JP2016146776A - Sorghum dry juice property control gene, and method for controlling liquid extract property of plant - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a gene involved in control of dry juice property of sorghum stem and to provide a method for enhancing productivity of ingredient for bioethanol by introducing juice extract property into plant using such gene.SOLUTION: According to the present invention, there is provided D gene as essential gene for control of dry juice property of sorghum stem. The sorghum strain having juice property comprises mutations in D gene, thereby function in produced protein is inhibited. Juice liquid extract property may be introduced into plant using such mutation in D gene.SELECTED DRAWING: None

Description

  The present invention relates to a sorghum dryness control gene and use thereof.

  Biofuels are fuels that use the energy of biomass and are attracting attention as non-depleting resources that can replace exhausting resources such as petroleum.

  Sorghum is attracting attention as a candidate crop that can serve as a biofuel resource. Sorghum is a large Gramineae plant that has the property of accumulating sugar in the leaf buds and stems, similar to sugar cane, and grows much faster than sugar cane. Therefore, it is expected to produce bioethanol efficiently by growing sorghum, squeezing its stem, and fermenting sugar contained in the juice.

  In order to efficiently obtain a raw material of bioethanol from sorghum, it is necessary that the sorghum has a succulent character in which the medulla of the stem is filled with a high sugar content liquid. Sorghum is a very rare crop with both succulent and dry quality traits in the same species. The trait of sorghum dryness was reported nearly 100 years ago and was known to be an allele determined by a single gene. Furthermore, it has been known that the sorghum dryness is controlled by a single gene, and the sorghum is inferior (Non-Patent Document 1: Hilson, 1916). However, the gene that controls sorghum dryness has not been identified so far. Moreover, it has not been known at all which part of the whole genome sequence is involved in the sap of the cultivar.

Hilson, G. R. (1916) On the inheritance of Certain stem characters in sorghum. Agriculture Journal of India 11: 150-155 Yonemaru Ji, Ando T, Mizubayashi T, Kasuga S, Matsumoto T, Yano M (2009) Development of Genome-wide Simple Sequence Repeat Markers Using Whole-genome Shotgun Sequences of Sorghum (Sorghum bicolor (L.) Moench) .DNA Res 16 : 187-193 Hamajima N, Saito T, Matsuo K, Kozaki K, Takahashi T, Tajima K (2000) Polymerase chain reaction with confronting two-pair primers for polymorphism genotyping.Japanese journal of cancer research: Gann 91: 865-868 Kikuchi R, Kawahigashi H, Ando T, Tonooka T, Handa H (2009) Molecular and functional characterization of PEBP genes in barley reveal the diversification of their roles in flowering.Plant physiology 149: 1341-1353 Murray MG, Thompson WF: Rapid isolation of high molecular weight plant DNA.Nucleic Acids Res 1980, 8 (19): 4321-4325. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731-2739 Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for transcriptomics.Nature Reviews 10: 57-63

  In order to contribute to bioethanol production, the problem to be solved by the present invention is to provide a gene that controls the dryness of sorghum as a raw material, and further to use this gene to have a squeezed squeezing characteristic Is to create.

  As a result of diligent research to solve the above-mentioned problems, the present inventors have found that the D gene, which is a dominant trait, is an essential gene for controlling the dryness of the sorghum stem. Wild-type D gene confers dry squeezing characteristics to sorghum varieties. On the other hand, the present inventors have found that sorghum varieties having juiciness have a recessive mutation in the D gene. Such recessive genes (hereinafter referred to as d genes) confer squeezed squeezing characteristics to sorghum varieties. It is considered that the sorghum d gene has a mutation that inhibits the expression of normal proteins and thus exhibits a succulent character.

Preferred Embodiments of the Invention The present invention preferably includes the following embodiments.
[Aspect 1]
In a plant having dry squeezing characteristics, the protein imparts dry squeezing characteristics to the plant, and the following (a) to (c):
(A) SEQ ID NO: 2 (protein consisting of the amino acid sequence of
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and imparting dry squeezing characteristics to plants, or (c) A protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to a plant,
Any of the proteins,
A method for producing a transformed plant having squeezed squeezing characteristics, characterized by inhibiting the function of
[Aspect 2]
The following (a) to (g);
(A) a nucleic acid encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2,
(B) a nucleic acid encoding a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and which imparts dry squeezing characteristics to plants,
(C) a nucleic acid that encodes a protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to plants
(D) a nucleic acid comprising the base sequence of SEQ ID NO: 1,
(E) a nucleic acid encoding a protein consisting of a base sequence in which one or more bases are deleted, substituted and / or added in SEQ ID NO: 1, and which imparts dry squeezing characteristics to plants,
(F) a nucleic acid encoding a protein comprising a base sequence having at least 83% sequence identity with the base sequence shown in SEQ ID NO: 1 and imparting dry squeezing characteristics to plants
(G) Coding a protein consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and a base sequence that hybridizes under stringent conditions and imparts dry squeezing characteristics to plants Nucleic acid to
A nucleic acid selected from the group consisting of: a function of imparting dry squeezing characteristics to the plant of the protein by introducing a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation; A method for producing a transformed plant having squeezed squeezing characteristics according to aspect 1, wherein the plant is inhibited.
[Aspect 3]
A plant having dry squeezing characteristics, which is a protein that imparts dry squeezing characteristics to the plant and inhibits the function of the proteins described in (a) to (c) of aspect 1. A method for imparting squeezed juice characteristics to plants.
[Aspect 4]
Inhibiting the function of the protein by introducing a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation in the nucleic acid described in (a) to (g) of Aspect 2 A method according to embodiment 3, characterized in.
[Aspect 5]
The plant according to any one of aspects 1 to 4, wherein the plant is a gramineous plant (preferably a plant selected from the group consisting of sorghum, corn, switchgrass, millet, brachypodium, rice, more preferably sorghum). the method of.
[Aspect 6]
The site to be mutated in SEQ ID NO: 1 is the base deletion or base substitution of base number 115 of SEQ ID NO: 1, the base deletion of base numbers 3690 to 3701, the base substitution of base number 3783, the base number Base addition between 3869 and 3870, base substitution at base number 3979, base deletion at base numbers 4012 to 4015, base substitution at base number 4069, base substitution at base number 4076, base addition between base numbers 4079 and 4080 The method according to Aspect 2 or Aspect 4, wherein the base deletion of base numbers 4086 to 4088 and the base substitution of base number 4093 are performed.
[Aspect 7]
The site to be mutated in SEQ ID NO: 2 is the amino acid substitution of amino acid number 39 of SEQ ID NO: 2, the amino acid deletion of amino acid numbers 149 to 152, the amino acid substitution of amino acid number 180, the amino acid number of 208 and 209 Amino acid addition between, amino acid deletion between amino acid numbers 256 and 257, amino acid substitution at amino acid number 278, amino acid addition between amino acid numbers 278 and 279, amino acid deletion between amino acid numbers 281 and 282, The method in any one of 1-4.
[Aspect 8]
In the nucleic acid described in (a) to (g) of aspect 2, a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation is introduced, and the function of imparting dry squeezing characteristics is lost. Furthermore, a transformed plant having squeezed juice characteristics.
[Aspect 9]
In a plant having dry squeezing characteristics, the protein imparts dry squeezing characteristics to the plant, and the following (a) to (c):
(A) a protein comprising the amino acid sequence of SEQ ID NO: 2,
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and imparting dry squeezing characteristics to plants, or (c) A protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting squeezing characteristics to a plant in a dry manner,
Any of the proteins.
[Aspect 10]
The following (a) to (g);
(A) a nucleic acid encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2,
(B) a nucleic acid encoding a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and which imparts dry squeezing characteristics to plants,
(C) a nucleic acid that encodes a protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to plants
(D) a nucleic acid comprising the base sequence of SEQ ID NO: 1,
(E) a nucleic acid encoding a protein consisting of a base sequence in which one or more bases are deleted, substituted and / or added in SEQ ID NO: 1, and which imparts dry squeezing characteristics to plants,
(F) a nucleic acid encoding a protein comprising a base sequence having at least 83% sequence identity with the base sequence shown in SEQ ID NO: 1 and imparting dry squeezing characteristics to plants
(G) Coding a protein consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and a base sequence that hybridizes under stringent conditions and imparts dry squeezing characteristics to plants Nucleic acid to
A nucleic acid selected from the group consisting of:
[Aspect 11]
A transformed plant into which the nucleic acid according to (a) to (g) of aspect 2 has been introduced and has dry squeezing characteristics.
[Aspect 12]
A method for producing a transformed plant having dry squeezing characteristics, which comprises the step of introducing the nucleic acid according to aspects 2 (a) to (g) into a plant.
[Aspect 13]
A method for imparting dry squeezing characteristics to a plant, comprising introducing the nucleic acid according to aspect 10 into the plant.
[Aspect 14]
SEQ ID NO: 1 base deletion or base substitution of SEQ ID NO: 1 in plant, base deletion of base numbers 3690 to 3701, base substitution of base number 3783, base addition between base numbers 3869 and 3870, base Base substitution of number 3979, base deletion of base numbers 4012 to 4015, base substitution of base number 4069, base substitution of base number 4076, base addition between base numbers 4079 and 4080, base deletion of base numbers 4086 to 4088 A marker for determining the dryness of a plant, comprising a base sequence represented by the base substitution of base number 4093.
[Aspect 15]
SEQ ID NO: 1 base deletion or base substitution of SEQ ID NO: 1 in plant, base deletion of base numbers 3690 to 3701, base substitution of base number 3783, base addition between base numbers 3869 and 3870, base Base substitution of number 3979, base deletion of base numbers 4012 to 4015, base substitution of base number 4069, base substitution of base number 4076, base addition between base numbers 4079 and 4080, base deletion of base numbers 4086 to 4088 Detecting a marker for determining the dryness of a plant, including examining the presence or absence of a marker containing the base sequence represented by the base substitution of base number 4093, and the detected marker contains a mutation as described above. When a part of the base sequence is not translated into protein, the plant is determined to have squeezed squeezing characteristics, and when it does not contain the mutation, the plant is determined to have dry squeezing characteristics. A method for determining the dryness of plants.

  According to the present invention, a D gene involved in the dryness of gramineous plants such as sorghum, corn, switchgrass, millet, brachypodium, and rice is provided. By manipulating the D gene, it is possible to produce varieties of gramineous plants (eg, sorghum) having excellent biomass characteristics. Furthermore, by controlling the function of this gene using a recombination technique for gramineous plants, there is a possibility that the squeezing characteristics, which are important traits for bioethanol production efficiency, can be dramatically increased. That is, by introducing a mutation that deletes the protein defined by the D gene into the wild type D gene, the plant loses its function of imparting dry squeezing characteristics, resulting in succulent trait characteristics in the plant. And a succulent transformed plant can be produced. Furthermore, the partial sequence of the D gene involved in sorghum dryness can also be used as a marker for determining the dryness of plants.

FIG. 1 is a diagram showing the middle leaves of a sorghum dry individual and a sorghum juice individual (a: dry individual, b: juice individual) and stem longitudinal section (c: dry individual, d: juice individual) . FIG. 2 is a diagram showing BAC clone selection of a genomic region containing a D gene by bulk mapping and rough mapping. FIG. 3 is a diagram showing identification of gene regions by precise mapping using markers created by comparison of BAC clones. In the range of 18.99 Kb (18990 base pairs) sandwiched between the markers CTPP-053 and InDel-120117, the only gene predicted in the database was Sobic.006G147400, and this gene was assumed to be the D gene. FIG. 4 is a diagram showing a comparison between the predicted structure of the D gene and the predicted structures of the orthologous genes of rice and maize, which are other gramineous crops. In the dry rice and corn D gene orthologs, the region predicted to be the first exon is deficient in the corresponding region of the savory cultivar BTX623 used for sorghum genome decoding, and the database has an intron. It was estimated. The RNA-Seq results in the bottom sorghum also indicate that there are essentially no defects or introns in this region. For this reason, Sobic.006G147400 of succulent variety BTX623 has lost its function as a D gene. FIG. 5 is a diagram comparing amino acid sequences encoded by the D gene in various plants. The horizontal arrow indicates the part of the mutant d gene that is an intron. The bold solid line indicates the region corresponding to the motif conserved in a group of transcription factors called the NAM superfamily. Sb is sorghum juice (variety: BTX623), Sb-func is dry sorghum (variety: Senkinshiro), Zm is maize, Si is millet, Pv is switchgrass, Os is rice, Bd is brachypodium, At Indicates Arabidopsis and Pt indicates poplar. FIG. 6 is a graph comparing the expression levels of the wild-type D gene and the mutant d gene in the leaf blades of the dry variety individuals (Senji white) and the succulent variety individuals (Na-type MS-3B). FIG. 7 is a diagram showing the expression of a wild type D gene and a mutant d gene in a dry cultivar individual (senpaku white) and a juicy cultivar individual (Na-type MS-3B) in the reproductive growth stage. Root indicates the root, Clum indicates the stem, F.Leaf indicates the leaf blade, and Panicle indicates the ear. S indicates Senpaku white and N indicates Na-kei MS-3B. FIG. 8 is a diagram showing the expression times of the wild type D gene and the mutant d gene in the vegetative growth period in the dry variety individual (Senji white) and the succulent variety individual (Na-type MS-3B). 2w represents 2 weeks after germination, and 4w represents 4 weeks after germination. Clum indicates a stem, and Leaf blade indicates a blade. S indicates Senpaku white and N indicates Na-kei MS-3B. FIG. 9 is a diagram showing the positions of primers and the like for allele analysis of the wild-type D gene and the mutant d gene. The box shows the estimated exon. The number at the top of the box indicates the length of the exon. The numbers at the bottom indicate the length of the intron. The position information of exons and primers in the figure is indicated by the number of base pairs of chromosome 6 of the sorghum genome (Sorghum bicolor v2.1 genome (Na strain MS3B). The numbers below the arrows indicate the names of the primers.

(1) About wild-type D gene and D protein In the present invention, a protein encoded by the D gene (referred to as D protein) is a factor that controls the dryness of sorghum. Sorghum variety Senpaku white has the genomic DNA sequence of the wild type D gene, this base sequence is shown as SEQ ID NO: 1, and the amino acid sequence encoded by the coding region of SEQ ID NO: 1 Shown as the amino acid sequence of SEQ ID NO: 2. In the present invention, the wild-type D gene is a gene encoding a protein that imparts a dry trait to sorghum, and it has been clarified that this trait is a dominant trait.

  On the other hand, when a mutation occurs in the D gene and the protein defined by the D gene (that is, the D protein) can no longer give dry squeezing characteristics to gramineous plants such as sorghum. The mutant gene is called d gene. In this case, as a result of becoming d gene, it has the characteristic of giving a squeezed squeezing characteristic to a plant.

  The protein (D protein) specified by the D gene of the present invention can impart dry squeezing characteristics to plants as well as a protein consisting of the amino acid sequence of SEQ ID NO: 2 (wild type D protein) The concept includes mutant proteins.

In the present invention, the following proteins (a) to (c) are referred to as proteins having characteristics that impart dry squeezing characteristics to plants (hereinafter referred to as D proteins):
(A) a protein comprising the amino acid sequence of SEQ ID NO: 2,
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and imparting dry squeezing characteristics to plants, or (c) A protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting squeezing characteristics to a plant in a dry manner,
A protein selected from the group consisting of
Is defined as any protein.

  As used herein, dry means that the sorghum or other plant does not show a water-soaked phenotype in sorghum or other plants, and succulent means that the sorghum or other plant is soaked in stem or middle plant Indicates the phenotype of. Fig. 1 shows the mid-leaf (a: dry, b: succulent) and the stem vertical section (c: dry, d: succulent) of the sorghum dry individuals.

  The D protein consisting of the amino acid sequence encoded by the D gene of the present invention is not limited to the one represented by the amino acid sequence of SEQ ID NO: 2 (the aforementioned protein (a)), Mutants thereof (the aforementioned protein (b) or protein (c)) are also included as long as they impart juice characteristics. The mutant protein having the amino acid sequence of SEQ ID NO: 2 (the aforementioned protein (b) or protein (c)) will be described in detail below.

  In the present invention, the amino acid sequence represented by SEQ ID NO: 2 is a protein comprising an amino acid sequence containing one or more amino acid deletions, substitutions and / or additions, and the amino acid sequence of SEQ ID NO: 2 Similarly, proteins having the property of imparting dry squeezing properties to plants are included as variant proteins of the amino acid sequence of SEQ ID NO: 2 (protein (b)). Here, plural means 2 to 10, preferably 2 to 9, 2 to 7, 2 to 5, and 2 to 3.

  In the present invention, the amino acid sequence of SEQ ID NO: 2 is at least 80% or more, preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. Preferably, a protein comprising an amino acid sequence having a sequence identity of 99.3% or more and having the property of imparting a dry property to a plant as well as the amino acid sequence of SEQ ID NO: 2, Included as a variant protein of the amino acid sequence of NO: 2 (protein (c)).

  In the protein (c) embodiment, the percent identity between two amino acid sequences can be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of the two protein sequences is based on the algorithm of Needleman, SB and Wunsch, CD (J. Mol. Biol., 48: 443-453, 1970), and the University of Wisconsin Genetics Computer Group (UWGCG) It can be determined by comparing the sequence information using the more available GAP computer program. Preferred default parameters for the GAP program include: (1) Scoring matrix as described in Henikoff, S. and Henikoff, JG (Proc. Natl. Acad. Sci. USA, 89: 10915-10919, 1992). Blosum62; (2) 12 gap weights; (3) 4 gap length weights; and (4) no penalty for end gaps.

  Other programs used by those skilled in the art of sequence comparison can also be used. The percent identity can be determined by comparison with sequence information using, for example, the BLAST program described in Altschul et al. (Nucl. Acids. Res., 25, p. 3389-3402, 1997). The program can be used on the Internet from the National Center for Biotechnology Information (NCBI) or the DNA Data Bank of Japan (DDBJ) website. Various conditions (parameters) for identity search using the BLAST program are described in detail on the same site, and some settings can be changed as appropriate, but the search is usually performed using default values. Alternatively, the percent identity between two amino acid sequences can be determined using a program such as genetic information processing software GENETYX Ver.7 (manufactured by Genetics) or the FASTA algorithm. In this case, the default value can be used for the search.

  The D gene of the present invention is represented by the nucleotide sequence (nucleic acid (a)) encoding a protein consisting of the nucleotide sequence of SEQ ID NO: 1 (nucleic acid (d)) or the amino acid sequence of SEQ ID NO: 2. It is not limited to, but is a concept that includes other base sequences encoding the mutant protein that imparts dry squeezing characteristics to plants. The nucleotide sequence variant of SEQ ID NO: 1 is described in detail below.

As described above, the D protein of the present invention can be defined as proteins (a) to (c). Based on these proteins, the D gene of the present invention includes the following nucleic acids (a) to (c) as corresponding to the proteins (a) to (c):
(A) a nucleic acid encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2,
(B) a nucleic acid encoding a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and which imparts dry squeezing characteristics to plants,
(C) a nucleic acid that encodes a protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to plants
Any of the nucleic acids are included.

  In the nucleic acid encoding a protein, base sequence information recorded on the nucleic acid is converted into amino acid sequence information based on well-known codon rules. Degenerate codons are generated because either the amino acid information or the stop codon information is assigned. Therefore, it is understood that even if a change between degenerate codons is included in the base sequence of the nucleic acid, it is included in the embodiments of the nucleic acids (a) to (c) of the present invention. For example, in the case of the nucleic acid (a), a nucleic acid consisting of the base sequence of SEQ ID NO: 1 exists as a nucleic acid encoding the amino acid sequence of SEQ ID NO: 2. In the case where the amino acid sequence of SEQ ID NO: 2 is to be encoded as a result even if base substitution based on the degenerate codon change described above is included, such a nucleic acid is also a nucleic acid (a) include.

  In the nucleic acids (b) and (c), regarding the proteins (b) and (c) defined by the nucleic acids, the definition of “one or more amino acids” and the definition of “sequence identity” in each embodiment are attached. As described above.

In the present invention, as mentioned above, the D gene of the present invention includes the nucleotide sequence of SEQ ID NO: 1 (nucleic acid (d)) as one embodiment, and based on this nucleic acid (d). The resulting D gene variants are also included. Therefore, the D gene of the present invention includes the following nucleic acids (d) to (g):
(D) a nucleic acid comprising the base sequence of SEQ ID NO: 1,
(E) a nucleic acid encoding a protein consisting of a base sequence in which one or more bases are deleted, substituted and / or added in SEQ ID NO: 1, and which imparts dry squeezing characteristics to plants,
(F) a nucleic acid encoding a protein comprising a base sequence having at least 83% sequence identity with the base sequence shown in SEQ ID NO: 1 and imparting dry squeezing characteristics to plants
(G) a nucleic acid encoding a protein consisting of a base sequence that hybridizes to a complementary strand of the base sequence represented by SEQ ID NO: 1 under stringent conditions and imparting dry squeezing characteristics to plants,
Any of these nucleic acids are also included. Hereinafter, variants of the nucleotide sequence of SEQ ID NO: 1 (nucleic acids (e) to (g)) will be described in detail.

  In the base sequence shown in SEQ ID NO: 1, a nucleic acid consisting of a base sequence in which one or more bases are deleted, substituted and / or added, as in the base sequence of SEQ ID NO: 1, A nucleic acid encoding a protein having a property of imparting dry squeezing characteristics to a plant is also included in the mutant of the D gene of the present invention (nucleic acid (e)). Here, plural means 2 to 10, preferably 2 to 9, 2 to 7, 2 to 5, and 2 to 3.

  Further, the base sequence of SEQ ID NO: 1 and at least 80% or more, preferably 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, more preferably 99.3 A nucleic acid consisting of a base sequence having a sequence identity of at least%, and a nucleic acid encoding a protein having the property of imparting a dry property to a plant, as in the base sequence of SEQ ID NO: 1, Included in variants of the D gene (nucleic acid (f)).

The percent identity between two nucleic acid sequences can be determined by visual inspection and mathematical calculation, or more preferably, this comparison is made by comparing the sequence information using a computer program. A typical preferred computer program is the Wisconsin package, version 10.0 program “GAP” from the Genetics Computer Group (GCG; Madison, Wis.) (Devereux, et al., 1984, Nucl. Acids Res., 12: 387). By using this “GAP” program, in addition to comparing two nucleic acid sequences, two amino acid sequences can be compared, and a nucleic acid sequence and an amino acid sequence can be compared. Here, the preferred default parameters for the “GAP” program are: (1) GCG run of unary comparison matrix for nucleotides (including values of 1 for identical and 0 for non-identical), Schwartz and Supervised by Dayhoff “Atlas of Polypeptide Sequence and Structure”, National Biomedical Research Foundation, pages 353-358, 1979, Gribskov and Burgess, Nucl. Acids Res., 14 : Weighted amino acid comparison matrix of 6745, 1986; or other comparable comparison matrix; (2) 30 penalties for each gap of amino acids and one additional penalty for each symbol in each gap; or each gap in nucleotide sequence 50 penalties and 3 additional penalties for each symbol in each gap; (3) End gap NO Penalty: No maximum penalty to and (4) a long gap, are included. Other sequence comparison programs used by those skilled in the art are available, for example, at the National Library of Medicine website: http://www.ncbi.nlm.nih.gov/blast/bl2seq/bls.html A BLASTN program, version 2.2.7, or UW-BLAST 2.0 algorithm can be used. Standard default parameter settings for UW-BLAST 2.0 are described at the following Internet site: http://blast.wustl.edu. In addition, the BLAST algorithm uses a BLOSUM62 amino acid scoring matrix and the selection parameters that can be used are: (A) a segment of query sequence with low composition complexity (Wootton and Federhen's SEG program (Computers and Chemistry, 1993); Wootton and Federhen, 1996 “Analysis of compositionally biased regions in sequence databases” Methods Enzymol., 266: 544-71) Or include a filter to mask segments consisting of short-periodic internal repeats (determined by the XNU program in Claverie and States (Computers and Chemistry, 1993)), and (B) match against database sequences Statistical significance threshold for reporting, or E-score (Karlin and Altschul, 1 990), the expected probability of a match found by chance; if the statistical significance due to a match is greater than the E-score threshold, this match is not reported); the preferred E-score The numerical value of the threshold is 0.5, or in order of increasing preference, 0.25, 0.1, 0.05, 0.01, 0.001, 0.0001, 10 ^-5 , 10 ^-10 , 10 ^-15 , 10 ^-20 , 10 ^-25 , 10 ^-30 , 10 ^-40 , 10 ^-50 , 10 ^-75 , or 10 ^-100 .

  Further, a nucleic acid comprising a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1 and a base sequence that hybridizes under stringent conditions, wherein the base sequence of SEQ ID NO: 1 Similarly, a nucleic acid encoding a protein having a property of imparting dry squeezing characteristics to a plant is also included in the mutant of the D gene of the present invention (nucleic acid (g)).

  Here, “under stringent conditions” means to hybridize under moderately or highly stringent conditions. Specifically, moderately stringent conditions can be easily determined by those skilled in the art based on, for example, the length of DNA. Basic conditions are shown in Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd edition, Chapter 6, Cold Spring Harbor Laboratory Press, 2001. For example, 5 × SSC, 0.5% SDS, 1.0 mM EDTA (pH 8. 0) pre-wash solution, about 50% formamide at about 42 ° C., 2 × SSC to 6 × SSC, preferably 5 × SSC to 6 × SSC, 0.5% SDS (or about 50% formamide at about 42 ° C. In other similar hybridization solutions such as Stark solution) and the use of washing conditions of, for example, about 50 ° C. to 68 ° C., 0.1 × SSC to 6 × SSC, 0.1% SDS. Preferably, moderately stringent conditions include hybridization conditions (and wash conditions) at about 50 ° C., 6 × SSC, 0.5% SDS.

High stringency conditions can also be readily determined by one skilled in the art based on, for example, the length of the DNA. In general, these conditions include hybridization at higher temperatures and / or lower salt concentrations than moderately stringent conditions (eg, containing about 0.5% SDS, about 65 ° C., 6 × SSC to 0.2 × SSC, Preferably 6 × SSC, more preferably 2 × SSC, more preferably 0.2 × SSC, or 0.1 × SSC hybridization) and / or washing, eg, hybridization conditions as described above, and approximately 65 ° C. to 68 ° C. C, 0.2 x SSC to 0.1 x SSC, defined with 0.1% SDS wash. In hybridization and washing buffers, SSC (1 × SSC is 0.15 M NaCl and 15 mM sodium citrate) to SSPE (1 × SSPE is 0.15 M NaCl, 10 mM NaH ₂ PO ₄ , and 1.25 mM EDTA, pH 7.4) can be substituted, and washing is performed for 15 minutes to 1 hour after hybridization is completed.

  It was revealed that the D gene of the present invention described in this section encodes a protein having the property of imparting dry squeezing characteristics to plants (ie, D protein). On the other hand, by inhibiting the function of the D protein that imparts dry squeezing characteristics to plants, the function of imparting dry squeezing characteristics to plants is inhibited, resulting in squeezing juices to plants. It was shown that characteristics can be imparted. The details of the means for inhibiting the function of such D protein will be described later. As an example, in the nucleic acid encoding the D gene of the present invention, a group consisting of a stop codon mutation, a frameshift mutation, and a null mutation. By introducing the mutation selected from the above, the function of imparting dry squeezing characteristics can be lost, and as a result, squeezing squeezing characteristics can be imparted to plants. Such a mutant of the D gene that loses the function inherent to the D protein is hereinafter referred to as a d gene. As a result of analysis, this d gene was found to show a recessive character. The definition of plant sap, stop codon mutation, frameshift mutation, and null mutation is described in the section “About the d gene” in (2) below.

(2) About d gene
The d gene is a gene in which a mutation is introduced into the D gene described in the above (1), and as a result, the plant has a characteristic of squeezed juice characteristics. It has been clarified that this d gene exhibits a dry squeezing characteristic when present in a heterogeneous manner in plant cells, whereas it exhibits a squeezed squeezing characteristic only when present in a homozygote. From this, it was clarified that the d gene is a recessive trait gene and a function-deficient mutant of the D gene.

  Examples of the loss-of-function mutation as described above include, for example, a mutation selected from the group consisting of a stop codon mutation, a frame shift mutation, and a null mutation, which occurred in the open reading frame of the D gene. However, the present invention is not limited thereto, and includes various mutations as long as the plant has a trait of squeezing characteristics as a result of the mutation. In plants having a d gene in which such a mutation has been introduced into the D gene represented by the nucleotide sequence of SEQ ID NO: 1 in the sequence listing, expression of the d gene inhibits the function of the protein based on the D gene. It is characterized by being. And the plant in which the function of the protein based on D gene produced by d gene was inhibited has squeezed juice characteristics. Therefore, as described in the following (3) and (4), by introducing such a mutation into the D gene, the plant has juicing characteristics as a result.

  In the present specification, “the function of a protein based on the D gene is inhibited” means that the mutation of the D gene causes a loss of function or normal expression of the protein encoded by the D gene. It means you can't.

  As used herein, the term “stop codon mutation” refers to a base sequence in which the amino acid codon at the inserted site is a stop codon when one or several bases are inserted into the DNA defining the gene. Meaning mutation.

  In this specification, “frame shift” means that the reading frame (reading frame) of a triplet is shifted as a result of insertion or deletion of one or several (not a multiple of 3) bases in DNA. As a result, it means a mutation in the base sequence such that an amino acid sequence different from that of the wild type is specified or a stop codon is inserted after the place where the insertion or deletion occurs.

  As used herein, the term “null mutation” means a mutation in a base sequence that prevents a functional gene expression product from being produced, for example, the entire amino acid sequence is not expressed due to deletion or base substitution.

(3) Sequence analysis of D gene and d gene As described in detail in the examples below, mapping is performed for the D gene ortholog of the dry cultivar Senpaku white and the D system ortholog of the nasty MS3B sap cultivar, D gene candidate regions were narrowed down. The candidate region was narrowed down to 18.99 kb, and the nucleotide sequence of the region was searched from the publicly available sorghum database (all varieties of BTX623). This region in the entire nucleotide sequence of BTX623 contains Sorbic. Only the 006G147400 gene was present. Thus, it was found that the Sorbic.006G147400 gene is a dryness control gene of the succulent variety BTX623.

  The genomic DNA sequence of Sorbic.006G147400 gene is shown in SEQ ID NO: 3. Since BTX623 is a savory variety, the Sorbic.006G147400 gene is a mutant gene having a mutation. The amino acid sequence encoded by the coding region of SEQ ID NO: 3 is shown in the amino acid sequence of SEQ ID NO: 4 (this mutant gene is referred to as d gene).

  The base sequence of SEQ ID NO: 3 contains 4 exons. In SEQ ID NO: 3, base number 1 to base number 93 is the first exon, base number 133 to base number 169 is the second exon, base number 1547 to base number 1812 is the third exon, base Number 1960 to base number 2436 are the fourth exon.

  When these wild-type genes were analyzed for these mutant genes, the corresponding genes were found in the dry cultivar Senpaku white. As a result of the sequence analysis, the nucleotide sequence of SEQ ID NO: 1 A wild type gene (referred to as the D gene) identified by the amino acid sequence of SEQ ID NO: 2 encoded by its nucleotide sequence was obtained.

  The base sequence of SEQ ID NO: 1 contains 3 exons. In SEQ ID NO: 1, base numbers 1 to 169 are first exons, base numbers 1573 to 1838 are second exons, and base numbers 3680 to 4156 are third exons.

  The present inventors analyzed the relationship between dry phenotype and genotype in existing sorghum varieties. Analysis of orthologous genes in other succulent varieties revealed that the same gene was mutated. Based on the four exons of the Sorbic.006G147400 gene described above, these mutations are classified into the following (A) to (F). That is, these mutations are: (A) the first, second and third exons incapable of amplifying the first, second and third exons, (B) the first and second exons incapable of amplifying the first and second exons, (C 3) exon 3 in which the 3rd exon cannot be amplified, (D) 4th exon 12 bp in which the 12 bp of the 4th exon is missing, (E) stop codon mutation in the 1st and 2nd exons 1st and 2nd exon stop codon type, (F) type that shows succulent traits but no mutation in exon (see Table 1).

  They are examples of D gene mutations found in existing or natural varieties and are a preferred embodiment of the present invention. However, the D gene of the present invention is not limited to those existing in those existing or natural varieties, and those derived from transformed plants that have been bred so as to mimic such mutations also include the D gene of the present invention. include.

(4) Method for producing a transformed plant having squeezed squeezing characteristics The present invention relates to a wild-type protein encoded by a nucleic acid that imparts dry squeezing characteristics in a plant having dry squeezing characteristics (ie, D This is a method for producing a transformed plant having squeezed squeezing characteristics, characterized by inhibiting the function of a protein encoded by a gene.

  For transformation of sorghum, particle gun method (Kashio, National Institute of Agrobiological Sciences, 1999, No. 13, p68-70) and Agrobacterium method (Gurel et al. 2009, Plant Cell Reports, 28, 429) Can be used. For transformation of sorghum, corn, and rice, those skilled in the art can obtain transformants using known methods (Toyi Tabei, Transformation Protocol (Plant), Chemical Dojin).

  More specifically, a mutation is introduced into the D gene represented by the nucleotide sequence of SEQ ID NO: 1 in the sequence listing to inhibit the function of the wild-type protein encoded by the D gene as the d gene that is a mutant gene. By this, it is the method of producing the transformed plant which has a squeeze squeezing characteristic.

  The mutation is not limited, but is preferably a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation.

  More preferably, the mutation is based on the four exons of the mutant d gene compared to the three exons of the wild-type D gene, and (A) the first, second, third exons that cannot be amplified. 3 exon deficient type, (B) 1st and 2nd exon deficient type in which 1st and 2nd exons cannot be amplified, (C) 3rd exon deficient type in which 3rd exon cannot be amplified, (D) 12 bp of 4th exon 4th exon with 12 bp deficiency, (E) 1st and 2nd exon stop codon with 1st and 2nd exons, (F) Mutation to exon with succulent traits Is a mutation selected from the group consisting of:

  The plant used here is preferably selected from the group consisting of sorghum, corn, switchgrass, millet, brachypodium, rice, but is not limited thereto.

  An example of a method for introducing the above mutation into the D gene is a site-specific mutagenesis method. The site-specific mutagenesis method is a gene mutation introducing means generally used in this technical field, and kits and the like for use therein are commercially available. Furthermore, it is also conceivable to induce a mutation by irradiating plant cells with radiation, and select those in which the desired mutation has occurred. However, the method for introducing a mutation in the present invention is not limited to these methods.

(5) Method for imparting squeezed squeezing characteristics to a plant The present invention relates to a protein encoded by a nucleic acid that imparts dry squeezing characteristics in a plant having dry squeezing characteristics (ie, a protein encoded by a D gene). Is a method for imparting squeezed juice characteristics to plants. More specifically, by introducing mutation into the D gene shown in SEQ ID NO: 1 in the sequence listing, the function of the protein encoded by the D gene is inhibited, thereby imparting squeezed juice characteristics to the plant. It is a method to do.

  The mutation is preferably a mutation selected from the group consisting of, but not limited to, a stop codon mutation, a frameshift mutation, and a null mutation.

  More preferably, the mutation is based on the four exons of the mutant d gene compared to the three exons of the wild-type D gene, and (A) the first, second, third exons that cannot be amplified. 3 exon deficient types, (B) 1st and 2nd exon deficient types that cannot amplify 1st and 2nd exons, (C) 3rd exon deficient type that can not amplify 3rd exons, (D) 12 bp of 4th exon is deficient 4th exon 12 bp deficient type, (E) 1st and 2nd exon stop codon type in which 1st and 2nd exons are mutated, (F) succulent traits but exon is found to be mutated A mutation selected from the group consisting of:

  The plant used here is not limited thereto, but is preferably selected from the group consisting of sorghum, corn, switchgrass, millet, brachypodium, and rice. As the means for introducing the mutation, those described in (4) above can be used.

(6) Markers for judging the dryness of plants
SEQ ID NO: 1, base deletion or substitution at base number 115, base deletion at base numbers 3690 to 3701, base substitution at base number 3783, base addition between base numbers 3869 and 3870, base at base number 3979 Substitution, base deletion of base numbers 4012 to 4015, base replacement of base number 4069, base replacement of base number 4076, base addition between base numbers 4079 and 4080, base deletion of base numbers 4086 to 4088, base number 4093 A part of the base sequence of the D gene of the present invention comprising the base sequence of the base substitution is useful as a marker for judging the dryness of plants. That is, the present invention includes a base deletion or base substitution at base number 115 of SEQ ID NO: 1, a base deletion at base numbers 3690 to 3701, a base substitution at base number 3783, a base addition between base numbers 3869 and 3870, Base substitution of base number 3979, base deletion of base numbers 4012 to 4015, base substitution of base number 4069, base substitution of base number 4076, base addition between base numbers 4079 and 4080, base lack of base numbers 4086 to 4088 This is a marker for determining the dryness of a plant, including the base sequence of the base substitution of base number 4093.

  The DNA marker of the present invention used for such a purpose preferably comprises 15 to 100 bases of the base sequence represented by SEQ ID NO: 1 in the sequence listing, more preferably 20 to 20 of the base sequence. It contains 80 bases, and more preferably contains 30 to 50 bases of the base sequence. In addition, amino acid sequences encoded by these DNA markers can also be used as peptide markers. However, the dryness marker of the present invention is not limited thereto.

  Specific examples of the genetic marker include, but are not limited to, an Indel marker using a difference in length of base sequences and a marker using SNP. Indel markers include SSR markers that make use of differences in the length of repeat sequences, markers that make use of detection of 3 bp deletions, and the like. On the other hand, markers using SNP include CAPS markers, dCAPS markers, allele specific markers for detecting mutations in introns, and the like.

  As a more specific gene marker, a primer (SEQ ID NO: 5 to 22) for amplifying a region which is a gene marker used for mapping of Sorbic.006G147400 gene in the following examples, or prepared in the following examples These regions can be used as suitable markers by using primers (SEQ ID NO: 23-38) for amplifying regions that are SNP markers or Indel markers. Markers other than those listed above can also be produced by using polymorphisms detected between dry and succulent varieties in the sequence around the Sorbic.006G147400 gene, but if it is used for breeding, Sorbic. It is desirable to set a marker within several Mb around the 006G147400 gene. In the case of a marker based on PCR, 18-27 bp per primer is common (initial setting value of Primer 3 in the reference). In addition, when a gene related to an agricultural trait is revealed in the immediate vicinity of the Sorbic.006G147400 gene, it is necessary to break the linkage with that gene, so it is compared with the Sorbic.006G147400 gene among the markers listed above. It is effective to select the one in the close area.

(7) Method for determining the dryness of a plant The dryness of a plant can be determined using the marker described in (6) above. That is, the present invention includes examining the presence or absence of the nucleic acid marker or peptide marker described in (6) above in a plant, detecting the marker, and detecting the marker as a part of the base sequence by including a mutation. If the plant is not translated into protein, the plant is determined to have squeezed squeezing characteristics, and if it does not contain the mutation, the plant is determined to have a squeezing squeezing characteristic. This is a method of determining. Such a method seems to be of great use in the selection and breeding of varieties with excellent squeezing characteristics.

  EXAMPLES Hereinafter, the present invention will be specifically described by way of examples, but these are not intended to limit the technical scope of the present invention. Those skilled in the art can easily modify and change the present invention based on the description of the present specification, and these are included in the technical scope of the present invention.

Example 1: Mapping of sorghum dryness control gene D by high-precision linkage analysis In this example, in order to determine the locus position of gene D that controls dryness on the sorghum genome, Bulk mapping and rough mapping were performed using "Nakei MS3B" and dry cultivar "Senji Haku".

Specifically, by crossing那系MS3B and thousand pounds white to obtain an F ₂ population. From about 200 F ₂ populations, 54 individuals showing succulent traits were selected by the above-described determination method by sorghum stem cutting. The sorghum traits of sorghum can be distinguished to some extent by the color of the mid-leaf, and it is used as a simple selection method at the breeding site. By using this determination method for confirming that it is, it is possible to more accurately determine whether it is a juice character or a dry character. Adoption of this determination method by cutting led to the identification of the D gene and d gene that had not been identified for nearly 100 years, as will be described later.

Bulk mapping using a plurality of markers (Non-patent Document 2) was performed on 54 individuals that became clear to show succulent traits by the above discrimination method. About 10 pairs chromosome of sorghum, for each individual showing out juice traits of F ₂ population, each marker genotype of juice of sorghum那系MS3B in (non-patent document 2), the dry sorghum thousand loaf white genotype It was judged which was. In addition, we narrowed down the region that shows the genotype of nasty MS3B in common. By this method, the region of the rough succulent trait locus was narrowed down.

Subsequently, rough mapping using about 1000 F ₂ populations was performed. By a marker so that 6-7 pieces produced and selected in each chromosome using a F ₂ population all individuals investigates the area which is common to dry juice resistance trait那系MS3B genotype, gene of interest The candidate area was further narrowed. Specifically, we used sorghum's Simple Sequence Repeat (SSR) marker and polymorphism information in the gene to investigate genomic regions where the genotypes of Naseki MS3B and Senpaku white match the dry phenotype. A gene marker (Non-patent Document 2) was prepared. Their sequences are shown in SEQ ID NOs: 5-22. As a result, as a result of mapping using these markers, the candidate region of the D gene was narrowed down to 185 kb sandwiched between SB25453_re1 and SB25460 (FIG. 2).

The method used for mapping is shown below. DNA was extracted from sap cultivar Na MS MS3B and dry cultivar Senpaku white, or these F ₂ populations, respectively. DNA extraction was performed using the CTAB method (Murray et al. 1980) using leaf pieces. SSR markers and gene markers are amplified by electrophoresis using 3% agarose gel after amplification according to the PCR conditions in Table 1 using KAPA Taq (Nippon Genetics) and Go-Taq (Promega). The type was detected.

  A BAC library of dry varieties Senpaku white and succulent varieties MS3B was constructed. Specifically, a method was used in which nuclei were extracted from adult sorghum leaves and seedlings, digested with the restriction enzyme HindIII, then bound to a BAC vector (pIndigo BAC5) and introduced into Escherichia coli DH10B. As a result, it was possible to construct a library having an average insert length of 175 kb (total 47473 clones) for Senpaku White and an average insert length of 191 kb (total 45095 clones) for Na-type MS3B. This library exhibited 10.3 and 10.8 fold, respectively, assuming a sorghum genome size of 800 Mb.

BAC clones containing candidate gene regions were prepared from the respective BAC libraries, and the markers shown in FIG. 2 (SB24653, Sb6g022620, Sb06g022670, Sb06g022730, SB25460) were prepared in the region narrowed down to 185 kb. Primer sequences for detecting the sequences of these markers are shown in SEQ ID NOs: 5-22. Using these markers, 2 clones (Senkinnshiro_0085105, Senkinshiro_0113N08) from the Baku library of Senpaku white and 1 clone (Nakei-MS3B_0049G23) from the BAC library of Nakei MS3B were selected (Fig. 2). The base sequence was determined. SNP (CTPP method, non-patent document 3) marker and Indel marker were prepared from the nucleotide sequence information. Primer sequences for detecting these marker sequences are shown in SEQ ID NOs: 23-38. Thereby further using agarose electrophoresis and fragments analysis (Non-Patent Document 2) detecting the polymorphism, by precision mapping consisting F ₂ population 1925 individuals sandwiched candidate region CTPP-053 and Indel-120117-1 We narrowed it down to the 18.99 kb region (Figure 3). The nucleotide sequence of this region is shown in the public sorghum genome database (all varieties of BTX623) (Phytozome: Joint Genome Institute, University of California Regents: Sbicolor_v2.1, http: //www.phytozome. net / sorghum.php) BLAST search (http://www.phytozome.net/search.php?show=blast), it was estimated that only Sobic.006G147400 gene exists in this region (Figure 3). From this result, it was predicted that Sobic.006G147400 is a gene that controls dryness. The Sobic.006G147400 gene is a d gene that is recessive because it is derived from BTX623, a succulent variety. In the following, the wild type gene of the d gene is referred to as the D gene.

Example 2: Sequence database containing sequence information of whole-genome sequence decoded plants (Arabidopsis, millet, rice, switchgrass, sorghum, maize, brachypodium, poplar) for other plant species genes corresponding to D gene candidate genes From the Joint Genome Institute, University of California Regents: http://www.phytozome.net/search.php?show=blast) BLAST gene with high homology with the amino acid sequence of the sorghum D gene (e-value 50 or less) Extracted by. Based on the amino acid sequence information of the extracted gene group, alignment was performed using Clustalw (Non-patent Document 6), and a molecular phylogenetic tree was created by Mega5 (Non-patent Document 7) based on the obtained information. As a result, the sorghum D gene was presumed to be a gene encoding a transcription factor classified into the NAC superfamily that exists in large numbers on the genome (FIG. 5). In the clade (branching group) on the phylogenetic tree where the D gene exists, there are few similar genes found in dicotyledonous plants such as Arabidopsis and poplar, and the gene with the function corresponding to the D gene is specific to the monocotyledonous plant It was suggested that it may be a gene that exists in the field. The order of similarity of the equivalent genes of each plant species that is considered to be an ortholog (homologous molecular species) with high similarity to the sorghum D gene is as follows: Corn, 2. Awa, 3． Switch glass, 4. Rice and brachypodium, 5. It became Arabidopsis and poplar. This tended to be consistent with the closeness of each plant. The NAC superfamily motif corresponded to amino acids 1-180 in the amino acid sequence of the sorghum D gene (FIG. 5).

(Genetic structure of other plant genes corresponding to the D gene)
In the publicly available sorghum genome sequence information (juice varieties: BTX623), Sobic.006G147400 is presumed to have a gene structure with four exons (Sbicolor_v2.1, http://www.phytozome.net) /sorghum.php). On the other hand, orthologs of rice (LOC_Os04g43560.1) and corn ortholog (GRMZM2G081930_T01), which are the same gramineous crops, showed a structure consisting of three exons (Fig. 4). Here, an RNA fragment was also observed between the first exon and the second exon of Sobic.006G147400 from the results of RNA-Seq analysis (Non-patent Document 8) based on the sorghum genome database. RNA-Seq here is the estimated information of transcripts published in the sorghum database.

  The amino acid sequence of the sobic.006G147400 gene of sorghum sorghum variety BTX623, the amino acid sequence of the sobic.006G147400 gene of sushi sorghum variety Nakei MS3B and the D gene of dry sorghum variety Senpaku white, and Arabidopsis, which is a similar gene of other plants, As a result of comparison with amino acid sequences of millet, rice, switchgrass, sorghum, corn, brachypodium, and poplar, the estimated intron region of this sorghum sorghum variety BTX623 is found in any plant that does not have succulent traits The region was originally transcribed and translated into amino acids (Figure 4). In addition, about 180 amino acid residues at the 1st to 180th positions including the putative intron region of BTX623 are expected to be NAM superfamily motifs, and are considered to be regions where the amino acid sequence is conserved among plants. Nasal MS3B and BTX623, which are succulent varieties, have a stop codon due to the replacement of cytosine at position 115 from the start codon with thymine (Figure 5, Table 2 below), resulting in a protein that has lost its function. There is a high possibility.

Example 3: Primer set (SEQ ID NO: 47 (TCCCACAGGGATGGACTGGCTGA) (Sobic.006G147400-3'endF) that obtains sequence information of Sobic.006G147400 from gene expression sorghum genome information and amplifies 497 bp on the 3'-UTR side ) And SEQ ID NO: 48 (TGGATTGGAGAGGTGCACTCTTA) (Sobic.006G147400-3′UTRR)), and gene expression was analyzed by RT-PCR. RT-PCR was performed according to the method of Non-Patent Document 4. Specifically, for the sample, mix the plant pieces sampled from 3 individuals of Senpaku White into 1 sample, separately mix the plant pieces sampled from 3 individuals of MS3B and extract RNA from each did. The RNA quantification utilized the average of three measurements of the same sample to eliminate mechanical errors. As a result, transcripts of candidate gene D genes were observed 2 weeks after germination and expressed unchanged 4 weeks after germination in both dry cultivar Senpaku white and juicy cultivar MS3B (Figure 6).

  Moreover, as a result of investigating the expression for each organ of the plant, gene expression was detected in all the organs examined (leaf blade, stem, ear and root) (FIG. 7). From these results, it has been clarified that the candidate gene is not changed at the gene expression level regardless of the sequence variation and is expressed in many parts of the plant body.

  On the other hand, as a result of investigating the expression of candidate genes by dividing the expression site in the leaf blades into middle and other sites, the expression level of the candidate gene in the middle site may be more than 10 times that of other sites It became clear (Fig. 8). This result is consistent with the result that a dry trait is strongly observed in the midrib area.

  Furthermore, as a result of investigating the expression of rice orthologue of D gene using gene expression time and region database in rice root by laser microdissection etc., rice orthologue of D gene is strongly expressed in growing season and cortex (RiceXpro database; http://ricexpro.dna.affrc.go.jp/RXP_4001/index.php) This was consistent with the time and area in which the sorghum phenotype appeared. Since the D gene was predicted to be a NAC transcription factor gene having a NAM superfamily domain from the sequence, it was presumed to be involved in cell differentiation in the vascular bundle (Fig. 5).

Example 4: Allele analysis of putative D genes In order to clarify the relationship between the sequences of candidate genes and phenotypes, we investigated the sequence of candidate genes of 57 varieties of dry varieties and 38 varieties of sucrose collected from the world (Table). 2).

  The putative D gene genomic region of Senpaku white, a dry sorghum variety, is composed of three exons (SEQ ID NO: 1). On the other hand, the genomic region of the putative d gene (Sorbic.006G147400 gene) derived from BTX623, a succulent variety, is composed of four exons (SEQ ID NO: 3).

Each exon in the genomic region of the putative d gene, which is this mutant gene, can be analyzed using primers having the following sequences:
・ Exon1 and Exon2 sequence analysis primers:
SEQ ID NO: 39 (GCCCGCCTCTCCTGCAGGCTTCC) (79_sorchr6_250-s); and
SEQ ID NO: 40 (TGGGAGATG (G) GAGATAAGAAAC) (107_sorchr6_232-as);
Exon3 sequence analysis primer:
SEQ ID NO: 41 (GCATGTCAGACGCGGCGAAGCTG) (269_sorchr6_1564-s); and
SEQ ID NO: 42 (GGTACGGTACCTTTGGTGGCGT) (270_sorchr6_1827-as);
・ Exon4 sequence analysis primer
SEQ ID NO: 43 (GTTCCAGAAGCGGAAAGACAGCGA) (83_sorchr6_2560-s); and
SEQ ID NO: 44 (GTAATCTAACCTCACGCTAAGTACC) (28_sorchr6_3180-as);
・ Exon4 sequence analysis primer
SEQ ID NO: 45 (GCGTGCAGGAGGACTGGGTGCT 271_sorchr6_3671-s
SEQ ID NO: 46 (AGTCCATCCCTGTGGGAACCC) 272_sorchr6_4130-as;

Furthermore, as a marker for identifying base substitution (C / T) at the 115th base in the base sequence of exon 1 + 2,
(I) By performing PCR using a primer set (SEQ ID NO: 49 (CCAACGAGCGCGCCGAGT) and SEQ ID NO: 50 (TGCACACAACAACCATGAGCAGGA)) that amplifies the nasty MS3B type allele (T), the nasty MS3B type allele ( Amplification of the region containing T), a 198 bp PCR product is amplified;
(Ii) On the other hand, by carrying out PCR using a primer set (SEQ ID NO: 51 (CAACGAGCGCGCCGAGCA) and SEQ ID NO: 52 (ACCGGCCGAGCTAGTACTAATGA)) that amplifies a thousand white type allele (C), The region containing C) can be amplified, and a PCR product with a length of 394 bp is amplified.

  Actually, PCR is performed individually on the sample to be investigated using the above two primer sets. If the sample genotype is T / T, (i) 198 bp long PCR product band only (C) and (ii) 394 bp long PCR product band only In the case of C / T (hetero), both a band of the PCR product of (i) 198 bp and the PCR product of (ii) 394 bp are detected. PCR conditions are as shown in Table 1, but detection is relatively robust even if conditions other than the annealing temperature of 55 ° C are changed.

  As a result, all of the 57 dry varieties showed the same sequence as the dry cultivar Senpaku white (only representative information on Senpaku white is listed in Table 2). The first, second and third exon-deficient types are 18 varieties (allyl type A), the first and second exon-deficient types are one (allyl type B), and the third exon-deficient type is one. (Allyl type C), 4th exon 12 bp deficient type is classified into 3 varieties (Allyl type D), 1st and 2nd exon stop codon type found in Nakei MS3B, BTX623 is classified into 12 varieties (Allyl type E) It was. In addition, there were 3 dry exon varieties (allyl type F) that showed succulent traits but had no mutation in the exons. From allele types A to E, it was estimated that the D gene was deficient in function. Although allyl type F is unknown, it was presumed that the gene was not expressed for some reason. Therefore, if it can be detected that the sequences are allyl types A to E, it can be said that the juice phenotype is obtained.

Sequence listing free text:
SEQ ID NO: 1: Base sequence of genomic DNA of Senpaku white D gene
SEQ ID NO: 2 ： Amino acid sequence encoded by Senpaku white D gene
SEQ ID NO: 3: The base sequence of Sobic.006G147400 genomic DNA
SEQ ID NO: 4: Amino acid sequence of Sobic.006G147400
SEQ ID NO: 5: Forward Primer for amplifying SB25430 region.
SEQ ID NO: 6: Reverse Primer for amplifying SB25430 region.
SEQ ID NO: 7: Forward Primer for amplifying SB25434 region.
SEQ ID NO: 8: Reverse Primer for amplifying SB25434 region.
SEQ ID NO: 9: Forward Primer for amplifying SB25442 region.
SEQ ID NO: 10: Reverse Primer for amplifying SB25442 region.
SEQ ID NO: 11: Forward Primer for amplifying SB25446 region.
SEQ ID NO: 12: Reverse Primer for amplifying SB25446 region.
SEQ ID NO: 13: Forward Primer for amplifying SB25453_re1 region.
SEQ ID NO: 14: Reverse Primer for amplifying SB25453_re1 region.
SEQ ID NO: 15: Forward Primer for amplifying Sb06g022620 region.
SEQ ID NO: 16: Reverse Primer for amplifying Sb06g022620 region.
SEQ ID NO: 17: Forward Primer for amplifying Sb062022670 region.
SEQ ID NO: 18: Reverse Primer for amplifying Sb062022670 region.
SEQ ID NO: 19: Forward Primer for amplifying Sb06g022730 region.
SEQ ID NO: 20: Reverse Primer for amplifying Sb06g022730 region.
SEQ ID NO: 21: Forward Primer for amplifying SB25460 region.
SEQ ID NO: 22: Reverse Primer for amplifying SB25460 region.
SEQ ID NO: 23: Forward Primer for amplifying InDel-053 region.
SEQ ID NO: 24: Reverse Primer for amplifying InDel-053 region.
SEQ ID NO: 25: Forward Primer for amplifying CTPP-053 (Nakei MS3B) region.
SEQ ID NO: 26: Reverse Primer for amplifying CTPP-053 (Nakei MS3B) region.
SEQ ID NO: 27: Forward Primer for amplifying CTPP-053 (Senkinshiro) region.
SEQ ID NO: 28: Reverse Primer for amplifying CTPP-053 (Senkinshiro) region.
SEQ ID NO: 29: Forward Primer for amplifying InDel-120117-2 region.
SEQ ID NO: 30: Reverse Primer for amplifying InDel-120117-2 region.
SEQ ID NO: 31: Forward Primer for amplifying CTPP-007 (Nakei MS3B) region.
SEQ ID NO: 32: Reverse Primer for amplifying CTPP-007 (Nakei MS3B) region.
SEQ ID NO: 33: Forward Primer for amplifying CTPP-007 (Senkinshiro) region.
SEQ ID NO: 34: Reverse Primer for amplifying CTPP-007 (Senkinshiro) region.
SEQ ID NO: 35: Forward Primer for amplifying InDel-120117-1 region.
SEQ ID NO: 36: Reverse Primer for amplifying InDel-120117-1 region.
SEQ ID NO: 37: Forward Primer for amplifying InDel-089 region.
SEQ ID NO: 38: Reverse Primer for amplifying InDel-089 region.
SEQ ID NO: 39: Primer for analyzing Exon1 and Exon 2 (79_sorchr6_250-s).
SEQ ID NO: 40: Primer for analyzing Exon1 and Exon 2 (107_sorchr6_232-as).
SEQ ID NO: 41: Primer for analyzing Exon3 (269_sorchr6_1564-s).
SEQ ID NO: 42: Primer for analyzing Exon3 (270_sorchr6_1827-as).
SEQ ID NO: 43: Primer for analyzing Exon4 (83_sorchr6_2560-s).
SEQ ID NO: 44: Primer for analyzing Exon4 (28_sorchr6_3180-as).
SEQ ID NO: 45: Primer for analyzing Exon4 (271_sorchr6_3671-s).
SEQ ID NO: 46: Primer for analyzing Exon4 (272_sorchr6_4130-as).
SEQ ID NO: 47: Primer for RT-PCR (Sobic.006G147400-3'endF)
SEQ ID NO: 48: Primer for RT-PCR (Sobic.006G147400-3'UTRR)
SEQ ID NO: 49: Forward Primer for identifying MS3B Exon1 + 2_115SNP (MS3B_Exon1 & 2_115-F).
SEQ ID NO: 50: Reverse Primer for identifying MS3B Exon1 + 2_115SNP (MS3B_Exon1 & 2_115-R).
SEQ ID NO: 51: Forward Primer for identifying Senkin Exon1 + 2_115SNP (Senkin_Exon1 & 2_115-F).
SEQ ID NO: 52: Reverse Primer for identifying Senkin Exon1 + 2_115SNP (Senkin_Exon1 & 2_115-R).

Claims (15)

In a plant having dry squeezing characteristics, the protein imparts dry squeezing characteristics to the plant, and the following (a) to (c):
(A) a protein comprising the amino acid sequence of SEQ ID NO: 2,
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and imparting dry squeezing characteristics to plants, or (c) A protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to a plant,
Any of the proteins,
A method for producing a transformed plant having squeezed squeezing characteristics, characterized by inhibiting the function of The following (a) to (g);
(A) a nucleic acid encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2,
(B) a nucleic acid encoding a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and which imparts dry squeezing characteristics to plants,
(C) a nucleic acid that encodes a protein comprising an amino acid sequence having at least 75 % sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to plants,
(D) a nucleic acid comprising the base sequence of SEQ ID NO: 1,
(E) a nucleic acid encoding a protein consisting of a base sequence in which one or more bases are deleted, substituted and / or added in SEQ ID NO: 1, and which imparts dry squeezing characteristics to plants,
(F) a nucleic acid encoding a protein comprising a base sequence having at least 83 % sequence identity with the base sequence shown in SEQ ID NO: 1 and imparting dry squeezing characteristics to plants
(G) Coding a protein consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and a base sequence that hybridizes under stringent conditions and imparts dry squeezing characteristics to plants Nucleic acid to
A nucleic acid selected from the group consisting of: a function of imparting dry squeezing characteristics to the plant of the protein by introducing a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation; The method for producing a transformed plant having squeezed squeezing characteristics according to claim 1, wherein the plant is inhibited.   A plant having dry squeezing characteristics, wherein the protein imparts dry squeezing characteristics to the plant and inhibits the function of the proteins described in (a) to (c) of claim 1 And a method of imparting squeezed squeezing characteristics to a plant.   3. Inhibiting the function of the protein by introducing a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation in the nucleic acid according to claim 2 (a) to (g) The method according to claim 3, wherein:   The plant according to any one of claims 1 to 4, wherein the plant is a gramineous plant (preferably a plant selected from the group consisting of sorghum, corn, switchgrass, millet, brachypodium, rice, more preferably sorghum). The method described in 1.   The site to be mutated in SEQ ID NO: 1 is base deletion or base substitution at base number 115 of SEQ ID NO: 1, base deletion at base numbers 3690 to 3701, base substitution at base number 3783, base number Base addition between 3869 and 3870, base substitution at base number 3979, base deletion at base numbers 4012 to 4015, base substitution at base number 4069, base substitution at base number 4076, base addition between base numbers 4079 and 4080 5. The method according to claim 2 or 4, wherein the nucleotide number is 4086 to 4088, and the nucleotide number is 4093.   The site to be mutated in SEQ ID NO: 2 is the amino acid substitution of amino acid number 39 of SEQ ID NO: 2, the amino acid deletion of amino acid numbers 149 to 152, the amino acid substitution of amino acid number 180, the amino acid number of 208 and 209 Amino acid addition between, amino acid deletion between amino acid numbers 256 and 257, amino acid substitution at amino acid number 278, amino acid addition between amino acid numbers 278 and 279, amino acid deletion between amino acid numbers 281 and 282, The method according to any one of claims 1 to 4.   3. The nucleic acid according to claim 2 (a) to (g), wherein a mutation selected from the group consisting of a stop codon mutation, a frameshift mutation, and a null mutation is introduced, and the function of imparting dry squeezing characteristics is lost. A transformed plant having juicy squeezing characteristics. In a plant having dry squeezing characteristics, the protein imparts dry squeezing characteristics to the plant, and the following (a) to (c):
(A) a protein comprising the amino acid sequence of SEQ ID NO: 2,
(B) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and imparting dry squeezing characteristics to plants, or (c) A protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting squeezing characteristics to a plant in a dry manner,
Any of the proteins. The following (a) to (g);
(A) a nucleic acid encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2,
(B) a nucleic acid encoding a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted and / or added in SEQ ID NO: 2, and which imparts dry squeezing characteristics to plants,
(C) a nucleic acid that encodes a protein comprising an amino acid sequence having at least 75% sequence identity with the amino acid sequence shown in SEQ ID NO: 2 and imparting dry squeezing characteristics to plants
(D) a nucleic acid comprising the base sequence of SEQ ID NO: 1,
(E) a nucleic acid encoding a protein consisting of a base sequence in which one or more bases are deleted, substituted and / or added in SEQ ID NO: 1, and which imparts dry squeezing characteristics to plants,
(F) a nucleic acid encoding a protein comprising a base sequence having at least 83% sequence identity with the base sequence shown in SEQ ID NO: 1 and imparting dry squeezing characteristics to plants
(G) Coding a protein consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and a base sequence that hybridizes under stringent conditions and imparts dry squeezing characteristics to plants Nucleic acid to
A nucleic acid selected from the group consisting of:   A transformed plant into which the nucleic acid according to (a) to (g) of claim 2 has been introduced and has dry squeezing characteristics.   A method for producing a transformed plant having dry squeezing characteristics, comprising the step of introducing the nucleic acid according to (a) to (g) of claim 2 into a plant.   11. A method for imparting dry squeezing characteristics to a plant, comprising introducing the nucleic acid according to claim 10 into the plant. SEQ ID NO: 1 base deletion or base substitution of SEQ ID NO: 1 , base deletion of base numbers 3690 to 3701, base substitution of base number 3783, base addition between base numbers 3869 and 3870, base number 3979 in plants Base substitution, base number 4012-4015 base deletion, base number 4069 base substitution, base number 4076 base substitution, base addition between base numbers 4079 and 4080, base number 4086-4088 base deletion, base A marker for judging the dryness of a plant, comprising the base sequence represented by the base substitution No. 4093. SEQ ID NO: 1 base deletion or base substitution of SEQ ID NO: 1 , base deletion of base numbers 3690 to 3701, base substitution of base number 3783, base addition between base numbers 3869 and 3870, base number 3979 in plants Base substitution, base number 4012-4015 base deletion, base number 4069 base substitution, base number 4076 base substitution, base addition between base numbers 4079 and 4080, base number 4086-4088 base deletion, base Detecting a marker for judging the dryness of a plant, including examining the presence or absence of a marker containing the base sequence represented by the base substitution of No. 4093, and the detected marker contains a mutation to detect the above-mentioned base Determining that the plant has squeezed squeezing characteristics if a portion of the sequence is not translated into protein, and determining that it has dry squeezing characteristics if it does not contain the mutation. A method for determining dryness.