JP2017093313A - Novel vector and method for producing solubilized protein using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel vector and method for producing a solubilized protein using the vector to overcome disadvantages of a conventional expression system in E. coli, the system using an expression vector widely as a protein synthesis system based on genetic information, but the vector being often insoluble and inactivated, especially when a eukaryotic protein is expressed.SOLUTION: According to the present invention, a method for producing a soluble protein using a transformant being transformed by a vector is provided. The vector is an E. coli transformation vector in which an expression induction system of L11 gene introduced. The vector comprises a promoter capable of regulating the expression of the L11-expressing gene by an inducer, the promoter being incorporated upstream of the L11-expressing gene. Here, a promoter that can be regulated by an inducer different from the inducer of the L11 gene expression induction system may be introduced into the system for inducing expression of a target protein gene.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a method for producing a solubilized protein. Specifically, the present invention relates to an efficient method for producing a solubilized protein of interest using a novel expression vector.

  With the progress of genome analysis technology, genome information of a wide variety of organisms has been accumulated, and the existence of a huge number of functionally unknown genes has been revealed. Functional analysis of unknown genes is the most important issue of post-genome analysis, but its progress is delayed compared to genome analysis. This is because the protein encoded by the unknown function gene may not be synthesized in a soluble state that retains its function.

  As a method of synthesizing a protein based on gene information, a method of synthesizing a protein in Escherichia coli using an expression vector into which a target gene has been introduced is known (Non-patent Document 1). This method is the most widely used because of the ease of experimental manipulation, low cost, and high yield, but the target protein is synthesized as an inactive insoluble aggregate (inclusion body). (Non-Patent Document 1). This tends to be seen in many proteins from eukaryotes. One of the causes is that E. coli protein synthesis is too fast compared to eukaryotes and the amount of protein synthesized is large. It is mentioned that the higher-order structure necessary for protein functionalization is not normally folded.

  On the other hand, in Escherichia coli cultured at low temperature, it is known that a protein synthesized based on gene information introduced into an expression vector is produced in a soluble state that retains its function. This is considered to be caused by a decrease in the rate of protein synthesis in E. coli (Non-patent Document 2). In response to this, a technique has been reported in which the synthesized protein does not become inclusion bodies and is obtained in a soluble state by culturing the target protein expression host E. coli under low temperature conditions of 12 to 25 ° C. (Patent Document 1).

  Intracellular protein synthesis is carried out by intracellular amino acid ribosome polymerizing amino acids according to genetic information. It is known that this reaction is promoted by GTP hydrolysis energy generated when GTP-binding translation factor (GTPase translation factor) interacts in a specific region called GTPase center of ribosome.

  The GTPase center is a particularly protein-rich region in the ribosome, and L11, one of the GTPase center components of the E. coli ribosome, is known to be related to the interaction with the GTPase translation factor and lacks L11. It is known that the E. coli mutant strain (for example, AM68 strain) grows slower than the wild strain, and that the ribosome isolated from the AM68 strain has a reduced protein synthesis rate (Non-patent Documents 3 and 4). ). In response, a technique for synthesizing a protein derived from a eukaryote in a solubilized state by using the AM68 strain as an expression host has been reported (Patent Document 2).

Japanese Patent Laid-Open No. 2004-024243 JP 2007-300858 A

Baneyx, F., and Mujacic, M. (2004) Recombinant protein folding and misfolding in Escherichia coli. Nat. Biotechnol. 22, 1399-1408. Weinstock, GM, ap Rhys, C., Berman, ML, Hampar, B., Jackson, D., Silhavy, TJ, Weisemann, J., and Zweig, M. (1983) Open reading frame expression vectors: a general method for antigen production in Escherichia coli using protein fusions to beta-galactosidase.Proc. Natl. Acad. Sci. USA 80 (14), 4432-4436. Sorensen, H. P., and Mortensenm K. K. (2005) Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli.Microbial Cell Factories 2005, 4: 1 doi: 10.1186 / 1475-2859-4-1. Dabbs, E. R. (1979) Selection for Escherichia coli mutants with proteins missing from the ribosome. J. Bacteriol. 140, 734-737 Uchiumi, T., Honma, S., Nomura, T., Dabbs, ER, and Hachimori, A. (2002) Translation elongation by a hybrid ribosome in which proteins at the GTPase center of the Escherichia coli ribosome are replaced with rat counterparts J. Biol. Chem. 277, 3857-3862. Dyke, N. V., Xu, W., and Murgola, E. J. (2002) J. Mol. Biol. 319, 329-339.

  As shown in Patent Document 1, protein synthesis in E. coli under low-temperature culture conditions requires dedicated equipment for maintaining a low-temperature environment and costs for maintaining them, and it is necessary to synthesize many proteins. In some cases, the economic and environmental burdens are large. In contrast, when the L11-deficient E. coli mutant strain (AM68 strain) shown in Patent Document 2 is used as an expression host, it does not require a low-temperature environment, but because growth is too slow, it takes a long time for a series of operations. In other words, there is a problem that transformation efficiency for introducing an expression vector into Escherichia coli is extremely poor.

  In order to solve the above-mentioned problems, the inventors of the present invention do not require a culture condition in a low-temperature environment during the production of a target protein in the method for producing a solubilized protein using E. coli, and the growth of E. coli as a host is not necessary. Intensive research was conducted on how to shorten the growth time in the process. Since the AM68 strain is deficient in the L11 expression gene, the growth time is long in all processes of the host E. coli growth process and the target protein production process. Therefore, the present inventor promotes the expression of L11 in the growth process of E. coli as a host and suppresses the expression of L11 in the production process of the target protein, thereby delaying the growth time only in the production process of the target protein. We found that L11 expression can be controlled by an inducible substance by creating a vector incorporating an inducible promoter upstream of the L11 expressed gene that can regulate the expression of the L11 expression gene with an inducer. It was.

  Furthermore, an inducible promoter that can be regulated by an inducer different from the inducer of the L11 expression promoter was incorporated upstream of the target protein expression gene in order to suppress L11 expression and induce target protein expression during the target protein production process Obtaining knowledge that a solubilized target protein can be efficiently produced by preparing and transforming a vector, the present invention has been completed.

  That is, the present invention does not require a culture apparatus that maintains a low-temperature environment, and is capable of ensuring a sufficient growth rate and transformation efficiency, and a method for producing a solubilized target protein, and for realizing the same. An object of the present invention is to provide a novel vector.

  (1) A vector according to the present invention is an E. coli transformation vector into which an L11 gene expression induction system incorporating an inducible promoter capable of regulating the expression of an L11 expression gene with an inducer is introduced upstream of the L11 expression gene. A vector in which a target protein gene expression induction system in which an inducible promoter that can be regulated by an inducer different from the inducer of the L11 gene expression induction system is incorporated upstream of the target protein expression gene may be introduced. is there.

  (2) Another vector according to the present invention is the vector according to claim 1, wherein the L11 gene expression induction system and the target protein gene expression induction system are introduced. .

  (3) In another vector according to the present invention, inducible promoters introduced into the L11 gene expression induction system and the target protein gene expression induction system are different from each other, and include an araBAD promoter (PBAD promoter) and a tac promoter. The vector according to claim 1 or 2, wherein the vector is one selected from the group consisting of: trc promoter, lac promoter, lacUV5 promoter, trp promoter, λ promoter pL and phoA promoter.

  (4) In another vector according to the present invention, the inducible promoter introduced into the L11 gene expression induction system is an araBAD promoter, and the inducible promoter introduced into the target protein gene expression induction system is The vector according to claim 3, which is a tac promoter.

  (5) Another vector according to the present invention comprises a base sequence represented by SEQ ID NO: 1 in the sequence listing or a base sequence represented by a sequence in which one or more bases of the sequence are deleted, substituted or added. The vector according to claim 4, which comprises the vector.

  (6) Another transformant according to the present invention is a transformant for producing a solubilized protein, characterized by being transformed with the vector according to any one of claims 1 to 5. is there.

  (7) Another method for producing a solubilized protein according to the present invention is a method for producing a solubilized eukaryotic protein, characterized by using the transformant according to claim 6.

  (8) In another method for producing a solubilized protein according to the present invention, the inducible promoter of the L11 gene expression induction system is an araBAD promoter, the inducer is arabinose, and the target protein gene expression is induced. The method for producing a solubilized eukaryotic protein according to claim 7, wherein the inducible promoter of the system is a tac promoter and the inducer is isopropyl-β-thiogalactopyranoside (IPTG). It is.

It is a schematic diagram of the manufacturing method which concerns on this invention. It is a schematic diagram of pBAD24 / Ec_L11 production. It is a schematic diagram of preparation of the two-control system vector (pTAK) based on an Example. It is a schematic diagram of pTAK expression vector preparation. It is the result of the growth experiment of ΔL11-pBAD24 / Ec_L11. It is the result of the growth experiment of ΔL11-pTAK. It is an analysis result of L11 existence state in ΔL11-pTAK. It is an analysis result of the expression state of a target protein.

  Below, the form for implementing the manufacturing method of the solubilized protein which concerns on this invention is demonstrated.

  The present invention controls the expression of an inducible promoter that can regulate the expression of an L11-expressed gene by an inducer upstream of the L11-expressed gene, and can be regulated by an inducer different from the inducer of the L11-expressed promoter An E. coli transformation vector capable of efficiently generating a target protein solubilized by incorporating an inducible promoter upstream of the target protein expression gene, and a method for producing a soluble protein using E. coli transformed with the vector It is to provide.

  FIG. 1 shows a schematic diagram of a manufacturing method according to the present invention. At the time of pre-culture in the left part of the figure, growth is accelerated by inducing expression of L11. Thereafter, during the main culture at the center left and right in the figure, L11 expression is suppressed by suppressing the expression of L11, and the growth is slowed down. In this state, expression of the target protein is induced (right in the figure) to efficiently generate a solubilized target protein.

  In the production method according to the present invention, the type of the target protein is not particularly limited, but a eukaryotic protein can be suitably applied. Examples of eukaryotes include organisms having a nucleus in a cell, such as animals including humans, plants, and fungi. In the present specification, the solubilized target protein may be referred to as a solubilized protein for convenience.

  In the present invention, in order to control the growth rate, the expression of L11 is controlled using a predetermined inducer. By transforming an inducible promoter that can regulate the expression of the L11 expression gene with an inducer with a vector incorporated upstream of the L11 expression gene, L11 is induced by the inducer in the growth process of E. coli in the host. The cells are sufficiently grown by culturing at a growth rate. In addition, by transforming an inducible promoter that can be regulated by an inducer different from the inducer of the L11 expression promoter with a vector that is incorporated upstream of the target protein expression gene, L11 expression is suppressed during the target protein production process. In this state, the target protein can be expressed, and the solubilized protein can be efficiently produced.

  The inducible promoter that can be introduced into the L11 gene expression induction system and the target protein gene expression induction system of the vector of the present invention is not particularly limited as long as it is a promoter that can control the expression of L11 and the target protein with an inducer, and araBAD Promoters, tac promoters, trc promoters, lac promoters, lacUV5 promoters, trp promoters, lambda promoters pL and phoA promoters, etc., but the inducible promoters of the L11 gene expression induction system and the target protein gene expression induction system are It is necessary to combine different ones, and a combination of the araBAD promoter and the tac promoter is preferable.

  The inducible promoter inducer to be introduced into the L11 gene expression induction system and the target protein gene expression induction system of the present invention is not particularly limited as long as each inducible promoter can be controlled. Inducible promoter inducers must be different from each other and should not affect each other. Examples of the combination of different inducers include a combination of an araBAD promoter inducer arabinose and a tac promoter inducer isopropyl-β-thiogalactopyranoside (IPTG).

  As indicated above, L11 expression affects the growth rate of E. coli. For this reason, it is possible to control the culture rate by changing the expression of L11 by the addition of an inducer. That is, during the growth process of the host E. coli, an expression inducer of L11 expression gene promoter is added to improve the growth rate, and during the target protein production process, the growth rate is suppressed without adding the inducer and the target protein is added. It can be solubilized. Furthermore, in the target protein generation process, target protein expression is efficiently generated by adding target protein expression gene promoter inducer, which is different from L11 expression gene expression inducer, to enhance target protein expression gene expression. Can be made.

  The ΔL11 strain used in the present invention can be prepared by known methods that can be known by those skilled in the art. Examples of typical preparation methods include the method described in Non-Patent Document 6.

  In the present invention, the expression induction system refers to a mechanism for expressing a target gene cloned downstream of a promoter by addition of a predetermined inducer, and is incorporated into E. coli using a vector. The vector used in the present invention can be arbitrarily selected from known ones, but preferably contains an Escherichia coli endogenous promoter. Examples of typical vectors include pUC, pBAD, pGEX and the like.

  As a method for incorporating a gene into a vector, a known method can be applied, and can be arbitrarily selected according to the type of target protein, the type of vector, and the like. Examples of methods for incorporating genes into vectors include the In-Fusion method and the restriction enzyme method.

  According to the production method of the present invention, since the growth rate is reduced by controlling the expression of genes, it can be carried out in a normal culture environment without requiring a low-temperature environment. The normal culture environment refers to a culture temperature environment of E. coli without cooling. Generally, a temperature environment of 25 degrees Celsius to 45 degrees Celsius, preferably a temperature environment of 30 degrees Celsius to 40 degrees Celsius. Say. In addition, the present invention can be suitably applied in a normal culture environment, but this does not positively exclude the possibility of work under temperature control.

  In the present invention, the medium for culturing the transformant can be arbitrarily selected according to the type of host cell and the type of target protein, and representative examples include YM medium, Nutrient Agar medium, LB medium and the like. It is done.

  EXAMPLES The present invention will be described in detail below with reference to examples of the present invention, but the present invention is not limited to these examples.

(Preparation of L11 gene expression induction system introduction vector)
Only one L11 gene of E. coli exists on the chromosome, and it is known that the amount of transcription to mRNA is controlled by a promoter region located upstream of the L11 gene. In this example, since it is necessary to arbitrarily control the expression of L11, pBAD-24 having an araBAD promoter capable of controlling the expression by arabinose, and a vector (pBAD24 -Ec_L11) was produced. From 6xHis (His tag) of pBR322 / His-Ec_L11, a DNA region containing the L11 gene was amplified by polymerase chain reaction (PCR), pBAD24 was treated with restriction enzymes EcoRI and HindIII, and In Fusion cloning was performed. FIG. 2 shows a schematic diagram of the production of pBAD24 / Ec_L11.

  The primers used for the production of the vector are shown below. Each primer was adjusted to 10 pmol / μl using TE Buffer (10 mM Tris-HCl pH 7.6, 0.1 mM EDTA) in the PCR reaction.

His-EcL11-in-fusion-F
5'-CAGGAGGAATTCACCATGCATCATCATCATCATCATA-3 '

EcL11-in-fusion-R
5'-CAAAACAGCCAAGGCTTTTAGTCCTCCACTACCAGG-3 '

(Amplification of Ec_L11 gene DNA fragment by PCR method)
In the reaction solution shown below, pBR322 / His-Ec_L11 cloned from pBR322 vector with 6xHis (His tag) added to pBR322 vector from the genomic DNA of wild strain of E. coli (W3110 strain) at the N-terminus. A PCR reaction was performed.

  PCR reaction was performed at 94 ° C for 2 minutes, followed by 20 cycles of heat denaturation 98 ° C, 10 seconds, annealing 62 ° C, 30 seconds, extension reaction 68 ° C, 15 seconds, and then heated at 68 ° C for 7 minutes. did. After the reaction, for confirmation, perform 1.5% agarose gel electrophoresis using TBE Buffer (89 mM Tris-borate pH 8.3, 2 mM EDTA) as the running buffer. I confirmed that there was.

  The pBAD24 vector was digested with restriction enzymes EcoRI and HindIII. The following reaction solution was reacted at 37 ° C. for 1 hour.

  After completion of the reaction, phenol treatment and chloroform treatment are performed, DNA fragments are recovered by ethanol precipitation, dissolved in TE Buffer, and TAE Buffer (40 mM Tris-acetic acid pH 8.0, 1 mM EDTA) is run for confirmation. The 1.0% agarose gel electrophoresis used was used.

(Insertion of Ec_L11 gene DNA fragment into pBAD24 vector)
In order to perform the In Fusion reaction, the Ec_L11 gene DNA fragment was treated with an enhancer. A reaction solution shown below was prepared, incubated at 37 ° C. for 20 minutes, and then incubated at 80 ° C. for 15 minutes.

  An In Fusion reaction was performed to introduce the Ec_L11 gene DNA fragment into the pBAD24 vector that had been digested with restriction enzymes. The following reaction solution was prepared, reacted at 50 ° C. for 15 minutes, and then allowed to stand on ice.

  Competent cells DH5α were transformed using the vector prepared above and cultured on an LB selection (LB-Ap) agar medium containing the antibiotic ampicillin at 37 ° C. for about 12 hours. After culturing, colony PCR for ampicillin-resistant bacteria was performed with the following reaction solution in order to obtain a vector in which the Ec_L11 gene DNA fragment was inserted into the pBAD24 vector from the obtained bacterial colonies.

  The PCR reaction was performed with the following primer combinations.

araC-center-F
5'- CGGCGACAAGCAAACATGCTGTGCGACGC -3 '

EC_L11 In Fusion-R
5'-CAAAACAGCCAAGGCTTTTAGTCCTCCACTACCAGG-3 '

  The PCR reaction was performed at 94 ° C. for 2 minutes, followed by 30 cycles of heat denaturation 94 ° C., 30 seconds, annealing 61 ° C., 30 seconds, extension reaction 68 ° C., 1 minute 30 seconds, then 10 minutes at 72 ° C. Heated for minutes. After completion of the reaction, 1.5% agarose gel electrophoresis using TBE Buffer as the electrophoresis buffer was performed to confirm the insertion of the DNA fragment.

  Ampicillin-resistant colonies with confirmed DNA fragment insertion were inoculated into 1 ml of LB-Ap selective liquid medium, shaken overnight at 37 ° C, and then centrifuged at 15,000 rpm, 4 ° C for 10 minutes. The cells were collected, and a pBAD24 / Ec_L11 vector was obtained using a QIAprep (registered trademark) Spin Miniprep Kit.

(Production of L11 gene expression induction system / target protein gene expression induction system introduction vector)
In this example, since arabinose was employed as the L11 expression inducer, it is necessary to use a different inducer to induce the expression of the target protein. In this example, a pGEX-6P-1 vector having a Tac promoter capable of controlling expression by IPTG and using a two-control vector (pTAK) capable of controlling the expression of the target protein and L11. Built.

  DNA from araC of pBAD24 / Ec_L11 to Ec_L11 and up to the terminator region was subjected to PCR amplification, treated with pGEX-6P-1 using restriction enzymes BsaAI and AatIII, and then subjected to In Fusion cloning. FIG. 3 shows a schematic diagram of production of a bi-regulatory system vector (pTAK) according to this example.

  The primers used for the production of the vector are shown below. Each primer was adjusted to 10 pmol / μl using TE Buffer in the PCR reaction.

pGEX-6P-1-araC-F
5'- CCATGACCCAGTCACATTGTCTGATTCGTTACCAATT -3 '

rrnB-T2-ter-AatII-R
5'- GAAAAGTGCCACCTGAAAAGGCCATCCGTCAGGAT -3 '

(Amplification of araC-Ec_L11 DNA region by PCR method)
Using the prepared pBAD24 / EC_L11 as a template, PCR was performed using the following reaction solution.

  PCR reaction was performed at 94 ° C for 2 minutes, followed by 20 cycles of heat denaturation 98 ° C, 10 seconds, annealing 58 ° C, 30 seconds, extension reaction 68 ° C, 90 seconds, and then 68 ° C for 7 minutes. Heated. After completion of the reaction, 1.0% agarose gel electrophoresis using TAE Buffer (40 mM Tris-acetic acid pH 8.0, 1 mM EDTA) as an electrophoresis buffer was performed for confirmation. For the In Fusion reaction, 4 μl of Cloning enhancer was added to 10 μl of this PCR product, incubated at 37 ° C. for 20 minutes, and further incubated at 80 ° C. for 15 minutes.

(Restriction enzyme digestion of pGEX-6P-1 vector)
The pGEX-6P-1 vector was digested with BsaAI and then digested with AatII. The reaction solution shown below was prepared and reacted at 37 ° C. for 1 hour.

(BsaAI treatment)

(AatII treatment)

After completion of the reaction, the pGEX-6P-1 vector treated with phenol and chloroform, digested with restriction enzyme by ethanol precipitation is recovered, dissolved in TE Buffer, and 1.0% agarose using TAE Buffer as the running buffer for confirmation. Gel electrophoresis was performed.

(Insertion of araC-Ec_L11 DNA region into pGEX-6P-1 vector)
An In Fusion reaction was performed to introduce the araC-Ec_L11 gene DNA fragment into the pGEX-6P-1 vector that had been digested with restriction enzymes. The following reaction solutions were prepared and incubated at 50 ° C. for 15 minutes.

  Using this reaction solution, competent cell DH5α was transformed and cultured at 37 ° C. for about 12 hours on an LB-Ap agar medium containing the antibiotic ampicillin. In order to obtain a vector in which the araC-Ec_L11 gene DNA fragment has been inserted into the pGEX-6P-1 vector from the colony of ampicillin-resistant bacteria obtained by culture, colony PCR for ampicillin-resistant bacteria was performed in the reaction solution shown below. I went.

  The PCR reaction was performed with the following primer combinations.

pGEX-6P-1-BsaAI-92-F
5'- CGGTCACAGCTTGTCTGTAAGCGGATGCCG -3 '

pGEX-6P-1-AatII-68-R
5'- GGGTTATTGTCTCATGAGCGGATACAT -3 '

  The PCR reaction was performed at 94 ° C. for 2 minutes, followed by 25 cycles of heat denaturation 94 ° C., 30 seconds, annealing 56 ° C., 30 seconds, extension reaction 68 ° C., 2 minutes 30 seconds. After completion of the reaction, 1.0% agarose gel electrophoresis using TAE Buffer as the electrophoresis buffer was performed to confirm the insertion of the DNA fragment. Thereafter, colonies of ampicillin-resistant bacteria with confirmed DNA fragment insertion are inoculated into 1 ml of LB-Ap selective liquid medium, shaken overnight at 37 ° C, and then centrifuged at 15,000 rpm, 4 ° C for 10 minutes. Thus, the cells were collected, and a pTAK vector was obtained using the QIAprep Spin Miniprep Kit.

(Preparation of target protein expression vector)
In this example, firefly luciferase (Luc) was employed as the target protein. Specifically, the DNA region containing the Luc gene of the pSP-luc + NF vector was PCR amplified, treated with pTAK using restriction enzymes XhoI and SmaI, and then In Fusion cloning was performed. FIG. 4 shows a schematic diagram of pTAK / Luc vector preparation.

  Primers used for vector preparation and nucleotide sequence analysis (sequence reaction using ABI PRISM BigDye Terminator v3.1 Cycle Sequence Kit) are shown below. Each primer was used after adjusting to 10 pmol / μl using TE Buffer.

Luc-In-Fusion-F
5'- ATCCCCGGAATTCCCCATGGTCACCGACGCCAA -3 '

Luc-In-Fusion-R
5'- GATGCGGCCGCTCGATTACACGGCGATCTTTCCG -3 '

(Amplification of target protein DNA region by PCR method)
The Luc gene DNA region was subjected to PCR using the following reaction solution.

  The PCR reaction was performed at 94 ° C. for 2 minutes, followed by 15 cycles of heat denaturation 98 ° C., 10 seconds, annealing, 60 ° C. extension reaction 68 ° C., 60 seconds, and then heated at 68 ° C. for 7 minutes. Using 1 μl of this PCR product as a template, PCR amplification was further performed in the following reaction solution.

  The PCR cycle was performed in the same manner as the first time, and after the reaction was completed, 1.0% agarose gel electrophoresis using TAE Buffer as an electrophoresis buffer was performed for confirmation. For the In Fusion reaction, 4 μl of Cloning enhancer was added to 10 μl of this PCR product, incubated at 37 ° C. for 20 minutes, and further incubated at 80 ° C. for 15 minutes.

(Restriction enzyme digestion of pTAK vector)
The pTAK vector was digested with XhoI and then digested with SmaI. The following reaction solution was prepared and reacted at 37 ° C. for 3 hours.

  After the reaction is complete, treat with phenol and chloroform, collect the pTAK vector digested with restriction enzyme by ethanol precipitation, dissolve in TE Buffer, and perform 1.0% agarose gel electrophoresis using TAE Buffer as the running buffer for confirmation. went.

(Insertion of Luc gene DNA region into pTAK vector)
An In Fusion reaction was performed to introduce the Luc gene DNA fragment into the pTAK vector that had been digested with restriction enzymes. The following reaction solution was prepared, reacted at 50 ° C. for 15 minutes, and then allowed to stand on ice.

    Using this reaction solution, competent cell DH5α was transformed and cultured at 37 ° C. for about 12 hours on an LB-Ap agar medium containing the antibiotic ampicillin. In order to obtain a vector in which the araC-Ec_L11 gene DNA fragment has been inserted into the pGEX-6P-1 vector from the colony of ampicillin-resistant bacteria obtained by culture, colony PCR for ampicillin-resistant bacteria was performed in the reaction solution shown below. I went.

  The PCR reaction was performed at 94 ° C. for 2 minutes, followed by 25 cycles of heat denaturation 94 ° C., 30 seconds, annealing 56 ° C., 30 seconds, extension reaction 68 ° C., 2 minutes 30 seconds. After completion of the reaction, 1.0% agarose gel electrophoresis using TAE Buffer as the electrophoresis buffer was performed to confirm the insertion of the DNA fragment. Thereafter, colonies of ampicillin-resistant bacteria with confirmed DNA fragment insertion are inoculated into 1 ml of LB-Ap selective liquid medium, shaken overnight at 37 ° C, and then centrifuged at 15,000 rpm, 4 ° C for 10 minutes. Thus, the bacterial cells were collected and a pTAK / Luc vector was obtained using the QIAprep Spin Miniprep Kit.

(Acquisition of transformant)
Using the prepared pBAD24 / Ec_L11, pTAK, and pTAK / Luc vectors, the ΔL11 strain was transformed and cultured in an LB agar medium (LB-Ap-Ara agar medium) containing antibiotics ampicillin and arabinose. The transformants according to the examples (ΔL11-pBAD24 / Ec_L11, ΔL11-pTAK, ΔL11-pTAK / Luc were prepared. Although the transformants were obtained even in the absence of arabinose, they were obtained more easily than the existing conditions. It took a long time.

(Analysis of growth control by pBAD24 / Ec_L11 vector)
In order to analyze the effect of arabinose on the growth of ΔL11-pBAD24 / Ec_L11, which was a transformant, stationary culture was performed in the presence or absence of arabinose. ΔL11-pBAD24 / Ec_L11 was shaken in LB-Ap-Ara selective liquid medium at OD600nm of 0.4 at 37 ° C, and the culture broth was LB-Ap (left) and LB-Ap-Ara (right) selected agar medium Then, static culture was performed at 37 ° C. for 64 hours. A photograph of the culture results is shown in FIG. 5A.

  In order to analyze the presence of L11 in cells, L11 (His tag) was detected by Western blot. ΔL11-pBAD24 / Ec_L11 is shake-cultured in LB-Ap selective liquid medium until OD600nm is 0.5 at 37 ° C, arabinose is added, and the presence state of L11 after 0, 1, 3, 5 and hours is set to His-Probe. The analysis was performed by the Western blot used. The result is shown in FIG. 5B. The left in the figure is the result under the condition where arabinose is not added, and the right in the figure is the result of the experiment under the condition where arabinose is added.

  As a result of stationary culture, growth of the transformant was confirmed under the conditions where arabinose was present, but a significant delay was observed under the conditions where it was absent. In liquid culture, L11 protein was detected only in the presence of arabinose, but not in the absence. From these results, it was found that intracellular supplementation of L11 to restore the growth of ΔL11 strain can be controlled by arabinose induction by the araBAD promoter.

(Analysis of growth control by pTAK vector)
In order to analyze the influence of arabinose on the growth of ΔL11-pTAK, a transformant, static culture was performed in the presence and absence of arabinose. ΔL11-pTAK was shake-cultured in LB-Ap-Ara selective liquid medium at OD600nm to 0.4 at 37 ° C, and the culture was applied to LB-Ap (left) and LB-Ap-Ara (right) selective agar medium. And static culture was performed at 37 ° C. for 64 hours. A photograph of the culture results is shown in FIG. 6A.

  ΔL11-pTAK was subjected to shaking culture under different arabinose concentrations, and the doubling time was calculated from the growth curve obtained by time-lapse measurement. ΔL11-pTAK was shaken and cultured in 2 ml of LB-Ap-Ara selective liquid medium at 37 ° C until OD600nm reached 0.5, and 12.5 μl of the culture was added to 5 ml of LB-Ap-Ara (0%, 0.1% , 0.3%, 0.4%, 0.5%, 0.8%, 1.0%) was added to a liquid medium, shake-cultured at 37 ° C., and OD600 nm was measured every 10 minutes. The growth curve is shown in FIG. 6C. The doubling time was calculated from the change in OD600nm during shaking culture. The calculation result is shown in FIG. 6D.

  OD600nm was measured with Taitec OD Senser-T at an angle of 45 °, an amplitude of 50nm, 150rpm, and an interval of 10 minutes. A graph with the natural logarithm of OD600nm as the vertical axis and time as the horizontal axis is drawn as a growth curve, and doubled using the following formula from the slope of the approximate linear expression in the range where the natural logarithm of OD600nm is linear The time (Doubling Time) was calculated. For comparison, WT-pTAK obtained by transforming E. coli wild-type W3110 with a pTAK vector was subjected to the same experiment at an arabinose concentration of 0%.

Doubling Time = (ln 2 / tilt) × 60 min

  In order to analyze the presence of L11 in cells, L11 (His tag) was detected by Western blot. ΔL11-pTAK was shake-cultured in LB-Ap selective liquid medium until OD600nm was 0.5 at 37 ° C, arabinose was added, and the presence state of L11 after 0, 1, 3, 5 and hours was used with His-Probe Analyzed by Western blot. The result is shown in FIG. 6B. The left in the figure is the result under the condition where arabinose is not added, and the right in the figure is the result of the experiment under the condition where arabinose is added.

  As a result of stationary culture, growth of the transformant was confirmed under the conditions where arabinose was present, but a significant delay was observed under the conditions where it was absent. In shaking culture in a liquid medium, ΔL11-pTAK had an extremely slow doubling time of about 149 minutes when the arabinose concentration was 0%, which was about 5 times that when the wild strain was used as a host. It recovered to about 54 minutes, and it was found that it recovered to the same level as the wild type at 0.3% or more. The expression of L11 protein was observed 1 hour after the addition of arabinose and was continuously expressed for 5 hours. On the other hand, L11 was not detected in the absence of arabinose. From these results, it was found that arabinose induction of L11 by the araBAD promoter in the pTAK vector acts effectively, and the growth rate of the ΔL11 strain can be controlled by the concentration of arabinose added.

(L11 and target protein expression control by pTAK vector)
The pTAK vector contains a Glutathione S-transferase (GST) gene under the control of the Tac promoter (FIG. 3 right), and GST expression induction by IPTG is possible. In general, expression induction by IPTG is performed in the logarithmic growth phase of E. coli (OD600nm is 0.2 to 1.0). Therefore, expression control by the presence or absence of L11 arabinose in cells of ΔL11-pTAK during this culture period was analyzed. did. ΔL11-pTAK was shake-cultured in a LB-Ap-Ara (0%, 0.4%) selective liquid medium at 37 ° C., and the culture solution at each point was collected while measuring OD600 nm over time. The results are shown in the upper part of FIG. 7A. In addition, the presence of L11 was analyzed by Western blotting with His-Probe using each sample with an OD600nm equivalent to 0.04. The results are shown in the lower part of FIG. 7A.

  The influence of arabinose on IPST induction of GST and the effect of ITPG on L11 expression control were analyzed. ΔL11-pTAK was shaken in LB-Ap-Ara (0%, 0.4%) selective liquid medium until OD600nm reached 0.5 at 37 ° C, and IPTG was added to a final concentration of 1 mM. Then, after 0, 1, 2, 3, and 5 hours, 200 μl of the culture solution was collected, and SDS-PAGE was performed using each sample with an OD600nm equivalent to 0.04 to perform Coomassie staining. The results are shown in the upper part of FIG. 7B. Moreover, the presence state of L11 was analyzed by performing Western blotting with His-Probe using the same sample. The results are shown in the lower part of FIG. 7B.

  As a result of the experiment, L11 was always detected in the liquid culture in the presence of arabinose, but was not detected even in the non-existing condition. Since similar results were obtained even in the presence of IPTG, the suppression of intracellular L11 expression in the ΔL11 strain by the pTKA vector was strictly performed in the absence of arabinose, and there was no effect of IPTG. found. In addition, the expression of GST induced by IPTG is slightly lower than that in the presence of arabinose, but it was also observed in the absence of the strain, and the cells of ΔL11 strain that suppressed growth and slowed protein synthesis were observed. In particular, it was found that expression of target protein (GST) can be induced by IPTG.

(Analysis of target protein expression state)
The presence state of GST expressed in cells of wild-type Escherichia coli (WT-pTAK) transformed with ΔL11-pTAK and pTAK vector was analyzed. ΔL11-pTAK and WT-pTAK were shake-cultured in LB-Ap liquid selection medium until OD600nm reached 0.5 at 37 ° C, and IPTG was added so that the final concentration was 1 mM. The culture solution was collected. Then freeze and thaw, add lysozyme to a final concentration of 4 μg / ml, freeze and thaw again, collect a portion as a Total (T) fraction, and supernatat (S) and Precipitate (P ) Separated into fractions. SDS-PAGE was performed using each sample with an OD600nm equivalent to 0.03, and Coomassie staining was performed. The results are shown in the upper part of FIG. 8A. In addition, the detected band intensity of GST was digitized with the software ImageJ and graphed. The results are shown in the lower part of FIG. 8A.

  The state of enzyme function of luciferase expressed in cells of wild-type E. coli (WT-pTAK / Luc) transformed with ΔL11-pTAK / Luc and pTAK / Luc vectors was analyzed. ΔL11-pTAK / Luc and WT-pTAK / Luc were shake cultured in LB-Ap liquid selective medium at 37 ° C until OD600nm reached 0.5, and after collecting a part (previous), the final concentration was 1 IPTG was added so that it might become mM, and the culture solution was collect | recovered 3 hours later (after). SDS-PAGE was performed using a bacterial solution with an OD600nm equivalent to 0.03, and Coomassie staining was performed. The results are shown in the upper part of FIG. 8B. In addition, using a similar bacterial solution having an OD600nm equivalent to 0.03, it was reacted with Picker Gene (manufactured by Toyo B-Net) (registered trademark), and the photon number at that time was measured by Arvo x2 (luciferase assay). The band intensity of luciferase detected by SDS-PAGE is digitized by software ImageJ, and the photon number obtained in the luciferase assay is divided by that value to retain the enzyme function in the expressed luciferase. The ratio was calculated as luciferase activity. The relative amount was expressed as a graph when the luciferase activity of WT-pTAK / Luc was taken as 100%. The results are shown in the lower part of FIG. 8B.

  GST is a highly soluble protein. When a wild strain was used as a host, about 70% of the total expression amount was expressed as a soluble protein. When ΔL11 was used as a host, it was found that the amount that became more soluble than the wild strain (about 90% of the total expression amount) and the solubilization rate was about 20% higher. This result shows that the ΔL11-pTAK protein synthesis system is useful for solubilized expression of proteins even for highly soluble proteins. When the target protein was firefly luciferase, which is a eukaryotic protein, the enzyme activity of luciferase expressed using ΔL11 as a host was about 2.5 times higher than that of the wild type. This indicates that the ΔL11-pTAK protein synthesis system works preferentially for solubilization and functional expression of eukaryotic proteins that tend to be expressed as insoluble and inactive proteins.

  The production method according to the present invention is a method for efficiently producing a solubilized target protein without requiring a culture apparatus that maintains a low-temperature environment, and is highly likely to be compatible with various proteins, and is widely studied. It is extremely useful in that it can be used effectively in the field and contribute to the development of proteomic research.

Claims (8)

  An E. coli transformation vector into which an L11 gene expression induction system incorporating an inducible promoter capable of regulating the expression of an L11 expression gene with an inducer is introduced upstream of the L11 expression gene, and the L11 gene expression induction system A vector in which a target protein gene expression induction system in which an inducible promoter that can be regulated by an inducer different from the above inducer is incorporated upstream of the target protein expression gene may be introduced.   The vector according to claim 1, wherein the L11 gene expression induction system and the target protein gene expression induction system are introduced.   The inducible promoters introduced into the L11 gene expression induction system and the target protein gene expression induction system are different from each other, and the araBAD promoter, tac promoter, trc promoter, lac promoter, lacUV5 promoter, trp promoter, λ promoter pL and phoA The vector according to claim 1 or 2, wherein the vector is one selected from the group of promoters.   The inducible promoter introduced into the L11 gene expression induction system is an araBAD promoter, and the inducible promoter introduced into the target protein gene expression induction system is a tac promoter. Vector.   5. The vector according to claim 4, wherein the vector has a base sequence represented by SEQ ID NO: 1 in the sequence listing or a base sequence represented by a sequence in which one or more bases of the sequence are deleted, substituted or added. .   A transformant for producing a solubilized protein, which is transformed with the vector according to any one of claims 1 to 5.   A method for producing a solubilized eukaryotic protein, characterized by using the transformant according to claim 6.   The inducible promoter of the L11 gene expression induction system is araBAD promoter, the inducer is arabinose, the inducible promoter of the target protein gene expression induction system is the tac promoter, and the inducer is isopropyl-β-thiogalacto The method for producing a solubilized eukaryotic protein according to claim 7, wherein the method is pyranoside (IPTG).