WO2015117206A1 - Improved aptamers - Google Patents

Abstract

The present disclosure relates to aptamers and uses thereof. In particular, the present disclosure relates to the generation of short aptamers which are functional and stable.

Description

Improved Aptamers

Related Applications and Incorporation by Reference

All documents cited or referenced herein, and all documents cited or referenced in herein cited documents, together with any manufacturer's instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference in their entirety.

The present application claims priority from Australian provisional application no. 2014900356 entitled 'Improved Aptamers' filed 6 February 2014, the entire contents of which are herein incorporated by reference.

Field of the Invention

The present disclosure relates to aptamers and uses thereof. In particular, the present disclosure relates to the generation of short aptamers which are functional and stable.

Background of the Invention

Immunotherapy has had a great impact on the treatment of diseases such as cancer in recent years. However, the use of antibodies, even humanised antibodies, can lead to adverse side effects that can be fatal (Hansel et al. 2010. Nat Rev Drug Discov 9:325-38). This has led to the search for 'bigger and better' options. There have been several attempts made to use nucleic acids as therapeutics though these have met with disappointing results, not least because of the failure of these nucleic acids to enter the cell (Shigdar et al. 201 1 . Br J Haematol 155:3-13).

Chemical antibodies, termed aptamers, have been increasingly utilised for clinical applications in the last twenty years. Aptamers are single-stranded oligonucleotides, including both RNAs and DNAs (and combinations thereof) that express high binding selectivity and affinity for a wide variety of biological, organic or inorganic molecules. Often referred to as "chemical antibodies", aptamers typically exhibit comparable affinity and greater selectivity for specific "target ligands" than can be achieved by monoclonal protein antibodies.

The high affinity and selectivity of aptamers for their "targets" derives from their ability to fold into distinct conformations. Aptamers for a given "target" are typically selected using an in vitro selection process termed SELEX (systematic evolution of ligands by exponential enrichment).

For an aptamer to be an effective drug delivery agent, the aptamer must bind to its target on the cell surface and be internalised within a short period of time. Since longer oligonucleotides are known to be able to elicit a form of innate anti-viral immune response it is also desirable to be able to shorten yet contain the structure and binding specificity of aptamers. Furthermore, research in the field of therapeutic oligonucleotides has shown that generally the shorter the oligonucleotide the better the bio-distribution and pharmaco-kinetics the oligonucleotide has.

Accordingly, there is a need in the art for improved aptamers having affinity and selectively for a given target which is comparable to, or superior to antibodies for therapeutic applications. Summary of the Invention

By applying several nucleotide modifications to a starting aptamer sequence, the present inventors have been able to generate derivative aptamers that are significantly shorter, more biostable and more target specific than the original aptamer. These improved aptamers thus overcome the above mentioned drawbacks.

Accordingly, the present disclosure provides an aptamer of between 10 to 20 nucleotides in length, the aptamer comprising:

(i) a loop region sequence comprising between 3 and 14 unpaired nucleotides and wherein at least one unpaired nucleotide is substituted with an unlocked nucleic acid (UNA) nucleotide;

(ii) a stem region sequence comprising at least two nucleotide pairs and wherein at least one pair of nucleotides is substituted with locked nucleic acid (LNA) nucleotides;

(iii) a terminal 5' nucleotide substituted with a LNA; and

(iv) a terminal 3' nucleotide substituted with a 2'O-methyl RNA and/or a 3' inverted dT. The aptamer according to the present disclosure may be capable of specifically or selectively binding to its target. In one example, the target is selected from the group consisting of CD133, EpCAM, cAMP, HIV, ampicillin, B1 -adrenoreceptor autoantibodies antigen, and aflatoxin,

In one example, the terminal 5' nucleotide and/or the terminal 3' nucleotide is unpaired.

The stem region of the aptamer may comprise at least two nucleotide pairs, at least three nucleotide pairs, at least four nucleotide pairs, at least five nucleotide pairs, at least six nucleotide pairs, at least seven nucleotide pairs, or at least eight nucleotide pairs. The aptamer may also comprise between two and eight nucleotide pairs, between four and seven nucleotide pairs or between four and six nucleotide pairs.

The term "nucleotide pairs" as used herein is understood to mean a complementary pairing of nucleotides, for example C-G would be considered one nucleotide pair wherein the C nucleotide is located on one strand and is base paired with its complementary nucleotide G on the same strand thus forming a stem structure of the aptamer. The term "paired" may be used interchangeably with "complementary to".

The aptamer of the present disclosure may further comprise one or more nucleotide substitutions within the sequence which maintain the stem loop structure of the aptamer. In one example, the sequence comprises at least one, two, three, four, five or six substitutions within the stem region of the aptamer or within the stem region sequence of an aptamer described herein below.

The aptamer of the present disclosure may comprise one or more further modifications that improve aptamer stability in vivo and in vitro. In one example, at least one pyrimidine (C or U) nucleotide is 2'-fluoro (2'-F) modified. For example, at least one cytidine is substituted by 2'-deoxy-2'-fluorocytidine and/or at least one uridine is substituted by 2'-deoxy-2'- fluorouridine. In further examples, at least two, at least three, at least four, at least five C and/or U nucleotides are 2'-F modified. In another example, all uridine and cytidine nucleotides are 2'-F modified. In a further example, at least one cytidine (C) and/or thymine (T) nucleotide is a deoxycytidine (dC) or thymidine (dT). Accordingly, when modified in this way, such nucleotides are understood to be DNA nucleotides. In another example, the 3' end of the aptamer may be modified to protect it from nuclease digestion. For example, the 3' terminal nucleotide may be an inverted dT. In another example, the 3' terminal nucleotide is 2'0-methyl modified. In another example, the 5' end may be coupled to a label (e.g. detectable label) such as biotin, fluorescein isothiocyanate (FITC), cyanine (Cy3 or Cy5). Additional modifications will be familiar to persons skilled in the art and are considered to be encompassed by the present disclosure.

The inventors have found that the introduction of an unlocked nucleic acid (UNA) nucleotide in one or two specific positions within the loop region sequence of the aptamer ensures the disruption of duplex formation while introducing enough flexibility to facilitate bending of the aptamer sequence into the desired stem-loop configuration. Accordingly, the aptamer according to the present disclosure comprises at least one UNA nucleotide in the loop region sequence. In another example, the aptamer comprises a single UNA nucleotide in the loop region sequence. In yet another example the aptamer comprises no more than two UNA nucleotides in the loop region sequence. In a further example, the at least one nucleotide which is substituted with an UNA nucleotide is the second, third or fourth unpaired nucleotide commencing from the 5' end of the aptamer.

Additionally the inventors have found that the combination of UNA nucleotides and LNA nucleotides in the aptamer provides unexpected benefits with respect to aptamer stability. The combination of UNA nucleotides and LNA nucleotides in the aptamer allows for LNA to be introduced closer to the loop region sequence than would typically be allowable because a LNA is a structurally rigid modification. An LNA nucleotide modification introduced into the stem region sequence of the aptamer is thought to assist in increasing binding affinity of the aptamer, and in combination with 2'0-methyl modifications provides increased biological stability to the aptamer and protection against nucleases, including exo and endo nucleases. Thus, the present inventors have determined that the presence of UNA nucleotides within the loop region assists in increasing aptamer stability whilst still permitting flexibility in the ligand binding region of the aptamer and when used in combination with at least one LNA provides for the generation of shorter aptamers having a sufficiently stabilized stem region. Accordingly, the combination of these UNA and LNA nucleotides allows for the generation of shorter aptamers which are still stable and functional. The advantages of such shorter aptamers will be apparent to persons skilled in the art. Such advantages include better intracellular penetration and tumor penetration and increased target specificity. This makes them attractive molecules for therapeutics.

The aptamer according to the present disclosure may be an RNA aptamer, a DNA aptamer, a hybrid RNA/DNA aptamer or a chimeric aptamer. In another example, the aptamer is an isolated aptamer. In another example, the aptamer is synthesized according to art known methods (e.g. SELEX).

The term "chimeric aptamer" as used herein is understood to refer to aptamers comprising at least one LNA-T (locked nucleic acid thymine). In one example, a single LNA-T is present in the aptamer. The LNA-T may be present towards the 5' or 3' end of the aptamer.

The aptamer according to the present disclosure may be capable of specifically or selectively binding to its target.

The aptamer may comprise one or more modifications as described above. As referred to herein, any non-natural nucleotides are referred to as modifications of the aptamer oligonucleotide. The modifications may be non-natural bases e.g. universal bases. The modifications may be modifications to the backbone sugar or phosphate, e.g. 2Ό- modifications including LNA. It makes no difference whether the modifications are present on the nucleotide before incorporation into the aptamer oligonucleotide or whether the aptamer oligonucleotide is modified after synthesis. Preferred modifications are those that increase the biostability of the oligonucleotide aptamer, which include, but are not limited to LNA, UNA, 2'O-Fluoro, 2'-0-methyl, and 2'-0-methoxyethyl.

A wide range of other non-natural units may also be incorporated into the aptamer oligonucleotide e.g. morpholino, 2'-deoxy-2'-fluoro-arabinonucleic acid (FANA) and arabinonucleic acid (ANA) Modifications of the oligonucleotide aptamer contemplated in this disclosure include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the oligonucleotide or nucleotide bases. Modification to generate oligonucleotide populations which are resistant to nucleases can be include one or more substituted internucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include, but are not limited to 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5- iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanidine. Modifications can also include 3' and 5' modifications such as capping.

The present disclosure also provides an aptamer of between 10 to 20 nucleotides in length which specifically or selectively binds to CD133, the aptamer comprising:

(i) a loop region sequence comprising between 3 and 14 unpaired nucleotides and wherein at least one unpaired nucleotide is substituted with an unlocked nucleic acid (UNA) nucleotides;

(ii) a stem region sequence comprising at least two nucleotide pairs and wherein at least one pair of nucleotides is substituted with locked nucleic acid (LNA) nucleotides;

(iii) a terminal 5' nucleotide substituted with a LNA; and

(iv) a terminal 3' nucleotide substituted with a 2'O-methyl RNA and/or a 3' inverted dT.

In one example, the terminal 5' nucleotide and/or the terminal 3' nucleotide is unpaired.

The present disclosure provides an aptamer which specifically or selectively binds to CD133. In one example, the unsubstituted aptamer comprises the consensus sequence 5' - CCUCCUACAUAGG- 3' or 5' -CTCCUACAUAG- 3'.

In another example, the aptamer comprises a consensus sequence

5'- LC fC LC fU fC (fC or unaC) (fU or unaU) (A or unaA) fC A fU A G (G or LG) mG -3' wherein f is a 2'fluoro modification, L is a locked nucleic acid, una is an unlocked nucleic acid and m is 2'O-methyl modification.

In another example, the aptamer comprises a consensus sequence

5'- LC LT fC (fC or unaC) (fU or unaU) (A or unaA) fC A fU LA (mG or LG) -3';

wherein f is a 2'fluoro modification, L is a locked nucleic acid, una is an unlocked nucleic acid and m is 2'O-methyl modification.

In one example, the aptamer of the present disclosure has a dissociation constant (k_D) for CD133 in the range from 67-589 nM, preferably 67-298 nM, more preferably 67-217nM, more preferably 67-167 nM. In a further example, the aptamer has a dissociation constant (k_D) for CD133 of about 155nM or less. In a particular example, the aptamer has a dissociation constant (K_D) for CD133 of 99 + 79 nM.

The present disclosure also provides an aptamer comprising a sequence selected from the group consisting of SEQ ID NO's: 8-9, 12-16 and 18 having one or more substitutions described herein. In another example, the aptamer consists of the sequence selected from the group consisting of SEQ ID NO's: 8-9, 12-1 6 and 1 8 having one or more substitutions described herein.

In another example, the aptamer is aptamer 2.1 , 2.2, 3.1 , 3.2, 5.1 , 5.2, 5.3, or 5.4 described in Table 1 .

The aptamer may comprise at least one LNA-T. Furthermore, the aptamer may comprise one or more modifications described above including locked nucleic acid (L or LNA), unlocked nucleic acid (UNA), 2'0-Fluoro (F), 2'-0-methyl, and 2'-0-methoxyethyl.

The present disclosure also provides an aptamer which specifically or selectively binds to CD133 comprising a sequence selected from the group consisting of:

(i) 5' -LCLTfCunaCfUAfCAfULAmG- 3' (SEQ ID NO: 8);

(ii) 5' -LCLTfCfCfUunaAfCAfULAmG- 3' (SEQ ID NO: 9);

(iii) 5' - LCfCLCfUfCunaCfUAfCAfUAGLGmG- X-3' (SEQ ID NO:12);

(iv) 5' -LCfCLCfUfCfCfUunaAfCAfUAGLGmG- X-3' (SEQ ID NO:13);

(v) 5' -LCfCLCfUfCfCunaUAfCAfUAGLGmG- X-3' (SEQ ID NO:14);

(vi) 5' - LCLTfCunaCfUAfCAfULAmG- X- 3' (SEQ ID NO:15);

(vii) 5'-LCLTfCfCunaUAfCAfULAmG-X- 3' (SEQ ID NO:16); and

(viii) 5' -LCLTfCunaCfUAfCAfULALG- X- 3' (SEQ ID NO:18);

wherein L is a Locked nucleic acid, f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O- methyl RNA, T is LNA- thymine and X is an invdT.

In one example, the aptamer comprises the sequence 5' LCLTfCunaCfUAfCAfULAmG-X- 3' (SEQ ID NO:15) or 5'-LCLTfCfCunaUAfCAfULAmG-X- 3' (SEQ ID NO:16), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA-thymine and X is an invdT.

In one example, the aptamer consists of the sequence 5'

LCLTfCunaCfUAfCAfULAmG- 3' (SEQ ID NO:8), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA-thymine.

In one example, the aptamer consists of the sequence 5' LCLTfCfCfUunaAfCAfULAmG- 3' (SEQ ID NO:9), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA-thymine. In another example, the aptamer consists of the sequence 5' LCfCLCfUfCunaCfUAfCAfUAGLGmG- X-3' (SEQ ID NO:12), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA- thymine and X is an invdT.

In another example, the aptamer consists of the sequence 5'

LCfCLCfUfCfCfUunaAfCAfUAGLGmG- X-3' (SEQ ID NO:13), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA- thymine and X is an invdT.

In another example, the aptamer consists of the sequence 5' LCfCLCfUfCfCunaUAfCAfUAGLGmG- X-3' (SEQ ID NO:14), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA- thymine and X is an invdT.

In another example, the aptamer consists of the sequence 5' LCLTfCunaCfUAfCAfULAmG- X- 3' (SEQ ID NO:15), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA-thymine and X is an invdT.

In another example, the aptamer consists of the sequence 5'- LCLTfCfCunaUAfCAfULAmG-X- 3' (SEQ ID NO:1 6), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA-thymine and X is an invdT.

In another example, the aptamer consists of the sequence 5' LCLTfCunaCfUAfCAfULALG- X- 3' (SEQ ID NO:1 8), wherein wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA- thymine and X is an invdT.

The aptamers according to the present disclosure may further comprise a 5' label e.g.

Cy3.

In yet another example, the aptamer comprises a two dimensional structure according to an aptamer described in the Figures. In another example, the aptamer is an RNA aptamer or chimeric aptamer.

An aptamer as described herein may be linked to another aptamer as described herein or to another aptamer not described herein but which aptamer also binds to a marker present on cancer stem cells. One or more aptamers may be ligated via a linker. The linker may be a polymer, for example, PEG.

The present disclosure also provides an aptamer according to the present disclosure which specifically or selectively binds to CD133+ cell(s). The CD133+ cell(s) are preferably stem cells, more particularly cancer stem cells. The cancer stem cells may be characterised as (i) expressing CD133, (ii) is tumorigenic, (iii) is capable of self renewal (iv) is capable of differentiating and (v) resistant to apoptosis by conventional therapy.

The cancer stem cells may be alternatively described as isolated, enriched or purified from a source, such as a biological sample. In another example, the cancer stem cell(s) represent a population of cells enriched on the basis of CD133⁺ expression. In another example, the population of cells comprises at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or

95% cancer stem cells.

In one example, the CD133 expressing cells and/or cancer stem cells are present in vivo. In another example, the CD133 expressing cells and/or cancer stem cells are present in vitro. In a further example, the CD133 expressing cells and/or cancer stem cells are present in a biological sample obtained from a subject. The binding of the aptamer may be detected in any convenient manner, for example, by detecting a label associated with the aptamer, by imaging the aptamer or by determining the amount of bound aptamer. Suitable methods are described for example in WO 2004/081574.

In another example, the CD133 expressing cells and/or cancer stem cells of the present disclosure may express one or more markers individually or collectively including

CD44, ABCG2, β-catenin, CD1 1 7, ALDH, VLA-2, CD166, CD201 , IGFR, EpCAM, and

EGF1 R.

By "individually" is meant that the disclosure encompasses the recited markers or groups of markers separately, and that, notwithstanding that individual markers or groups of markers may not be separately listed herein the accompanying claims may define such marker or groups of markers separately and divisibly from each other.

By "collectively" is meant that the disclosure encompasses any number or combination of the recited markers or groups of peptides, and that, notwithstanding that such numbers or combinations of markers or groups of markers may not be specifically listed herein the accompanying claims may define such combinations or sub- combinations separately and divisibly from any other combination of markers or groups of markers.

In another example, the cancer stem cell according to the present disclosure is a brain cancer stem cell, a brain cancer metastasis, a breast cancer stem cell, a prostate cancer stem cell, a pancreatic cancer stem cell, a colon cancer stem cell, a liver cancer stem cell, a lung cancer stem cell, an ovarian cancer stem cell, a skin cancer stem cell or a melanoma stem cell.

The present disclosure also provides a diagnostic agent or a detection agent comprising an aptamer as described herein. When used as a diagnostic agent, it is preferable that the aptamer is coupled to a detectable label. In one example, the diagnostic agent is used to detect for CD133 expressing cancer stem cells in vivo or in vitro. The present disclosure also provides a method for identifying or detecting a CD133 expressing cell(s) and/or cancer stem cell(s) in a subject or a biological sample obtained from a subject, having, or suspected of having cancer, the method comprising contacting the cell(s) with a diagnostic agent, a detection agent or aptamer as described herein.

The aptamer of the present disclosure can be used to detect the presence of CD133 expressing cells and/or cancer stem cells in a subject or in a biological sample obtained from a subject having cancer or suspected of having cancer. Detection can be facilitated by coupling the aptamer to a detectable label. Examples of detectable labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, electron dense labels, labels for MRI and radioactive materials.

The present disclosure provides an aptamer as described herein or the diagnostic agent as described herein for use in detecting CD133 expressing cells and/or cancer stem cells in a subject or in a biological sample obtained from a subject. In a particular example, the subject is one having cancer or suspected of having cancer.

The present disclosure provides an aptamer as described herein or the diagnostic agent as described herein for use in diagnosing cancer in a subject. The diagnosis may be performed in vivo or in vitro.

The present disclosure also provides an aptamer as described herein or the diagnostic agent as described herein for use in histological examination of biological samples. Methods for preparing histological preparations will be familiar to persons skilled in the art.

The aptamer of the present disclosure may be further coupled to a moiety which may be an active moiety. The moiety may be a ligand, such as a further aptamer or an alternative ligand. The moiety may be an immunoglobulin, or fragment or portion of an immunoglobulin, a therapeutic agent, another drug or bioactive agent, toxin, or radionuclide. Alternatively, the moiety may include siRNA, DNAzymes or ribozymes. Combinations of any of the foregoing moieties are also included in the present disclosure.

The present disclosure also provides a method for treating cancer in a subject in need thereof, comprising providing a subject with the aptamer as described herein. The subject being treated is typically one which would benefit from treatment with the aptamer of the present disclosure. In one example, the subject is diagnosed as having cancer. Alternatively, the subject is one which is suspected of having cancer. The aptamer of the present disclosure which is coupled to a moiety as described herein, may be administered to the subject over a period of weeks, months or years to treat the subject.

The subject according to the present disclosure may be one which has, or is suspected of having a cancer selected from brain cancer, breast cancer, prostate cancer, pancreatic cancer, colon cancer, liver cancer, lung cancer, ovarian cancer, skin cancer, melanoma or any other cancer in which CD133+ cells are present. In one example, the cancer is any cancer in which CD133 expressing cells and/or cancer stem cells are present or suspected of being present.

The present disclosure also provides the use of an aptamer as described herein in the manufacture of a diagnostic reagent for the detection or diagnosis of cancer.

The present disclosure also provides use of an aptamer according to the present disclosure in the manufacture of a medicament for treating cancer in a subject.

The present disclosure also provides a composition comprising a therapeutically effective amount of an aptamer as described herein, together with a pharmaceutically acceptable carrier and/or excipient. In one example, the composition is a pharmaceutical composition.

The aptamer, diagnostic agent, or pharmaceutical composition as described herein may be used alone or in combination with other treatment modalities. For example, the aptamer, diagnostic agent, or pharmaceutical composition may be used in combination with chemotherapy and/or radiotherapy. While not wishing to be bound by theory, it is postulated that the chemotherapy or radiotherapeutic agents can be used to shrink tumours by primarily targeting rapidly dividing cells which are typically the progeny cells of the cancer stem cells. The diagnostic agent can be used to determine the effectiveness of any prior treatment modality to eliminate cancer stem cells by detecting the presence or absence of cancer stem cells in the tumour. The anticancer agent, delivery agent or pharmaceutical composition containing the aptamer of the present disclosure can then be administered to the site of the tumour/cancer to specifically deplete cancer stem cells. Accordingly, the aptamer or pharmaceutical composition containing the aptamer can be used together with chemotherapy or radiotherapy or subsequent to chemotherapy or radiotherapy treatment. It is also contemplated that the aptamer of the present disclosure can be combined with one or more additional aptamers which target an antigen present on a cancer stem cell.

Each example of the disclosure shall be taken to apply mutatis mutandis to a method for treating, or ameliorating a disorder or disease (e.g. cancer) in a subject.

In a further example, the aptamer comprises, or consists of a sequence selected from the group consisting of:

(i) 5' -LTLGrGfUfUrAunaCfCLCmG- 3' (SEQ ID NO:29);

(ii) 5' -LGrALCrUunaArArArAunaCrGrArCrUrULGUmC- 3' (SEQ ID NO:30);

(iii) 5' -LTLALGdCdCUunaAdTLCdTmC- 3' (SEQ ID NO:31 );

(iv) 5' -LTdTLGUunaGdGdGUunaTdTLCLAmG- 3' (SEQ ID NO:32);

(v) 5' -LALALCCG unaCG u naTG AG LGLTmC- 3' (SEQ ID NO:33); or

(vi) 5' -LALCLTGCTunaAGLALGmA- 3' (SEQ ID NO:34); wherein, wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl, T is a LNA- thymine, d is deoxy (DNA nucleotide), r is ribo (RNA nucleotide) and X is an invdT.

The disclosure also provides an aptamer comprising or consisting of the sequence 5' - LTLGrGfUfUrAunaCfCLCmG- 3' (SEQ ID NO:29), which specifically or selectively binds to EpCAM.

The disclosure also provides an aptamer comprising or consisting of the sequence 5' - LGrALCrUunaArArArAunaCrGrArCrUrULGUmC- 3' (SEQ ID NO:30) which specifically or selectively binds to cAMP.

The disclosure also provides an aptamer comprising or consisting of the sequence 5' -

LTLALGdCdCUunaAdTLCdTmC- 3' (SEQ ID NO:31 ) which specifically or selectively binds to HIV.

The disclosure also provides an aptamer comprising or consisting of the sequence 5' - LTdTLGUunaGdGdGUunaTdTLCLAmG- 3' (SEQ ID NO:32) which specifically or selectively binds to Ampicillin.

The disclosure also provides an aptamer comprising or consisting of the sequence 5' - LALALCCGunaCGunaTGAGLGLTmC- 3' (SEQ ID NO:33) or a modified form thereof which specifically or selectively binds to the B1 Adrenoreceptor autoantibodies antigen.

The disclosure also provides an aptamer comprising or consisting of the sequence 5' - LALCLTGCTunaAGLALGmA- 3' (SEQ ID NO:34) or a modified form thereof which specifically or selectively binds to aflatoxin.

The present disclosure also provides an aptamer according to any one of SEQ ID NOs: 29 to 34 for use in treating a disease or disorder in a subject in need thereof.

The present disclosure also provides a method of treating a disease or disorder comprising administering to a subject in need thereof an aptamer according to any one of SEQ ID NOs: 29 to 34 above.

The present disclosure also provides use of an apatmer according to any one of SEQ ID NOs: 29 to 34 for treating a disease or disorder in a subject in need thereof.

The present disclosure also provides a method for improving the biological stability of an aptamer between 10 to 20 nucleotides in length and having a loop region sequence of between 3 and 14 nucleotides, the method comprising:

(i) introducing at least one unlocked nucleic acid (UNA) nucleotide by substitution into an unpaired nucleotide in a loop region sequence;

(ii) introducing locked nucleic acid (LNA) nucleotides into at least one pair of nucleotides in the stem region sequence;

(iii) substituting the terminal 5' nucleotide with a LNA; and (iv) substituting the terminal 3' nucleotide with a 2'0-methyl RNA and/or a 3' inverted dT.

The present disclosure also provides an aptamer obtained by the method according to the present disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Two dimensional structures of nineteen (19) CD133 synthesised aptamers. The modifications are denoted with prefixes and coding: grey= 2'-fluoro modified base; asterisk^ Locked nucleic acid (LNA); underline^ unlocked nucleic acid (una); m= 2'-0-methyl-RNA; s= phosphorothioate backbone; inv-dT= inverted dT.

(A) Aptamer 1 , SEQ ID NO:1 ; (B) Aptamer 4, SEQ ID NO:2; (C) Aptamer 3, SEQ ID NO:3; (D) Aptamer 2, SEQ ID NO:4; (E) Aptamer 5, SEQ ID NO:5; (F) Aptamer 1 .1 , SEQ ID NO:6; (G) Aptamer 1 .2, SEQ ID NO:7; (H) Aptamer 5.1 , SEQ ID NO:8; (I) Aptamer 3.1 , SEQ ID NO:9; (J) Aptamer 6, SEQ ID NO:10; (K) Aptamer 7, SEQ ID NO:1 1 ; (L) Aptamer 5.2, SEQ ID NO:12; (M) Aptamer 3.2, SEQ ID NO:13; (N) Aptamer 2.1 , SEQ ID NO:14; (O) Aptamer 5.3, SEQ ID NO:15; (P) Aptamer 2.2, SEQ ID NO:16; (Q) Aptamer 7.1 , SEQ ID NO:17; (R) Aptamer 5.4, SEQ ID NO:39; and (S) Aptamer 5.5, SEQ ID NO:1 9.

Figure 2. Determination of dissociation constant (K_D) of aptamers with CD133-positive (K562) and -negative (MOLT4) cells. Dark: K562; Light: MOLT4. Binding curves were obtained using aptamer concentrations of 20 nM to 400 nM . (A) Aptamer 1 (SEQ ID NO:1 ); (B) Aptamer 1 .1 (SEQ ID NO:6); (C) Aptamer 1 .2 (SEQ ID NO:7); (D) Aptamer 2 (SEQ ID NO:4); (E) Aptamer 3 (SEQ ID NO:3); (F) Aptamer 3.1 (SEQ ID NO:9); (G) Aptamer 4 (SEQ ID NO:2); (H) Aptamer 5 (SEQ ID NO:5); (I) Aptamer 5.1 (SEQ ID NO:8); and (J) Aptamer 7 (SEQ ID NO:1 1 ). Data presented as mean ± SEM (n=3).

Figure 3. The internalisation of engineered CD133 aptamers. Each CD133 aptamer was incubated with CD133-positive and -negative cell lines for 30 min at 37°C, followed by imaging using confocal microscopy. Top panels with dark background: fluorescence micrographs; bottom panels: phase contrast images. Blue: nuclei; red: Cy-3 labelled aptamer. Scale bar: 10μΜ. (A) Aptamer 1 ; (B) Aptamer 1 .1 ; (C) Aptamer 1 .2; (D) Aptamer 2; (E) Aptamer 3; (F) Aptamer 3.1 ; (G) Aptamer 4; (H) Aptamer 5; (I) Aptamer 5.1 ; (J) Aptamer 6; and (K) Aptamer 7. Data are representative of two independent experiments. Figure 4. Assessment of aptamer internalisation rate. Each aptamer was incubated with the K562 CD133 -positive cells for either 5, 10, 20 or 30 minutes followed by fluorescence confocal microscopy for assessment of the rate of aptamer internalisation. (A) Representative micrographs of internalisation of selected aptamers top panels with dark background: fluorescence micrographs; bottom panels: phase contrast micrographs. Blue: nuclei; red: Cy-3 labelled aptamer. Scale bare: 10μΜ. (B) Quantification of aptamer internalisation over time. Data shown presented as mean ± SEM (n=3).

Figure s. Stability of aptamers in 100% human serum shown in minutes. (A) shows the stability of Aptamer 7.2 in 100% human serum over time in minutes run on a 10% denaturing gel. Y-axis = relative fluorescence unit and X-axis = time in hours. (B) shows the stability of aptamer 7.2 represented graphically (C) shows the stability of Aptamer 1 .2 in 100% human serum shown in minutes run on a denaturing gel. Arrow indicates full length Aptamer. Sample labelled control is the pure aptamer in the absence of serum.

Figure 6. Stability of aptamers in 1 00% human serum shown in minutes or hours. (A) shows the stability of Aptamer 5.1 in 100% human serum over 150 minutes. Sample labelled control is the pure aptamer in the absence of serum. (B) shows the stability of Aptamer 1 .2 (left) and Aptamer 5.1 (right) over 48 hours in 100% human serum run on a 10% denaturing gel (C) shows the stability of Aptamer 1 .2 in 100% human serum over 48 hours and (D) shows the stability of aptamer 5,1 in 1 00% human serum over 48 hours. Y-axis = relative fluorescence unit and X-axis = time in hours.

Figure 7. Stability of aptamers in 100% human serum shown in hours. Stability of Aptamer 5.3 and 7.1 in 100% human serum over 48 hours. (A) shows the aptamer 5.3 (left) and aptamer 7.1 (right). Y-axis = relative fluorescence unit and X-axis = time in hours.

Figure 8 Thermal stability of aptamer 5.1 in various medium and salt concentrations. Aptamer 5.1 in 1 x PBS and 2.5 nM MgCI₂ (A), aptamer 5.1 in 1 0 x PBS and 10mM MgCI₂ (B) and aptamer 5.1 and complementary RNA in 1 0 x PBS and 1 0mM MgCI₂ (C) measured by spectrophotometry.

Figure 9. Thermal stability measured by circular dichroism (CD) of aptamer 5.1 at 15^SC

(B) aptamer 5.1 and complementary RNA duplex at 15^SC, and aptamer 5.1 and complementary RNA duplex at 65^SC (C). Figure 10. fluorescence quencher assay for aptamer 7.2 (A), aptamer 5.1 (B), aptamer 7

(C) and negative control EpCAM aptamer (D). Figure 11 Predicted secondary structure of CD133 aptamers from thermodynamic calculations of: aptamer 5.3 and 2.2 (SEQ ID NO:15 and 16) (A) and (B); aptamer 1 .1 (SEQ ID NO: 6) (C) and (D); and aptamer 7 SEQ ID NO 1 1 : (E) (F) (G) and (H).

Figure 12. Secondary structure of aptamers based on thermodynamic calculations: (A) modified EpCAM Aptamer (SEQ ID NO:29); (B) modified cAMP specific Aptamer (SEQ ID NO:30); (C) modified HIV Aptamer (SEQ ID NO:31 ); (D) modified Ampicillin Aptamer (SEQ ID NO:32); (E) modified Adrenoreceptor Autoantibody Aptamer (SEQ ID NO:33); (F) modified Aflatoxin Aptamer (SEQ ID NO:34). grey= 2'-fluoro modified base; asterisk^ Locked nucleic acid (LNA); underline^ unlocked nucleic acid (una); m= 2'-0-methyl-RNA; s= phosphorothioate backbone; dT= deoxythmidine, dC=deoxycytidine.

Key to Sequence Listing

SEQ ID NO :1 : : sequence for the CD133 Aptamer 1

SEQ ID NO :2: : sequence for the CD133 Aptamer 4

SEQ ID NO :3: : sequence for the CD133 Aptamer 3

SEQ ID NO :4: : sequence for the CD133 Aptamer 2

SEQ ID NO :5: : sequence for the CD133 Aptamer 5

SEQ ID NO :6: : sequence for the CD133 Aptamer 1 .1

SEQ ID NO :7: : sequence for the CD133 Aptamer 1 .2

SEQ ID NO :8: : sequence for the CD133 Aptamer 5.1

SEQ ID NO :9: : sequence for the CD133 Aptamer 3.1

SEQ ID NO :1 0 : sequence for the CD133 Aptamer 6

SEQ ID NO :1 1 : sequence for the CD133 Aptamer 7

SEQ ID NO :12 : sequence for the CD133 Aptamer 5.2

SEQ ID NO :13 : sequence for the CD133 Aptamer 3.2

SEQ ID NO :14 : sequence for the CD133 Aptamer 2.1

SEQ ID NO :1 5 : sequence for the CD133 Aptamer 5.3

SEQ ID NO :1 6 : sequence for the CD133 Aptamer 2.2

SEQ ID NO :1 7 : sequence for the CD133 Aptamer 7.1

SEQ ID NO :1 8 : sequence for the CD133 Aptamer 5.4

SEQ ID NO :1 9 : sequence for the CD133 Aptamer 5.5

SEQ ID NO ^■20 : sequence for the Aptamer 7.2

SEQ ID NO :21 : sequence for the Aptamer 4.1

SEQ ID NO :22 : sequence for the Aptamer 5.6 SEQ ID NO :23: sequence for the Aptamer 7.3

SEQ ID NO 24: sequence for the Aptamer 1 .3

SEQ ID NO 25: sequence for the Aptamer 5.7

SEQ ID NO 26: sequence of CD133 aptamer 5.8

SEQ ID NO 27: CD133 aptamer consensus sequence

SEQ ID NO 28 CD133 apatmer consensus sequence

SEQ ID NO 29: sequence of EpCAM aptamer

SEQ ID NO :30: sequence of cAMP aptamer

SEQ ID NO :31 : sequence of HIV aptamer

SEQ ID NO 32: sequence of the ampicillin aptamber

SEQ ID NO :33: sequence of adrenoreceptor autoantibody aptamer

SEQ ID NO :34: sequence of aflatoxin aptamer

DETAILED DESCRIPTION OF THE INVENTION

General Techniques and Selected Definitions

The term "and/or", e.g., "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.

Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

Each example described herein is to be applied mutatis mutandis to each and every other example of the disclosure unless specifically stated otherwise.

Those skilled in the art will appreciate that the disclosure is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the disclosure.

The present disclosure is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, recombinant DNA technology, cell biology and immunology. Such procedures are described, for example, in Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Second Edition (1989), whole of Vols I, II, and III; DNA Cloning: A Practical Approach, Vols. I and II (D. N. Glover, ed., 1985), IRL Press, Oxford, whole of text; Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed, 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, ppl-22; Atkinson et al, pp35-81 ; Sproat et al, pp 83-1 15; and Wu et al, pp 135-151 ; 4. Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J. Higgins, eds., 1 985) IRL Press, Oxford, whole of text; Immobilized Cells and Enzymes: A Practical Approach (1986) IRL Press, Oxford, whole of text; Perbal, B., A Practical Guide to Molecular Cloning (1984); Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.), whole of series, Sakakibara, D., Teichman, J., Lien, E. Land Fenichel, R.L. (1976). Biochem. Biophys. Res. Commun. 73 336- 342; Merrifield, R.B. (1963). J. Am. Chem. Soc. 85, 2149-21 54; Barany, G. and Merrifield, R.B. (1979) in The Peptides (Gross, E. and Meienhofer, J. eds.), vol. 2, pp. 1 -284, Academic Press, New York. 12. WQnsch, E., ed. (1974) Synthese von Peptiden in Houben-Weyls Metoden der Organischen Chemie (MQIer, E., ed.), vol. 15, 4th edn., Parts 1 and 2, Thieme, Stuttgart; Bodanszky, M. (1984) Principles of Peptide Synthesis, Springer-Verlag, Heidelberg; Bodanszky, M. & Bodanszky, A. (1984) The Practice of Peptide Synthesis, Springer-Verlag, Heidelberg; Bodanszky, M. (1985) Int. J. Peptide Protein Res. 25, 449-474; Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific Publications); and Animal Cell Culture: Practical Approach, Third Edition (John R. W. Masters, ed., 2000), ISBN 0199637970, whole of text.

Throughout this specification, unless the context requires otherwise, the word

"comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

The term "consists of" or "consisting of" shall be understood to mean that a method, process or composition of matter has the recited steps and/or components and no additional steps or components. The term "about", as used herein when referring to a measurable value such as an amount of weight, time, dose, etc. is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1 %, and still more preferably ±0.1 % from the specified amount.

The term "aptamer" or "oligonucleotide aptamer" as used herein is generic to polydeoxyribonucleotides (containing 2'-deoxy-D-ribose or modified forms thereof), i.e. DNA, to polyribonucleotides (containing D ribose or modified forms thereof), i.e. RNA, and to any other type of polynucleotide which is an N-glycoside or C-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base or abasic nucleotides. According to the present disclosure the term "oligonucleotide" includes not only those with conventional bases, sugar residues and internucleotide linkages, but also those that contain modifications of any or all of these three moieties. The aptamer according to the present disclosure is isolated or purified.

As used herein the term "binding affinity" is intended to refer to the tendency of an aptamer to bind or not bind a target and describes the measure of the strength of the binding or affinity of the aptamer to bind the target. The energetics of said interactions are significant in "binding affinity" because they define the necessary concentrations of interacting partners, the rates at which these partners are capable of associating, and the relative concentrations of bound and free molecules in a solution. The energetics are characterized herein through, among other ways, by the determination of a dissociation constant, Kd. As is known in the art, a low dissociation constant indicates stronger binding and affinity of the molecules to each other.

As used herein, the term "biological sample" refers to a cell or population of cells or a quantity of tissue or fluid from a subject. Most often, the sample has been removed from a subject, but the term "biological sample" can also refer to cells or tissue analyzed in vivo, i.e. without removal from the subject. Often, a "biological sample" will contain cells from the subject. In the present disclosure the "biological sample" will include CD133 expressing cells. Biological samples include, but are not limited to, tissue biopsies, needle biopsies, scrapes (e.g. buccal scrapes), whole blood, plasma, serum, lymph, bone marrow, urine, saliva, sputum, cell culture, pleural fluid, pericardial fluid, ascitic fluid or cerebrospinal fluid. Biological samples also include tissue biopsies and cell cultures. A biological sample or tissue sample can refer to a sample of tissue or fluid isolated from an individual, including but not limited to, for example, blood, plasma, serum, tumor biopsy, urine, stool, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, the external sections of the skin, respiratory, intestinal, and genitourinary tracts, tears, saliva, milk, cells (including but not limited to blood cells), tumors, organs, and also samples of in vitro cell culture constituent. In some embodiments, the sample is from a resection, bronchoscopic biopsy, or core needle biopsy of a primary or metastatic tumor, or a cellblock from pleural fluid. In addition, fine needle aspirate samples can be used. Samples may be paraffin-embedded or frozen tissue. The sample can be obtained by removing a sample of cells from a subject.

The term "coupled to" as used herein is intended to encompass any construction whereby the aptamer is linked, attached or joined to a 3' or 5' terminal agent as described herein (e.g. invdT) or to a moiety as described herein.

The term "isolated" as used herein is intended to refer to the aptamer purified from other components or chemicals which may be present during the process of generating and purifying the aptamer (e.g. using the SELEX method). In the context of cells, the term also refers to cells isolatable or purified from other components in the environment in which it may naturally occur. The isolated cell may be purified to any degree relative to its naturally- obtainable state.

The term "ligand" as used herein refers to a molecule or other chemical entity having a capacity for binding to a target. A ligand can comprise a peptide, an oligomer, a nucleic acid (e.g. an aptamer), a small molecule (e.g. a chemical compound), an antibody or fragment thereof, nucleic acid-protein fusion and/or any other affinity agent. Thus, a ligand can come from any source, including libraries, particularly combinatorial libraries, such as the aptamer libraries disclosed herein below, phage display libraries, or any other library as would be apparent to one of ordinary skill in the art after review of the disclosure herein.

As used herein, the term "therapeutically effective amount" shall be taken to mean a sufficient quantity of aptamer, anticancer agent, delivery agent or pharmaceutical composition according to the present disclosure to reduce or inhibit one or more symptoms of a specified disease or disorder (e.g. cancer). The skilled artisan will be aware that such an amount will vary depending upon, for example, the particular subject and/or the type or severity or level of disease. The term is not be construed to limit the present disclosure to a specific quantity of aptamer.

As used herein, the term "treat" or "treatment" or "treating" shall be understood to mean administering a therapeutically effective amount of apatmer or pharmaceutical composition as disclosed herein and reducing or inhibiting at least one symptom of a clinical condition associated with or caused by a disease or disorder (e.g. cancer).

As used herein, the term "specifically binds" shall be taken to mean that the aptamer reacts or associates more frequently, more rapidly, with greater duration and/or with greater affinity with a particular cell or substance than it does with alternative cells or substances. For example, an aptamer that specifically binds to a target protein binds that protein or an epitope or immunogenic fragment thereof with greater affinity, avidity, more readily, and/or with greater duration than it binds to unrelated protein and/or epitopes or immunogenic fragments thereof. It is also understood by reading this definition that, for example, a aptamer that specifically binds to a first target may or may not specifically bind to a second target. As such, "specific binding" does not necessarily require exclusive binding or non-detectable binding of another target, this is encompassed by the term "selective binding". Generally, but not necessarily, reference to binding means specific binding. The specificity of binding is defined in terms of the comparative dissociation constants (Kd) of the aptamer for target as compared to the dissociation constant with respect to the aptamer and other materials in the environment or unrelated molecules in general. Typically, the Kd for the aptamer with respect to the target will be 2-fold, 5-fold, or 10-fold less than the Kd with respect to the target and the unrelated material or accompanying material in the environment. Even more preferably, the Kd will be 50- fold, 100-fold or 200-fold less.

The term "selective binding" shall be taken to mean exclusive binding or non-detectable binding of the aptamer to a marker or antigen expressed on a cell or target.

The term "CD133⁺" or "CD133 expressing cell" as used herein may be used interchangeably. The term encompasses cell surface expression of the CD133 antigen which can be detected by any suitable means. In one example, reference to a cell being positive for a given marker means it may be either a low (lo or dim) or a high (bright, bri) expresser of that marker depending on the degree to which the marker is present on the cell surface, where the terms relate to intensity of fluorescence.

As used herein, the term "subject" shall be taken to mean any subject, including a human or non-human subject. The non-human subject may include non-human primates, ungulate (bovines, porcines, ovines, caprines, equines, buffalo and bison), canine, feline, lagomorph (rabbits, hares and pikas), rodent (mouse, rat, guinea pig, hamster and gerbil), avian, and fish. In one example, the subject is a human.

Aptamers

Several unique properties of aptamers make them attractive tools for use in a wide array of molecular biology applications, and as potential pharmaceutical agents. First, most aptamers bind to targets with high affinity, demonstrating typical dissociation constants in the pico- to nanomolar range. Binding sites for aptamers include clefts and grooves of target molecules resulting in antagonistic activity very similar to many currently available pharmaceutical agents. Second, aptamers are structurally stable across a wide range of temperature and storage conditions, maintaining the ability to form their unique tertiary structures. Third, aptamers can be chemically synthesised, in contrast to the expensive and work-intensive biological systems needed to produce monoclonal antibodies. Without wishing to be bound by theory, RNA aptamers are generally preferred by many groups due to the theoretically higher affinity of RNA aptamers for their target proteins as well as the greater plasma stability of modified RNA than unmodified RNA.

Aptamers are single stranded oligonucleotides or oligonucleotide analogs that bind to a particular target molecule, such as a protein or a small molecule. Thus, aptamers are the oligonucleotide analogy to antibodies.

Aptamer binding is highly dependent on the secondary structure formed by the aptamer oligonucleotide. Both RNA and single stranded DNA (or analog) aptamers are known. See, for example, Burke et al (1996). J. Mol. Biol. 264:650-666; Ellington and Szostak (1990). Nature 346:818-22; Hirao et al (1998). Mol Divers. 4:75-89; Jaeger et al (1998). EMBO Journal 17:4535; Kensch et al (2000). J. Biol. Chem 275:18271 -8; Schneider et al (1995). Biochemistry 34:9599-9610; and US 5773598; US6028186; US 61 1 0900; US61271 19; and US 6171 795.

Selection of aptamers for a given target

Various methods for preparing aptamers according to the present disclosure will be familiar to persons skilled in the art. Systematic Evolution of Ligands by Exponential Enrichment, "SELEX™" is a method for making a nucleic acid ligand for any desired target, as described, e.g., in U.S. 5,475,096 and 5,270,1 63, and PCT/US91 /04078, each of which is specifically incorporated herein by reference.

SELEX™ technology is based on the fact that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with virtually any chemical compound, whether large or small in size.

The method involves selection from a mixture of candidates and step-wise iterations of structural improvement, using the same general selection theme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX™ method includes steps of contacting the mixture with the target under conditions favourable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound to target molecules, dissociating the nucleic acid-target pairs, amplifying the nucleic acids dissociated from the nucleic acid-target pairs to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired.

Within a nucleic acid mixture containing a large number of possible sequences and structures, there is a wide range of binding affinities for a given target. A nucleic acid mixture comprising, for example a 20 nucleotide randomized segment can have 4²⁰ candidate possibilities. Those which have the higher affinity constants for the target are most likely to bind to the target. After partitioning, dissociation and amplification, a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favour the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested for binding affinity as pure ligands.

Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle. The method may be used to sample as many as about 10¹⁸ different nucleic acid species. The nucleic acids of the test mixture preferably include a randomized sequence portion as well as conserved sequences necessary for efficient amplification. Nucleic acid sequence variants can be produced in a number of ways including synthesis of randomized nucleic acid sequences and size selection from randomly cleaved cellular nucleic acids. The variable sequence portion may contain fully or partially random sequence; it may also contain subportions of conserved sequence incorporated with randomized sequence. Sequence variation in test nucleic acids can be introduced or increased by mutagenesis before or during the selection/amplification iterations.

Enrichment of aptamer candidates during selection may be monitored using restriction fragment length polymorphism (RFLP) and flow cytometry as described in Shigdar S et al (2013) Cancer Letters 330:84-95.

Aptamer modification according to the present disclosure

The concept of modifying a preselected aptamer to an improved aptamer in accordance with the present invention may be defined by the following conceptual method steps:

A preselected functional aptamer composed of DNA, RNA, 2'F-RNA or mixtures thereof is needed. This can be achieved by choosing a known published aptamer or by performing SELEX using libraries of DNA RNA or 2'F-RNA or mixtures hereof, against a target of your interest. Normally the random region of a SELEX library will be larger than 20 nucleotides in order to have enough diversity; 20 nt gives a diversity of 10¹² which is usually said to be the lowest diversity possible to ensure structures that will bind any target. Increasing the length also increases the possible secondary structuring of the aptamer. In normal SELEX libraries PCR flanking regions of 20 nt each are also present - hence lowest number of nucleotides in an aptamer from such a library is 60, but in many (but not all) cases the PCR regions can be partially or fully removed post-SELEX leaving a shorter functional aptamer sequence.)

The chosen preselected aptamer should also initially be relatively short (fx up to 60 nucleotides) and form one or more defined stem-loop structure(s) directly involved in target recognition; Alternatively the sequence of the preselected aptamer can be even longer than 60, but must contain one or more defined stem-loop structures that are involved in target recognition. The chosen stem-loop(s) must not themselves form or be part of a G-quadruplex.

The chosen stem-loop(s) is then shortened to 10 to 20 nucleotides in the modified aptamer.

M-fold can then be used to evaluate if the shortened native (as in unmodified) sequence is able to still form the wanted stem-loop structure i.e. if delta G for this is still negative. A delta G calculation must be done on all possible homodimer formations of the shortened native sequence (native as in unmodified).

Although the thermodynamics of short sequences of pure RNA, DNA, 2'F-RNA or mixtures thereof containing self-complementary elements may not favor stem-loop formation but rather homo-dimer formation, the modification pattern described herein will force the stem- loop formation over the homo-dimer formation.

Many published data on aptamers are difficult to reproduce in other than the lab they were originally developed in. Often, very specific circumstances are needed for correct folding of the frequently long nucleotide sequences the aptamers are composed of. This makes many aptamers unsuited for further clinical development and even for diagnostic applications. Likewise aptamers composed of pure RNA or DNA are highly unstable in serum and are often too long to be suited for systemic administration, where they elicit a viral - like - immune response via the Toll-like receptors. Hence very few nucleotide aptamers have actually reached the market as drugs or diagnostic tools. Two examples are, Macugen and antithrombin aptamer. The Thrombin Binding Aptamer (TBA) is a special example composed of a pure DNA G-quadruplex (15 nt very defined structure) and Macugen, for Wet Age-Related Macular Degeneration.

Locked nucleic acids have previously been shown to add stability to stem structures of aptamers but have been shown to be unfit for use in loop-regions and even in basepairs next to a loop region. Most likely this is due to enforced rigidity of the LNA modified oligonucleotide making it unable to uphold the stem-loop structure, and promoting homo-dimers by strong LNA- LNA and LNA -DNA/RNA interactions.

Here the present inventors show that adding just one UNA in the loop in combination with LNA in the stem, reinstates the stemloop structure in even very short, by nature self- complementary, sequences. The UNA not only adds more flexibility for the loop to bend because of its open structure, but also weakens duplex formation (homo-dimers) by weakened basepairing by and around the UNA nucleotide.

Even more surprising, as exemplified by the short modified CD133 aptamer, the inventors were able to place LNA-pairs next to a loop and to have a highly stable stem of only two basepairs and a loop of 7 unpaired nucleotides, while retaining and even improving target specificity. Serum stability measurements show drastically improved stability of this short, heavily modified aptamer. Moreover, it appears that the folding into the stem-loop does not require the otherwise often encountered highly specific buffer components and concentrations but can take place in a range of salt concentrations and pH.

When referring to a base, what is meant is the base of a nucleotide. The base may be part of DNA, RNA, INA (intercalating nucleic acid) LNA, UNA or any other nucleic acid or nucleic acid capable of specific base pairing. The base may also be part of PNA (Peptide Nucleic Acid) or morpholino nucleic acid. In some embodiments, the base may be a universal base.

Specifically for use in the loop region of the short modified aptamers other Tm- lowering nucleotide analogues and/or acyclic nucleotide analogues such as, but not limited to, INA, TNA, GNA and derivatives here of may be used. Likewise acyclic chemical linkers could be used such as PEG.

CD133

CD133, also known as Prominin-1 is a pentaspan, highly glycosylated, membrane glycoprotein that is associated with cholesterol in the plasma membrane. Though this protein is known to define a broad population of cells, including somatic stem and progenitor cells, and is expressed in various developing epithelial and differentiated cells, its exact function is still being elucidated. It has however been linked to the Notch-signalling pathway which is critical for binary cell fate, differentiation of intestinal epithelium, and lymphopoiesis (Ulasov et al. 201 1 . Mol Med 17:103-12). More interest has been shown in this molecule in recent years due to it being thought to be a marker of cancer stem cells (CSCs) in a number of cancers. Indeed, growing evidence has shown that CD133 is expressed on CSCs in a number of cancers, and there is an enhanced tumorigenic potential of CD133⁺ cells versus their negative counterparts in immunodeficient mice (Dittfeld et al. 2009. Radiother Oncol 92:353-61 ).

CD133 is expressed in hematopoietic stem cells, endothelial progenitor cells, gliobalstoma, neuronal and glial stem cells, carious pediatric brain tumors, as well as adult kidney, mammary glands, trachea, salivary glands, placenta, digestive tract, testes and other cell types.

Binding affinity of aptamers

The binding affinity describes the measure of the strength of the binding or affinity of molecules to each other. Binding affinity of the aptamer herein with respect to targets and other molecules is defined in terms of K_D. The dissociation constant can be determined by methods known in the art and can be computed even for complex mixtures by methods such as those, for example, set forth in Caceci, M., et al., Byte (1984) 9:340-362. Examples of measuring dissociation constants are described for example in US 7602495 which describes surface Plasmon resonance analysis, US 6562627, US 6562627, and US 2012/00445849. In another example, the K_D is established using a double-filter nitrocellulose filter binding assay such as that disclosed by Wong and Lohman, (1993). Proc. Natl. Acad. Sci. USA 90, 5428- 5432.

It has been observed, however, that for some small oligonucleotides, direct determination of K_D is difficult, and can lead to misleadingly high results. Under these circumstances, a competitive binding assay for the target molecule or other candidate substance can be conducted with respect to substances known to bind the target or candidate. The value of the concentration at which 50% inhibition occurs (K,) is, under ideal conditions, equivalent to K_D. However, in no event will a K, be less than K_D. Thus, determination of K,, in the alternative, sets a maximal value for the value of K_D. Under those circumstances where technical difficulties preclude accurate measurement of K_D, measurement of K, can conveniently be substituted to provide an upper limit for K_D. A K, value can also be used to confirm that an aptamer of the present binds a target.

Improving aptamer stability

One potential problem encountered in the use of nucleic acids as therapeutics in that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. The present disclosure also includes RNA analogs as described herein and/or additional modifications designed to improve one or more characteristics of the RNA aptamer such as protection from nuclease digestion.

Oligonucleotide aptamer modifications contemplated in the present disclosure include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole.

Modifications to generate oligonucleotides which are resistant to nucleases can also include one or more substitute internucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanosine; 3' and 5' modifications such as capping; conjugation to a high molecular weight, non-immunogenic compound; conjugation to a lipophilic compound; and phosphate backbone modification.

In one example, the non-immunogenic, high molecular weight compound conjugated to the aptamer of the present disclosure is polyalkylene glycol, preferably polyethylene glycol. In one example, the backbone modification comprises incorporation of one or more phosphorothioates into the phosphate backbone. In another example, the aptamer of the present disclosure comprises the incorporation of fewer than 10, fewer than 6, or fewer than 3 phosphorothioates in the phosphate backbone.

Other modifications are described earlier.

Utility of the aptamers

The aptamer molecules of the present disclosure can be used as affinity ligands to separate and purify target molecules (e.g. CD133 bearing cancer stem cells), as probes to trace, monitor, detect and quantitate target molecules (e.g. CD133 bearing cancer stem cells), or to block, allow, activate or catalyse reactions that are physiologically relevant to achieve therapeutic effect. They can act as pharmaceutical agent, bind to a specific target and direct specific molecules to a desired site.

The aptamer molecules of the present disclosure can be used in in vitro processes, for example affinity purification mixtures to purify target molecules (e.g. CD133 bearing cancer stem cells). The aptamers are ideal for chromatographic separations of target molecules (e.g. CD133 bearing cancer stem cells) from contaminants and for purifying target molecules from cell cultures or cell extracts.

In one example, the aptamer molecules of the present disclosure can be used as a capture agent to bind or immobilise a target (e.g. CD133 bearing cancer stem cells) to a solid support. The solid support can be comprised of substrates having the structure and composition commonly associated with filters, wafers, wafer chips, membranes and thin films. However, it is contemplated that the solid support may be comprises of substrates including, but not limited to resins, affinity resins, magnetic or polymer beads, or any diagnostic detection reagent, to capture or immobilise reagents for diagnostic, detection or quantitative studies, The solid supports may comprise any material depending of the desired use, including but not limited to glass, metal surfaces and materials such as steel, ceramic or polymeric materials such as polyethylene, polypropylene, polyamide, and polyvinylidenefluoride etc or combinations thereof. Isolation and purification of CD133 expressing cancer stem cells

The best known example of adult cell renewal by the differentiation of stem cells is the hematopoietic system. Developmentally immature precursors such as hematopoietic stem cells and progenitor cells respond to molecular signals to gradually form the varied blood and lymphoid cell types. Stem cells are also found in other tissues, including epithelial tissues and mesenchymal tissues. Cancer stem cells may arise from any of these cell types, for example, as a result of genetic damage in normal stem cells or by the dysregulated proliferation of stem cells and/or differentiated cells.

Cancer stem cells may be derived from any cancer comprising tumorigenic stem cells, i.e. cells having an ability to proliferate extensively or indefinitely, and which give rise to the majority of cancer cells. Within an established tumor, most cells have lost the ability to proliferate extensively and form new tumors, and a small subset of cancer stem cells proliferate to thereby regenerate the cancer stem cells as well as give rise to tumor cells lacking tumorigenic potential. Cancer stem cells may divide asymmetrically and symmetrically and may show variable rates of proliferation. Cancer stem cell may include transit amplifying cells or progenitor cells that have reacquired stem cell properties.

Representative cancers from which stem cells may be isolated include cancers characterised by solid tumors, including for example fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, synovioma, lymphagioendotheliosarcoma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma and retinoblastoma.

Additional representative cancers from which stem cells can be isolated or enriched according to the present disclosure include hematopoietic malignancies, such as B cell lymphomas and leukemias, including low grade/follicular non-Hodgkin's lymphoma (NHL), small lymphocytic (SL) NHL, intermediate grade/follicular NHL, intermediate grade diffuse NHL, high grade immunoblastic NHL, high grade small non-cleaved cell NHL, bulky disease NHL and Waldenstrom's Macroglobulinemia, chronic leukocytic leukemia, acute myelogenous leukemia, chronic myelogenous leukemia, lymphoblastic leukemia, lymphocytic leukemia, monocytic leukemia, myelogenous leukemia and promyelocytic leukemia.

Cancer stem cells bearing CD133 may be selected using the aptamer molecules as described herein. For example, aptamers which are coupled to fluorescent dyes can be used for the positive selection of cancer stem cells. CD133 is also known to be expressed in some normal cells. However, CD133 expression is thought to be upregulated in cancer stem cells.

Cancer stem cell markers are typically expressed at a level that is at least about 5-fold greater than differentiated cells of the same origin or non-tumorigenic cells, for example, at least about

10-fold greater, or at least about 15-fold greater, or at least about 20-fold greater, or at least about 50-fold greater, or at least about 100-fold greater. The selection process may also include negative selection markers which can be used for the elimination of those cancer cells in the population that are not cancer stem cells.

It will be understood that in performing the present disclosure, separation of cells bearing CD133 can be effected by a number of different methods. For example, the aptamer of the present disclosure may be attached to a solid support to allow for a crude separation.

Various techniques of different efficacy may be employed depending upon efficiency of separation, associated cytotoxicity, ease and speed of performance and necessity for sophisticated equipment and/or technical skill. Procedures for isolation or purification may include, but are not limited to, magnetic separation using aptamer-coated magnetic beads, affinity chromatography and "panning" with aptamer attached to a solid matrix. Techniques providing accurate isolation or purification include but are not limited to FACS. Methods for preparing FACS will be apparent to the skilled artisan.

Enrichment of CD133 expressing cancer stem cells

In one example, the aptamer molecules of the present disclosure are enriched from a biological sample obtained from a subject. Typically the subject will be one which has a tumor or is suspected of having a tumor containing cancer stem cells. The term "enriched" or "enrichment" or variations thereof are used herein to describe a population of cells in which the proportion of one particular cell type (i.e. cancer stem cells) is increased when compared with an untreated population of the cells (e.g. cells in the sample).

In one example, a population enriched for cancer stem cells comprises at least about 0.1 %, or 0.5% or 1 % or 2% or 5% or 10% or 15% or 20% or 25% or 30% or 50% or 75% CD133 bearing cancer stem cells. In this regard, the term "enriched cell population comprising cancer stem cells" will be taken to provide explicit support for the term "population of cells comprising X% cancer stem cells, wherein X% is a percentage as recited herein. In one example, the population of cells is enriched from a cell preparation comprising CD133⁺ cells in a selectable form . In this regard, the term "selectable form" will be understood to mean that the cells express a marker (e.g. a cell surface marker) permitting selection of CD133 bearing cells.

Diagnosis using aptamer molecules

The aptamer molecules of the present disclosure can be used in vitro for diagnostic purposes to determine the presence of cancer stem cells in malignant tissue or other target (e.g. HIV or cancer). An aptamer molecule as described herein can also be used for detection of HIV.

The method involves examining a biological sample for the presence of, for example, CD133⁺ cancer stem cells or HIV etc.. For example, the biological sample can be contacted with a labelled aptamer of the present disclosure and the ability of the aptamer to specifically bind to the cells in the sample is determined. Binding indicates the presence of the target bearing the marker (e.g. a CD133 bearing cancer stem cell or HIV etc). The aptamer of the present disclosure can also be used to localise a tumor in vivo by administering to a subject an isolated aptamer of the present disclosure which is labelled with a reporter group which gives a detectable signal. Bound aptamers can then be detected using flow cytometry, microscopy, external scintigraphy, emission tomography, optical imaging or radionuclear scanning. The method can be used to stage a cancer in a subject with respect to the extent of the disease and to monitor changes in response to therapy.

Detection of the target can be facilitated by coupling the aptamer to a detectable label. Examples of detectable labels include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, electron dense labels, labels for MRI , and radioactive materials. Examples of suitable enzymes include horseradish peroxidise, alkaline phosphatise, β-galactosidase, or acetylcholinesterase. Examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin. Examples of suitable fluorescent materials include umbellifone, fluorescein isothiocyanate, rhodamine, dischlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin . An example of a luminescent material includes luminol. Examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include ¹²⁵l, ¹³¹ l, ³⁵S, ¹⁸F, ⁶⁴Cu, ^94mTc, ¹²⁴l, ^{1 1} C, ¹³N, ¹⁵0, ⁶⁸Ga, ⁸⁶Y, ⁸²Rb or ³H.

Labelling at the 3' end of the aptamer can be achieved, for example by templated extension using Klenow polymerase, by T4 RNA ligase-mediated ligation and by terminal deoxynucleotidyl transferase. Labelling at the 5' end can be achieved by the supplementation of the in vitro transcription mix with an excess of GTP-p-S, the thiol of which can then be used to attach biotin. In addition, direct chemical conjugation of a suitable group(s) to either 5'- or 3'- end can be used to label the aptamers.

The aptamer molecules of the present disclosure can be conjugated to a moiety and used to direct the moiety to CD133⁺ cells, preferably cancer stem cells, or to the target to which the aptamer binds. Examples of moieties include toxins, radionuclides, or chemotherapeutic agents which can be used to kill cancer stem cells or viruses.

The aptamer can be fused to the moiety, e.g. the toxin, either by virtue of the moiety and aptamer being chemically synthesised, or by means of conjugation, e.g. a non-peptide covalent bond, e.g. a non-amide bond, which is used to join separately produced aptamer and the moiety. Alternatively, the aptamer and moiety may be joined by virtue of a suitable linker peptide.

Useful toxin molecules include peptide toxins, which are significantly cytotoxic when present intracellularly. Examples of toxins include cytotoxins, metabolic disrupters (inhibitors and activators) that disrupt enzymatic activity, and radioactive molecules that kill all cells within a defined radius of the effector portion. A metabolic disrupter is a molecule, e.g. an enzyme or a cytokine that changes the metabolism of a cell such that is normal function is altered. Broadly, the term toxin includes any effector that causes death to a tumor cell.

Many peptide toxins have a generalised eukaryotic receptor binding domain; in these instances the toxin must be modified to prevent killing cells not bearing CD133 (e.g. to prevent killing cells not bearing CD133 but having a receptor for the unmodified toxin). Such modifications must be made in a manner that preserves the cytotoxic function of the molecule. Potentially useful toxins include, but are not limited to diphtheria toxin, cholera toxin, ricin, 0- Shiga-like toxin (SLT-I, SLT-II, SLT-II_V), LT toxin, C3 toxin, Shiga toxin pertussis toxin, tetanus toxin, Pseudomonas exotoxin, alorin, saponin, modeccin and gelanin. Other toxins include tumor necrosis actor alpha (TNF-alpha) and lymphotoxin (LT). Another toxin which has antitumor activity is calicheamicin gamma 1 , a diyne-ene containing antitumor antibiotic with considerable potency against tumors (Zein N et al (1988). Science 240:1 198-201 ).

As an example, diphtheria toxin (which sequence is known) can be conjugated to the aptamer molecules of the present disclosure. The natural diphtheria toxin molecule secreted by Corynebacterium diptheriae consist of several functional domains that can be characterised, starting at the amino terminal end of the molecule, as enzymatically-active fragment A (AA 1 - 193) and fragment B (AA 194-535) which includes a translocation domain and a generalised cell binding domain (AA 475-535).

The aptamer and the toxin moiety can be linked in any of several ways which will be known to persons skilled in the art. For example, a method of conjugating an aptamer to a toxin (gelonin) is described in Chu TC et al. (2006) Cancer Res 6(12)5989-5992. The moiety can also be a modulator of the immune system that either activates or inhibits the body's immune system at the local level. For example, cytokines e.g. lymphokines such as IL-2, delivered to a tumour can cause the proliferation of cytotoxic T-lymphocytes or natural killer cells in the vicinity of the tumour.

The moiety or reporter group can also be a radioactive molecule, e.g. a radionucleotide, or a so-called sensitizer, e.g. a precursor molecule that becomes radioactive under specific conditions, e.g. boron when exposed to a bean of low-energy neutrons, in the so-called "boron neutron capture therapy" (BNCT) as described in Barth et al. (1990). Scientific American Oct 1990:100-107. Compounds with such radioactive effector portions can be used both to inhibit proliferation of cancer stem cells in the tumour and to label the cancer stem cells for imaging purposes.

Radionucleotides are single atom radioactive molecules that can emit either α, β, or γ particles. Alpha particle emitters are preferred to β, or γ particle emitters, because they release far higher energy emissions over a shorter distance, and are therefore efficient without significantly penetrating, and harming, normal tissues. Suitable a particle emitting radionuclides include ^{21 1}At, ²¹²Pb, and ²¹²Bi.

The radioactive molecule must be tightly linked to the aptamer either directly or by a bifunctional chelate. This chelate must not allow elution and thus premature release of the radioactive molecule in vivo. Waldmann, Science, 252:1657-62 (1991 ). As an example, to adapt BNCT to the present invention, a stable isotope of boron, e.g., boron 10, can be selected as the antitumour moiety or effector portion of the compound. The boron will be delivered to and concentrates in or on the tumour cells by the specific binding of the aptamer to the cancer stem cell. After a time that allows a sufficient amount of the boron to accumulate, the tumour can be imaged and irradiated with a beam of low-energy neutrons, having an energy of about 0.025 eV. While this neutron irradiation, by itself, causes little damage to either the healthy tissue surrounding the tumour, or the tumour itself, boron 10 (e.g., on the surface of a tumour cell) will capture the neutrons, thereby forming an unstable isotope, boron 1 1 . Boron 1 1 instantly fissions yielding lithium 7 nuclei and energetic a particles, about 2.79 million Ev. These heavy particles are a highly lethal, but very localized, form of radiation, because particles have a path length of only about one cell diameter (10 microns).

The aptamer molecules of the present disclosure can be used for siRNA or ribozyme delivery into cells. Examples of suitable siRNA or ribozyme will depend upon the circumstances. Examples of siRNAs or ribozymes that are suitable for use according to the present disclosure include those which target ATP binding cassette membrane transporters, stemness genes (Bmi-1 , Notch 1 , Sox 2, Oct-4, Nanog, β-catenin, Smo, nestin, ABCG2, Wnt2 and SCF, etc), GAPDH (glyceraldehyde 3-phosphate dehydrogenase), and survivin. By way of example, this has been demonstrated in the prior art using an anti-PSMA aptamer. Based on the knowledge that PSMA is internalised via clathrin-coated pits to endosome, it was postulated that the anti-PSMA aptamer would carry the attached siRNA to the cells that express PSMA, and the aptamer-siRNA bound to the PSMA protein would gain access to the cell via internalisation. Next, the siRNA portion would undergo processing by the Dicer complex and feed into the RNA-lnduced Silencing Complex (RlSC)-mediated gene- silencing pathway. Three groups have utilised different strategies to accomplish this. Chu et al (2006) Nucleic Acids Res 34, e73 describes a biotin-streptavidin bridge mediated conjugation method to assemble the anti-PSMA aptamer and the siRNA. McNamara et al. (2006) Nat Biotechnol 24, 1005-1015 used a "RNA-only" aptamer-siRNA chimera approach to link the aptamer and the siRNA. In a subsequent study by Wullner et al (2008). Curr. Cancer Drug Targets 8:554-565, the authors used the anti-PSMA aptamer to deliver Eukaryotic Elongation Factor 2 (EEF2) siRNA to PSMA-positive prostate cancer cells, Bivalent PSMA aptamers were used for this purpose. The authors demonstrated that, compared to the monovlaent anti- PSMA-siRNA chimera, the gene knock-down potency of the bivalent aptamer-construct was superior.

The aptamer molecules of the present disclosure can also be used to deliver cargo into CD133⁺ cancer stem cells in a variety of solid tumours. Gelonin is a ribosomal toxin that can inhibit the process of protein synthesis and is cytotoxic. However, it is membrane impermeable and needs an usher for its cellular entry. Thus, the aptamer molecules of the present disclosure can be utilised to deliver membrane impermeable toxic payload to cancer stem cells.

Tumour resistance to cytotoxic chemotherapeutic agents is due in part to insufficient delivery to and uptake, and more importantly, efflux by cancer cells. Biodegradable nanoparticle (NP) derived from poly(D,L-lactic-co-glycolic acid) PLGA were used to address this problem as described in Dhar et al (2008) Proc. Natl. Acad. Sci. USA 105:17356-17361 . Briefly, cisplatin was converted to its pro-drug, Pt(IV) compound, by introducing two alkyl chains. This increased the hydrophobicity of the compound and eased the process of its packaging within the hydrophobic core of the NP. Polyethylene glycol (PEG) was used as a copolymer during the nanoprecipitation step to synthesise the PLGA-PEG nanoparticle. The PLGA-PEG-NP surface was decorated with a PSMA (prostate specific membrane antigen) aptamer. The NP underwent endocytosis when incubated with LNCaP cells, and the alkylated pro-drug was converted to cisplatin by the cytosolic reduction process.

The present disclosure also extends to the use of the aptamer molecules as simultaneous drug delivery and imaging agents. This can be achieved by conjugating the aptamer to the surface of a fluorescent quantum dot (QD). Next, the QD-aptamer conjugate is incubated with Dox to form the QD-aptamer-Dox nanoparticle. Both Dox and QD are fluorescent molecules. However, due to their proximity in the QD-aptamer-Dox nanoparticle, they quench each other's fluorescence by a bi-fluorescence resonance energy transfer (FRET) mechanism. Thus, the QD-aptamer-Dox nanoparticle is non-fluorescent. However, internalisation of the QD-aptamer-Dox nanoparticle via PSMA-mediated endocytosis in prostate cancer cells causes the release of Dox from the QD-aptamer-Dox nanoparticles that results in the recovery of fluorescence by both Dox and QD.

Pharmaceutical compositions

In one example of the present disclosure the aptamer according to the present disclosure is administered in the form of a composition comprising a pharmaceutically acceptable carrier and/or excipient. The choice of excipient or other elements of the composition can be adapted in accordance with the route and device used for administration.

The terms "carrier" and "excipient" refer to compositions of matter that are conventionally used in the art to facilitate the storage, administration, and/or the biological activity of an active compound (see, e.g., Remington's Pharmaceutical Sciences, 16th Ed., Mac Publishing Company (1980). A carrier may also reduce any undesirable side effects of the active compound. A suitable carrier is, for example, stable, e.g., incapable of reacting with other ingredients in the carrier. In one example, the carrier does not produce significant local or systemic adverse effect in recipients at the dosages and concentrations employed for treatment.

Suitable carriers for the present disclosure include those conventionally used, e.g. water, saline, aqueous dextrose, lactose, Ringer's solution a buffered solution, hyaluronan and glycols are exemplary liquid carriers, particularly (when isotonic) for solutions. Suitable pharmaceutical carriers and excipients include starch, cellulose, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, glycerol, propylene glycol, water, ethanol, and the like.

Other general additives such as anti-oxidative agent, buffer solution, bacteriostatic agent etc can be added. In order to prepare injectable solutions, pills, capsules, granules, or tablets, diluents, dispersing agents, surfactants, binders and lubricants can be additionally added.

The aptamers of the disclosure and formulations thereof may be administered directly or topically (e.g., locally) to the patient or target tissue or organ as is generally known in the art. For example, a composition can comprise a delivery vehicle, including liposomes, for administration to a subject. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins poly (lactic-co-glycolic) acid (PLGA) and PLCA microspheres, biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors.

Delivery systems which may be used with the aptamers of the present disclosure include, for example, aqueous and non-aqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and non-aqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone). In one embodiment, the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer.

A pharmaceutical composition of the disclosure is in a form suitable for administration, e.g., systemic or local administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition from exerting its effect.

The aptamer or composition comprising the aptamer of the present disclosure can be administered parentally (for example, intravenous, hypodermic, local or peritoneal injection). The effective dosage of the aptamer can be determined according to weight, age, gender, health condition, diet, administration frequency, administration method, excretion and severity of a disease. In one example, the aptamer or theranostic agent as described herein contains the aptamer by 1 0-95 weight %. In another example, the aptamer or theranostic agent contains the aptamer by 25-75 weight %.

Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered.

Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.

Aqueous suspensions contain the aptamer in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more colouring agents, one or more flavouring agents, and one or more sweetening agents, such as sucrose or saccharin.

Oily suspensions can be formulated by suspending the aptamer in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavouring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an antioxidant such as ascorbic acid.

Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the aptamer in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavouring and colouring agents, can also be present.

Pharmaceutical compositions of the invention can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions can also contain sweetening and flavouring agents.

A sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1 ,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution, isotonic sodium chloride solution, and an isotonic salt solution containing sodium and potassium chloride. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.

It is understood that the specific dose level for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy. The administration frequency may be one to several times a day, weekly, or monthly.

Combinations of aptamers

The aptamer molecule(s) of the present disclosure can be used alone or in combination with one or more additional aptamers according to any method disclosed herein. In one example, the aptamer molecule(s) of the present disclosure can be combined with an aptamer that facilitates the detection, purification or enrichment of cancer stem cells. In one example, the additional aptamer comprises the sequence of aptamer EpDT3 5' GCGACUGGUUACCCGGUCG- 3' as described in Shigdar S et al (201 1 ). Cancer Sci 102(5):991 -998. In another example, the additional RNA aptamer binds to a different target present on a cancer stem cell.

Kits

The present disclosure also provides diagnostic kits for carrying out the methods disclosed herein. In one example, the diagnostic kit includes the aptamer or the diagnostic agent as described herein.

The kit may also include ancillary agents such as buffering agents and stabilising agents. The diagnostic kit may further include agents for reducing background interference, control reagents and an apparatus for conducting a test. Instructions on how to use the diagnostic kit are generally also included.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

Examples

Methods

Cell lines and cell culture.

The cell lines chronic myelogenous leukemia cells (K562) and human acute lymphoblastic leukemia cells (MOLT4) were purchased from the American Type Cell Culture Collection (ATCC). K562 cells express the CD133 and MOLT4 do not express CD133. Cells were grown and maintained in culture with Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal calf serum (FCS) at 37°C in a 5% C0₂ environment. Approximately every 5 days or following use, cells were passaged.

Synthesis/Source of aptamers.

Aptamer sequences as described herein were derived from published aptamer sequences as described in the Examples. The original 15-nucleotide CD133 aptamer was developed as described Xiaohong, F., et al. 2009 Accounts of Chemical Research 43(1 );48-57.

Preparation of aptamers for application.

Approximately 30 min prior to application of aptamers for the experiments provided apatamers were removed from storage at -20 °C and allowed to thaw at room temperature. Aptamers were serially diluted in phosphate buffered saline (PBS) supplemented with 2.5 mM MgCI₂ at a concentration from 20 to 400 nM. The aptamers were folded by heating at 85 °C for 5 minutes, followed by slow cooling to 22°C over 1 0 minutes and a further incubation at 37°C for 15 minutes.

Example 1 : Modified CD133 specific aptamers.

In the following example the inventors have deduced modification patterns that stabilize CD133 specific aptamers.

Starting with the original 15-nucleotide CD133 Aptamer developed by the Duan laboratory (Xiaohong, F., et al. 2009 Accounts of Chemical Research 43(1 );48-57) chemically modified aptamers were generated through the strategic placement of UNAs and/or, LNAs and the addition of a 3'-invdT and truncation into shorter nucleotides sequences. Sequences are provided in Table 1 and two dimensional structures in Figure 1 . Aptamer 7 (SEQ ID NO 1 1 ) being an exact replica of the original CD133 and was generated to act as positive control. Aptamer 6 (SEQ ID NO 10) has been used as a negative control, as the introduction of LNAs into all of the 2'-fluoropyrimidine positions resulted in the aptamer losing its binding capabilities.

Aptamer 5.1 (SEQ ID NO 8) worked unexpectedly well.

un er ne . pamer . conane a p osp oro oae ac one. Example 2: Determination of Kn of engineered aptamers with CD133-positive (K562) and negative (MOLT4) cells.

The equilibrium dissociation constant (K_D) of each aptamer was determined by measuring its binding to native CD133 protein expressed on the cell surface with flow cytometry. K562 which expresses CD133 and MOLT4 which does not express CD133 (5 x 10⁵ cells) were incubated with blocking buffer (PBS containing 10% FCS; 0.1 mg/mL tRNA, Sigma; 1 mg/mL BSA, Sigma) for 30 minutes followed by a single wash with binding buffer (10% FCS, 1 mg/mL tRNA, 1 mg/mL BSA, and PBS) prior to incubation with serial dilutions of concentrations of the respective Cy3-labelled aptamers (20 nM to 400 nM) in binding buffer for 30 min at 37°C. The cells were then washed three times with PBS, resuspended in PBS and subjected to flow cytometric analysis. The fluorescent intensity was determined using a FACS Canto II flow cytometer (Becton Dickinson), counting 10,000 events for each sample. The fluorescent geometric mean of each concentration was subtracted from that of the auto fluorescent control and normalised with Aptamer 6 (negative control aptamer; SEQ ID NO:10) to ensure specific binding. The K_D for each aptamer was calculated from the normalised values for fluorescent intensity. Data was analysed using Graph Pad Prism 3 and data was reported as mean and standard error (mean ± SEM).

The ability of an aptamer to bind specifically to its target is a vital property for therapeutic application. To test the effect of each modification on the K_D for each aptamer, binding assays were performed. Each assay entailed the incubation with 20-400 nM of fluorescently labelled aptamers with CD133-positive (K562) and CD133-negative (MOLT4) cells followed by analysis using flow cytometry, experiments were repeated in triplicate. The assays were controlled through the inclusion of Aptamer 7 (SEQ ID NO:1 1 ) as a positive control, as well as Aptamer 6 and CD133-negative cells as negative controls, to account for non-specific binding. The calculated K_D are presented in Table 2 and the binding curves are shown in Figure 2.

The introductions of each modification within the CD133 aptamer produced a variety of results, with some causing an increase or decrease in binding affinity and others a loss of specificity. The introduction of three LNAs into the stem region of Aptamer 1 resulted in a minor decrease in K_D while specificity was maintained, evident from the large value recorded for the negative cell line indicating low affinity and no non-specific binding (Figure 2A). Aptamer 1 .1 (SEQ ID NO:6) was generated from the truncation of Aptamer 1 from 15 nucleotides to 13 nucleotides plus the introduction of additional LNAs into SL2 and SR4. This resulted in a significant decrease in binding affinity and specificity was completely lost (Figure 2B). In contrast, while further truncation of Aptamer 1 to 1 1 nucleotides (Aptamer 1 .2; SEQ ID NO:7) resulted in a larger decrease in binding affinity, while the specificity was largely maintained (Figure 2C).

Aptamers 2, 3, 4, and 5 were all generated through the addition of an UNA monomer at different positions of the binding loop. The modifications introduced to Aptamers 3 (SEQ ID NO:3) and 4 (SEQ ID NO:2) resulted in a slight decrease in binding affinity with the maintenance of specificity (Figure 2E and G), while the opposite was observed for Aptamers 2 (SEQ ID NO:4) and 5 (SEQ ID NO:5), Figure 2D and H. The modifications within these two aptamers produced a large decrease in their affinity toward the K562 cells and a significant increase to the MOLT4 cells, indicating specificity was lost.

The truncation of Aptamer 5 from 15 base pairs to 11 and the introduction of LNA monomers into SL3, SL4 and SR4 produced Aptamer 5.1 (SEQ ID NO:8). This aptamer possesses properties that are the complete opposite from its parent aptamer. Aptamer 5 had lost its specificity for CD133 and had a decreased binding affinity (Figure 2H) whereas Aptamer 5.1 had a higher binding affinity while maintaining its specificity (Figure 2I), compared to the original CD133 aptamer (Figure 2A).

Table 2 CD133 dissociation binding constants against K562 CD133-positive cells and MOLT4 CD133-negative cells

Aptamer K562 (K_D, nM) MOLT4 {K_D, nM)

1 121 ± 86.14 >1000

1.1 278.5 ± 178.1 393.91419.9

1.2 575.2 ± 349.8 >1000

2 431.2 ± 155.6 126.3154.29

2.1 300.5 ± 196.2 275.91141.0

376.6 ±213.0 300.2170

2.2 117150.26 157514764

3 65.39147.81 >1000

3.1 196.61127.9 618.51397.7

4 124.21121.5 >1000

5 339.01256.9 258.31117.2

5.1 82.38164.34 >1000

5.2 267.51158.0 142.6195.93

5.3 155.8161.05 767.1 11274

5.4 177.51105.7 114.31118.8

5.5 158.3182.36 251.71145.5 7 97.51 ± 34.2 >1000

7.1 149.2 ± 148.9 823.5 ± 1 1 10

Example 3: The internalisation of CD133 aptamers.

The ability of each CD133 aptamer to be internalised via receptor mediated endocytosis was established with confocal microscopy. K562 and MOLT4 cells were harvested, centrifuged (1000 x g for 5 minutes) and resuspended in blocking buffer (10% FCS, 0.1 mg/mL tRNA, 1 mg/mL BSA, PBS) for 30 minutes. Next, cells were centrifuged (1300 x g for 3 min) and resuspended in binding buffer (10% FCS, 0.1 mg/mL tRNA, 1 mg/mL BSA, and PBS) prior to incubation with the aptamers (200 nM) at 37°C for 30 min. Following the completion of the incubation period, cells were incubated for a further 10 minutes with Bisbenzimide Hoechst 33342 (3 μg/mL, Sigma). Aptamer and Hoechst solution were removed and cells were washed twice in PBS and transferred to an 8-chamber slide (Lab-Tek II, Nunc) prior to visualisation using a FluoView FV10i laser scanning confocal microscope (Olympus).

For an aptamer to be developed for therapeutic applications, such as drug delivery vehicles, it is imperative that they have the ability not only to specifically bind with target cells, but also to be internalised to deliver their pay load. Therefore, given that the original CD133 aptamer is specifically internalised within CD133 positive cells via receptor mediated endocytosis, it was essential in this study to ensure that the final and desired modifications introduced in the CD133 aptamers will maintain their ability to be internalised (Shigdar, S., et al. 201 1 Cancer Letters 330:84-95). To this end, each fluorescently labelled aptamer was subjected to two independent internalisation experiments in which they were incubated with both CD133-positive (K562) and -negative (MOLT4) cells for 30 min at 37°C, representing physiological conditions, followed by visualization using confocal microscopy. The specificity of binding and internalisation was established through the use of Aptamer 7 (SEQ ID NO:1 1 ) as a positive control and Aptamer 6 (SEQ ID NO:10) which does not bind to CD133 and the CD133- negative MOLT4 cells acting as negative controls.

As presented in Figure 3, the majority of the aptamers were efficiently internalised upon binding within the 30 min incubation period. The internalisation was specific under the experimental conditions as no fluorescent signal was present within the negative cell line (MOLT4). Comparable to the results from the binding assay, the UNA modification in position L5 of Aptamer 2 (SEQ ID NO:4) again resulted in a loss of specificity, with fluorescent signal present within the positive and negative cell lines (Figure 3). Aptamer 6 (SEQ ID NO:10), the negative control aptamer, did not show internalisation into the K562 or MOLT4 cell lines, indicating that the internalisation displayed by the other aptamers was not a non-specific uptake of the RNA aptamers studied. Example 4: Assessment of rate of internalisation.

The rate at which each modified aptamer was internalised was established through qualitative analysis using a protocol similar to that of quantitative assessment of the cellular internalisation described in Example 3. All aptamers and the K562 cell lines were prepared in the same manner as for flow cytometry and cellular internalisation (Example 2 and 3). Each aptamer (200 nM) was incubated with the cells for either: 5, 10, 20 or 30 min at 37°C. Following the completion of each incubation period, internalisation was terminated through the addition of excess PBS. Cells were then washed once with PBS and incubated for a further 10 minutes with Bisbenzimide Hoechst 33342 (Sigma). Subsequent to washing, cells were resuspended in 20 μΙ_ PBS and transferred into an 8-chamber slide (Lab-Tek II, Nunc) followed by visualisation using confocal microscopy.

The extent and rate at which each aptamer is internalised was quantified using the confocal images captured for each time point with Image Pro Premier (Media Cybernetics) analysis. The fluorescent intensity of the aptamer and nuclei within the cell at each time point was measured equally through the use of a standard measurement area (32272 pix^A2) placed inside the plasma membrane and normalised to the 30 min time point. Fluorescent intensity was recorded for each time point in triplicate. Data was analysed and was reported as mean and standard error (mean ± SEM). The relative fluorescent intensities were graphed to establish a semi-quantitative rate of internalisation.

As shown in qualitative assessment of internalisation in Figure 3, none of the modifications introduced to the CD133 aptamer had a negative influence on the rate of internalisation (Figure 4). Under the experimental settings, the original CD133 aptamer, Aptamer 7 (SEQ ID NO:1 1 ), was internalised within 20 min of incubation.

The mean relative intensities of the fluorescence were then graphed and compared to

Aptamer 7 to establish if the modifications introduced had influenced rate of internalisation. As shown in Figure 4B, all of the engineered aptamers were efficiently internalised within 20 min, with some also demonstrating an increase in the rate of internalisation. Compared to Aptamer 7 which was internalized with 20 min, Aptamers 1 .1 , 1 .2 and 4 (SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:2, respectively) were internalised within 10 min, demonstrating a doubling in the efficiency of cellular internalisation upon cell surface binding to CD133.

Example 5: Aptamer stability in 100% human serum

Human serum was freshly prepared and cy5 labelled aptamers were incubated for up to 48 hours in 100% serum at 37°C. Samples were taken at regular intervals and transferred to 95% formamide and 20mM EDTA and boiled for 3 minutes at 95 °C. The samples were kept at - 20 until run on a 10% denaturing gel. The appearance of a reverse looking degradation pattern is due to positive charge on the cy5 label which causes the degraded products to move slower than the full length aptamer. Samples labelled control are pure aptamer without serum to show the position of the intact aptamer in the gel.

Results clearly show in Figures 5A and 5Bthat the shortened version of the original 2'F-

RNA aptamer (designated aptamer 7.2 (SEQ ID NO:20) is degraded very fast, with a half life of less than 10 minutes (intensity of bands were measured using the free software Image J).

In comparison aptamer 1 .2 which is shortened and modified with LNA and 2'O-methyl at the ends has a half life of more than 3 hours (Figure 5C). Aptamer 5.1 which has an additional UNA in the loop area was stable up to at least 48 hours where no degradation is visible (Figure 6A).

With respect to the stability of the original aptamer 7.1 containing a 3' invdT, degradation products become visible after 4 hours showing that even the longer 3'invdT capped form is not as stable as the short highly modified aptamer 5.1 , which has no 3'invdT (Figure 6B).

Aptamer 5.3 is the same as aptamer 5.1 , but has the 3'invdT. The 3'invdT does not change the stability (Figure 7A-C), but does however lower the target affinity and increase background binding.

The results demonstrate that aptamer 5.1 which lacks the 3' invdT demonstrated superior stability in human serum.

Example 6: Evaluation of aptamer conformation

Aptamer 5.1 was prepared in 1 xPBS with 2,5 mM MgCI₂ and heated to 95 degrees for 3 min and cooled slowly. In some cases the Aptamer was mixed with an RNA 5'Cy3- CUAUGAGGAG-3' which was complementary to aptamer 5.1

Figure 8A shows spectrophotomeric analysis (Bckman Coultier) of aptamer 5.1 in 1 xPBS and 2.5mM MgCI₂ which corresponds to physiological salt concentration. The wide transition shown in Figure 8A corresponds to the melting of a hairpin structure. Nearly 100% of aptamer 5.1 is in the hairpin form under physiological salt concentrations and temperature (Anna Avino et al (2009) Chemistry and Biodiversity vol 6(2):1 17-126). The MgCI₂ contributes to a much nicer melting curve, indicating stabilisation of the hairpin when salt concentration is low. Silicon oil was used to prevent air bubble formation in the samples and contributed to a smoother curve. The Tm of aptamer 5.1 was determined to be 74.4^SC.

Figure 8B shows the same analysis of aptamer 5.1 but using a high salt concentration (10x PBS and 10mM MgCI₂). High salt concentrations were observed to push the duplex- hairpin equilibrium in favour of duplex formation at physiological temperature (37^SC). Two transitions were observed, a Tm1 of 61 .2^SC which corresponds to the melting of the duplex formation and a switching to the hairpin formation and Tm2 at 85.3^SC which corresponds to the melting of the hairpin formation (approximately 10 degrees high than in 1 x PBS) (Anna Avino et al (2009) Chemistry and Biodiversity vol 6(2):1 17-126; Wing et al (1980) Nature 287:755- 758).

Figure 8C shows analysis of aptamer 5.1 , together with the complementary RNA showing the Tm of the duplex corresponding to about 55^SC.

The results shown in Figures 8A to C are the average of four samples of 2.5μΜ aptamer.

Circular dichroism (CD) specters of aptamer 5.1 and the corresponding duplex

(aptamer 5.1 and its complementary RNA) were obtained at four different temperatures (15^SC, 45^SC, 65^SC and 95^SC) as shown in Figures 9A for aptamer 5.1 (at 15^SC), 9B for aptamer 5.1 and complementary RNA at 15^SC and 9C for aptamer 5.1 and complementary RNA at 65^SC. For Figure 9C, 65^SC is beyond the Tm of the duplex but not the Tm of the hairpin. The specters show some characteristics of RNA helix and single stranded oligonucleotides (which appears likely for a hairpin). When a perfectly complementary oligo is added to the aptamer, a curve resembling both RNA and DNA occurs and would indicate an equilibrium between duplex and hairpin formations (Kaushik et al (2003) Nucleic acid research vol 31 :23 pages 6904- 6915). When measuring the specters of the duplexes at a temperature above the previously obtained melting temperatures for the duplex, the profile of a hairpin re-emerges indicating that the hairpin is more temperature stable than the duplex, the aptamer snaps back into a hairpin formation once the complementary RNA is dissociated from the aptamer at high temperature. At 95^SC, the curves almost completely flatten out (not shown).

Thus, the results demonstrate by two different methods the aptamer 5.1 is clearly a hairpin structure.

Example 7: Quencher assay confirming hairpin structure of short modified aptamer

Quencher assays were performed by incubating Cy 3 labelled aptamer (1 pmol) in PBS in black clear bottomed 96 well tray with 0.1 , 1 or 10 pmol of quencher labelled (3' Cy 3-BH2 quencher) aptamer. Samples were heated to 85 degrees and left to anneal at room temperature. The plates where read on a typhoon scanner (GE Healthcare). All samples were prepared in triplicate.

To show that Cy 3 can be quenched, an oligonucleotide (termed #Q81 ) which is complementary to the aptamer sequence was synthesised with the BH2 quencher also. . As a negative control to rule out quenching because of high concentrations of BH2 oligo, an unrelated aptamer for EpCAM was used. Results in Figure 1 0 show that the original CD133 aptamer (aptamer 7 shown in Figure 10C) with 2'F-RNA and aptamer 5.1 (shown in Figure 10B) both have strong hairpin formations (only 1 0% quenching even in 10 fold quencher excess ) whereas only 50-55 % of the shortened version with only 2'F-RNA modifications (aptamer 7.2) is in the hairpin form. The maximum fluorescence of the aptamers in the absence of quenchers is normalized to the value 1 for simplicity. As expected and shown in Figure 10D, with the EpCAM aptamer there was no duplex formation observed and consequently no quenching.

Example 8: Thermodynamic calculations of CD133 Aptamers.

In the following the inventors have made thermodynamic calculations, which verify the improvements made in the modified CD133 aptamers are needed to achieve the stem loop structure.

Based on thermodynamic calculations, the inventors predicted that the unmodified sequences would not form a proper stem-loop structure based positive delta-G value. Nevertheless, the modifications were found to result in the formation of a stem-loop structure.

It would be expected that the greater the number of basepairs in the stem region of the aptamer the more favourable the thermodynamics (however, it is also necessary to consider the length and sequence within the loop region) and therefore by shortening the sequence the thermodynamics will be less favourable (hence less likelihood of forming a stem-loop structure). By incorporating both UNA and LNA into the original sequence, a stem-loop construction was favoured over duplex formation. The combination of these modifications facilitated the formation of correct stem-loop structures in a short aptamer sequence, thereby allowing the inventors to generate aptamers that were much smaller in length compared to the original sequence but which were functional and stable.

By way of example, Aptamer 7 (SEQ ID NO:1 1 ) which did not include any UNA/LNA modifications in the sequence was shortened by 4 bases (5'cc and 3'gg) to produce the unmodified aptamer corresponding to Aptamers 2.2 and 5.3 respectively (SEQ ID NO 16/SEQ ID NO 15). Thermodynamic analysis of the shorter sequences (shown in Table 5 and below) showed a positive delta G value for the two types of predicted aptamer structures (Figure 1 1 A and 1 1 B). When the 1 1 mer unmodified sequence was modified via the introduction of LNAs and UNAs to generate aptamers 2.2 and 5.3 (see Table 1 ), these aptamers showed the character of correct stem loop formation, CD133 binding (KD 1 17 and 155.7, respectively) similar to binding of 15 mer Aptamer 7 (KD 97.51 ) (Example 2). Aptamer 5.3 also demonstrated stability in serum (demonstrated by a half-life of 34.86 hr), considerably longer compared to starting Aptamer 7 (half-life 14.0 hr) (Example 5).

Table 3 Thermodynamic Calculations of truncated unmodified Aptamer corresponding to 2.2, 5.1 and 5.3 (SEQ ID NO 16/ SEQ ID NO 8/SEQ ID NO 15)

HOMO-DIMER ANALYSIS

Maximum Delta G -16.13 kcal/mole

Delta G -2.56 kcal/mole

Base Pairs 3

5 ' CTCCTACATAG

3 ' GATACATCCTC

Delta G -1.6 kcal/mole

Base Pairs 2

5 ' CTCCTACATAG

3 ' GATACATCCTC

Delta G -1.47 kcal/mole

2

Base Pairs

5 ' CTCCTACATAG

3 ' GATACATCCTC Delta G -0.96 kcal/mole

Base Pairs 2

5 ' CTCCTACATAG

3 ' GATACATCCTC

Delta G -0.96 kcal/mole

Base Pairs 2

5 ' CTCCTACATAG

3 ' GATACATCCTC

Table 4 Thermodynamic Calculations unmodified DNA nucleotide sequence corresponding to Aptamer 1 .1 (SEQ ID NO:6)

HOMO-DIMER ANALYSIS Dimer Sequence

5'- CCTCCTACATAGG -3'

Maximum Delta G -22.27 kcal/mole

Delta G -5.63 kcal/mole

Base Pairs 4

5 ' CCTCCTACATAGG

3 ' GGATACATCCTCC

Delta G -4.67 kcal/mole

Base Pairs 3

5 ' CCTCCTACATAGG

3 ' GGATACATCCTCC Delta G -1.47 kcal/mole

Base Pairs 2

5 ' CCTCCTACATAGG

3 ' GGATACATCCTCC

Delta G -0.96 kcal/mole

Base Pairs 2

5 ' CCTCCTACATAGG

3 ' GGATACATCCTCC

Delta G -0.96 kcal/mole

Base Pairs 2

5 ' CCTCCTACATAGG

3 ' GGATACATCCTCC

Table 5 Thermodynamic Calculations unmodified DNA nucleotide sequence corresponding to Aptamer 7 (SEQ ID NO:1 1 )

APTAMER ANALYSIS

Potential DeltaG Tm deltaH deltas Figure Aptamer

structure no.

1 -4.19 67.2 -33.8 -99.31 Figure 1 1 E

2 -3.22 56.7 -33.5 -101 .56 Figure 1 1 F

3 -3.12 58.4 -31 -93.5 Figure 1 1 G

4 -2.93 53.6 -33.5 -102.53 Figure 1 1 H

HOMO-DIMER ANALYSIS Dimer Sequence

5 ' - CCCTCCTACATAGGG -3 '

Maximum Delta G -28.41 kcal/mole

Delta G -7.74 kcal/mole Base Pairs 4

5 ' CCCTCCTACATAGGG 3 ' GGGATACATCCTCCC

Delta G -5.63 kcal/mole Base Pairs 4

5 ' CCCTCCTACATAGGG

3 ' GGGATACATCCTCCC

Delta G -3.07 kcal/mole Base Pairs 2

5 ' CCCTCCTACATAGGG 3 ' GGGATACATCCTCCC

Delta G -3.07 kcal/mole Base Pairs 2

5 ' CCCTCCTACATAGGG 3 ' GGGATACATCCTCCC

Delta G -3.07 kcal/mole Base Pairs 2

5 ' CCCTCCTACATAGGG

3 ' GGGATACATCCTCCC

Delta G -1.47 kcal/mole Base Pairs 2

5 ' CCCTCCTACATAGGG

3 ' GGGATACATCCTCCC Delta G -0.96 kcal/mole

Base Pairs 2

5 ' CCCTCCTACATAGGG

3 ' GGGATACATCCTCCC

Example 9: Thermodynamic calculations EpCAM Aptamer.

To further demonstrate the versatility of the present invention throughout the claimed scope the inventors have also modified other known aptamers. In the following, an epithelial cell adhesion molecule (EpCAM) specific RNA aptamer was modified.

EpCAM specific Aptamer

Aptamer Chemistry:2'-F-RNA

Target: Cancer stem cell marker epithelial cell adhesion molecule

Sequence:5'-rGpfCprGprApfCpfUprGprGpfUpfUp rApfCpfCpfCprGprGpfUpfCprGpdTi-3'

Full length 5'-GCGACUGGUUACCCGGUCGU

Suggested shorter sequence: 5'-UGGUUACCCG

Modified sequence: SEQ ID NO 29: 5'LTLGrGfUfUrAunaCfCLCmG

The EpCAM aptamer has been shortened from 20 to 10 nucleic acids, the loop region contains 6 nucleotides including an UNA C. The stem region now contains 3 locked nucleic acids, including a GC LNA pair and a 5' LNA. The 3' nucleotide is substituted with 2'O-methyl G. The secondary structure of the modified EpCAM Aptamer is provided in Figure 12A. In the following the inventors have made thermodynamic calculations, which show the envisaged improvements are needed to achieve the stemloop structure in the modified version.

APTAMER ANALYSIS

Potential DeltaG Tm deltaH deltas Figure Aptamer

structure

1 0.79 7.1 -12.4 -44.25 Figure 12A HOMO-DIMER ANALYSIS

Delta G -4.41 kcal/mole

Base Pairs 3

UGGUUACCCG GCCCAUUGGU

Delta G -3.61 kcal/mole

Base Pairs 2

5 ' UGGUUACCCG

3 ' GCCCAUUGGU

Delta G -3.07 kcal/mole

Base Pairs 2

UGGUUACCCG GCCCAUUGGU

Example 10: Thermodynamic calculations cAMP specific Aptamer.

To further demonstrate the versatility of the present invention throughout the claimed scope the inventors have also modified other known aptamers. In the following, the known cAMP RNA Aptamer, described in Kozumi and Breaker. Biochemistry, 39 (2000): 8983-8992, has been modified. cAMP Aptamer

Aptamer Chemistry: RNA Target: cAMP Antigen/Target Category: Small Organic Affinity (Kd):10 μΜ (reported value) Length:31 Binding Conditions/BuffenBinding Buffer (20 mM Tris- HCI (pH 7.5 at 23 °C), 450 mM NaCI, 100 mM KCI, 10 mM MgCI₂, 1 mM MnCI₂, and 5 mM CaCI₂).

Molecular Weight:10044.1 7

Extinction Coefficient: 316000.00

Sequence:5'{5'/Phosphate}rGprGprAprAprGprAprGprAprUprGprGprCprGprAprCprUprAprAprA prAprCprGprAprCprUprUprGprUprCprGprCp-3'.

Original sequence: GGAAGAGAUGGCGACUAAAACGACUUGUCGC

Suggested shorter sequence: GACUAAAACGACUUGUC

Modified sequence: SEQ ID NO:30 LGrALCrUunaArArArAunaCrGrArCrUrULGUmC The cAMP Aptamer has been shortened from 31 to 17 nucleic acids; the loop region contains 13 nucleotides including two unlocked nucleic acids an A and a C. The stem region now contains 3 LNAs, including a GC LNA pair and a 5' LNA. The 3' nucleotide is substituted with 2'0-methyl C. The secondary structure of the modified cAMP Aptamer is provided in Figure 12B. Provided below the inventors have made thermodynamic calculations which show the envisaged improvements are needed to achieve the stemloop structure in the modified version.

Maximum Delta G -27.59 kcal/mole

Homodimer complexes

Delta G -3.61 kcal/mole

Base Pairs 2

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG

Delta G -2.92 kcal/mole

Base Pairs 3

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG

Delta G -2.92 kcal/mole

Base Pairs 3

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG

Delta G -1.94 kcal/mole

Base Pairs 2

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG

Delta G -1.94 kcal/mole

Base Pairs 2

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG Delta G -1.34 kcal/mole

Base Pairs 2

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG

Delta G -0.96 kcal/mole

Base Pairs 2

5 ' GACUAAAACGACUUGUC

3 ' CUGUUCAGCAAAAUCAG

Example 1 1 : Thermodynamic calculations HIV Aptamer.

To further demonstrate the versatility of the present invention throughout the claimed scope the inventors have also modified other well-known aptamers. In the following, the known HIV DNA aptamer, described in Sekkai et al. Antisense and Nucleic Acid Drug Development, 12 (2002): 265-274 has been modified.

HIV specific Aptamer

Chemistry:DNA Target:HIV-1 TAR RNA Hairpin Loop Antigen/Target Category:Small Organic Affinity (Kd):50 nM (reported value)Length:19Binding Conditions/BuffenR buffer (20 mM HEPES (pH 7.4), 140 mM potassium acetate, 20 mM sodium acetate, 3 mM magnesium acetate)Refolding Program:N/A If the oligo is a known aptamer sequence: For binding studies, perform a refolding program to ensure proper function (i.e. binding to antigen or target). Refer to the aptamer reference source for the appropriate refolding parameters and binding conditions.

Molecular Weight: 5659.71

Extinction Coefficient: 166500.00

Sequence: 5'-dCpdCpdCpdTpdApdGpdTpdTpdApdGpdCpdCpdApdTpdCpdTpdCpdCpdCp-3' Original sequence: CCCTAGTTAGCCATCTCCC

Suggested shorter sequence: TAGCCATCTC

Modified sequence: SEQ ID NO:31 : LTLALGdCdCUnaAdTLCdTmC

The Sekkai HIV Aptamer has been shortened from 19 to 10 nucleic acids, the loop region contains 6 nucleotides including an UNA. The stem region now contains 4 LNAs, including a GC LNA pair and a 5' LNA. The 3' nucleotide is substituted with 2'O-methyl C. The secondary structure of the modified HIV Aptamer is provided in Figure 12C. Provided Below the inventors have made thermodynamic calculations, which show the envisaged improvements are needed to achieve the stemloop structure in the modified version.

HOMO-D IMER ANALYS I S

Dimer Sequence

5 ' - TAGCCATCTC -3 '

Maximum Delta G -16.94 kcal/mole

Delta G -3.14 kcal/mole

Base Pairs 2

5 ' TAGCCATCTC

3 ' CTCTACCGAT

Delta G -1.6 kcal/mole

Base Pairs 2

5 ' TAGCCATCTC

3 ' CTCTACCGAT

Delta G -1.47 kcal/mole

Base Pairs 2

5 ' TAGCCATCTC

3 ' CTCTACCGAT

Delta G -0.96 kcal/mole

Base Pairs 2

5' TAGCCATCTC

3 ' CTCTACCGAT

Example 12: Thermodynamic calculations Ampicillin Aptamer.

To further demonstrate the versatility of the present invention throughout the claimed scope the inventors have also modified other known aptamers. In the following, the known Ampicillin aptamer, described in Song KM, Jeong E, Ban C, et al. (2012). Anal Bioanal Chem. 402:2153-2161 , has been modified. Ampicillin Aptamer

Chemistry:DNA Target:Ampicillin Antigen/Target Category:Small Organic Affinity (Kd):9.8 nM (reported value)Length:19Binding Conditions/BuffenBinding Buffer: 20mM Tris-HCI (pH 8.0), 50 mM NaCI, 5 mM KCI, 5 mM MgCI₂. Refolding Program :Heated at 90°C for 3 min and then cooled at 4°C for 1 hour.

Molecular Weight: 5895.91

Extinction Coefficient: 180800.00

Sequence:5'-dTpdTpdTpdApdGpdTpdTpdGpdGpdGpdGpdTpdTpdCpdApdGpdTpdTpdGp-3'

Original sequence: TTTAGTTGGGGTTCAGTTG

Suggested shorter sequence: TTGGGGTTCAG

Modified sequence: SEQ ID NO: 32: LT dT LG UnaG dG dG UnaT dT LC LA mG

The Song Ampicillin Aptamer has been shortened from 19 to 1 1 nucleic acids, the loop region contains 7 bases including two UNAs. The stem region now contains 5 LNAs, including two LNA pairs and a 5' LNA. The 3' nucleotide is substituted with 2'O-methyl G. The secondary structure of the modified HIV Aptamer is provided in Figure 12D. In the following the inventors have made thermodynamic calculations, which show the envisaged improvements are needed to achieve the stemloop structure in the modified version.

APTAMER ANALYSIS

Potential DeltaG Tm deltaH deltas Figure Aptamer

structure 0.99 5.4 -14.1 -50.83 Figure 12D HOMO-DIMER ANALYSIS

Dimer Sequence

5 ' - TTGGGGTTCAG -3 '

Maximum Delta G -21.52 kcal/mole

Delta G -1.95 kcal/mole

Base Pairs 2

5 ' TTGGGGTTCAG

3 ' GACTTGGGGTT

Example 13: Thermodynamic calculations modified Adrenoreceptor Autoantibody Aptamer

To further demonstrate the versatility of the present invention throughout the claimed scope the inventors have also modified other well-known aptamers. In the following, the known Adrenoreceptor Autoantibody aptamer, described in Haberland, A., et al. Circulation Research, 109 (201 1 ): 986-992, has been modified.

Adrenoreceptor Autoantibody Aptamer

Chemistry: DNA Target:B1 -Adrenoceptor Autoantibodies(AABs) Antigen/Target Category rotein Affinity (Kd):n/a nM (reported value) Length: 21 Binding Conditions/BuffenBuffer 1 : Tris buffer pH 7.3, 0.1 % Tween-20, DMEM, 0.1 % Tween-20 Buffer 2: Phosphate buffer pH 7.5, 0.1 % Tween-20Refolding Program:N/A If the oligo is a known aptamer sequence: For binding studies, perform a refolding program to ensure proper function (i.e. binding to antigen or target). Refer to the aptamer reference source for the appropriate refolding parameters and binding conditions.

Molecular Weight: 6480.27

Extinction Coefficient: 212600.00

Sequence:5'dApdCpdApdGpdTpdApdApdCpdCpdGpdCpdGpdTpdGpdApdGpdGpdTpdCpdGp dAp-3'

Original sequence: ACAGTAACCGCGTGAGGTCGA

Suggested shorter sequence: AACCGCGTGAGGTC

Modified sequence: SEQ ID NO: 33: LALALCCGunaCGunaTGAGLGLTmC

The Haberland Adrenoreceptor Autoantibody Aptamer has been shortened from 21 to 14 nucleotides, the loop region contains 8 bases including two UNAs. The stem region now contains 5 LNAs, including two LNA pairs and a 5' LNA. The 3' nucleotide is substitute a 2Ό- methyl C. The secondary structure of the modified Adrenoreceptor Autoantibody Aptamer is provided in Figure 12E. In the following the inventors have made thermodynamic calculations, which show the envisaged improvements are needed to achieve the stemloop structure in the modified version.

HOMO-DIMER ANALYSIS

Dimer Sequence

5 ' - AACCGCGTGAGGTC -3 '

Maximum Delta G -29.17 kcal/mole

Delta G -10.36 kcal/mole

Base Pairs 4

5' AACCGCGTGAGGTC

3 ' CTGGAGTGCGCCAA

Delta G -4.41 kcal/mole

Base Pairs 3

5' AACCGCGTGAGGTC

3 ' CTGGAGTGCGCCAA

Delta G -3.61 kcal/mole

Base Pairs 2

5 ' AACCGCGTGAGGTC

3 ' CTGGAGTGCGCCAA

Delta G -3.61 kcal/mole

Base Pairs 2

5' AACCGCGTGAGGTC

3 ' CTGGAGTGCGCCAA

Delta G -1.57 kcal/mole

Base Pairs 2

5' AACCGCGTGAGGTC

3 ' CTGGAGTGCGCCAA Delta G -1.34 kcal/mole

Base Pairs 2

5 ' AACCGCGTGAGGTC

3 ' CTGGAGTGCGCCAA

Example 14: Thermodynamic calculations Aflatoxin Aptamer

To further demonstrate the versatility of the present invention throughout the claimed scope the inventors have also modified other well-known aptamers. In the following the known Aflatoxin Aptamer, described in Nguyen, B.H., et al., Material Science and Engineering. C, Materials for biological applications (2013) 1 ;33(4):2229-34, has been modified. Aflatoxin Aptamer

Aptamer Chemistry:DNA Target:Aflatoxin M1 Antigen/Target Category rotein Affinity (Kd):0.0182 nM (reported value)Length:21 Binding Conditions/BuffenN/ARefolding Program :N/A Comments:affinity in this paper was determined by cyclic voltammetry and measured current Vs E/V. Kd was determined by finding the highest peak and converting its concentration of aptamer and target to nM of target. Aptamer sequence is shorter than most. The Nguyen et al. paper claims it came from a university in Vietnam but cites no paper for further investigation into its length.

Molecular Weight: 6380.23

Extinction Coefficient: 201700.00

Sequence:5'dApdCpdTpdGpdCpdTpdApdGpdApdGpdApdTpdTpdTpdTpdCpdCpdApdCpdApd Tp-3'

Original sequence: ACTG CT AG AG ATTTTCC AC AT

Suggested shorter sequence: ACTGCTAGAGA

Modified sequence: SEQ ID NO: 34: LALCLTGCTunaAGLALGmA

The Nguyen Aflatoxin Aptamer has been shortened from 21 to 1 1 nucleotides; the loop region contains 7 nucleotides including 1 UNAs. The stem region now contains 5 LNAs, including two LNA pairs and a 5' LNA. The 3' nucleotide is substitute a 2'O-methyl A. The secondary structure of the modified Aflatoxin Aptamer is provided in Figure 12F. In the following the inventors have made thermodynamic calculations, which show the envisaged improvements are needed to achieve the stemloop structure in the modified version. -0.28 29.8 -17.7 -58.43 deltaG tm deltaH Deltas

APTAMER ANALYSIS

Potential DeltaG Tm deltaH deltas Figure Aptamer

structure -0.28 29.8 -17.7 -58.43 Figure 12F

Dimer Sequence

5 ' - ACTGCTAGAGA -3 '

Maximum Delta G -16.94 kcal/mole

Delta G -4.16 kcal/mole

Base Pairs 4

5 ' ACTGCTAGAGA

3 ' AGAGATCGTCA

Delta G -3.14 kcal/mole

Base Pairs 2

5 ' ACTGCTAGAGA

3 ' AGAGATCGTCA

Delta G -1.6 kcal/mole

Base Pairs 2

5 ' ACTGCTAGAGA

3 ' AGAGATCGTCA

Delta G -1.6 kcal/mole

Base Pairs 2

5 ' ACTGCTAGAGA

3 ' AGAGATCGTCA Delta G -1.6 kcal/mole Base Pairs 2

5 ' ACTGCTAGAGA

3 ' AGAGATCGTCA

Claims

CLAIMS:

1 . An aptamer of between 1 0 to 20 nucleotides in length, the aptamer comprising:

(i) a loop region sequence comprising between 3 and 14 unpaired nucleotides and wherein at least one unpaired nucleotide is substituted with an unlocked nucleic acid (UNA) nucleotides;

(ii) a stem region sequence comprising at least two nucleotide pairs and wherein at least one pair of nucleotides is substituted with locked nucleic acid (LNA) nucleotides;

(iii) a terminal 5' nucleotide substituted with a LNA; and

(iv) a terminal 3' nucleotide substituted with a 2'O-methyl RNA and/or a 3' inverted dT.

2. The aptamer according to claim 1 which specifically or selectively binds to a target selected from the group consisting of CD133, EpCAM, cAMP, HIV, ampicillin, B1 - adrenoreceptor autoantibodies antigen, and aflatoxin,

3. The aptamer according to claim 1 or 2, wherein the terminal 5' nucleotide and/or the terminal 3' nucleotide is unpaired.

4. The aptamer according to any one of claims 1 to 3, wherein at least one of the pyrimidine nucleotides is substituted with 2'-deoxy-2'-fluorocytidine or 2'-deoxy-2'- fluorocytidine for the corresponding cytidine or uracil.

5. The aptamer according to any one of claims 1 to 4, wherein the loop region comprises between 4 and 7 unpaired nucleotides.

6. The aptamer according to any one of claims 1 to 4, wherein the loop region comprises between 6 and 1 1 unpaired nucleotides.

7. The aptamer according to any one of claims 1 to 4, wherein the loop region comprises 7 unpaired nucleotides.

8. The aptamer according to any one of claims 1 to 7, wherein the stem region comprises between 2 and 8 nucleotide pairs.

9. The aptamer according to any one of claims 1 to 7, wherein the stem region comprises 2 nucleotide pairs.

10. The aptamer according to any one of claims 1 to 9 which is an RNA aptamer, a DNA aptamer, an RNA/DNA aptamer or a chimeric aptamer.

1 1 . The aptamer according to any one of claims 1 to 10, wherein the aptamer specifically or selectively binds to CD133.

12. An aptamer of between 10 to 20 nucleotides in length which specifically or selectively binds to CD133, the aptamer comprising:

(i) a loop region sequence comprising between 3 and 14 unpaired nucleotides and wherein at least one unpaired nucleotide is substituted with an unlocked nucleic acid (UNA) nucleotides;

(ii) a stem region sequence comprising at least two nucleotide pairs and wherein at least one pair of nucleotides is substituted with locked nucleic acid (LNA) nucleotides;

(iii) a terminal 5' nucleotide substituted with a LNA; and

(iv) a terminal 3' nucleotide substituted with a 2'O-methyl RNA and/or a 3' inverted dT.

13. The aptamer according to claim 12, comprising a consensus sequence

5'- LC fC LC fU fC (fC or unaC) (fU or unaU) (A or unaA) fC A fU A G (G or LG) mG -3' wherein f is a 2'fluoro modification, L is a locked nucleic acid, una is an unlocked nucleic acid and m is 2'O-methyl modification.

14. The aptamer according to claim 12 comprising a consensus sequence

5'- LC LT fC (fC or unaC) (fU or unaU) (A or unaA) fC A fU LA (mG or LG) -3';

wherein f is a 2'fluoro modification, L is a locked nucleic acid, una is an unlocked nucleic acid and m is 2'O-methyl modification.

15. The aptamer according to any one of claims 1 1 to 14 having a dissociation constant for CD133 in the range of from 67-589 nM, of from 67-298 nM, of from 67-217nM, or of from 67-167 nM.

16. The aptamer according to any one of claims 1 1 to 15 comprising a sequence selected from the group consisting of:

(i) 5' -LCLTfCunaCfUAfCAfULAmG- 3' (SEQ ID NO:8);

(ii) 5' -LCLTfCfCfUunaAfCAfULAmG- 3' (SEQ ID NO:9);

(iii) 5' - LCfCLCfUfCunaCfUAfCAfUAGLGmG- X-3' (SEQ ID NO:12); (iv) 5' -LCfCLCfUfCfCfUunaAfCAfUAGLGmG- X-3' (SEQ ID NO:13);

(v) 5' -LCfCLCfUfCfCunaUAfCAfUAGLGmG- X-3' (SEQ ID N0:14);

(vi) 5' - LCLTfCunaCfUAfCAfULAmG- X- 3' (SEQ ID N0:15);

(vii) 5'-LCLTfCfCunaUAfCAfULAmG-X- 3' (SEQ ID N0:16); and

(viii) 5' -LCLTfCunaCfUAfCAfULALG- X- 3' (SEQ ID N0:18);

wherein L is a Locked nucleic acid, f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O- methyl RNA, T is LNA- thymine and X is an invdT.

17. The aptamer according to claim 16 consisting of the sequence 5' - LCLTfCunaCfUAfCAfULAmG- 3' (SEQ ID NO:8), wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl RNA, T is LNA-thymine.

18. The aptamer according to any one of claims 1 to 17 further comprising a 5' label.

19. The aptamer according to any one of claims 1 to 18, wherein the aptamer is ligated via a linker at the 5' and/or 3' termini to a further aptamer.

20. The aptamer according to any one of claims 1 1 to 19, wherein the CD133+ cell(s) are cancer stem cell(s).

21 . The aptamer according to claim 20, wherein the cell(s) is in vivo or in vitro.

22. The aptamer according to any one of claims 1 1 to 21 , wherein the cell is present in a biological sample obtained from a subject.

23. A diagnostic agent comprising the aptamer according to any one of claims 1 to 19 coupled to a detectable label.

24. A detection agent comprising the aptamer according to any one of claims 1 to 19 coupled to a detectable label.

25. A method for identifying a CD133 expressing cell(s) and/or cancer stem cell(s) in a subject or a biological sample obtained from a subject having, or suspected of having cancer, the method comprising contacting the cell(s) with a diagnostic agent according to claim 23 or detection agent according to claim 24.

26. An aptamer according to any one of claims 1 to 19, or the agent according to claim 23 or 24 for use in histological examination of biological samples.

27. An aptamer according to any one of claims 1 to 19 coupled to an active moiety.

28. A method for treating cancer in a subject in need thereof, comprising providing the subject with the aptamer according to any one of claims 1 to 1 9 or 27.

29. Use of an aptamer according to any one of claims 1 to 19 or 27 in the manufacture of a medicament for treating cancer in a subject.

30. Use of an aptamer according to any one of claims 1 to 19 or 27 in medicine.

31 . Use of an aptamer according to any one of claims 1 to 19 or 27 for treating cancer in a subject in need thereof

32. A composition comprising a therapeutically effective amount of an aptamer according to any one of claims 1 to 19 or 27, together with a pharmaceutically acceptable carrier and/or excipient.

33. An aptamer according to claim 1 comprising a sequence selected from the group consisting of:

(i) 5' -LTLGrGfUfUrAunaCfCLCmG- 3' (SEQ ID NO:29);

(ii) 5' -LGrALCrUunaArArArAunaCrGrArCrUrULGUmC - 3' (SEQ ID NO:30);

(iii) 5' -LTLALGdCdCUunaAdTLCdTmC- 3 (SEQ ID NO: 31 )';

(iv) 5' -LTdTLGUunaGdGdGUunaTdTLCLAmG- 3' (SEQ ID NO:32);

(v) 5' -LALALCCG unaCG u naTG AG LGLTmC- 3' (SEQ ID NO:33); or

(vi) 5' -LALCLTGCTunaAGLALGmA- 3' (SEQ ID NO:34);

wherein, wherein L is a Locked nucleic acid (LNA), f is 2'-fluoro, una is an Unlocked nucleic acid, m is 2' O-methyl, T is a LNA- thymine, d is deoxy (DNA nucleotide), r is ribo (RNA nucleotide) and X is an invdT.

34. A method for improving the biological stability of an aptamer between 1 0 to 20 nucleotides in length and having a loop region sequence of between 3 and 14 nucleotides, the method comprising: (i) introducing at least one unlocked nucleic acid (UNA) nucleotide by substitution into an unpaired nucleotide in a loop region sequence;

(ii) introducing locked nucleic acid (LNA) nucleotides into at least one pair of nucleotides in the stem region sequence;

(iii) substituting the terminal 5' nucleotide with a LNA; and

(iv) substituting the terminal 3' nucleotide with a 2'0-methyl RNA and/or a 3' inverted dT.