, the chronic myeloid leukemia targeted in this patent has a marked increase in leukocytes, and especially neutrophil increase is the main subject, but increases in basophils and eosinophils are also observed. The neutrophil alkaline phosphatase score is markedly reduced. Conventional chemotherapy with hydroxyurea, busulfan, etc. usually becomes resistant to treatment in 4 years, and spleen enlargement, basophil increase, thrombocytopenia, and fever of unknown cause cause death in the acute phase. Imatinib, which specifically inhibits the tyrosine kinase activity produced by the BCR-ABL1 gene, which causes chronic myeloid leukemia, has been used for treatment since 2000, and the 8-year survival rate is superior to 90%. It seemed to show a therapeutic effect.

In recent years, however, chronic myeloid leukemia resistant to imatinib has appeared in about 25% of chronic myeloid leukemia, and development of therapeutic agents and diagnostic agents for these resistant strains has been demanded.

JP 2006-149302 A JP 2011-92138 A International Publication WO91 / 19813

Yaxin Jiang, Xiahong Fang, and Chunli Bai., Anal chem .., 76 (17): 5230-3235, 2004. Yen-An Shieh, Shu-Jyuan Yang, Ming-Feng Wei and Ming-JiumShieh., ACS NANO., Vol.4, No.3, 1433-1442, 2010. Guo, et al., Int. J. Mol. Sci., 9 (4): 668, 2008.

  Under the background as described above, an object of the present invention is to provide a novel DNA aptamer related to chronic myelogenous leukemia cells useful for diagnosis, treatment, etc. of chronic myelogenous leukemia.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors have identified a nucleotide sequence having a specific binding ability to chronic myeloid leukemia cells by using the Cell-SELEX method. The inventors have newly found that a DNA having the sequence can function as a specific aptamer for chronic myeloid leukemia cells, and have completed the present invention.

That is, the present invention, in one embodiment,
(1) A DNA aptamer having at least one nucleotide sequence selected from the sequences represented by SEQ ID NOs: 1 to 12, and specifically binding to chronic myeloid leukemia cells;
(2) In at least one nucleotide sequence selected from the sequences represented by SEQ ID NOs: 1 to 12, it has a sequence containing 1 to 3 nucleotide substitutions, deletions or additions, and has chronic myeloid leukemia cells. A DNA aptamer characterized in that it specifically binds to;
(3) a DNA aptamer that specifically binds to chronic myeloid leukemia cells,
5′-P ₁ -XP ₂ -3 ′
Having a nucleotide sequence represented by
Here, X is 1) a nucleotide sequence selected from the sequences shown in SEQ ID NOs: 1 to 12, or 2) 1 to 3 nucleotides in the nucleotide sequence selected from the sequences shown in SEQ ID NOs: 1 to 12 A sequence containing substitutions, deletions or additions,
DNA aptamer according to (1) or (2), wherein P ₁ and P ₂ are first and second primer recognition sequences introduced for PCR amplification;
(4) The DNA aptamer according to (3) above, wherein P ₁ is a first primer recognition sequence represented by SEQ ID NO: 13, and P ₂ is a second primer recognition sequence represented by SEQ ID NO: 14;
(5) The DNA aptamer according to any one of (1) to (4), wherein the chronic myeloid cell is a K562 cell;
(6) comprising at least one chemical modification selected from the group consisting of chemical substitution at the sugar chain moiety, chemical substitution at the phosphate ester moiety, and chemical substitution at the nucleobase moiety. The DNA aptamer according to any one of to (5);
(7) The DNA aptamer according to any one of (1) to (6) above, which has a fluorescent label at the 5 ′ end or the 3 ′ end;
(8) The fluorescent label is green fluorescent protein (GFP), fluorescent protein, fluorescein isothiocyanate (FITC), 6-carboxyfluorocein-aminohexyl, fluorescein derivative, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 488 , Alexa Fluor 647, Alexa Fluor 750, rhodamine, 6-carboxytetramethylrhodamine, TAMRA®, phycoerythrin (PE), phycocyanin (PC), PC5, PC7, Cy dye, Cy3, Cy3.5, Cy5 , Cy5.5, Cy7, TexasRed, allophycocyanin (APC), aminomethylcoumarin acetate (AMCA), Marina Blue, Casca e Blue, Cascade Yellow, Pacific Blue, SPRD, Tetramethylrhodamine isothiocyanate (TRITC), R110, mC1B, CellTracker dye, CFSE, JC-1, PKH, DCFH-DA, DHR, FDA, Calcein AM, Nitrobenzodia Azole (NBD) group, dimethylaminosulfonylbenzooxadiazole group, acidine (Acd), dansyl (Dns), 7-dimethylaminocoumarin-4-acetic acid (DMACA), 5-((2-aminoethyl) amino ) Having an emission wavelength of 421 nm to 712 nm including at least one selected from naphthalene-1-sulfonic acid (EDANS), naphthalene, anthracene and protoporphyrin 9 DNA aptamers described in (7) is a machine-based fluorescent molecules;
(9) The DNA aptamer according to (7), wherein the fluorescent label is a quantum dot;
(10) a DNA aptamer in which the DNA aptamer according to any one of (1) to (9), which is fluorescently labeled at the 5 ′ end or the 3 ′ end, is adsorbed on the surface of the metal nanoparticle; and (11) the above The DNA aptamer according to the above (10), wherein the metal used for the metal nanoparticles is gold, silver, copper, iron or silicon.

In another aspect, the present invention relates to the detection of chronic myeloid leukemia cells with the above DNA aptamer, in particular,
(12) A composition for detecting chronic myeloid leukemia cells, comprising the DNA aptamer according to any one of (1) to (11) above;
(13) A kit for detecting chronic myeloid leukemia, comprising the DNA aptamer according to any one of (1) to (11) above;
(14) A method for detecting chronic myeloid leukemia, comprising using the DNA aptamer according to any one of (1) to (11) above;
(15) A step of bringing the DNA aptamer into contact with a sample collected from a living body selected from the group consisting of chronic myeloid leukemia cells, blood, serum, plasma, saliva, and sputum, and binding of the sample to the DNA aptamer Detecting the presence of chronic myeloid leukemia by observing the response according to (14) above;
(16) The detection method according to (15), wherein the response is a fluorescence response; and (17) The detection method according to (15), wherein the response is a Raman scattering response.

In a further aspect, the present invention relates to the use of the above DNA aptamer in pharmaceutical compositions and drug delivery systems, in particular,
(18) A pharmaceutical composition for treating chronic myeloid leukemia, comprising the DNA aptamer according to any one of (1) to (11) above;
(19) Use of the DNA aptamer according to any one of (1) to (11) above for the manufacture of a pharmaceutical composition for treating chronic myeloid leukemia; and (20) (1) to (11) above. The drug delivery system for treatment of chronic myeloid leukemia containing the DNA aptamer according to any one of the above.

  According to the present invention, the use of a novel DNA aptamer that specifically binds to chronic myeloid leukemia cells enables efficient detection of such chronic myeloid leukemia cells. In particular, by applying to a kit containing a DNA aptamer provided with a detection site such as a fluorescent label, it is possible to perform simple and high-throughput detection or imaging using chronic myeloid leukemia cells collected from a living body as a measurement target. . Furthermore, by applying to a kit or the like containing a dispersion in which the DNA aptamer labeled with the fluorescent label is fixed to metal nanoparticles, it is easy and easy to measure chronic myeloid leukemia cells and tissues collected from a living body. High-throughput detection or imaging can be performed. By detecting such chronic myelogenous leukemia cells, it is possible to diagnose the onset of cancer, the presence or absence of metastasis, the prognosis of cancer, and the grade of malignancy.

  Further, since the DNA aptamer of the present invention has the property of being able to specifically bind to chronic myeloid leukemia cells, the drug can be obtained by binding a drug such as an anticancer drug to the DNA aptamer. Therefore, it can be expected to be useful as a pharmaceutical composition for treating chronic myeloid leukemia or a drug delivery system for such a pharmaceutical composition.

  Furthermore, since the consensus sequence in the DNA aptamer of the present invention is a relatively short region of only about 30 bases, it is possible to suppress the labor and cost for production, and to perform desired chemical modification or the like depending on various applications. There is also an advantage that it is easy to add a further function.

FIG. 1 is a schematic diagram showing the formation of single-stranded double-stranded DNA using magnetic particles. FIG. 2 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 1. FIG. 3 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 1. FIG. 4 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 2. FIG. 5 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 2. FIG. 6 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 3. FIG. 7 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 3. FIG. 8 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 4. FIG. 9 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 4. FIG. 10 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 5. FIG. 11 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 5. FIG. 12 is a real image of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 6. FIG. 13 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 6. FIG. 14 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 7. FIG. 15 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 7. FIG. 16 is a real image of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 8. FIG. 17 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells with a DNA aptamer having SEQ ID NO: 8. FIG. 18 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 9. FIG. 19 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 9. FIG. 20 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 10. FIG. 21 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 10. FIG. 22 is a real image of chronic myeloid leukemia K562 cells by DNA aptamer having SEQ ID NO: 11. FIG. 23 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 11. FIG. 24 is a real image of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 12. FIG. 25 is a fluorescence imaging diagram of chronic myeloid leukemia K562 cells by a DNA aptamer having SEQ ID NO: 12.

  Hereinafter, embodiments of the present invention will be described. The scope of the present invention is not limited to these descriptions, and other than the following examples, the scope of the present invention can be appropriately changed and implemented without departing from the spirit of the present invention.

1. DNA aptamer In the present application, “DNA aptamer” means a single-stranded oligo DNA that can specifically recognize a target molecule or substance, and the DNA aptamer according to the present invention is specific for chronic myeloid leukemia cells. It is a single-stranded oligo DNA having a function of binding to. In a typical embodiment, the DNA aptamer according to the present invention has a nucleotide sequence represented by any of SEQ ID NOs: 1 to 24 shown below. The nucleotide sequence is written from left to right in the direction from the 5 ′ end to the 3 ′ end.
<SEQ ID NO: 1>
GGGAGACAAGAATAAGCGCCACCTAAGCTGTACC
<SEQ ID NO: 2>
TGCGCGTGGGTGGTTTGCTCGTCAGCTTGGGGTG
<SEQ ID NO: 3>
TGCGGTGGTGCTATTCTGGTGTCAGCTTAGGGTC
<SEQ ID NO: 4>
CGCTTCCTGGATATAGTGTTGTCAGCCTTAGGGTG
<SEQ ID NO: 5>
CGGTGAAGTTGTGTCTTGGTGGCAGCTTAGGGTC
<SEQ ID NO: 6>
GGGAGACAAGAAATAAGCGCACCTAAGCTGACC
<SEQ ID NO: 7>
TGCGCGTGGGTGGTTTGCTCGTCAGCGTTGTG
<SEQ ID NO: 8>
GGGAGACAAGATAATAAGCGCACCCAAGCTGACAGAC
<SEQ ID NO: 9>
GGGAGACAAGAATAAGCGCCACCTAAGCTGAAC
<SEQ ID NO: 10>
GTTGACGTGAATATGTTGCCGGTTCAGCTTAGGGTG
<SEQ ID NO: 11>
GTAGGTTCCGTTGCCACAAGGTGTCAGCCTTAGGGTG
<SEQ ID NO: 12>
TGGCGGTGGGTGCCCTATCTGGTGTCAGCTTAGGGTC

  As long as the DNA aptamer according to the present invention has a function of specifically binding to chronic myeloid leukemia cells, one or a plurality of nucleotides in the sequences of SEQ ID NOs: 1 to 12 are substituted, deleted, or added. It may be an array. Preferably, the number of nucleotides to be substituted, deleted or added is 1 to 3, more preferably 1 or 2, and still more preferably 1. When such nucleotide substitution, deletion, or addition is present, the sequence of the DNA aptamer according to the present invention is 90% or more, preferably 93% or more, more preferably 96, with each of the above SEQ ID NOs: 1-12. % Or more homologous sequences (hereinafter sometimes referred to as “homologues”). Here, as used herein, the term “homology” refers to the generally accepted meaning in the art. The term is typically referred to when examined by sequence analysis programs (eg, Karlin and Altschul, 1990, PNAS 87: 2264-2268; Karlin and Altschul, 1993, PNAS 90: 5873-5877) or by visual inspection. The number of nucleotides of the subject nucleic acid sequence that match the same nucleotides of the nucleic acid sequence.

  When one or more nucleotides are substituted, the substitution can be made with a universal base. The term “universal base” indicates its commonly accepted meaning in the art. That is, the term generally refers to nucleotide base analogs that form base pairs with each base of standard DNA / RNA almost indistinguishably and are recognized by intracellular enzymes (see, eg, Loakes et al., 1997, J. MoI. Mol.Bio.270: 426-435). Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carbozamide, and nitroazole derivatives (3-nitropyrrole, 4-nitroindole , 5-nitroindole, and 6-nitroindole) (Loakes, 2001, Nucleic Acids Res. 29: 2437).

  In addition, the DNA aptamer according to the present invention has no upper limit as long as it has a function of specifically binding to chronic myeloid leukemia cells. However, in consideration of easiness of synthesis, antigenicity problems, etc., the upper limit of the length of the DNA aptamer in the present embodiment is, for example, 200 bases or less, preferably 150 bases or less, more preferably 100 bases or less. . When the total number of bases is small, chemical synthesis and mass production are easier, and the cost advantage is great. Moreover, chemical modification is easy, safety in the living body is high, and toxicity is low. As a minimum, it is more than the base number in the said sequence number 1-12, ie, 32 bases or more. The DNA aptamer is preferably single-stranded (ssDNA), but even when a double-stranded structure is partially formed by taking a hairpin loop structure, the length of the DNA aptamer is one. Calculate as the length of the chain.

In a preferred embodiment, the DNA aptamer according to the present invention may be a nucleotide sequence comprising any one of the sequences of SEQ ID NOs: 1 to 12 and a primer recognition sequence on the 5 ′ and 3 ′ terminal sides thereof. That is, in this case, the DNA aptamer is
5′-P ₁ -XP ₂ -3 ′
It has the nucleotide sequence represented by these. Here, X is a nucleotide sequence selected from the sequences shown in SEQ ID NOs: 1 to 12, or a sequence containing 1 to 3 nucleotide substitutions, deletions or additions in these sequences. P ₁ and _{P 2} are the first and second primer recognition sequence introduced for the PCR amplification. Preferably, P ₁ is GCC TGT TGT GAG CCT CCT (SEQ ID NO: 13) and P ₂ is CGC TTA TTC TTG TCT CCC (SEQ ID NO: 14).

The DNA aptamer according to the present invention may be chemically modified in order to increase stability in vivo. Non-limiting examples of such chemical modifications include chemical substitution at the sugar chain moiety (eg 2′-0 methylation), chemical substitution at the phosphate ester moiety (eg phosphorothioation, amino group) , Chemical modification of lower alkylamine group, acetyl group, etc.), and chemical substitution at the base moiety.
Similarly, it may have additional bases at the 5 ′ or 3 ′ end. The length of the additional base is usually 5 bases or less. The additional base may be DNA or RNA, but if DNA is used, the stability of the aptamer may be improved in some cases. Examples of such an additional base sequence include ug-3 ′, uu-3 ′, tg-3 ′, tt-3 ′, ggg-3 ′, guuu-3 ′, gttt-3 ′, and tttt-3. Examples of such sequences include, but are not limited to, ', uuuu-3'.

  In addition, the DNA aptamer according to the present invention can have a detection label linked to, for example, the 5 'end or the 3' end for use in the method for detecting chronic myeloid leukemia cells described below or the detection kit. As the detection label, a fluorescent label is preferable, but a Raman scattering label, an enzyme label, and an infrared label may be used.

As the fluorescent label, a fluorescent labeling agent commonly used in the technical field can be used. However, green fluorescent protein (GFP), fluorescent protein, fluorescein isothiocyanate (FITC), 6-carboxyfluorocein-aminohexyl, Fluorescein derivative, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor 647, Alexa Fluor 750, rhodamine, 6-carboxytetramethylrhodamine, TAMRA®, phycoerythrin (PE), phycocyanin (PC), PC5, PC7, Cy dye, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, TexasRed, allophycocyanin (APC), aminomethyl Marine acetate (AMCA), Marina Blue, Cascade Blue, Cascade Yellow, Pacific Blue, SPRD, tetramethylrhodamine isothiocyanate (TRITC), R110, mC1B, CellTracker dye, CFSE, JC-1, PKH, DCH, DCH, DCH, DCH, DCH FDA, Calcein AM, nitrobenzooxadiazole (NBD) group, dimethylaminosulfonylbenzooxadiazole group, acidine (Acd), dansyl (Dns), 7-dimethylaminocoumarin-4-acetic acid (DMACA), 5 -((2-aminoethyl) amino) naphthalene-1-sulfonic acid (EDANS), naphthalene, anthracene and pro It includes organic fluorescent molecules 712nm from the light-emitting wavelength 421nm containing one or more selected from porphyrin 9. More preferably, for example, 6-carboxytetramethylrhodamine (TAMRA (trademark)), fluorescein isothiocyanate (FITC), 6-carboxyfluorocein-aminohexyl (FAM), cyanine fluorescent dye (Cy3, Cy3.5, Cy5) , Cy5.5) and other fluorophores that can be introduced by a commercially available oligonucleotide solid-phase synthesis service.

Furthermore, a quencher (quenching substance) that absorbs fluorescence energy emitted from the fluorescent substance may be further bound in the vicinity of the fluorescent substance. In such an embodiment, the fluorescence is detected by separating the fluorescent substance and the quencher during the detection reaction. Examples of enzyme labels include β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like. Further, as a luminescent substrate, luminol, luminol derivatives, luciferin, lucigenin, or the like may be used as a labeling agent.

  The Raman scattering label is not particularly limited as a substituent having the ability to bind to a metal surface, for example, either the 5 ′ end or the 3 ′ end of the fluorescently labeled aptamer, but a thiol (SH) group. By introducing a group selected from an alkylamino group, an aromatic amino group and a carboxyl group and adsorbing the group to, for example, the gold nanoparticle surface, the enhanced Raman scattering light emitted from the aptamer-adsorbed metal particle is detected. Cell recognition is performed. In this case, although not particularly limited, gold, silver, iron, quantum dots, or the like can be used as the metal nanoparticles.

2. Selection of DNA aptamer The DNA aptamer of the present invention can be selected and obtained using in vitro selection methods well known in the art. As a preferable example of such a technique, an in vitro evolution method (System Evolution of Ligands by EXPERIMENTAL ENRICHEMENT: SELEX method) is used. In the SELEX method, nucleic acid ligands (aptamers) that bind to a target substance are selected several times and exponential amplification by PCR (Polymerase Chain Reaction) is repeated a plurality of times to obtain a nucleic acid molecule having affinity for the target substance (one Strand DNA, RNA). As an improved technique, it is preferable to use a Cell-SELEX method as described in, for example, Guo, et al., Int. J. Mol. Sci., 9 (4): 668, 2008. Since this method can use cells themselves as a target, analysis of membrane proteins on the cell surface is unnecessary and multiple aptamers that can bind to the cell surface can be selected simultaneously compared to the conventional SELEX method. And an aptamer that more specifically binds to the target cell can be selected. In addition to these, the DNA aptamer of the present invention can be selected and obtained using a method well known in the art.

  As described above, the “in vitro selection method” selects an aptamer molecule having affinity for a target molecule or cell from a pool of nucleic acid molecules (so-called DNA pool) containing a random nucleotide sequence, and determines the affinity. It is a method of eliminating molecules that do not have. By repeating the cycle of amplifying only the selected aptamer molecule by PCR or the like, and further selecting by affinity, aptamer molecules having strong binding ability can be concentrated.

  Specifically, first, a single-stranded nucleic acid molecule containing a random nucleotide sequence (base sequence) region of about 20 to 300 bases, preferably 30 to 150 bases, more preferably about 30 to 100 bases, for example, oligo DNA is prepared. To do. In order to enable PCR amplification, it is preferable to use an oligo DNA having a base sequence to serve as a primer at both ends. The primer recognition sequence portion may have an appropriate restriction enzyme site so that the primer portion can be excised with a restriction enzyme after PCR amplification. The length of the primer recognition sequence portion to be used is not particularly limited, but is about 20 to 50, preferably about 20 to 30 bases. Further, in order to make it possible to separate the single-stranded DNA after PCR amplification by electrophoresis or the like, the 5 ′ end may be labeled with a radiolabel, a fluorescent label, or the like.

  Next, the nucleic acid molecule (library pool) having the random nucleotide sequence obtained above and the target cell are mixed at an appropriate concentration ratio and incubated under an appropriate condition. After incubation, the mixture is centrifuged to separate the nucleic acid molecule-target cell complex and free nucleic acid molecule. The supernatant portion of the separation solution is removed, and a cell-bound nucleic acid sequence is amplified by performing a PCR reaction using the obtained nucleic acid molecule-target cell complex. Thereafter, the nucleic acid molecule forming a complex with the target cell is made into a single strand according to a technique well known in the art. As such a technique, for example, separation utilizing the binding of streptavidin-immobilized magnetic particles and biotin can be mentioned. Thereby, ssDNA having cell binding ability can be separated from the amplified nucleic acid duplex, and unnecessary coexisting substances contained in the PCR reaction solution such as DNA polymerase can be removed. Thereafter, the same operation is performed using the recovered ssDNA as a library pool.

  A series of operations from mixing the above-described nucleic acid molecule and target cell, separation of the nucleic acid molecule bound to the target cell, PCR amplification, and use of the amplified nucleic acid molecule again for binding to the target cell are performed in several rounds. By repeating rounds, nucleic acid molecules that bind to target cells more specifically can be selected. The obtained nucleic acid molecule can be subjected to sequence analysis by a technique well known in the art.

3. Sensing composition cancer cells, detection methods, and kits as described above, DNA aptamers according to the present invention has a function of binding specifically to chronic myelogenous leukemia cells, the chronic myelogenous The composition for detection containing the DNA aptamer of the present invention can be preferably used as a tumor marker for chronic myeloid leukemia.

  Specifically, the detection composition containing the DNA aptamer of the present invention is brought into contact with a sample collected from a living body selected from the group consisting of blood, serum, plasma, saliva, and sputum, and then the sample and DNA The presence of chronic myeloid leukemia cells is detected by observing the response (with or without signal) due to binding with the aptamer. The “sample collected from a living body” is a sample collected from an animal, preferably a human, and is in the form of a sample that can be secured with minimal invasiveness or a secretory fluid, in vitro cell culture fluid component sample, etc. It is not limited. In addition, the “response” for detecting the presence of chronic myeloid leukemia cells is preferably a fluorescence response or a Raman scattering response. Therefore, as described above, in the fluorescence response, the 5 ′ end of the DNA aptamer or 3 It is preferable to link a fluorescent labeling agent such as TAMRA ™ FITC to the end. In the Raman scattering response, a fluorescent labeling agent such as Cy3.5 (trademark), TAMRA (trademark), FITC or the like is linked to the 5 'end or 3' end of the DNA aptamer, and the thiol (SH) group, alkylamino is further linked. It is preferable to introduce a group selected from a group, an aromatic amino group and a carboxyl group, and to adsorb it on, for example, the gold nanoparticle surface.

  In addition, the composition for detecting chronic myeloid leukemia cells of the present invention can be provided as a kit containing a DNA aptamer in order to improve its convenience and portability. In the kit, the DNA aptamer can be provided usually in the form of an aqueous solution dissolved at an appropriate concentration, or in the form of a DNA array in which the DNA aptamer is immobilized on a solid phase carrier. For example, biotin is bound to the end of a DNA aptamer to form a complex, streptavidin is immobilized on the surface of the solid support, and the DNA aptamer is immobilized on the solid support by the interaction of biotin and streptavidin. can do. The kit may appropriately contain other reagents as necessary. For example, additives such as a solubilizing agent, a pH adjusting agent, a buffering agent, and a tonicity agent may be used as an additive. These blending amounts can be appropriately selected by those skilled in the art.

4). Pharmaceutical composition and DDS
In another aspect, the present invention provides a pharmaceutical composition for the treatment of chronic myelogenous leukemia comprising the above DNA aptamer. Preferably, in addition to the DNA aptamer, the pharmaceutical composition can contain an effective amount of a pharmaceutical compound (active ingredient) for the treatment of chronic myeloid leukemia and a pharmaceutically acceptable carrier.
The active ingredient contained in the pharmaceutical composition of the present invention is not particularly limited as long as it is effective for the treatment of chronic myelogenous leukemia, but is preferably an anticancer agent. Examples of such anticancer agents include imatinib, nilotinib and dasatinib.

Targets of molecular target drugs are classified into 1) cell surface antigen, 2) growth factor / receptor / signal transduction system, 3) cell cycle, 4) apoptosis, 5) telomere / telomerase, 6) metastasis / angiogenesis The In chronic myeloid leukemia, imatinib, nilotinib, and dasatinib are generally used as tyrosine kinase inhibitors.
Molecularly targeted therapeutics that target cell surface antigens are often antibodies, but antibodies are not used in chronic myelogenous leukemia.

    Examples of the pharmaceutically acceptable carrier contained in the pharmaceutical composition of the present invention include excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, and stearic acid. Lubricants such as magnesium and aerosil, fragrances such as citric acid and menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspending agents such as methylcellulose and polyvinylpyrrolidone, and interfaces Examples include, but are not limited to, dispersants such as active agents, diluents such as water and physiological saline, and base waxes.

  In order to promote introduction of the pharmaceutical composition of the present invention into chronic myeloid leukemia cells, the composition may further contain a nucleic acid introduction reagent. As the reagent for introducing nucleic acid, cationic lipids such as atelocollagen, liposome, nanoparticle, lipofectin, lipfectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDAB, HDAB, polybrene, or polyethyleneimine are used. I can do it.

The pharmaceutical composition of the present invention can be administered to, for example, mammals (eg, humans, rats, mice, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.).

The pharmaceutical composition of the present invention can take various dosage forms, for example, capsules, tablets, liquids and the like, but is not limited, but more generally, it is liquefied and made into injections. Or an oral agent or a sustained-release agent. The injection can be prepared by a well-known method in the technical field. For example, it can be prepared by dissolving in an appropriate solvent such as sterilized water, buffer solution, physiological saline, etc., sterilizing by filtration with a filter or the like, and then filling in an aseptic container. Oral preparations are formulated into dosage forms such as tablets, granules, fine granules, powders, soft or hard capsules, solutions, emulsions, suspensions, syrups and the like. As a sustained release agent, it is formulated into dosage forms such as tablets, granules, fine granules, powders, soft or hard capsules, microcapsules and the like. In the case of formulating, a stabilizer such as albumin, globulin, gelatin, mannitol, glucose, dextran, ethylene glycol or the like can be preferably added. Furthermore, in the formulation of the pharmaceutical composition of the present invention, necessary auxiliary additives such as excipients, solubilizers, antioxidants, soothing agents, tonicity agents and the like may be included. In the case of a liquid preparation, it is desirable to store it after removing moisture by freeze storage or freeze drying. The freeze-dried agent is used by re-dissolving it by adding distilled water for injection at the time of use. In the case of a sustained release agent, examples of sustained release carriers include soluble collagen or soluble collagen derivatives, proteins such as gelatin, ceramic porous bodies, polyamino acids, polylactic acid, chitin or chitin derivatives, water-swellable polymer gels, etc. Can be used.

  The pharmaceutical composition of the present invention can be administered by an appropriate administration route depending on the form. While it is possible to administer orally or parenterally, it is desirable to administer parenterally. For example, it can be administered into a vein, artery, subcutaneous, intramuscular, etc. in the form of an injection. Moreover, it can administer by implanting in the living body, for example, an affected part, subcutaneous, intramuscular, etc. in the form of a sustained release agent. The dose and frequency of administration vary depending on the purpose of administration, administration method, type and size of cancer, and the situation (gender, age, body weight, etc.) of the subject of administration, but basically a desirable dosage form for the above active ingredients Follow.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not limited by these.

Example 1 Selection of Aptamers Aptamers that specifically bind to K562 cells, which are chronic myeloid leukemia cells, were selected from a DNA pool having a random sequence using the Cell-SELEX method. Each step in the Cell-SELEX method is as follows.
1) Preparation of DNA pool (solution preparation of DNA aptamer candidate group)
2) Mixing with target substance-K562 cells 3) Separation of target-binding DNA and non-binding DNA 4) Replication of target-binding DNA (step of amplifying DNA aptamer bound to target substance)
5) Purification of target-binding DNA (step of purifying amplified DNA aptamer into single-stranded DNA)
6) Cloning of target-binding nucleic acid (pretreatment for sequence analysis of the obtained DNA aptamer)
7) 6 rounds of steps 1) to 6) are performed 8) Sequence analysis of target-binding nucleic acid (analysis of nucleotide sequence of DNA aptamer by sequencer)
A more detailed experimental procedure is as follows.

The DNA pool used was an oligo DNA having the following sequence with a total length of 70 bases and a random sequence part (N) of 34 bases.
DNA pool: Random 34 (manufactured by Tsukuba Oligo)
- sequence: 5'-GCC TGT TGT GAG CCT CCT (N 34) CGC TTA TTC TTG TCT CCC-3 '
・ Length: 70 bases (random sequence is the center 34 bases)
・ Molecular weight: 21391.3 g / mol
Molar extinction coefficient: 630475 L / mol · cm
Both sides of the random sequence are sequences that are recognized by primers in later PCR and allow amplification. A 1 μM DNA pool was prepared from the random DNA using a cell culture medium (Wako Pure Chemical Industries, Ltd .: RPM1-1640) buffer as a solvent.

Thereafter, K562 cells were cultured in a culture dish and cultured until the number of cells reached 10 ⁶ to 10 ⁷ . After the culture, the medium was removed, and 2 mL of phosphate buffered saline (hereinafter referred to as PBS) was added to the petri dish to wash the cells. 1 mL of 0.05% trypsin solution containing EDTA was added to the petri dish, and left in a 37 ° C. incubator for 2 minutes. After confirming that the cells were detached from the petri dish, 4 mL of PBS was added, and this was collected in a 15 mL centrifuge tube and centrifuged at 200 g for 3 minutes. Thereafter, the supernatant was removed with an aspirator. PBS (3 mL) was added thereto, the cells were suspended by pipetting, centrifuged at 200 g for 3 minutes, and the washing step for removing the supernatant was performed twice. Were prepared medium to 10 ⁶ cells in 330UL. To the prepared suspension, 370 μL of a 1 μM random DNA (DNA pool) solution prepared in advance was mixed and mixed thoroughly by vortexing.

  The obtained mixed solution was allowed to stand in a 37 ° C. incubator for 1 hour. Thereafter, centrifugation was performed at 400 g for 4 minutes using the same centrifuge tube. After removing the supernatant, 500 μL of PBS was added and centrifuged at 400 g for 4 minutes. This washing operation was performed three times. After removing the supernatant, 200 μL of PBS was added and heated at 95 ° C. for 10 minutes. Centrifugation was performed at 13000 g for 5 minutes, and the supernatant was collected.

The separated K562 cell binding DNA was amplified by PCR. The apparatus used was a Thermal Cycler (TAKARA-TP600). As the primer, an 18-base primer corresponding to the common sequence of the random DNA was used (manufactured by Tsukuba Oligo). On the 5 ′ end side of the primer, biotin modification is applied to enable separation of single-stranded DNA as described later.
Streptavidin is added to the purified DNA and adsorbed on the magnetic particles. After collecting the magnetic particles with a magnet, the supernatant is removed, and then single-stranded DNA not bound to the magnetic particles is recovered in the supernatant by denaturation with alkaline buffer ( FIG. 1). Thereafter, the alkaline buffer was replaced with a PBS buffer, and the single-stranded DNA, which was the target compound bound to the magnetic particles, was recovered. This was one round and this operation was performed 6 times.
Six rounds later, PCR amplification was performed using an 18-base primer not modified with biotin, and the PCR product was subjected to sequencer analysis.

Example 2: Staining of chronic myelogenous leukemia cells with fluorescently labeled DNA aptamer K562 cells are cultured in a culture dish and cultured until the number of cells reaches 10 ⁶ to 10 ⁷ . An aptamer solution in which the 5 ′ end of a DNA aptamer consisting of a nucleotide sequence having affinity for K562 cells found by sequencer analysis was modified with TAMRA ™, and the DNA was adjusted to 100 μM with ultrapure water. Was added while being dispersed in a culture dish having a 1 mL culture solution. This was left still in an incubator at 37 ° C. for 1 hour. Thereafter, the cells were washed three times with PBS, and further observed with an inverted fluorescence microscope IX71 manufactured by Olympus with 2 mL of PBS added. The results with the DNA aptamers having SEQ ID NOs: 1 to 24 are shown in FIGS. 2 to 25, respectively. It was revealed that these fluorescently labeled DNA aptamers specifically bind to K562 cells, thereby obtaining good fluorescence imaging images for K562 cells.

The aptamer of the present invention is useful for detecting chronic myeloid leukemia. Further, it can be expected to be useful as a pharmaceutical composition for treating chronic myelogenous leukemia or a drug delivery system for such a pharmaceutical composition.

Claims (20)

A DNA aptamer having at least one nucleotide sequence selected from the sequences represented by SEQ ID NOs: 1 to 12 and specifically binding to chronic myeloid leukemia cells. At least one nucleotide sequence selected from the sequences shown in SEQ ID NOs: 1 to 12, having a sequence containing 1 to 3 nucleotide substitutions, deletions or additions, and specific for chronic myeloid leukemia cells DNA aptamer characterized by binding to the target. A DNA aptamer that specifically binds to chronic myeloid leukemia cells,
5′-P ₁ -XP ₂ -3 ′
Having a nucleotide sequence represented by:
X is 1) a nucleotide sequence selected from the sequences represented by SEQ ID NOs: 1 to 12, or 2) substitution of 1 to 3 nucleotides in the nucleotide sequence selected from the sequences represented by SEQ ID NOs: 1 to 12 A sequence containing a loss or addition,
P ₁ and P ₂ are DNA aptamers that are first and second primer recognition sequences introduced for PCR amplification. P ₁ is a first primer recognition sequence shown in SEQ ID NO: 13, and P ₂ is a second primer recognition sequence shown in SEQ ID NO: 14, DNA aptamer according to claim 3. The DNA aptamer according to any one of claims 1 to 4, wherein the chronic myeloid cell is a K562 cell. 5. The method according to claim 1, comprising at least one chemical modification selected from the group consisting of chemical substitution at the sugar chain moiety, chemical substitution at the phosphate ester moiety and chemical substitution at the nucleobase moiety. Or a DNA aptamer according to claim 1. The DNA aptamer according to any one of claims 1 to 5, which has a fluorescent label at the 5 'end or 3' end. The fluorescent label is green fluorescent protein (GFP), fluorescent protein, fluorescein isothiocyanate (FITC), 6-carboxyfluorocein-aminohexyl, fluorescein derivative, Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 488, Alexa Fluor. 647, Alexa Fluor 750, rhodamine, 6-carboxytetramethylrhodamine, TAMRA (registered trademark), phycoerythrin (PE), phycocyanin (PC), PC5, PC7, Cy dye, Cy3, Cy3.5, Cy5, Cy5. 5, Cy7, Texas Red, allophycocyanin (APC), aminomethylcoumarin acetate (AMCA), Marina Blue, Casc de Blue, Cascade Yellow, Pacific Blue, SPRD, Tetramethylrhodamine isothiocyanate (TRITC), R110, mC1B, CellTracker dye, CFSE, JC-1, PKH, DCFH-DA, DHR, FDA, Calcein AM, Nitrobenzodia Azole (NBD) group, dimethylaminosulfonylbenzooxadiazole group, acidine (Acd), dansyl (Dns), 7-dimethylaminocoumarin-4-acetic acid (DMACA), 5-((2-aminoethyl) amino ) Emission wavelength including one or more selected from naphthalene-1-sulfonic acid (EDANS), naphthalene, anthracene and protoporphyrin 9 to 421 nm to 7 An organic fluorescent molecules 2 nm, DNA aptamer according to claim 7. The DNA aptamer according to claim 7, wherein the fluorescent label is a quantum dot. A DNA aptamer in which the DNA aptamer according to any one of claims 1 to 9, wherein the 5 'end or the 3' end is fluorescently labeled, is adsorbed on the surface of the metal nanoparticle. The DNA aptamer according to claim 10, wherein the metal used for the metal nanoparticles is gold, silver, copper, iron or silicon. A composition for detecting chronic myeloid leukemia cells, comprising the DNA aptamer according to any one of claims 1 to 11. A kit for detecting chronic myeloid leukemia cells, comprising the DNA aptamer according to any one of claims 1 to 11. A method for detecting chronic myeloid leukemia, comprising using the DNA aptamer according to any one of claims 1 to 11. By contacting the DNA aptamer with a sample collected from a living body selected from the group consisting of blood, serum, plasma, saliva, and sputum, and by observing a response due to the binding between the sample and the DNA aptamer, chronic bone marrow The detection method of Claim 14 including the process of detecting presence of a sex leukemia cell. The detection method according to claim 15, wherein the response is a fluorescence response. The detection method according to claim 16, wherein the response is a Raman scattering response. A therapeutic composition for chronic myeloid leukemia, comprising the DNA aptamer according to any one of claims 1 to 11. Use of the DNA aptamer according to any one of claims 1 to 11 for the manufacture of a pharmaceutical composition for the treatment of chronic myeloid leukemia. A drug delivery system for treating chronic myeloid leukemia, comprising the DNA aptamer according to any one of claims 1 to 11.