JP2016088926A - Antiphlogistic based on ikaros inhibition - Google Patents

Abstract

PROBLEM TO BE SOLVED: To explore a novel inflammation controlling method which uses completely different type from the existing inflammation control method as a target.SOLUTION: The invention provides antiphlogistic containing an IKAROS (IKZF1) inhibitor. The invention also provides a screening method of an anti-inflammation substance comprising the following steps (1)-(3): (1) contacting cells, which includes nucleic acids encoding reporter proteins under the control of IKAROS genes or the transcription control regions of the genes concerned, to test substances; (2) measuring the expression level of the IKAROS genes, IKAROS proteins, or reporter proteins in the cells; (3) selecting the test substance which lowers expression level of the IKAROS genes, IKAROS proteins, or reporter proteins as a candidate of an anti-inflammation substance by comparing to when measuring under the absence of the test substances.SELECTED DRAWING: None

Description

The present invention relates to an anti-inflammatory drug.

  Inflammatory diseases such as allergic diseases (eg, hay fever, allergic conjunctivitis, asthma, atopic dermatitis, Crohn's disease, ulcerative colitis) have been increasing in morbidity. On the other hand, current inflammation control techniques are mainly non-steroidal anti-inflammatory drugs (NSAIDs), steroid drugs or immunosuppressive drugs targeting immune cells such as lymphocytes, and their side effects such as induction of infections. Is a problem.

  So far, as described in Patent Documents 1 to 3, research on IKAROS has been made. Moreover, there are non-patent documents 1 to 18 as research on TLR3 and inflammation.

Japanese Patent No. 3562528 JP 10-507070 gazette Japanese National Patent Publication No. 11-512284

Nakamura N, Tamagawa-Mineoka R, Ueta M, Kinoshita S, Katoh N. Toll-Like Receptor 3 Increases Allergic and Irritant Contact Dermatitis.J Invest Dermatol. 2014 Sep 17. doi: 10.1038 / jid.2014.402. Ueta M, Sotozono C, Koga A, Yokoi N, Kinoshita S. Usefulness of a New Therapy Using Rebamipide Eyedrops in Patients with VKC / AKC Refractory to Conventional Anti-Allergic Treatments. Allergol Int. 2014 63: 75-81 Ueta M, Mizushima K, Naito Y, Narumiya S, Shinomiya K, Kinoshita S. Suppression of polyI: C-inducible gene expression by EP3 in murine conjunctival epithelium.Immunol Lett.2013 Sep 12.pii: S0165-2478 (13) 00121 -1. Ueta M, Sotozono C, Yokoi N, Kinoshita S: Rebamipide Suppresses PolyI: C-Stimulated Cytokine Production in Human Conjunctival Epithelial Cells.J Ocul Pharmacol Ther. 2013 Sep; 29 (7): 688-93. Ueta M, Kinoshita S: Ocular surface inflammation is regulated by innate immunity.Prog Retin Eye Res. 2012; 31 (6): 551-575. Ueta M, Matsuoka T, Sotozono C, Kinoshita S: Prostaglandin E2 Suppresses Poly I: C-Stimulated Cytokine Production Via EP2 and EP3 in Immortalized Human Corneal Epithelial Cells. Cornea. 2012; 31 (11): 1294-1298. Ueta M, Tamiya G, Tokunaga K, Sotozono C, Ueki M, Sawai H, Inatomi T, Matsuoka T, Akira S, Narumiya S, Tashiro K, Kinoshita S: Epistatic interaction between Toll-like receptor 3 (TLR3) and prostaglandin E receptor 3 (PTGER3) genes. J Allergy Clin Immunol. 2012; 129 (5): 1413-1416.e11. Ueta M, Matsuoka T, Yokoi N, Kinoshita S: Prostaglandin E2 suppresses polyinosine-polycytidylic acid (polyI: C) -stimulated cytokine production via prostaglandin (EP) 2 and 3 in human conjunctival epithelial cells. Br J Ophthalmol. 2011; 95 ( 6): 859-863. Ueta M, Matsuoka T, Yokoi N, Kinoshita S: Prostaglandin E receptor subtype EP3 downregulates TSLP expression in human conjunctival epithelium. Br J Ophthalmol. 2011; 95 (5): 742-743. Ueta M, Mizushima K, Yokoi N, Naito Y, Kinoshita S: Gene-expression analysis of polyI: C-stimulated primary human conjunctival epithelial cells. Br J Ophthalmol. 2010; 94 (11): 1528-1532. Ueta M, Kinoshita S: Innate immunity of the ocular surface.Brain Res Bull. 2010; 81 (2-3): 219-228. Ueta M, Uematsu S, Akira S, Kinoshita S: Toll-like receptor 3 enhances late-phase reaction of experimental allergic conjunctivitis. J Allergy Clin Immunol. 2009; 123 (5): 1187-1189. Ueta M, Matsuoka T, Narumiya S, Kinoshita S: Prostaglandin E receptor subtype EP3 in conjunctival epithelium regulates late-phase reaction of experimental allergic conjunctivitis. J Allergy Clin Immunol. 2009; 123 (2): 466-471. Kaniwa N, Saito Y, Aihara M, Matsunaga K, Tohkin M, Kurose K, Sawada J, Furuya H, Takahashi Y, Muramatsu M, Kinoshita S, Abe M, Ikeda H, Kashiwagi M, Song Y, Ueta M, Sotozono C , Ikezawa Z, Hasegawa R: JSAR research group.HLA-B locus in Japanese patients with anti-epileptics and allopurinol-related Stevens-Johnson syndrome and toxic epidermal necrolysis.Pharmacogenomics. 2008; 9 (11): 1617-1622. Ueta M: Innate immunity of the ocular surface and ocular surface inflammatory disorders. Cornea. 2008; 27 (Suppl 1): S31-40. Ueta M, Sotozono C, Inatomi T, Kojima K, Hamuro J, Kinoshita S: Association of Fas Ligand gene polymorphism with Stevens-Johnson syndrome. Br J Ophthalmol. 2008; 92 (7): 989-991. Ueta M, Sotozono C, Inatomi T, Kojima K, Tashiro K, Hamuro J, Kinoshita S: Toll like receptor 3 gene polymorphisms in Japanese patients with Stevens-Johnson syndrome.Br J Ophthalmol. 2007; 91 (7): 962-965 . Ueta M, Hamuro J, Kiyono H, Kinoshita S: Triggering of TLR3 by polyI: C in human corneal epithelial cells to induce inflammatory cytokines.Biochem Biophys Res Commun. 2005; 331 (1): 285-294.

  The present inventors have found the expression of IKAROS in epithelial cells that have not been reported so far, and have found a method for inducing IKAROS in cultured human mucosal epithelium and cultured human epidermis, thereby completing the present invention. In the present invention, focusing on the fact that not only immune cells but also epithelial cells are involved in the inflammatory state, a novel method for controlling inflammation has been developed. Thus, local administration is facilitated by making the target an epithelial cell, and side effects are expected to be drastically reduced. Accordingly, the present invention provides the following.

Although prostaglandins (PG) _{E 2} may be also referred to as inflammatory substances, the result of the present invention, since the suppressing IKAROS found to be an inflammatory factor in epithelial, certain inflammatory, IKAROS, EP3 (PGE ₂ receptor 3), an abbreviation for TLR3 (Toll-like receptor 3 (Toll-like receptor-3)); TLR3 recognizes virus-derived double-stranded RNA (dsRNA) and exhibits strong antiviral activity It is one of the innate immune system molecules that promotes the production of interferon and works against viruses.) Related inflammation (eg, Stevens-Johnson syndrome, asthma, contact dermatitis, acute dermatitis, atopic dermatitis, For allergic conjunctivitis and atopic keratoconjunctivitis), it functions as an inhibitor and as an anti-inflammatory drug Proven to use. The therapeutic agent for IKAROS expression-promoting diseases of the present invention cannot be predicted only by the knowledge of existing literature that discusses the relationship between prostaglandin (PG) E2 or polyI: C and allergy. Therefore, the present invention may be useful as a highly specific anti-inflammatory drug not found in the prior art. Accordingly, the present invention provides the following.
(1) An anti-inflammatory drug containing an IKAROS (IKZF1) inhibitor.
(2) The anti-inflammatory drug according to item 1, wherein the IKAROS inhibitor is selected from the group consisting of PGE ₂ , anti-IKAROS siRNA, and anti-IKAROS antibody.
(3) The anti-inflammatory drug according to item 1 or 2, wherein the anti-inflammatory drug targets epithelial tissue.
(4) The anti-inflammatory drug according to any one of items 1 to 3, wherein the inflammation is inflammation caused by IKAROS.
(5) The anti-inflammatory drug according to any one of Items 1 to 4, wherein the inflammation is inflammation caused by increased expression of IKAROS.
(6) The anti-inflammatory drug according to any one of Items 1 to 5, wherein the inflammation is inflammation involving an epithelium caused by IKAROS.
(7) The anti-inflammatory drug according to any one of Items 1 to 6, wherein the inflammation is inflammation involving IKAROS and TLR3 in the epithelium.
(8) The anti-inflammatory drug according to any one of Items 1 to 7, wherein the inflammation is caused by an allergic disease.
(9) The inflammation is selected from the group consisting of Stevens-Johnson syndrome, asthma, contact dermatitis, acute dermatitis, atopic dermatitis, allergic conjunctivitis and atopic keratoconjunctivitis, The anti-inflammatory drug according to claim 1.
(10) The anti-inflammatory drug according to any one of items 1 to 9, which is a topical agent.
(11) The anti-inflammatory agent according to item 10, wherein the topical administration agent is an external preparation, eye drops, nasal drop or inhalant.
(12) The anti-inflammatory drug according to any one of items 1 to 11, wherein the anti-inflammatory drug is for treatment or prevention of inflammation in skin or mucosal tissue.
(13) The anti-inflammatory drug according to item 12, wherein the mucosal tissue is eyes, oral cavity, nasal cavity, pharynx, respiratory tract, vagina, urethra and / or gastrointestinal tract.
(14) The anti-inflammatory agent according to any one of items 1 to 13, wherein the anti-inflammatory agent is for treatment or prevention of inflammation in the eye.
(15) The following steps (1) to (3):
(1) contacting a cell containing a nucleic acid encoding a reporter protein under the control of the IKAROS gene or the transcriptional regulatory region of the gene of interest with a test substance;
(2) a step of measuring the expression level of an IKAROS gene or an IKAROS protein or reporter protein in the cell; and (3) an IKAROS gene or an IKAROS protein or a reporter protein as compared with a case where measurement is performed in the absence of a test substance. A method for screening an anti-inflammatory substance, comprising a step of selecting a test substance having a reduced expression level of as a candidate for an anti-inflammatory substance.
(16) A screening method for an anti-inflammatory substance, which comprises contacting IKAROS with a test substance and selecting a test substance having an ability to bind to IKAROS as a candidate for an anti-inflammatory substance.
(17) The following steps (1) to (3):
(1) contacting IKAROS with a cell membrane fraction of a target cell of an inflammatory disease in the presence of a test substance;
(2) a step of measuring the amount of IKAROS bound to the cell membrane fraction; and (3) a test in which the amount of IKAROS bound to the cell membrane fraction is reduced as compared with the case of measurement in the absence of the test substance. Item 17. The screening method according to Item 15 or 16, comprising a step of selecting a substance as a candidate for an anti-inflammatory substance.
(18) Any one of items 15 to 17, further comprising applying a test substance selected as a candidate for an anti-inflammatory substance to an inflammation model and testing whether or not to suppress an inflammatory reaction in the model. The method according to item.
(19) The following steps (1) to (3):
(1) a step of contacting a target cell of an inflammatory disease with a test substance in the presence and absence of IKAROS;
(2) a step of measuring the degree of inflammatory reaction in the cells under each condition; and (3) suppressing the inflammatory reaction in the presence of IKAROS as compared to the case of measuring in the absence of the test substance. A method for screening an anti-inflammatory substance, comprising a step of selecting a test substance that did not suppress an inflammatory reaction in the absence of IKAROS as a candidate for a substance that inhibits the function of IKAROS and exhibits an anti-inflammatory action.
(20) The method according to any one of items 15 to 19, further comprising a step of inducing an inflammatory reaction in the target cell.
(21) Any one of Items 15 to 20, characterized in that polyI: C, interleukin-Iα (IL-1α), tumor necrosis factor (TNF) α, or H ₂ O ₂ stimulates an inflammatory response. The method according to item.
(22) The method according to any one of items 15 to 21, wherein the cells include or are related to epithelial cells.
(23) The epithelial cells are skin epidermal cells, esophageal epithelial cells, gastric epithelial cells, vaginal epithelial cells, uterine epithelial cells, thymic epithelial cells, bladder epithelial cells, prostate epithelial cells, mammary epithelial cells, conjunctival epithelial cells or corneal epithelium. The method according to item 22, wherein the cell is a cell.
(24) The method according to item 22 or 23, wherein the epithelial cells are skin epidermal cells, conjunctival epithelial cells or corneal epithelial cells.
(25) The method according to any one of items 22 to 24, wherein the epithelial cells are mucosal epithelial cells expressing keratin 5.
(26) The method according to any one of items 15 to 25, wherein the inflammation is inflammation caused by increased expression of IKAROS.
(27) The method according to any one of items 15 to 26, wherein the inflammation is inflammation involving an epithelium caused by IKAROS.
(28) The method according to any one of items 15 to 27, wherein the inflammation is inflammation involving IKAROS and TLR3 in the epithelium.
(29) A composition for increasing or inducing the expression of the IKAROS gene, comprising polyI: C.
(30) The composition according to item 29, wherein the expression increase or induction of the IKAROS gene is in epithelial cells.
(31) An isolated cell in which expression of the IKAROS gene is increased or induced.
(31A) The isolated cell according to item 31, wherein the cell is keratin positive.
(32) The cell according to item 31 or 31A, wherein the increase or induction of the expression of the IKAROS gene is caused by polyI: C.
(33) A cell according to item 31, 31A or 32, wherein the cell is an epithelial cell.
(34) An inflammation model animal in which expression of the IKAROS gene is increased or induced.
(35) The animal according to item 34, wherein the increase or induction of the expression of the IKAROS gene is caused by polyI: C.
(36) The animal according to item 34 or 35, wherein the inflammation model includes inflammation on the ocular surface.
(37) The animal according to any one of items 34 to 36, wherein the increase or induction of the expression of the IKAROS gene is caused by genetic modification.
(38) The animal according to any one of items 34 to 37, wherein the genetic modification includes modification so that the IKAROS gene is expressed specifically in an epithelium.
(39) The animal according to any one of items 34 to 38, wherein the animal develops mucocutaneous inflammation.
(40) The animal according to any one of items 34 to 39, wherein the animal comprises a vector comprising a nucleic acid sequence operably linked to a promoter of keratin 5 and encoding the IKAROS gene.
(41) The animal according to any one of items 34 to 40, wherein the animal is a rodent.
(41A) The animal according to any one of items 34 to 41, wherein the inflammation model animal has cell infiltration in at least one selected from the group consisting of skin tissue and mucosal tissue.

  In the present invention, it is contemplated that one or more of the features described above may be provided in further combinations in addition to the express combinations. Still further embodiments and advantages of the invention will be appreciated by those skilled in the art upon reading and understanding the following detailed description as necessary.

  In the present invention, a novel anti-inflammatory therapeutic method targeting IKAROS (IKZF1) of epithelial cells is provided.

  Inflammatory diseases such as allergic diseases continue to increase in prevalence, and today's inflammation control methods are mainly steroid drugs and immunosuppressive drugs targeting immune cells such as lymphocytes, and their side effects are problematic Therefore, according to the present invention, not only immune cells but also epithelial cells (“epidermis” covering the body surface and “epithelium (narrow sense)” constituting the mucous membrane of a luminal organ) are greatly involved in the inflammatory pathology. In particular, it is possible to develop a novel inflammation control method targeting epithelial cells. By using epithelial cells as targets, local administration is facilitated, and side effects are expected to be drastically reduced.

  According to the present invention, it is possible to develop a novel inflammation control method targeting epithelial cells, focusing on the fact that epithelial cells are involved in the development of inflammatory pathologies as a factor located upstream of immune cells. By controlling the dynamics and activation of immune cells using the target as epithelial cells, local administration is facilitated, and there is a substantial merit that side effects can be drastically reduced. There is also provided an inflammation control model from a point of interest that has not been performed so far. The development of new inflammation control methods that target epithelial cells that are completely different from existing inflammation control methods will contribute to the realization of a safe and secure society by providing appropriate treatments and extending healthy life expectancy. Furthermore, the development of a novel inflammation control method that controls the dynamics and activation of immune cells targeting epithelial cells leads to a major turning point in the inflammation control method. The novel inflammation control method targeting epithelial cells is expected to greatly reduce side effects because local administration with a control compound is easy, and will be a major player in future inflammation treatment.

  In addition to the development of new compounds related to IKAROS present in epithelial cells, the mechanism of action can be elucidated at the molecular level, leading to the development of further molecular targets and drug seeds. In addition, a new evaluation system for tissue permeability is constructed to facilitate the search for compounds that selectively act on epithelial cells. Elucidation of the mechanism of action at the molecular level reveals the mechanism of inflammation control through epithelial cells to prevent allergic diseases, treatment with drugs and medical supplies, and safe and secure quality (chemical materials, cosmetics, foods, health foods) Connected with As a result, it is possible to directly contribute to the improvement of human life in the future from the viewpoint of a safe and secure society by providing appropriate treatments and extending the healthy life expectancy, and a wide range of industries (medical, pharmaceutical, chemical, food, etc.) A ripple effect can be expected.

FIG. 1 shows a technique for inducing IKAROS in human epidermis and epithelial cells. FIG. 1a shows the time course of IKAROS mRNA expression in primary cultured cells of human conjunctival epithelial cells exposed to 10 μg / ml polyI: C (poly I: C). From the left, 0 hours, 1 hour, 3 hours, 6 hours and 10 hours are shown. The quantitative data was normalized to the expression of the housekeeping gene GAPDH. The vertical axis shows the increase in specific mRNA relative to the 0 hr sample. FIG. 1b shows IKAROS mRNA expression in primary cultured cells of human conjunctival epithelial cells exposed to 10 μg / ml polyI: C (poly I: C) for 10 hours. The left shows the medium, and the right shows polyI: C. The quantitative data was normalized to the expression of the housekeeping gene GAPDH. The vertical axis shows the increase in specific mRNA relative to the unstimulated sample. Data are representative of triplicate experiments and represent the mean ± SEM from experiments performed in 3 wells per group. FIG. 1c shows the expression of IKAROS mRNA in primary cultured cells of keratinocytes, which are the majority of cells that make up the epidermis exposed to 10 μg / ml poly I: C (poly I: C) for 10 hours. . The quantitative data was normalized to the expression of the housekeeping gene GAPDH. The vertical axis shows the increase in specific mRNA relative to the unstimulated sample. Data are representative of triplicate experiments and represent the mean ± SEM from experiments performed in 3 wells per group. FIG. 2 shows the state of animals in IKAROS overexpression and the like. The upper photo is a comparison of the abdomen of IKAROS (IK1) transgenic mice (left) and wild mice (right). The lower left panel is a face comparison between transgenic mice (top) and wild mice (bottom) of IKAROS (IK1). The lower right panel is a back comparison of IKAROS (IK1) transgenic mice (right) and wild mice (left). FIG. 3 shows the expression of IKAROS mRNA and its inhibitory effect with inhibitors. FIG. 3a shows that polyI: C-induced (10-hour stimulation) IKAROS mRNA expression in primary cultured human conjunctival epithelial cells was significantly suppressed by addition of 100 μg / ml PGE ₂ (left). Is the control, polyI: C stimulation only in the center, and right shows polyI: C stimulation + 100 μg / ml PGE ₂ addition.) FIG. 3b shows that expression of polyI: C-inducible (10-hour stimulation) IKAROS mRNA in primary cultured human keratinocytes (keratinocytes) cells was significantly suppressed by addition of 100 μg / ml PGE ₂ (Left shows control, middle shows polyI: C stimulation only, right shows polyI: C stimulation + 100 μg / ml PGE ₂ addition). FIG. 4 shows the structure and construction procedure of the expression vector (pK5-Ikzfl-2A-EGFP) prepared in the present invention. The upper part shows the structure of each element. Keratin 5 promoter is drawn on the left side, and the structure of Ikzfl-P2A-EGFP is shown on the right side. An expression vector (pK5-lkzfl-2A-EGFP) prepared by inserting into the Spe1 and NotI sites located downstream of the promoter of pBSK5 (human keratin 5 promoter in pBluescript II KS +) is shown in the lower part. FIG. 5 shows a restriction map of the prepared expression vector (pK5-Ikzfl-P2A-EGFP) (SEQ ID NO: 5). A vector map is shown on the left, and a blot showing the DNA cleavage pattern on the right. The restriction enzymes used are as shown in the figure. From the left side, molecular weight markers, lanes 1-7, indicate SalI, SalI + NotI, SpeI + NotI, Acc65I, EcoRI, and BamHI. The right side is also a molecular weight marker. A SalI recognition sequence (GTCGAC) site is present at positions 2223 to 2228 of SEQ ID NO: 5. There is a human keratin 5 promoter region sequence from position 2229 to position 16654 of SEQ ID NO: 5. The 2762rd position of SEQ ID NO: 5 is T, but is C in the NCBI database. There is a SpeI recognition site (ACTAGT) at positions 16655 to 16660 of SEQ ID NO: 5. The sequence of Ikzf1 isoform 1 (DNA (1545 bp; NM_001025597) is present from positions 16667 to 18211 of SEQ ID NO: 5. A P2A sequence is present from positions 18212 to 18277 of SEQ ID NO: 5. From position 18284 of SEQ ID NO: 5. EGFP (720 bp) is present at position 19003. bGH polyA is present from positions 19020 to 19309 of SEQ ID NO: 5. A NotI recognition sequence (GCGGCCGC) is present from positions 19310 to 19317 of SEQ ID NO: 5. In FIG. 6, the examination result of the pCR analysis conditions for pK5-Ikzfl-2A-EGFP founder mouse | mouth selection is shown (condition 1). As the condition 1, K5p-F1 that binds to the Keratin5 promoter and BGH-R3 primer that binds downstream of bGH polyA were designed. In this figure, each primer sequence and PCR analysis conditions are shown. In FIG. 7, the examination result of the pCR analysis conditions for pK5-Ikzfl-2A-EGFP founder mouse | mouth selection is shown (condition 2). As Condition 2, K5p-F6 and K5p-R2 primers that bind to the upstream site of the Keratin5 promoter were designed. In this figure, each primer sequence and PCR analysis conditions are shown. FIG. 8 shows the preparation of pK5-Ikzfl-2A-EGFP transgene. The upper row shows the structure of the transgene, and the lower row shows the cleavage pattern by the restriction enzyme. Specifically, the expression vector was digested with restriction enzymes SalI and Natl. As a result, the plasmid vector sequence was separated, and the expression cassette portion (about 17.1 kbp) was purified. The bottom row confirms that cutting is correct. FIG. 9 shows the results of confirming the expression by PCR for IKAROS and GAPDH. For each lane, the leftmost is an empty lane, the second is a molecular weight ladder marker (each shown in units of 100 bp), and an arrow is attached at a position of 500 bp. The third and fourth from the left indicate mononuclear spheres, with IKAROS RT and no RT, respectively. One, the sixth from the left is the molecular weight ladder marker again, and the seventh and eighth from the left indicate the conjunctival epithelium, indicating IKAROS RT and no RT, respectively. The 10th from the left is the molecular weight ladder marker again, the 11th and 12th from the left are mononuclear cells, and GAPDH (28 cycles) RT is present and RT is not present. The first 14th from the left is the molecular weight ladder marker, and the 15th and 16th from the left indicate the conjunctival epithelium, indicating GAPDH (28 cycles) RT and no RT, respectively. FIG. 10 shows a HE-stained photograph of skin tissue (auricle) in IKZF1Tg mice (Example 5). The left column shows wild type and the right column shows IKZF1 transgenic. Bars indicate 100 μm (upper) or 50 μm (lower). FIG. 11 shows a HE-stained photograph of skin tissue (back epidermis) in IKZF1Tg mice (Example 5). The left column shows wild type and the right column shows IKZF1 transgenic. The upper row shows 50 times and the lower row shows 100 times. Bars indicate 100 μm (upper) or 50 μm (lower). FIG. 12 shows a HE-stained photograph of mucosal tissue (eyelid) in IKZF1Tg mice (Example 5). The left column shows wild type and the right column shows IKZF1 transgenic. The upper row shows 50 times and the lower row shows 100 times. Bars indicate 100 μm (upper) or 50 μm (lower). FIG. 13 shows a HE-stained photograph of mucosal tissue (tongue) in IKZF1Tg mice (Example 5). The left column shows wild type and the right column shows IKZF1 transgenic. The upper row shows 50 times and the lower row shows 100 times. Bars indicate 100 μm (upper) or 50 μm (lower). FIG. 14 shows a photograph showing expression analysis of IKZF1 protein in human conjunctival tissue (Steven Jones syndrome (SJS) supracorneal scarring conjunctival tissue) (Example 6). From the top, HE staining (bar indicates 100 μm), staining photograph with goat anti-IKZF antibody (bar indicates 100 μm), and staining photograph with goat IgG (bar indicates 100 μm). (Stained with goat anti-IKZF antibody but not with control goat IgG. FIG. 15 shows a photograph showing an expression analysis of IKZF1 protein in human conjunctival tissue (Steven Jones syndrome (SJS) scarlet conjunctival tissue) (Example 6). From the top, HE staining (bar indicates 100 μm), staining photograph with goat anti-IKZF antibody (bar indicates 100 μm), and staining photograph with goat IgG (bar indicates 100 μm). Stained with goat anti-IKZF antibody but not with control goat IgG. FIG. 16 shows a photograph showing an expression analysis of IKZF1 protein in human control conjunctival tissue (conjunctivochalasis) (Example 6). From the top, HE staining (bar indicates 100 μm), staining photograph with goat anti-IKZF antibody (bar indicates 100 μm), and staining photograph with goat IgG (bar indicates 100 μm). Stained with goat anti-IKZF antibody but not with control goat IgG. FIG. 17 shows a photograph showing an expression analysis of IKZF1 protein in human control conjunctival tissue (conjunctivochalasis) (Example 6). From the top, HE staining (bar indicates 100 μm), staining photograph with goat anti-IKZF antibody (bar indicates 100 μm), and staining photograph with goat IgG (bar indicates 100 μm). Stained with goat anti-IKZF antibody but not with control goat IgG.

  The present invention will be described below. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. Thus, it should be understood that singular articles (eg, “a”, “an”, “the”, etc. in the case of English) also include the plural concept unless otherwise stated. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

  The present invention is based, at least in part, on the discovery that IKAROS is associated with the epithelium and contributes to the exacerbation of inflammatory diseases including conjunctivitis, dermatitis and the like. This finding indicates that IKAROS can be used not only as an inflammation marker but also as a drug discovery target for inflammatory diseases. That is, known inhibitors of IKAROS are useful for the prevention and / or treatment of inflammatory diseases, and novel IKAROS inhibitors, and thus prevention of inflammatory diseases, using IKAROS protein and cells / animals expressing the same. -You can also search for substances that will be therapeutic agents.

(IKAROS protein and nucleic acid encoding the same)
In the present specification, “IKAROS” (Icarus) is a known protein also called “IKZF1”, and Genbank Accession No. : NP_001207694 (human) <its nucleic acid sequence NM_001220765.2>, or Genbank Accession No. : NP_001020768 (mouse) <the nucleic acid sequence NM_001025597.2>, the amino acid sequence of human or mouse IKAROS represented by SEQ ID NO: 2 or 4 (the nucleic acid sequence is SEQ ID NO: 1 or 3, respectively), or It is a protein comprising an amino acid sequence substantially identical to this. In the present specification, proteins and peptides are described with the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end according to the convention of peptide notation.

As used herein, IKAROS refers to cells of humans and other warm-blooded animals (eg, mice, rats, cows, monkeys, dogs, pigs, sheep, rabbits, guinea pigs, hamsters, chickens, etc.) [eg, neutrophils, etc.] Alternatively, it may be isolated and purified from a tissue [for example, blood or the like] by a known protein separation and purification technique. IKAROS is a “zinc finger” DNA binding protein of the Kruppel family, one such regulatory network essential for normal lymphocyte generation. IKAROS acts as an evolutionarily conserved “master switch” that causes hematopoiesis and governs transcriptional regulation at the earliest stages of lymphocyte ontogeny and differentiation (Georgoulous et al., 1994, Cell). 79: 143-156; Georgepoulos et al., 1992, Science, 258: 808-812; Hahn et al., 1994, Mol. Cell Biol., 14: 7111- 7123; Molnar and Georgeporous, 1994, Mol. Biol., 14: 8292-8303; Wang et al., 1996, Immunity, 5: 537-549; Winandy et al., 1995, Cell, 83. 289-299; Molnar et
al. 1996, J. MoI. of Immunol. 156: 585-592; Sun et al. , 1996, EMBO J. et al. 15: 5358-5369; Hansen et al. , 1997, Eur. J. et al. Immunol, 27: 3049-3058; Georgepolous et al. , 1997, Ann. Rev. Immunol. 15: 155-176; Brown et al. 1997, Cell, 91: 845-854; and Klug et al. 1998, Proc. Natl. Acad. Sci. USA, 95: 657-662). The programmed expression and function of the IKAROS gene is tightly controlled by alternative splicing of the IKAROS pre-mRNA, which produces eight different icaros isoforms. The eight icaros isoforms (Ik-1, Ik-2, Ik-3, Ik-4, Ik-5, Ik-6, Ik-7, and Ik-8) are all common carboxy (C) termini This C-terminal domain has two transcriptional activation motifs and two necessary for the formation of homodimer or heterodimer between IKAROS isoforms and interaction with other proteins. And zinc finger motifs.

“IKAROS” used in the present invention is represented by the amino acid sequence represented by SEQ ID NO: 2 or 4, or an amino acid sequence substantially identical thereto, and includes functional equivalents thereof. (A) to (e) of:
(A) the amino acid sequence represented by SEQ ID NO: 2 or 4;
(B) an amino acid sequence in which one or more amino acids are deleted, added, inserted or substituted in the amino acid sequence represented by SEQ ID NO: 2 or 4, and impart an activity that promotes an inflammatory reaction;
(C) an amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 2 or 4 and imparting an activity of promoting an inflammatory reaction;
(D) an amino acid sequence encoded by DNA having the base sequence represented by SEQ ID NO: 1 or 3;
(E) an amino acid sequence encoded by a DNA that hybridizes under stringent conditions with a DNA having a complementary strand sequence of the base sequence represented by SEQ ID NO: 1 or 3, and imparts an activity that promotes an inflammatory reaction.

  Specifically, the human IKAROS protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or 4 or the amino acid sequence of an ortholog in other mammals, or the human IKAROS protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or 4 or Examples thereof include amino acid sequences in splice variants, allelic variants, or polymorphic variants of the ortholog.

  Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by a generally recognized one letter code. As used herein, “homology” refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably the algorithm uses a sequence of sequences for optimal alignment). The percentage of identical and similar amino acid residues relative to all overlapping amino acid residues in which one or both of the gaps can be considered). “Similar amino acids” mean amino acids that are similar in physicochemical properties, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn). ), Basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids having hydroxyl groups (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met), etc. Examples include amino acids classified into groups. It is expected that substitution with such similar amino acids will not change the phenotype of the protein (ie, is a conservative amino acid substitution). Specific examples of conservative amino acid substitutions are well known in the art and are described in various literature (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).

  In this specification, the comparison of similarity, identity and homology between amino acid sequences and base sequences is calculated using default parameters using BLAST, which is a sequence analysis tool. The identity search can be performed using, for example, NCBI BLAST (National Center for Biotechnology Information Basic Alignment Search Tool) 2.2.26 (issued 2011.10.30). In the present specification, the identity value usually refers to a value when the BLAST is used and aligned under default conditions. However, if a higher value is obtained by changing the parameter, the highest value is set as the identity value. When identity is evaluated in a plurality of areas, the highest value among them is set as the identity value. Similarity is a numerical value calculated for similar amino acids in addition to identity. When NCBI BLAST is used, for example, calculation can be performed under the following conditions (expected value = 10; allow gap; matrix = BLOSUM62; filtering = OFF). Other algorithms for determining amino acid sequence homology include, for example, Karlin et al., Proc. Natl. Acad. Sci. USA, 90: 5873-5877 (1993) [the algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25: 3389-3402 (1997)]. )], Needleman et al., J. MoI. Mol. Biol. 48: 444-453 (1970) [the algorithm is incorporated into the GAP program in the GCG software package], Myers and Miller, CABIOS, 4: 11-17 (1988) [ The algorithm is incorporated into the ALIGN program (version 2.0) which is part of the CGC sequence alignment software package], Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-2448 (1988) [the algorithm is incorporated in the FASTA program in the GCG software package] and the like, and they can be preferably used as well.

  The stringent conditions in (e) above are, for example, the conditions described in Current Protocols in Molecular Biology, John Wiley & Sons, 6.3.1-6.3.6, 1999, for example, 6 × SSC ( (sodium chloride / sodium citrate) / 45 ° C., followed by one or more washings at 0.2 × SSC / 0.1% SDS / 50-65 ° C. Hybridization conditions that give the same stringency can be selected as appropriate.

  More preferably, as the “amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or 4,” the amino acid sequence represented by SEQ ID NO: 2 or 4 is about 90% or more, preferably about 95%. More preferably, amino acid sequences having identity of about 96% or more, more preferably about 97% or more, particularly preferably about 98% or more, and most preferably about 99% or more are mentioned.

  “A protein comprising an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or 4” comprises an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 2 or 4; It is a protein having substantially the same function as the protein consisting of the amino acid sequence represented by No. 2 or 4.

  The modified amino acid sequence such as IKAROS used in the present invention has, for example, 1 to 30, preferably 1 to 20, more preferably 1 to 9, further preferably 1 to 5, particularly preferably 1 to 2. An amino acid can be inserted, substituted, or deleted, or added to one or both ends. The modified amino acid sequence is preferably an amino acid sequence having one or more (preferably 1 or several, 1, 2, 3, or 4) conservative substitutions in the amino acid sequence such as IKAROS. There may be. As used herein, “conservative substitution” means substitution of one or more amino acid residues with another chemically similar amino acid residue so as not to substantially alter the function of the protein. For example, when a certain hydrophobic residue is substituted by another hydrophobic residue, a certain polar residue is substituted by another polar residue having the same charge, and the like. Functionally similar amino acids that can make such substitutions are known in the art for each amino acid. Specific examples include non-polar (hydrophobic) amino acids such as alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Examples of polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Examples of positively charged (basic) amino acids include arginine, histidine, and lysine. Examples of negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

  Here, “substantially the same function” means that the properties are qualitatively the same, for example, physiologically or pharmacologically, and the degree of function (eg, about 0.1 to about 0.1). Quantities such as about 10 times, preferably about 0.5 to about 2 times) and the molecular weight of the protein may be different. Moreover, although the detailed role of IKAROS in vivo is unknown at present, a protein having an activity of promoting an inflammatory reaction can be regarded as a “protein having substantially the same function”.

  Therefore, in the present specification, the “functional equivalent” means any target having the same target function as that of the target entity, that is, having substantially the same function but different structure. Say things. Therefore, in the case of “IKAROS or a functional equivalent thereof” or “group consisting of IKAROS and a functional equivalent thereof”, in addition to IKAROS itself, a fragment, variant or variant of IKAROS (for example, an amino acid sequence variant, etc. ) Having one or more biological functions possessed by IKAROS, and those that can change to IKAROS or a fragment, variant or variant of this IKAROS at the time of action (eg, IKAROS itself or It is understood that nucleic acids encoding IKAROS fragments, variants or variants, and vectors, cells, etc. containing the nucleic acids are encompassed. “IKAROS or a functional equivalent thereof” or “group consisting of IKAROS and functional equivalents thereof” includes, as a representative example, at least one factor selected from the group consisting of IKAROS and fragments thereof. In the present invention, it is understood that the functional equivalent of IKAROS can be used in the same manner as IKAROS even if not specifically mentioned.

  Here, the inflammatory response promoting activity can be measured using, for example, an in vitro or in vivo inflammation model (for example, the cell or animal model of the present invention) described later.

  As used herein, “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg 11 etc.) are also suitable as lower limits obtain. In the case of polynucleotides, examples include 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 and more nucleotides. Non-integer lengths (eg, 11 etc.) may also be appropriate as a lower limit. As used herein, it is understood that such laminin chains also fall within the scope of the present invention if the laminin chain functions as a factor for its activity, eg, growth promotion or maintenance. In accordance with the present invention, the term “activity” refers herein to the function of a molecule in the broadest sense. Activity is not intended to be limiting, but generally includes the biological function, biochemical function, physical function or chemical function of a molecule. Activity activates, promotes, stabilizes, inhibits, suppresses, or destabilizes, for example, enzyme activity, the ability to interact with other molecules, and the function of other molecules Ability, stability, and ability to localize to specific intracellular locations. Where applicable, the term also relates to the function of the protein complex in the broadest sense. As used herein, “biological function” refers to a specific function that a gene, nucleic acid molecule or polypeptide may have in vivo when referring to a gene or a nucleic acid molecule or polypeptide related thereto. Examples of the antibody include, but are not limited to, generation of specific antibodies, enzyme activity, and imparting resistance. As used herein, a biological function can be exerted by “biological activity”. As used herein, “biological activity” refers to activity that a certain factor (eg, polynucleotide, protein, etc.) may have in vivo, and exhibits various functions (eg, transcription promoting activity). For example, an activity in which another molecule is activated or inactivated by interaction with one molecule. When two factors interact, their biological activity depends on the binding between the two molecules and the resulting biological change, eg, when one molecule is precipitated with an antibody, the other When molecules also coprecipitate, the two molecules are considered bound. Therefore, seeing such coprecipitation is one of the judgment methods. For example, when a factor is an enzyme, the biological activity includes the enzyme activity. In another example, when an agent is a ligand, the ligand includes binding to the corresponding receptor. Such biological activity can be measured by techniques well known in the art. Thus, “activity” indicates or reveals binding (either direct or indirect); affects the response (ie, has a measurable effect in response to some exposure or stimulus), Refers to various measurable indicators, such as the affinity of a compound that directly binds to a polypeptide or polynucleotide of the invention, or the amount of protein upstream or downstream after some stimulation or event or other A measure of similar function.

  As the IKAROS protein in the present invention, for example, (i) 1 to 30, preferably 1 to 10, more preferably 1 to the number (5, 4, 3 or 5) in the amino acid sequence represented by SEQ ID NO: 2 or 4 2) an amino acid sequence in which one amino acid is deleted; (ii) 1 to 30, preferably 1 to 10, more preferably 1 to a number (5, 4, 3 or 2) an amino acid sequence added with amino acids, (iii) 1 to 30, preferably 1 to 10, more preferably 1 to number (5, 4) in the amino acid sequence represented by SEQ ID NO: 2 or 4. 3 or 2) an amino acid sequence in which amino acids are inserted, (iv) 1 to 30, preferably 1 to 10, more preferably 1 to a number (number) in the amino acid sequence represented by SEQ ID NO: 2 or 4. 5, 4, 3 Properly 2) number of amino acid sequence are substituted with other amino acids, or (v) be such as protein comprising the amino acid sequence comprising a combination thereof are included.

  When the amino acid sequence is inserted, deleted, added or substituted as described above, the position of the insertion, deletion, addition or substitution is not particularly limited as long as the protein can promote an inflammatory response.

  Here, as a technique for artificially performing deletion, addition, insertion or substitution of amino acids, for example, conventional site-directed mutagenesis is performed on DNA encoding the amino acid sequence represented by SEQ ID NO: 2 or 4. And a method for expressing the DNA by a conventional method. Here, as a site-specific mutagenesis method, for example, a method using an amber mutation (gapped duplex method, Nucleic Acids Res., 12, 9441-9456 (1984)), or PCR using a mutagenesis primer. Methods and the like.

  Preferred examples of IKAROS include, for example, a human protein consisting of the amino acid sequence represented by SEQ ID NO: 2 (Genbank Accession No. NP — 443204), or an ortholog thereof (eg, mouse IKAROS protein (SEQ ID NO: 4, Genbank) in other mammals. Accession No. NP — 084072)), allelic variants, polymorphic variants [eg, single nucleotide polymorphisms (SNPs)] and the like.

The “nucleic acid encoding IKAROS” used in the present invention encodes the amino acid sequence represented by SEQ ID NO: 2 or 4 shown in the above (a) to (e) or an amino acid sequence substantially identical thereto. The nucleic acid containing the base sequence to represent. Specifically, the following (f) to (j):
(F) a base sequence encoding the amino acid sequence represented by SEQ ID NO: 2 or 4,
(G) a base sequence encoding an amino acid sequence in which one or more amino acids are deleted, added, inserted or substituted in the amino acid sequence represented by SEQ ID NO: 2 or 4, and which imparts an activity that promotes an inflammatory reaction;
(H) a base sequence encoding an amino acid sequence having 90% or more homology with the amino acid sequence represented by SEQ ID NO: 2 or 4 and imparting an activity that promotes an inflammatory reaction,
(I) a base sequence represented by SEQ ID NO: 1 or 3,
(J) A base sequence that hybridizes under stringent conditions with a DNA having a complementary strand sequence of the base sequence represented by SEQ ID NO: 1 or 3, and encodes an amino acid sequence that imparts an activity that promotes an inflammatory reaction Base sequence,
The nucleic acid which has is mentioned.

  Here, the gene may be any of DNA such as cDNA or genomic DNA, or RNA such as mRNA, and is a concept including both a single-stranded nucleic acid sequence and a double-stranded nucleic acid sequence. In addition, in this specification, the nucleic acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 3 are DNA sequences for convenience, but when RNA sequences such as mRNA are shown, thymine (T) is converted to uracil (U). To understand.

  Preferable examples of the nucleic acid encoding IKAROS include, for example, human IKAROS cDNA (Genbank Accession No. NM_052972) consisting of the base sequence represented by SEQ ID NO: 1, or its ortholog (eg, mouse IKAROS cDNA ( SEQ ID NO: 3, Genbank Accession No. NM — 029796), etc.), allelic variants, polymorphic variants [eg single nucleotide polymorphisms (SNPs)] and the like.

  As used herein, “protein”, “polypeptide”, “oligopeptide” and “peptide” are interchangeable and are used interchangeably herein and refer to a polymer of amino acids of any length. This polymer may be linear, branched, or cyclic. The amino acid may be natural or non-natural and may be a modified amino acid. The term can also encompass one assembled into a complex of multiple polypeptide chains. The term also encompasses natural or artificially modified amino acid polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification (eg, conjugation with a labeling component). This definition also includes, for example, polypeptides containing one or more analogs of amino acids (eg, including unnatural amino acids, etc.), peptide-like compounds (eg, peptoids) and other modifications known in the art. Is done. The protein of the present invention (for example, IKAROS) can be expressed in each host in either a eukaryotic cell or a prokaryotic cell by incorporating a DNA encoding each desired chain gene into an appropriate vector. A desired protein can be obtained by introducing using an expression vector and expressing each chain. Host cells that can be used to express IKAROS are not particularly limited, and prokaryotic host cells such as Escherichia coli and Bacillus subtilis, and true cells such as yeast, fungi, insect cells, plants and plant cells, and mammalian cells. A nuclear host may be mentioned. A vector constructed to express the desired IKAROS or the like is transformed into the above by transformation, transfection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate precipitation, Agrobacterium method, direct microinjection, etc. In the host cell. Cells containing the vector are grown in an appropriate medium to produce IKAROS and the like used in the present invention, and purified from the cells or the medium to obtain IKAROS and the like. Purification can be performed using size exclusion chromatography, HPLC, ion exchange chromatography, immunoaffinity chromatography, and the like.

  In the present specification, the “amino acid” may be natural or non-natural as long as it satisfies the object of the present invention.

  As used herein, “polynucleotide”, “oligonucleotide” and “nucleic acid” are interchangeable and are used interchangeably herein and refer to a nucleotide polymer of any length. The term also includes “oligonucleotide derivatives” or “polynucleotide derivatives”. “Oligonucleotide derivatives” or “polynucleotide derivatives” refer to oligonucleotides or polynucleotides that include derivatives of nucleotides or that have unusual linkages between nucleotides, and are used interchangeably. Specific examples of such oligonucleotides include, for example, 2′-O-methyl-ribonucleotides, oligonucleotide derivatives in which phosphodiester bonds in oligonucleotides are converted to phosphorothioate bonds, and phosphodiester bonds in oligonucleotides. Derivative converted to N3′-P5 ′ phosphoramidate bond, oligonucleotide derivative in which ribose and phosphodiester bond in oligonucleotide are converted to peptide nucleic acid bond, uracil in oligonucleotide is C− Oligonucleotide derivatives substituted with 5-propynyluracil, oligonucleotide derivatives wherein uracil in oligonucleotide is substituted with C-5 thiazole uracil, cytosine in oligonucleotide is C-5 propynylcytosine Substituted oligonucleotide derivatives, oligonucleotide derivatives in which the cytosine in the oligonucleotide is replaced with phenoxazine-modified cytosine, oligonucleotide derivatives in which the ribose in DNA is replaced with 2'-O-propylribose Examples thereof include oligonucleotide derivatives in which the ribose in the oligonucleotide is substituted with 2′-methoxyethoxyribose. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as those explicitly indicated. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol .. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). As used herein, “nucleic acid” is also used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide. In the present specification, the “nucleotide” may be natural or non-natural.

  As used herein, “gene” refers to a factor that defines a genetic trait. Usually arranged in a certain order on the chromosome. A gene that defines the primary structure of a protein is called a structural gene, and a gene that affects its expression is called a regulatory gene. As used herein, “gene” may refer to “polynucleotide”, “oligonucleotide”, and “nucleic acid”.

(Description of Preferred Embodiment)
The description of the preferred embodiment is described below, but it should be understood that this embodiment is an illustration of the present invention and that the scope of the present invention is not limited to such a preferred embodiment. It should be understood that those skilled in the art can easily make modifications, changes and the like within the scope of the present invention with reference to the following preferred embodiments. It should also be understood that any embodiment may be combined.

(Anti-inflammatory drugs through inhibition of IKAROS (IKZF1))
In one aspect, the present invention provides an anti-inflammatory agent comprising an IKAROS (IKZF1) inhibitor. Before the present invention was disclosed, it was not known that IKAROS was involved in inflammation, and the present inventors found for the first time that IKAROS inhibitors suppressed or eliminated inflammation. It was confirmed by this.

In one embodiment, the IKAROS inhibitor may include PGE ₂ , anti-IKAROS siRNA, anti-IKAROS antibody, and the like. In certain embodiments, compounds that inhibit the action of polyI: C can also be used as IKAROS inhibitors.

In one embodiment, the compound that inhibits the action of polyI: C includes prostaglandin E ₂ (PGE ₂ ), rebamipide <the 62nd Annual Meeting of the Japanese Society of Allergology (http: //jja.jsaweb) .jp / am / view.php? pubdate = 20121025 & dir = 2012a & number = 12a_on640O64-4); UetaM, Sotozono C, Yokoi N, Kinoshita S: Rebamipide Suppresses PolyI: C-StimulatedCytokine Production in Human Conjunctival Epithelial Cells. J Ocul Pharmacol Sep; 29 (7): 688-93. And WO 2013108644). )> In addition to EP3 agonists and EP2 agonists (references include Ueta M, Matsuoka T, Yokoi N, Kinoshita S: Prostaglandin E2 suppresses polyinosine-polycytidylic acid (polyI: C) -stimulated cytokine production via prostaglandin (EP) 2 and 3 in human conjunctival epithelial cells.Br J Ophthalmol.2011; 95 (6): 859-863 .; and Ueta M, Sotozono C, Yokoi N, Kinoshita S: Rebamipide Suppresses PolyI: C-Stimulated Cytokine Production in Human Conjunctival Epithelial Cells. See J Ocul Pharmacol Ther. 2013 Sep; 29 (7): 688-93.). Although not wishing to be bound by theory, polyI: C is considered to be via TLR3, and MDA5 or RIG-1 having IPS1 as an adapter factor may also be via. IPS1 is an adapter factor for MDA5 and RIG-1, and it has been reported that polyI: C-inducible cytokines in the conjunctival epithelium are also suppressed in IPS-1 KO mice (Ueta M, Kawai T, Yokoi N, Akira S). Kinoshita S: Contribution of IPS-1 to poly I: C-induced cytokine production in conjunctival epithelial cells. See Biochem Biophys Res Commun. 2011; 404 (1): 419-423).

  In one embodiment, the anti-inflammatory drug targets epithelial tissue or epithelial cells. In the past, epithelial cells were thought to be unrelated to inflammation, but the present inventors have found that this is related. By controlling the dynamics and activation of immune cells using the target as epithelial cells, local administration is facilitated, and there is a substantial merit that side effects can be drastically reduced. Compounds that have poor tissue permeability and are likely to act selectively on epithelial cells are preferred. The epithelial cells referred to in the present invention refer to the “epidermis” covering the body surface and the “epithelium (narrow sense)” constituting the mucous membrane of a luminal organ. Although it has been thought that it only constitutes a structural and functional barrier against foreign antigens, it has become clear that epithelial cells are greatly involved in the control of inflammation. The development of new inflammation control methods that target epithelial cells that are completely different from existing inflammation control methods can be said to contribute to the realization of a safe and secure society by providing appropriate treatment methods and extending healthy life expectancy.

In one embodiment, the inflammation targeted by the present invention is inflammation caused by IKAROS. Although inflammation is to follow a complex path, the present invention, where IKAROS has been found to be involved in inflammation, TLR3, EP3 routes (prostaglandin E ₂ type 3 receptor) Linkage with mediated inflammation is also found in the present invention, and inflammation related to these pathways is specific inflammation and can be preferably used as a subject to be treated according to the present invention.

  In one embodiment, the inflammation targeted by the present invention is inflammation resulting from increased expression of IKAROS. As used herein, “enhanced expression” refers to expression at a level significantly higher than the level at which it is normally expressed.

In another embodiment, the inflammation is inflammation involving the epithelium due to IKAROS. In a more specific embodiment, the inflammation targeted by the present invention is an inflammation involving IKAROS and TLR3 and / or EP3 in the epithelium. While not wishing to be bound by theory, since polyI: C is a ligand for TLR3, the target of the present invention is based on the information revealed in the present invention and is also an inflammation involving IKAROS and TLR3. It can be said that it was not known that inflammation involving both IKAROS and TLR3 could be targeted. Therefore, the therapeutic agent for this IKAROS expression-enhanced disease cannot be predicted based only on the existing literature that discusses the relationship between PGE ₂ and polyI: C and allergy. Further, as far as the inventors know, there is no document that reports the relationship between TLR3 and IKAROS. Therefore, it can be said that the treatment of “inflammation involving IKAROS and TLR3” with the present IKAROS inhibitor cannot be predicted based on the knowledge of literature regarding “inflammation involving TLR3” alone.

  In certain embodiments, the inflammation targeted by the present invention is due to an allergic disease, typically Stevens-Johnson syndrome, asthma, contact dermatitis, acute dermatitis, atopic dermatitis, allergic Examples include conjunctivitis and atopic keratoconjunctivitis, but are not limited thereto. Epithelial cells constitute a structural and functional barrier against foreign antigens. Recently, however, it has been reported using mouse models that the epithelial cells are greatly involved in the pathogenesis of inflammatory diseases. Mice that are specifically deficient in the intestinal epithelium of NEMO molecules required for NFkB activation develop inflammatory bowel disease (Nenci A, et al. Nature 2007, 446 (7135): 557-61). Further, TSLP (Thymic lymphopoietin) identified as a lymphocyte growth factor causes atopic dermatitis by being expressed in the epidermis (Yoo J, et al. J Exp Med 2005, 202: 541-9), Bronchial asthma is caused by expression in the tracheal epithelium (Zhou B, et al. Nat Immunol 2005, 6, 1047-1053). From these, it is understood that the inflammation and inflammatory diseases targeted by the present invention can be exemplified by these epithelial related diseases.

  In another embodiment, the anti-inflammatory agent of the present invention can be administered as a topical agent (eg, an external preparation, an eye drop, a nasal drop or an inhalant). Although not wishing to be bound by theory, local administration was facilitated because the kinetics and activation of immune cells can be controlled using epithelial cells as targets. And by allowing local administration, a drastic reduction in side effects is expected. In addition, since local administration targeting epithelial cells requires a small amount of the control molecule for effect expression, it is expected to be effective in a small amount. There is also an advantage that it is not necessary to consider absorption distribution metabolism excretion (ADME). This is because reaching the deep tissue is unnecessary. In addition, the control molecule design that retains on the epithelial cell surface for a long time makes it possible to further reduce the dose necessary for expression of the effect, and further side effect reduction can be expected. Since the present invention targets epithelial cells as a control target, it is possible to administer the control compound locally (application, transdermal, ophthalmic, and nasal administration), and the play of side effects that is the greatest barrier to drug development. Realization. Conventional inflammation control methods that directly suppress and control immune cells are prone to immunodeficiency and often induce infections. However, the epithelial cell-mediated inflammation control method developed in this study controls and suppresses only local immune cells via epithelial cells, so it does not enter an immunodeficient state. Reduction can be expected. The inflammation control technology of the present invention through an inflammation control mechanism by epithelial cells may be a major player in future inflammation treatment, replacing the conventional inflammation control technology. Although not wishing to be bound by theory, the present invention aims to create a control molecule suitable for local administration for the purpose of acting on epithelial cells from the beginning. Considering that it is a tissue hormone receptor that has a natural function, it is in harmony with the target's natural workings, and it is used for drug discovery aimed at conventional systemic administration (for example, various antibiotics, atropine, steroids, NSAIDS, β1 agonist, β2 agonist, PGE1, salazosulfapyridine, FK506, cyclosporine, VEGF antibody, heparin, adrenaline). On the other hand, some of them have been developed on the premise of local administration from the beginning because they are difficult to use or cannot be used for the whole body (no side effects or effects can be expected). The representatives are Botox (lid convulsions, unilateral facial convulsions, spastic torticollis, strabismus, facial tics, hyperhidrosis, migraine), xalatan, hyaluronic acid preparation (joint injection), fublast spray (wound healing), aptamer (Macugen: age-related macular disease). Since the present invention is an inflammation control technique targeting epithelial cells, it can be administered locally for the purpose of acting on epithelial cells from the beginning, so there is little need to consider the side effects associated with pharmacokinetics and systemic administration. A wide selection is possible.

  Until now, the target of inflammation control has been immune cells, so that side effects such as induction of infection by systemically administered drugs, diabetes, gastric ulcer, osteoporosis, cataract and glaucoma are inevitable. Since the present invention targets epithelial cells as a control target, it is possible to administer the control compound locally (application, transdermal, ophthalmic, and nasal administration), and the play of side effects that is the greatest barrier to drug development. It is thought that it realizes the target reduction. One of the challenges of the drug discovery process is the difficulty in designing compounds that act as specifically as possible on the organ or tissue that is the disease site. However, the method of controlling inflammation targeting epithelial cells can be applied directly to the affected area by local administration. It can act only on certain epithelial cells, and has a great advantage that a control molecule can be designed without considering ADME (A: absorption, D: distribution, M: metabolism, E: excretion).

  In one preferred embodiment, the anti-inflammatory agent of the invention is for the treatment or prevention of inflammation in mucosal tissue.

  In another embodiment, the anti-inflammatory agent of the invention is for the treatment or prevention of inflammation in the eye or skin.

  In a further embodiment, the anti-inflammatory agent of the invention is for the treatment or prevention of inflammation in the eye.

  In a further embodiment, the anti-inflammatory agent of the present invention is an external preparation, eye drops, nasal drops or inhalants.

  The present invention provides an IKAROS inhibitor, for example, a prophylactic and / or therapeutic agent for an inflammatory disease containing a substance that inhibits the expression or function of IKAROS.

  In the present specification, “drug”, “agent” or “factor” (both corresponding to “agent” in English) are used interchangeably in a broad sense, and so long as they can achieve their intended purpose. It may be a substance or other element (for example, energy such as light, radioactivity, heat, electricity, etc.) (for example, “inhibitor” is an agent that “inhibits” a target substance) ). Such substances include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, RNA such as mRNA), poly Saccharides, oligosaccharides, lipids, small organic molecules (for example, hormones, ligands, signaling substances, small organic molecules, molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.)) , These complex molecules are included, but not limited thereto. As a factor specific for a polynucleotide, typically, a polynucleotide having a certain sequence homology to the sequence of the polynucleotide (for example, 70% or more sequence identity) and complementarity, Examples include, but are not limited to, a polypeptide such as a transcription factor that binds to the promoter region. Factors specific for a polypeptide typically include an antibody specifically directed against the polypeptide or a derivative or analog thereof (eg, a single chain antibody), and the polypeptide is a receptor. Alternatively, specific ligands or receptors in the case of ligands, and substrates thereof when the polypeptide is an enzyme include, but are not limited to.

(Substance that inhibits the expression of IKAROS)
In the present invention, the “substance that inhibits the expression of IKAROS” means any level of the transcription level of the nucleic acid encoding IKAROS (IKAROS gene), the level of post-transcriptional regulation, the level of translation into IKAROS protein, the level of post-translational modification, It may be one that works. Therefore, as a substance that inhibits the expression of IKAROS, for example, a substance that inhibits the transcription of the IKAROS gene (eg, antigene), a substance that inhibits the processing of the initial transcript to mRNA, and the transport of mRNA to the cytoplasm is inhibited. Substances that inhibit translation of IKAROS from mRNA (eg, antisense nucleic acid, miRNA), substances that degrade mRNA (eg, siRNA, ribozyme), and substances that inhibit post-translational modification of the initial translation product . Any substance acting at any stage can be preferably used, but more preferably, a substance selected from the group consisting of the following (1) to (3) is exemplified.
(1) an antisense nucleic acid against a transcript of the IKAROS gene,
(2) a ribozyme nucleic acid for the transcript of the IKAROS gene,
(3) A nucleic acid having RNAi activity for a transcription product of the IKAROS gene or a precursor thereof.

  Here, a preferable example of the transcription product is mRNA.

  As a substance that specifically inhibits the translation of IKAROS gene from mRNA to IKAROS (or degrades mRNA), preferably, a base sequence complementary to or substantially complementary to the base sequence of these mRNAs or a part thereof The nucleic acid containing is mentioned.

  The nucleotide sequence substantially complementary to the nucleotide sequence of the mRNA of the IKAROS gene binds to the target sequence of the mRNA under physiological conditions of IKAROS producing cells (eg, neutrophils) in the mammal to be administered. A base sequence having a degree of complementarity that can inhibit the translation (or cleave the target sequence), specifically, for example, a base sequence that is completely complementary to the base sequence of the mRNA (ie, , The base sequence of the complementary strand of mRNA) and a base sequence having a homology of about 90% or more, preferably about 95% or more, more preferably about 97% or more with respect to the overlapping region.

  The “base sequence homology” in the present invention uses the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Alignment Search Tool) and the following conditions (expectation value = 10; allow gap; filtering = ON; Match score = 1; mismatch score = -3).

More specifically, the base sequence complementary or substantially complementary to the base sequence of the mRNA of the IKAROS gene includes the following (k) or (l):
(K) a base sequence complementary or substantially complementary to the base sequence represented by SEQ ID NO: 1;
(L) Complementary to a sequence encoding a protein that hybridizes with a complementary strand sequence of the base sequence represented by SEQ ID NO: 1 under stringent conditions and that has an activity of promoting an inflammatory reaction Or a substantially complementary nucleotide sequence;
Is mentioned. The stringent conditions are as described above.

  As a preferable example of mRNA of IKAROS gene, human IKAROS mRNA containing the nucleotide sequence represented by SEQ ID NO: 1 (Genbank Accession No. NM_052972), or their orthologs in other mammals (for example, mouse IKAROS (SEQ ID NO: 3, Genbank Accession No. NM — 029796) and the like, and splice variants, allelic variants, polymorphic variants and the like thereof.

  The nucleotide sequence of the IKAROS gene mRNA and the “part of the complementary or substantially complementary nucleotide sequence” are capable of specifically binding to the mRNA of the IKAROS gene and translating the protein from the mRNA. The length and position are not particularly limited as long as they can inhibit (or degrade the mRNA), but at least 10 bases are complementary or substantially complementary to the target sequence from the viewpoint of sequence specificity. As mentioned above, it preferably contains about 15 bases or more.

Specifically, the nucleic acid comprising any one of the following (1) to (3) is preferably exemplified as a nucleic acid complementary to or substantially complementary to the nucleotide sequence of mRNA of the IKAROS gene or a part thereof: Is:
(1) an antisense nucleic acid against mRNA of the IKAROS gene,
(2) a ribozyme nucleic acid against mRNA of the IKAROS gene,
(3) A nucleic acid having RNAi activity against the mRNA of the IKAROS gene or a precursor thereof.

(1) Antisense nucleic acid against mRNA of IKAROS gene “Antisense nucleic acid against mRNA of IKAROS gene” in the present invention includes a base sequence complementary to or substantially complementary to the base sequence of the mRNA or a part thereof. It is a nucleic acid and has a function of suppressing protein synthesis by forming a specific and stable duplex with a target mRNA.

  Antisense nucleic acids are polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, Other polymers with non-nucleotide backbones (eg, commercially available protein nucleic acids and synthetic sequence specific nucleic acid polymers) or other polymers containing special linkages, provided that the polymer is a base as found in DNA or RNA And a nucleotide having a configuration that allows attachment of a base). They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, unmodified polynucleotides (or unmodified oligonucleotides), known modifications Additions, such as those with labels known in the art, capped, methylated, one or more natural nucleotides replaced with analogs, intramolecular nucleotide modifications Such as those having uncharged bonds (eg methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds or sulfur-containing bonds (eg phosphorothioates, phosphorodithioates, etc.) Things such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, Null peptide, poly-L-lysine, etc.) and sugars (eg, monosaccharides), etc., side chain groups, intercurrent compounds (eg, acridine, psoralen, etc.), chelate compounds (eg, , Metals, radioactive metals, boron, oxidizing metals, etc.), alkylating agents, and modified bonds (eg, alpha anomeric nucleic acids) Also good. Here, the “nucleoside”, “nucleotide” and “nucleic acid” may include not only purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleosides and modified nucleotides may also be modified at the sugar moiety, for example, one or more hydroxyl groups are replaced by halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may be converted.

  As described above, the antisense nucleic acid may be DNA or RNA, or may be a DNA / RNA chimera. When the antisense nucleic acid is DNA, the RNA: DNA hybrid formed by the target RNA and the antisense DNA can be recognized by endogenous RNase H and cause selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only the sequence in mRNA but also the sequence of the intron region in the initial translation product of the IKAROS gene. The intron sequence can be determined by comparing the genomic sequence and the cDNA base sequence of the IKAROS gene using a homology search program such as BLAST or FASTA.

  The length of the target region of the antisense nucleic acid of the present invention is not particularly limited as long as the antisense nucleic acid hybridizes, and as a result, the translation into protein: IKAROS is inhibited. The entire sequence or partial sequence of mRNA may be a short sequence of about 10 bases and a long sequence of mRNA or the initial transcript. In view of easiness of synthesis, antigenicity, intracellular migration, and the like, an oligonucleotide consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases is preferable, but not limited thereto. Specifically, 5 'end hairpin loop, 5' end 6-base pair repeat, 5 'end untranslated region, translation start codon, protein coding region, ORF translation stop codon, 3' end untranslated region of IKAROS gene A 3 ′ end palindromic region or a 3 ′ end hairpin loop or the like may be selected as a preferred target region of an antisense nucleic acid, but is not limited thereto.

  Furthermore, the antisense nucleic acid of the present invention not only hybridizes with the mRNA of the IKAROS gene and the initial transcription product to inhibit translation into protein, but also binds to these genes that are double-stranded DNA to form a triplex ( (Antigene) that can form a triplex) and inhibit transcription to RNA.

The nucleotide molecules constituting the antisense nucleic acid may be natural DNA or RNA, but various chemicals may be used to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA). Modifications can be included. For example, in order to prevent degradation by a hydrolase such as nuclease, the phosphate residue (phosphate) of each nucleotide constituting the antisense nucleic acid is chemically modified, for example, phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be substituted with a phosphate residue. In addition, the hydroxyl group at the 2 ′ position of the sugar (ribose) of each nucleotide is represented by —OR (R═CH ₃ (2′-O-Me), CH ₂ CH ₂ OCH ₃ (2′-O-MOE), CH _2. (CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.) may be substituted. Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl, etc. Is mentioned.

  The conformation of the sugar part of RNA is dominated by C2′-endo (S type) and C3′-endo (N type). In single-stranded RNA, it exists as an equilibrium between the two, but double-stranded Is fixed to the N type. Therefore, in order to give strong binding ability to the target RNA, BNA (LNA) (Imanishi), which is an RNA derivative in which the conformation of the sugar moiety is fixed to the N-type by cross-linking 2 ′ oxygen and 4 ′ carbon , T. et al., Chem. Commun., 1653-9, 2002; Jepsen, JS et al., Oligonucleotides, 14, 130-46, 2004) and ENA (Morita, K. et al., Nucleosides). (Nucleotides Nucleic Acids, 22, 1619-1621, 2003) can also be preferably used.

  The antisense oligonucleotide of the present invention determines the target sequence of mRNA or initial transcript based on the cDNA sequence or genomic DNA sequence of the IKAROS gene, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman) Etc.) can be prepared by synthesizing a complementary sequence thereto. In addition, any of the above-described antisense nucleic acids containing various modifications can be chemically synthesized by a method known per se.

(2) Ribozyme nucleic acid against mRNA of IKAROS gene As another preferred example of a nucleic acid comprising a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of IKAROS gene mRNA or a part thereof, the mRNA is used as a coding region. Examples include ribozyme nucleic acids that can be cleaved specifically inside. “Ribozyme” refers to RNA having an enzyme activity that cleaves nucleic acids in a narrow sense, but in this specification, it is used as a concept including DNA as long as it has sequence-specific nucleic acid cleaving activity. The most versatile ribozyme nucleic acid is self-splicing RNA found in infectious RNA such as viroid and virusoid, and hammerhead type and hairpin type are known. The hammerhead type exhibits enzyme activity at about 40 bases, and a few bases at both ends adjacent to the part having the hammerhead structure (about 10 bases in total) are made into a sequence complementary to the desired cleavage site of mRNA. By doing so, it is possible to specifically cleave only the target mRNA. This type of ribozyme nucleic acid has the additional advantage of not attacking genomic DNA because it uses only RNA as a substrate. When the mRNA of the IKAROS gene has a double-stranded structure itself, the target sequence is made single-stranded by using a hybrid ribozyme linked with an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase. [Proc. Natl. Acad. Sci. USA, 98 (10): 5572-5577 (2001)]. Furthermore, when the ribozyme is used in the form of an expression vector containing the DNA encoding the ribozyme, in order to promote the transfer of the transcription product to the cytoplasm, the ribozyme should be a hybrid ribozyme further linked with a tRNA-modified sequence. [Nucleic Acids Res. 29 (13): 2780-2788 (2001)].

(3) siRNA against mRNA of IKAROS gene
In the present specification, a double-stranded RNA composed of an oligo RNA complementary to the mRNA of the IKAROS gene and its complementary strand, so-called siRNA, is also complementary or substantially complementary to the nucleotide sequence of the mRNA of the IKAROS gene. Defined as encompassed by nucleic acid containing base sequence or part thereof. When a short double-stranded RNA is introduced into a cell, a phenomenon called RNA interference (RNAi), in which mRNA complementary to the RNA is degraded, has been known in nematodes, insects, plants, etc. Since it has been confirmed that this phenomenon occurs widely in animal cells [Nature, 411 (6836): 494-498 (2001)], it has been widely used as an alternative technique to the above-described antisense nucleic acids and ribozymes.

  Based on the cDNA sequence information of the target gene, siRNA can be obtained, for example, from Elbashir et al. (Genes Dev., 15, 188-200 (2001)), Teramoto et al. (FEBS Lett. 579 (13): p2878-82 (2005)). Can be designed according to the rules proposed by The target sequence of siRNA basically has a length of 15 to 50 bases, preferably 19 to 49 bases, more preferably 19 to 27 bases. For example, AA + (N) 19 (following AA, 19 Base sequence), AA + (N) 21 (base sequence of 21 bases following AA) or A + (N) 21 (base sequence of 21 bases following A).

  The nucleic acid of the present invention may have an additional base at the 5 'or 3' end. The length of the additional base is usually about 2 to 4 bases, and the total length of siRNA is 19 bases or more. The additional base may be DNA or RNA, but the use of DNA may improve the stability of the nucleic acid. Examples of such an additional base sequence include ug-3 ′, uu-3 ′, tg-3 ′, tt-3 ′, ggg-3 ′, guuu-3 ′, gttt-3 ′, and tttt-3. Examples of such sequences include, but are not limited to, ', uuuu-3'.

  Moreover, siRNA may have an overhang | projection part sequence (overhang) in 3 'terminal, and specifically, what added dTdT (dT represents the deoxythymidine residue of deoxyribonucleic acid) is mentioned. . Further, it may be a blunt end (blunt end) without end addition.

  The siRNA may have a different number of bases in the sense strand and the antisense strand, for example, “aiRNA” in which the antisense strand has a protruding portion sequence (overhang) at the 3 ′ end and the 5 ′ end. Can be mentioned. A typical aiRNA has an antisense strand consisting of 21 bases, a sense strand consisting of 15 bases, and has an overhang structure of 3 bases at both ends of the antisense strand (Sun, X. et al., Nature Biotechnology Vol 26). No. 12 p1379, International Publication No. WO2009 / 029688 pamphlet).

  The position of the target sequence is not particularly limited, but it is desirable to select the target sequence from the 5'-UTR and the start codon to about 50 bases, and from regions other than the 3'-UTR. For a candidate group of target sequences selected based on the above-mentioned rules and others, whether or not there is a homology in a 16-17 base sequence in mRNA other than the target is determined by BLAST (http: //www.ncbi.nlm Investigate using homology search software such as .nih.gov / BLAST /) to confirm the specificity of the selected target sequence. For the target sequence confirmed to be specific, a sense strand having a 3 'end overhang of TT or UU at 19-21 bases after AA (or NA), a sequence complementary to the 19-21 bases and TT or A double-stranded RNA consisting of an antisense strand having a 3 ′ terminal overhang of UU may be designed as siRNA. In addition, for the short hairpin RNA (shRNA) that is a precursor of siRNA, an arbitrary linker sequence (for example, about 5-25 bases) capable of forming a loop structure is appropriately selected, and the sense strand and the antisense strand are combined with each other. It can be designed by linking via a linker sequence.

  The sequence of siRNA and / or shRNA can be searched using search software provided free of charge on various web sites. Such sites include, for example, siRNA Target Finder (http://www.ambion.com/jp/techlib/misc/siRNA_finder.html) provided by Ambion and insert design tool for pSilencer® Expression Tool (registered trademark) http://www.ambion.com/jp/techlib/misc/psilencer_converter.html), GeneSeer provided by RNAi Codex (http://codex.cshl.edu/scripts/newsearch. Not.

  The ribonucleoside molecule constituting the siRNA may also be modified in the same manner as in the above-described antisense nucleic acid in order to improve stability, specific activity and the like. However, in the case of siRNA, if all ribonucleoside molecules in natural RNA are replaced with a modified form, RNAi activity may be lost, and therefore it is necessary to introduce a minimum modified nucleoside that allows the RISC complex to function. .

Specifically, in order to improve a part of the nucleotide molecule constituting siRNA, natural DNA, stability (chemical and / or enzyme) and specific activity (affinity with RNA) as the modification. Can be substituted with various chemically modified RNAs (see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Sym. Ser. 31, 163). For example, in order to prevent degradation by a hydrolase such as nuclease, a phosphate residue (phosphate) of each nucleotide constituting siRNA is changed to a chemically modified phosphate such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be substituted with a residue. In addition, the hydroxyl group at the 2 ′ position of the sugar (ribose) of each nucleotide is represented by —OR (R═CH ₃ (2′-O-Me), CH ₂ CH ₂ OCH ₃ (2′-O-MOE), CH _2. CH ₂ NHC (NH) NH ₂ , CH ₂ CONHCH ₃ , CH ₂ CH ₂ CN, etc.) or a fluorine atom (—F) may be substituted. Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, for example, introduction of a methyl group or a cationic functional group at the 5-position of the pyrimidine base, or substitution of the carbonyl group at the 2-position with thiocarbonyl, etc. Is mentioned. In addition, the method for modifying an antisense nucleic acid described in (1) above can be used. Or you may give the chemical modification (2'-deoxylation, 2'-H) which substitutes a part of RNA in siRNA with DNA. Alternatively, an artificial nucleic acid (LNA: Locked Nucleic Acid) in which the 2′-position and 4′-position of sugar (ribose) are cross-linked with —O—CH ₂ — and the conformation is fixed to N-type may be used.

  In addition, the sense strand and antisense strand constituting siRNA are linked via a linker to a ligand, peptide, sugar chain, antibody, lipid, positive charge, or molecular structure that specifically recognizes a receptor present on the cell surface. It may be chemically bonded to oligoarginine, Tat peptide, Rev peptide, Ant peptide or the like that adsorbs and penetrates the surface layer.

  For siRNA, the sense strand and the antisense strand of the target sequence on mRNA are respectively synthesized by a DNA / RNA automatic synthesizer, denatured at about 90 to about 95 ° C. for about 1 minute in an appropriate annealing buffer, It can be prepared by annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. It can also be prepared by synthesizing a short hairpin RNA (shRNA) serving as a precursor of siRNA and cleaving it with a dicer.

  In the present specification, a nucleic acid designed to generate siRNA against IKAROS gene mRNA in vivo also includes a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of IKAROS gene mRNA or one of the nucleotide sequences. Defined as encompassed by a nucleic acid containing a moiety. Examples of such a nucleic acid include an expression vector constructed so as to express the above-mentioned shRNA and siRNA. The shRNA is an oligo containing a base sequence in which a sense sequence and an antisense strand of a target sequence on mRNA are connected by inserting a spacer sequence (for example, about 5 to 25 bases) long enough to form a suitable loop structure. It can be prepared by designing RNA and synthesizing it with an automatic DNA / RNA synthesizer. There are tandem type and stem loop (hairpin) type in vectors expressing shRNA. In the former, siRNA sense strand expression cassette and antisense strand expression cassette are connected in tandem, and each strand is expressed and annealed in the cell to form double stranded siRNA (dsRNA). It is. On the other hand, the latter is one in which an shRNA expression cassette is inserted into a vector, in which shRNA is expressed in cells and processed by dicer to form dsRNA. As a promoter, a pol II promoter (for example, a CMV immediate early promoter) can be used, but a pol III promoter is generally used in order to cause transcription of a short RNA accurately. Examples of the polIII promoter include mouse and human U6-snRNA promoter, human H1-RNasePRNA promoter, human valine-tRNA promoter, and the like. Further, a sequence in which 4 or more Ts are continuous is used as a transcription termination signal.

  The siRNA or shRNA expression cassette thus constructed is then inserted into a plasmid vector or viral vector. As such vectors, virus vectors such as retrovirus, lentivirus, adenovirus, adeno-associated virus, herpes virus, Sendai virus, animal cell expression plasmids and the like are used.

  The siRNA is based on nucleotide sequence information, for example, 394 Applied Biosystems, Inc. It can be chemically synthesized according to a conventional method using an automatic DNA / RNA synthesizer such as a synthesizer. For example, Caruthers et al. , 1992, Methods in Enzymology 211, 3-19, Thompson et al. , International Publication No. 99/54459, Wincott et al. , 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al. , 1997, Methods Mol. Bio. 74, 59, Brennan et al. , 1998, Biotechnol Bioeng. 61, 33-45, Usman et al. , 1987 J.H. Am. Chem. Soc. 109, 7845; Scaringe et al. 1990 Nucleic Acids Res. , 18, 5433, and the method described in US Pat. No. 6,00131111. Specifically, it can be synthesized using a nucleic acid protecting group (for example, dimethoxytrityl group at the 5 'end) and a coupling group (for example, phosphoramidite at the 3' end) known to those skilled in the art. That is, the protecting group at the 5 'end is deprotected with an acid such as TCA (trichloroacetic acid) and a coupling reaction is performed. Then, after capping with an acetyl group, the next nucleic acid condensation reaction is performed. In the case of siRNA containing modified RNA or DNA, a modified RNA (for example, 2′-O-methyl nucleotide, 2′-deoxy-2′-fluoronucleotide) may be used as a raw material, and the coupling reaction These conditions can be adjusted as appropriate. When introducing a phosphorothioate bond in which the phosphate binding moiety is modified, a borage reagent (3H-1,2-benzodithiol-3-one 1,1-dioxide) can be used.

  Alternatively, oligonucleotides may be synthesized separately and joined together after synthesis, for example by ligation (Moore et al., 1992, Science 256, 9923; Draper et al. International Publication WO 93/23569; Shabarova et al. , 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997, Nucleosides & Nucleotides, onle. Et al. After hybridization or after deprotection, You may connect it to the beginning. siRNA molecules can also be synthesized by tandem synthesis. That is, both siRNA strands are synthesized as a single continuous oligonucleotide separated by a cleavable linker, which is then cleaved to generate separate siRNA fragments that are hybridized and purified. . The linker may be a polynucleotide linker or a non-nucleotide linker.

  The synthesized siRNA molecules can be purified using methods known to those skilled in the art. For example, a method of purification by gel electrophoresis or a method of purification using high performance liquid chromatography (HPLC) can be mentioned.

  Another preferred example of a nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of mRNA of the IKAROS gene or a part thereof is microRNA (miRNA) targeting the mRNA. miRNA can also be prepared according to the method described for siRNA.

  Nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of mRNA of IKAROS gene or a part thereof is provided in a special form such as liposome or microsphere, or other molecules are added. It can be provided in the form. Examples of additional forms that can be used include polycationic substances such as polylysine that act to neutralize the charge of the phosphate group skeleton, and lipids that enhance interaction with cell membranes and increase nucleic acid uptake. Hydrophobic substances such as (eg, phospholipid, cholesterol, etc.) can be mentioned. Preferred lipids for addition include cholesterol and derivatives thereof (eg, cholesteryl chloroformate, cholic acid, etc.). Such can be attached to the 3 'or 5' end of the nucleic acid and can be attached via a base, sugar, intramolecular nucleoside linkage. Examples of the other group include a cap group specifically arranged at the 3 'end or 5' end of a nucleic acid, which prevents degradation by nucleases such as exonuclease and RNase. Such capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol.

  The IKAROS expression inhibitory activity of these nucleic acids should be examined using a transformant introduced with a nucleic acid encoding IKAROS, an in vivo or in vitro IKAROS gene expression system, or an in vivo or in vitro IKAROS protein translation system. Can do.

  The substance that inhibits the expression of IKAROS in the present invention is not limited to a nucleic acid comprising a base sequence complementary to or substantially complementary to the base sequence of mRNA of the IKAROS gene as described above, or a production of IKAROS. Other substances such as low molecular weight compounds may be used as long as they are directly or indirectly inhibited. Such a substance can be obtained, for example, by the screening method of the present invention described later.

(Substance that inhibits the function of IKAROS)
In the present invention, the “substance that inhibits the function of IKAROS” may be any substance as long as IKAROS once produced functionally inhibits its function.

Specifically, examples of the substance that suppresses the function of IKAROS include antibodies against IKAROS. The antibody may be a polyclonal antibody or a monoclonal antibody. These antibodies can be produced according to per se known antibody or antiserum production methods. The isotype of the antibody is not particularly limited, but preferably includes IgG, IgM or IgA, and particularly preferably IgG. The antibody is not particularly limited as long as it has at least a complementarity determining region (CDR) for specifically recognizing and binding to a target antigen. In addition to a complete antibody molecule, for example, Fab, Fab ′, F (Ab ′) ₂ such as a fragment, scFv, scFv-Fc, a conjugate molecule prepared by genetic engineering such as a minibody, diabody, or a molecule having a protein stabilizing action such as polyethylene glycol (PEG) They may be modified derivatives thereof.

  In a preferred embodiment, since an antibody against IKAROS is used as a pharmaceutical for human administration, the antibody (preferably a monoclonal antibody) is an antibody having a reduced risk of showing antigenicity when administered to a human. Specific examples include fully human antibodies, humanized antibodies, mouse-human chimeric antibodies, and particularly preferably fully human antibodies. Humanized antibodies and chimeric antibodies can be produced by genetic engineering according to conventional methods. In addition, a fully human antibody can be produced from a human-human (or mouse) hybridoma, but in order to provide a large amount of antibody stably and at low cost, a human antibody-producing mouse or a phage display method is used. It is desirable to manufacture using.

  Another preferred substance that suppresses the function of IKAROS is a low molecular weight compound suitable for Lipinski's Rule. Such a compound can be obtained, for example, using the screening method of the present invention described later.

  A substance that inhibits the expression or function of IKAROS exhibits an activity of suppressing an inflammatory response promoted by IKAROS, and thus is useful as an anti-inflammatory agent for the prevention and / or treatment of inflammatory diseases such as inflammatory bowel disease. is there.

  Therefore, a medicament containing a substance that inhibits the expression or function of IKAROS can be used as a preventive and / or therapeutic agent (anti-inflammatory agent) for inflammatory diseases.

(Pharmaceutical containing antisense nucleic acid, ribozyme nucleic acid, siRNA and precursor thereof)
An antisense nucleic acid of the present invention that can bind complementarily to the transcript of the IKAROS gene and suppress the translation of the protein from the transcript, or a homologous (or complementary) to the transcript (mRNA) of the IKAROS gene ) SiRNA (or ribozyme) having a base sequence and capable of cleaving the transcript with the transcript as a target, and shRNA that is a precursor of the siRNA (hereinafter collectively referred to as “the nucleic acid of the present invention”) Can be used as an anti-inflammatory agent because it suppresses the expression of IKAROS in vivo and suppresses the inflammatory reaction.

  The medicament containing the nucleic acid of the present invention has low toxicity and can be used as a liquid or as a pharmaceutical composition of an appropriate dosage form as a human or non-human mammal (eg, rat, rabbit, sheep, pig, cow, cat, It can be administered orally or parenterally (eg, intravascular administration, subcutaneous administration, etc.) to dogs, monkeys, etc.

  When the nucleic acid of the present invention is used as the above-mentioned anti-inflammatory agent, it can be formulated and administered according to a method known per se. That is, the nucleic acid of the present invention is inserted alone or in a functional manner into an appropriate expression vector for mammalian cells such as a retrovirus vector, adenovirus vector, adenovirus associated virus vector, etc., and then formulated according to conventional means. can do. The nucleic acid can be administered as it is or together with an auxiliary agent for promoting intake by a catheter such as a gene gun or a hydrogel catheter. Alternatively, it can be aerosolized and locally administered into the trachea as an inhalant.

  Furthermore, for the purpose of improving the pharmacokinetics, prolonging the half-life, and improving the efficiency of cellular uptake, the nucleic acid may be formulated (injection) alone or with a carrier such as liposome and administered intravenously, subcutaneously, etc. .

  The nucleic acids of the invention may be administered per se or as a suitable pharmaceutical composition. The pharmaceutical composition used for administration may contain the nucleic acid of the present invention and a pharmacologically acceptable carrier, diluent or excipient. Such pharmaceutical compositions are provided as dosage forms suitable for oral or parenteral administration.

  As a composition for parenteral administration, for example, injections, suppositories and the like are used. Injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included. Such an injection can be prepared according to a known method. As a method for preparing an injection, it can be prepared, for example, by dissolving, suspending or emulsifying the nucleic acid of the present invention in a sterile aqueous liquid or oily liquid usually used for injection. As an aqueous solution for injection, for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) additive of hydrogenated castor oil)), and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent. The prepared injection solution is preferably filled in a suitable ampoule. Suppositories used for rectal administration may be prepared by mixing the nucleic acid with a normal suppository base.

  Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like. Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field. As the carrier and excipient for tablets, for example, lactose, starch, sucrose, and magnesium stearate are used.

  The above parenteral or oral pharmaceutical compositions are conveniently prepared in dosage unit form to suit the dosage of the active ingredient. Examples of the dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories. The nucleic acid of the present invention is preferably contained, for example, usually in an amount of about 5 to about 500 mg per dosage unit form, especially about 5 to about 100 mg for injections and about 10 to about 250 mg for other dosage forms.

  The dose of the above-mentioned medicament containing the nucleic acid of the present invention varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, inflammatory bowel such as ulcerative colitis (UC) or Crohn's disease (CD) When used for the treatment / prevention of diseases (IBD), the nucleic acid of the present invention is usually about 0.01 to about 20 mg / kg body weight, preferably about 0.1 to about 10 mg / kg, as a single dose. It is convenient to administer about kg body weight, more preferably about 0.1 to about 5 mg / kg body weight by intravenous injection about 1 to 5 times a day, preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.

  Each of the above-described compositions may appropriately contain other active ingredients as long as an undesirable interaction is not caused by blending with the nucleic acid of the present invention.

(Pharmaceuticals containing antibodies against IKAROS, low molecular weight compounds that inhibit the expression or function of IKAROS)
An antibody against IKAROS or a low molecular weight compound that inhibits the expression or function of IKAROS can inhibit the production or function of IKAROS. Therefore, since these substances inhibit the expression or function of IKAROS in vivo, they can be used as preventive and / or therapeutic agents for inflammatory diseases.

  A medicine containing the above-mentioned antibody or low molecular weight compound has low toxicity, and it is used as a liquid or as a pharmaceutical composition of an appropriate dosage form as a human or mammal (eg, rat, rabbit, sheep, pig, cow, cat). Can be administered orally or parenterally (eg, intravascular administration, subcutaneous administration, etc.).

  The above-described antibodies and low-molecular compounds may be administered per se, or may be administered as an appropriate pharmaceutical composition. The pharmaceutical composition used for administration may contain the above antibody or low molecular compound or a salt thereof and a pharmacologically acceptable carrier, diluent or excipient. Such pharmaceutical compositions are provided as dosage forms suitable for oral or parenteral administration.

  As a composition for parenteral administration, for example, injections, suppositories and the like are used. Injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included. Such an injection can be prepared according to a known method. As a method for preparing an injection, it can be prepared, for example, by dissolving, suspending or emulsifying the antibody of the present invention or a low molecular weight compound or a salt thereof in a sterile aqueous liquid or oily liquid usually used for injection. As an aqueous solution for injection, for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) additive of hydrogenated castor oil)), and the like. As the oily liquid, for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent. The prepared injection solution is preferably filled in a suitable ampoule. A suppository used for rectal administration may be prepared by mixing the above-described antibody or a salt thereof with an ordinary suppository base.

  Compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like. Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field. As the carrier and excipient for tablets, for example, lactose, starch, sucrose, and magnesium stearate are used.

  The above parenteral or oral pharmaceutical compositions are conveniently prepared in dosage unit form to suit the dosage of the active ingredient. Examples of the dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories. The antibody or low molecular weight compound is usually contained in an amount of about 5 to about 500 mg per dosage unit form, especially about 5 to about 100 mg for injections, and about 10 to about 250 mg for other dosage forms.

  The dose of the above-mentioned pharmaceutical containing the above-mentioned antibody or low-molecular compound or a salt thereof varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, when used for treatment / prevention of IBD Is usually about 0.01 to about 20 mg / kg body weight, preferably about 0.1 to about 10 mg / kg body weight, more preferably about 0.1 to about 5 mg, in a single dose of antibody or low molecular weight compound. It is convenient to administer about / kg body weight by intravenous injection about 1 to 5 times a day, preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.

  Each of the above-described compositions may contain other active ingredients as long as an undesirable interaction is not caused by blending with the antibody or the low molecular weight compound.

  A pharmaceutical composition containing the above-mentioned antisense nucleic acid against IKAROS, ribozyme nucleic acid, siRNA and its precursor, an antibody against IKAROS, a low molecular compound that suppresses the expression or function of IKAROS, etc. It can be used to treat, prevent, or prevent progression of inflammatory diseases. Specific examples of inflammatory diseases include inflammatory bowel diseases (IBD) such as ulcerative colitis (UC) and Crohn's disease (CD), rheumatoid arthritis (RA), Behcet's disease, Castleman's disease and the like. Examples include, but are not limited to, autoimmune diseases, and any inflammation in which IKAROS is involved in exacerbating the disease state is included in the inflammatory diseases that are the subject of the present invention.

  Treatment of inflammatory diseases using a pharmaceutical composition containing the above-mentioned antisense nucleic acid, ribozyme nucleic acid, siRNA and precursor thereof against IKAROS, an antibody against IKAROS, a low molecular compound that suppresses the expression or function of IKAROS, and the like Or, when used for prevention, it may be used alone or in combination with one or more drugs having anti-inflammatory action.

  The drugs used in combination are not particularly limited. For example, mesalazine, corticosteroids (eg, betamethasone, prednisolone, hydrocortisone, dexamethasone, etc.), nonsteroidal anti-inflammatory drugs (NSAIDs; eg, salicylic acid, anthranilic acid) , Aryl acids, propionates, oxicams, pilins), anti-TNFα antibodies (influximab, adalimumab), anti-rheumatic drugs (eg, immunomodulators such as actarit, immunosuppressants such as methotrexate, anti-TNFα antibodies And biological preparations such as etanercept).

(Screening of drug candidate compounds or anti-inflammatory agents for diseases such as inflammation)
As described above, inhibition of IKAROS expression and / or function suppresses the inflammatory response. Therefore, a compound that inhibits the expression and / or function of IKAROS can be used as a prophylactic and / or therapeutic agent (anti-inflammatory agent) for inflammatory diseases.

  Therefore, cells that produce or enhance the expression of IKAROS should be used as a tool for screening anti-inflammatory substances by using the expression level and / or function of IKAROS (or IKAROS gene) as an index. Can do.

  When screening for a compound that inhibits the expression or function of IKAROS, the screening method involves culturing cells capable of producing IKAROS in the presence and absence of a test substance, and expression of IKAROS under both conditions. Comparing the amount or degree of function. In addition, a compound that inhibits the function of IKAROS can also be screened by testing the binding ability to the purified IKAROS protein and the binding inhibitory activity between the IKAROS protein and its binding protein (for example, an antibody against IKAROS). it can.

  Therefore, in one aspect, the present invention is under the control of the following steps (1) to (3): (1) a cell having the ability to produce IKAROS, such as the IKAROS gene or a transcriptional regulatory region of the gene Contacting a cell containing a nucleic acid encoding a reporter protein with a test substance; (2) measuring an expression level of the IKAROS gene or IKAROS protein or reporter protein in the cell; and (3) non-test substance Screening for an anti-inflammatory substance, comprising a step of selecting, as a candidate for an anti-inflammatory substance, a test substance in which the expression level of the IKAROS gene, the IKAROS protein or the reporter protein is reduced as compared with the case where it is measured in the presence Provide a method.

  Cells having the ability to produce IKAROS used in the above screening method may be human or other mammalian cells that naturally express them or biological samples (eg, blood, tissues, organs, etc.) containing them. There are no particular restrictions. In the case of blood, tissues, organs, etc. derived from non-human animals, they may be isolated from the living body and cultured, or the test substance is administered to the living body itself, and these biological samples are isolated after a certain period of time. May be.

  Examples of cells having the ability to produce IKAROS include various transformants prepared by known and commonly used genetic engineering techniques. As the host, for example, animal cells such as H4IIE-C3 cells, HepG2 cells, HEK293 cells, COS7 cells and CHO cells are preferably used.

  Specifically, it hybridizes under stringent conditions with the DNA encoding IKAROS (that is, the base sequence represented by SEQ ID NO: 1 or a base sequence complementary to the base sequence, and SEQ ID NO: 2). A DNA comprising a nucleotide sequence encoding a polypeptide having the same function as the protein consisting of the amino acid sequence shown) and ligated downstream of a promoter in an appropriate expression vector, and introduced into a host animal cell. be able to.

  A method for preparing a gene encoding IKAROS will be described below.

  The gene encoding IKAROS can be obtained by a conventional genetic engineering method (for example, Sambrook J., Frisch EF, Maniatis T., Molecular Cloning 2nd edition, published by Cold Spring Harbor Laboratory (Cold)). (Method described in Spring Harbor Laboratory press) and the like. That is, DNA encoding IKAROS is, for example, synthesized based on the nucleotide sequence represented by SEQ ID NO: 1 using an appropriate oligonucleotide as a probe or primer, and is derived from a cell or tissue that produces IKAROS as described above. Cloning can be performed from a library using a hybridization method or a PCR method. Hybridization can be performed, for example, according to the method described in Molecular Cloning 2nd edition (above). When a commercially available library is used, hybridization can be performed according to the method described in the instruction manual attached to the library.

The DNA base sequence can be determined using a known kit such as Mutan ^™ -super Express Km (Takara Shuzo), Mutan ^™ -K (Takara Shuzo), etc., using the ODA-LA PCR method, the Gapped duplex method, The conversion can be carried out according to a method known per se such as the Kunkel method or a method analogous thereto.

  The cloned DNA can be used as it is or after digestion with a restriction enzyme or addition of a linker, if desired. The DNA may have ATG as a translation initiation codon on the 5 'end side, and may have TAA, TGA or TAG as a translation termination codon on the 3' end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.

  Next, using the obtained IKAROS gene, an IKAROS protein can be produced and obtained according to a normal genetic engineering method.

  For example, a culture obtained by preparing a plasmid capable of expressing the IKAROS gene in a host cell, introducing the plasmid into the host cell, transforming it, and further culturing the transformed host cell (transformant). What is necessary is just to acquire IKAROS from a thing. Examples of the plasmid include a promoter that can replicate autonomously in a host cell, can replicate autonomously, can be easily isolated and purified from the host cell, and can function in the host cell. Preferred examples include those in which a gene encoding IKAROS is introduced into an expression vector having a detectable marker. Various types of expression vectors are commercially available.

  For example, an expression vector used for expression in E. coli is an expression vector containing a promoter such as lac, trp, tac, etc., and these are commercially available from Pharmacia, Takara Bio and the like. Restriction enzymes used for introducing a gene encoding IKAROS into the expression vector are also commercially available from Takara Bio and others. If it is necessary to induce further high expression, a ribosome binding region may be linked upstream of the DNA encoding IKAROS. Examples of the ribosome binding region used include Guarente L. et al. (Cell 20, p543) and Taniguchi et al. (Genetics of Industrial Microorganisms, p202, Kodansha).

  In addition, animal cell expression plasmids (eg, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); bacteriophages such as λ phage; animal virus vectors such as retrovirus, vaccinia virus, adenovirus, etc. It can also be used. The promoter may be any promoter as long as it is appropriate for the host used for gene expression. For example, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, β actin A gene promoter, aP2 gene promoter, etc. are used. Of these, EF-α promoter, CAG promoter, CMV promoter, SRα promoter and the like are preferable.

  In addition to the above, an expression vector containing an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 origin of replication (hereinafter sometimes abbreviated as SV40ori) and the like is used as desired. it can.

Examples of the selection marker include a dihydrofolate reductase gene (hereinafter abbreviated as dhfr, methotrexate (MTX) resistance), an ampicillin resistance gene (hereinafter abbreviated as amp ^r ), a neomycin resistance gene ( hereinafter sometimes abbreviated as neo ^r, include G418 resistance) and the like. In particular, when dhfr gene-deficient Chinese hamster cells are used and the dhfr gene is used as a selection marker, the target gene can be selected using a medium not containing thymidine.

  An IKAROS-expressing cell can be produced by transforming a host with an expression vector containing the above-described DNA encoding IKAROS.

Examples of host cells include prokaryotic or eukaryotic microbial cells, insect cells, or mammalian cells. Examples of mammalian cells include HepG2 cells, HEK293 cells, HeLa cells, human FL cells, monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary cells (hereinafter abbreviated as CHO cells), dhfr gene-deficient CHO cells ( Hereinafter, abbreviated as CHO (dhfr ⁻ ) cells), mouse L cells, mouse AtT-20 cells, mouse myeloma cells, rat H4IIE-C3 cells, rat GH3 cells, and the like. For example, Escherichia coli and the like can be preferably mentioned from the viewpoint of easy preparation of IKAROS in large quantities.

  The plasmid obtained as described above can be introduced into the host cell by an ordinary genetic engineering method. The transformant can be cultured by a conventional method used for culturing microorganisms, insect cells or mammalian cells. For example, in the case of Escherichia coli, culturing is performed in a medium appropriately containing an appropriate carbon source, nitrogen source, and micronutrients such as vitamins. The culture method may be any of solid culture and liquid culture, and preferred examples include liquid culture such as aeration and agitation culture.

  Transformation can be performed by calcium phosphate coprecipitation method, PEG method, electroporation method, microinjection method, lipofection method and the like. For example, the method described in Cell Engineering Supplement 8 New Cell Engineering Experiment Protocol, 263-267 (1995) (published by Shujunsha), Virology, Volume 52, 456 (1973) can be used.

  A transformed cell obtained as described above, a mammalian cell having an ability to produce IKAROS or a tissue / organ containing the cell is, for example, a minimal essential medium (MEM containing about 5 to 20% fetal calf serum). ) [Science, Vol. 122, 501 (1952)], Dulbecco's modified Eagle medium (DMEM) [Virology, Vol. 8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association, Vol. )], 199 medium [Proceeding of the Society for the Biological Medicine, Vol. 73, 1 (1950)]. The pH of the medium is preferably about 6-8. Culture is usually performed at about 30 to 40 ° C., and aeration and agitation are added as necessary.

  The IKAROS protein may be obtained by combining methods commonly used for general protein isolation / purification. For example, the transformant obtained by the above culture may be removed by centrifugation or the like, and IKAROS may be purified from the culture supernatant in the same manner as described above. In the case where the IKAROS protein accumulates in the cells of the transformant obtained by the above culture, for example, the transformant is collected by centrifugation or the like, and then the cells are crushed or dissolved. For example, the protein may be solubilized and purified by singly or in combination with various chromatographic processes such as ion exchange, hydrophobicity, and gel filtration. An operation of restoring the higher order structure of the purified protein may be further performed.

  In conducting the screening of the present invention, examples of the test substance include proteins, peptides, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like. These substances may be novel or may be known ones.

  In addition, when selecting a substance that decreases the expression level of IKAROS or the IKAROS gene, or a substance that decreases the function of IKAROS, a control cell that is not contacted with a test substance can also be used as a comparative control. Here, “do not contact the test substance” means that when the same amount of solvent (blank) as the test substance is added instead of the test substance, the expression level of the IKAROS or IKAROS gene or the function of the IKAROS is affected. The case where a negative control substance not given is added is also included.

  The contact of the test substance with the cells is, for example, the above-mentioned medium or various buffers (for example, HEPES buffer, phosphate buffer, phosphate buffered saline, Tris-HCl buffer, borate buffer, acetic acid). The test substance can be added to a buffer solution or the like, and the cells can be incubated for a certain time. The concentration of the test substance to be added varies depending on the type of compound (solubility, toxicity, etc.), but is appropriately selected within the range of about 0.1 nM to about 100 μM, for example. Examples of the incubation time include about 10 minutes to about 24 hours.

  When the cell producing IKAROS is provided in the form of a non-human mammal individual, the state of the animal individual is not particularly limited. For example, an inflammatory disease model animal (for example, an inflammatory disease model in which inflammation is induced by a drug or genetic modification) IBD such as mice in which colitis is induced by drugs such as sodium dextran sulfate (DSS) and 2.4.6-trinitrobenzenesulfonic acid (TNBS), genetically modified mice such as IL-10 knockout mice and IL-2 knockout mice Model animals, collagen-induced arthritis (CIA) mice, SKG mice, PD-1 knockout mice, K / BxN mice, RA model animals such as Synoviolin Tg mice, etc.). There are no particular restrictions on the breeding conditions of the animals used, but it is preferable that the animals are raised in an environment of SPF grade or higher. Contact of the test substance with the cells is carried out by administering the test substance to the animal individual. The administration route is not particularly limited, and examples thereof include intravenous administration, intraarterial administration, subcutaneous administration, intradermal administration, intraperitoneal administration, oral administration, intratracheal administration, and rectal administration. The dose is not particularly limited. For example, a dose of about 0.5 to 20 mg / kg can be administered 1 to 5 times a day, preferably 1 to 3 times a day, 1 to 14 days. .

  Alternatively, the above screening method can be carried out by bringing a test substance into contact with an extract of the cells or IKAROS isolated and purified from the cells, instead of the cells having the ability to produce IKAROS.

  Therefore, in another aspect, the present invention relates to an anti-inflammatory substance characterized by contacting IKAROS with a test substance and selecting a test substance capable of binding to IKAROS as a candidate for the anti-inflammatory substance. A screening method is provided. IKAROS that can be used can be an extract of cells having the ability to produce IKAROS, or can be isolated and purified from the cells.

  In one embodiment, in the screening method of the present invention, the following steps (1) to (3): (1) contacting IKAROS with a cell membrane fraction of a target cell of an inflammatory disease in the presence of a test substance (2) measuring the amount of IKAROS bound to the cell membrane fraction; and (3) reducing the amount of IKAROS bound to the cell membrane fraction as compared to when measured in the absence of the test substance. Selecting a test substance as a candidate for an anti-inflammatory substance.

  In a specific embodiment, the present invention utilizes a unique evaluation system for membrane permeability and tissue permeability using stratified conjunctival epithelial cells. In this evaluation system, it is possible to select a compound that selectively acts on epithelial cells.

  In a further embodiment, the present invention can use ocular surface inflammation as an evaluation system for inflammation. The ocular surface is an easily observable mucosal tissue, and has an advantage that inflammation evaluation is relatively easy in macroscopic and histological analyses. Further, topical administration by eye drops is generally used for the treatment of ocular surface inflammation, and the ocular surface inflammation model is superior in evaluating the anti-inflammatory effect of a novel compound. In addition, in the present invention, a mouse model of allergic conjunctivitis that is excellent in evaluating the inflammation inhibitory action can also be used. About such an inflammation model, what was illustrated in the Example can be utilized, but it is not limited to them.

  In one embodiment, the method of the present invention further comprises applying a test substance selected as a candidate for the above-mentioned anti-inflammatory substance to an inflammation model, and testing whether to suppress an inflammatory response in the model. Including.

(Measurement of expression level of IKAROS gene or IKAROS)
The present invention provides a method for screening an anti-inflammatory substance, characterized by comparing the expression of the protein (gene) in cells having the ability to produce IKAROS in the presence and absence of the test substance. To do. The cells used in this method, the type of test substance, the mode of contact between the test substance and cells, etc. are the same as described above.

  The expression level of IKAROS is stringent with the nucleic acid that can hybridize with the above-mentioned DNA encoding IKAROS under stringent conditions, that is, the nucleotide sequence represented by SEQ ID NO: 1 or 3, or a complementary nucleotide sequence thereto. It can be measured at the RNA level by detecting mRNA of the IKAROS gene using a nucleic acid (DNA) that can hybridize under conditions (hereinafter sometimes referred to as “the nucleic acid for detection of the present invention”). Alternatively, the expression level can also be measured at the protein level by detecting these proteins using the above-mentioned antibody against IKAROS (hereinafter sometimes referred to as “the detection antibody of the present invention”).

Therefore, more specifically, the present invention
(A) Cells having the ability to produce IKAROS are cultured in the presence and absence of a test substance, and the amount of mRNA encoding the protein under both conditions is measured using the nucleic acid for detection of the present invention. A method for screening an anti-inflammatory substance characterized by comparing, and (b) culturing cells having the ability to produce IKAROS in the presence and absence of a test substance, and the protein under both conditions A method for screening an anti-inflammatory substance, characterized by measuring and comparing the amount of the above using the detection antibody of the present invention.

That is, screening for a substance that changes the expression level of IKAROS can be performed as follows.
(I) Normal or disease model (eg, DSS or TNBS-induced colitis model) Non-human mammal (eg, mouse, rat, rabbit, sheep, pig, cow, cat, dog, monkey, etc.) After a certain time has elapsed after administration of a substance (30 minutes to 3 days later, preferably 1 hour to 2 days later, more preferably 1 hour to 24 hours later), blood or a specific organ (for example, brain Etc.) or tissue or cells isolated from an organ.

IKAROS mRNA can be quantified by extracting mRNA from cells or the like by a usual method, or can be quantified by Northern blot analysis known per se. On the other hand, the amount of IKAROS protein can be quantified using Western blot analysis or various immunoassay methods described in detail below.
(Ii) A cell expressing an IKAROS gene (for example, a transformant introduced with IKAROS) is prepared according to the above method, and a test substance is added to a medium or a buffer when culturing according to a conventional method, and for a certain period of time. After incubation (after 1 day to 7 days, preferably after 1 day to 3 days, more preferably after 2 days to 3 days), IKAROS or mRNA encoding the same contained in the cell culture is the same as (i) above. Can be quantified and analyzed.

  Detection and quantification of the expression level of the IKAROS gene (mRNA) can be performed by a known method such as Northern blotting or RT-PCR using RNA prepared from the cells or a complementary polynucleotide transcribed therefrom. Specifically, by using a polynucleotide having at least 15 contiguous bases in the base sequence of the IKAROS gene and / or its complementary polynucleotide as a primer or a probe, the presence or absence of expression of the IKAROS gene in RNA or its expression The level can be detected and measured. Such a probe or primer can be designed based on the base sequence of the IKAROS gene using, for example, primer 3 (http://primer3.sourceforge.net/) or vector NTI (manufactured by Infomax). .

When using Northern blotting, the primers or probes radioisotope (such as ^{32 P,} 33 ^P: RI) or a fluorescent substance labeled with a, it, RNA transfer cells derived from a nylon membrane or the like according to a conventional method After hybridization, the formed duplex of the primer or probe (DNA or RNA) and RNA is used as a signal derived from a label (RI or fluorescent substance) of the primer or probe as a radiation detector ( A method of detecting and measuring with BAS-1800II (manufactured by Fuji Film) or a fluorescence detector can be exemplified. Further, using AlkPhos Direct Labeling and Detection System (manufactured by Amersham Pharmacia Biotech), the probe is labeled according to the protocol, hybridized with cell-derived RNA, and then the signal derived from the probe label is multibiotic. A method of detecting and measuring with a major STORM860 (manufactured by Amersham Pharmacia Biotech) can also be used.

  When the RT-PCR method is used, cDNA is prepared from cell-derived RNA according to a conventional method, and a target IKAROS gene region can be amplified using this as a template to prepare a pair of IKAROS gene sequences. A method in which a primer (a normal strand that binds to the cDNA (-strand), a reverse strand that binds to a + strand) is hybridized with this, and a PCR method is performed according to a conventional method, and the resulting amplified double-stranded DNA is detected Can be illustrated. In addition, the detection of the amplified double-stranded DNA was performed by a method for detecting the labeled double-stranded DNA produced by performing the PCR using a primer previously labeled with RI or a fluorescent substance. For example, a method may be used in which double-stranded DNA is transferred to a nylon membrane or the like according to a conventional method, and the labeled primer is used as a probe to hybridize with this to detect it. The produced labeled double-stranded DNA product can be measured with an Agilent 2100 Bioanalyzer (manufactured by Yokogawa Analytical Systems). Further, an RT-PCR reaction solution is prepared according to the protocol using SYBR Green RT-PCR Reagents (manufactured by Applied Biosystems), and reacted with ABI PRIME 7900 Sequence Detection System (manufactured by Applied Biosystems). You can also

  The expression of the IKAROS gene in the cells to which the test substance is added is 2/3 times or less, preferably 1/2 times or less, more preferably 1/3 times the expression level in the control cells to which no test substance is added. The test substance can be selected as a substance that suppresses the expression of the IKAROS gene if it is as follows.

  Screening for substances that change the expression level of IKAROS can also be performed by a reporter gene assay using the transcriptional regulatory region of the IKAROS gene. Here, the “transcriptional regulatory region” usually refers to a range of several kb to several tens of kb upstream of the chromosomal gene. For example, (i) 5′-race method (5′-RACE method) (for example, 5 (Ii) a step of determining the 5 ′ end by a conventional method such as oligocap method, S1 primer mapping, etc. (ii) Genome Walker Kit (which can be carried out using “-full Race Core Kit (manufactured by Takara Bio Inc.), etc.); The 5 ″ -upstream region is obtained using Clontech, etc., and the obtained upstream region can be identified by a technique including a step of measuring promoter activity.

  A reporter protein expression vector is constructed by ligating a nucleic acid encoding a reporter protein (hereinafter referred to as “reporter gene”) in a functional manner downstream of the transcriptional regulatory region of the IKAROS gene. The vector may be prepared by a method known to those skilled in the art. That is, “Molecular Cloning: A Laboratory Manual 2nd edition” (1989), Cold Spring Harbor Laboratory Press, “Current Protocols in Molecular Biology” (1987), John Ins. The transcriptional regulatory region of the IKAROS gene excised according to the usual genetic engineering technique described in the above can be incorporated on a plasmid containing a reporter gene.

  Reporter proteins include β-glucuronidase (GUS), luciferase, chloramphenicol transacetylase (CAT), β-galactosidase (GAS), green fluorescent protein (GFP), yellow fluorescent protein (YFP), blue fluorescent protein ( CFP), red fluorescent protein (RFP) and the like.

  The reporter gene formed by linking the transcriptional regulatory region of the prepared IKAROS gene in a functional form is inserted into a vector that can be used in cells into which the reporter gene is to be introduced, using a normal genetic engineering technique, and a plasmid is inserted. And can be introduced into a suitable host cell. Stable transformed cells can be obtained by culturing in a medium with selection conditions according to the selection marker gene mounted on the vector. Alternatively, a reporter gene in which the transcriptional regulatory region of the IKAROS gene is operably linked may be transiently expressed in the host cell.

  In addition, as a method for measuring the expression level of the reporter gene, a method corresponding to each reporter gene may be used. For example, when a luciferase gene is used as a reporter gene, the transformed cell is cultured for several days, an extract of the cell is obtained, and then the extract is reacted with luciferin and ATP to cause chemiluminescence, and the luminescence intensity Promoter activity can be detected by measuring. In this case, a commercially available luciferase reaction detection kit such as Picker Gene Dual Kit (registered trademark; manufactured by Toyo Ink) can be used.

As a method for measuring the protein amount of IKAROS, specifically, for example,
(I) The detection antibody of the present invention is reacted competitively with the sample solution and labeled IKAROS, and the labeled protein bound to the antibody is detected to quantify IKAROS in the sample solution. How,
(Ii) The labeling agent on the insolubilized carrier after reacting the sample solution with the detection antibody of the present invention insolubilized on the carrier and another labeled detection antibody of the present invention simultaneously or continuously For example, a method of quantifying IKAROS in a sample solution by measuring the amount (activity) of.

IKAROS protein expression level can be detected and quantified according to a known method such as Western blotting using an antibody recognizing IKAROS. Western blotting uses an antibody that recognizes IKAROS as a primary antibody, and then binds to a primary antibody labeled with a radioisotope such as ¹²⁵ I, a fluorescent substance, an enzyme such as horseradish peroxidase (HRP) as a secondary antibody. This is carried out by measuring the signal derived from these labeling substances using a radiation measuring instrument (BAI-1800II: manufactured by Fuji Film Co., Ltd.), a fluorescence detector or the like. In addition, after using an antibody that recognizes IKAROS as a primary antibody, detection is performed according to the protocol using an ECL Plus Western Blotting Detection System (manufactured by Amersham Pharmacia Biotech Co., Ltd.), and a multi-biometric STORM860 (manufactured by Amersham Pharmacia Biotech Co., Ltd.) is used. It can also be measured.

  The form of the above-described antibody is not particularly limited, and may be a polyclonal antibody or an monoclonal antibody using IKAROS as an immunogen, and is usually at least a continuous amino acid sequence constituting IKAROS. An antibody having an antigen binding property to a polypeptide consisting of 8 amino acids, preferably 15 amino acids, more preferably 20 amino acids can also be used.

  Methods for producing these antibodies are already well known, and the antibodies of the present invention can also be produced according to these conventional methods (Current protocol in Molecular Biology edit. Ausubel et al. (1987) Publ. John Wiley and Sons. Section 11.12-11.13).

  In the quantification method (ii), it is desirable that the two antibodies recognize different portions of IKAROS. For example, if one antibody recognizes the N-terminal portion of IKAROS, one that reacts with the C-terminal portion of the protein can be used as the other antibody.

As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like is used. As the radioisotope, for example, [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are used. As the enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used. Furthermore, a biotin- (strept) avidin system can also be used for binding of an antibody or antigen and a labeling agent.

  The method for quantifying IKAROS using the detection antibody of the present invention is not particularly limited, and the amount of antibody, antigen or antibody-antigen complex corresponding to the amount of antigen in the sample solution is chemically or physically determined. Any measurement method may be used as long as it is a measurement method that is detected by means and calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephrometry, competition method, immunometric method and sandwich method are preferably used. In view of sensitivity and specificity, for example, the sandwich method described later is preferably used.

  In the insolubilization of the antigen or antibody, physical adsorption may be used, or a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, or glass.

  In the sandwich method, the sample solution is reacted with the insolubilized detection antibody of the present invention (primary reaction), and further labeled with another detection antibody of the present invention (secondary reaction), and then on the insolubilized carrier. By measuring the amount or activity of the labeling agent, IKAROS in the sample solution can be quantified. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at different times. The labeling agent and the insolubilization method can be the same as those described above. Further, in the immunoassay by the sandwich method, the antibody used for the immobilized antibody or the labeled antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity. May be.

  The detection antibody of the present invention can also be used in measurement systems other than the sandwich method, such as a competitive method, an immunometric method, or nephrometry.

  In the competition method, IKAROS in a sample solution and labeled IKAROS are reacted competitively with an antibody, and then an unreacted labeled antigen (F) and a labeled antigen (B) bound to the antibody are separated. (B / F separation), IKAROS in the sample solution is quantified by measuring the labeling amount of either B or F. In this reaction method, a soluble antibody is used as an antibody, B / F separation is performed using polyethylene glycol or a secondary antibody against the antibody (primary antibody), and a solid phase is used as the primary antibody. Either an antibody is used (direct method), or a primary antibody is soluble, and a solid phase antibody is used as a secondary antibody (indirect method).

  In the immunometric method, IKAROS in a sample solution and IKAROS immobilized on a solid phase are competitively reacted with a certain amount of labeled antibody, and then the solid phase and the liquid phase are separated, or IKAROS in the sample solution is separated from An excess amount of the labeled antibody is reacted, and then solid phased IKAROS is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to quantify the amount of antigen in the sample solution.

  In nephrometry, the amount of insoluble precipitate produced as a result of the antigen-antibody reaction in a gel or solution is measured. Laser nephrometry using laser scattering is preferably used even when the amount of IKAROS in the sample solution is small and only a small amount of sediment can be obtained.

  In applying these individual immunological measurement methods to the quantification method of the present invention, special conditions, operations and the like are not required to be set. What is necessary is just to construct | assemble the measurement system of IKAROS, adding the usual technical consideration of those skilled in the art to the usual conditions and operation methods in each method. For details of these general technical means, it is possible to refer to reviews, books and the like.

  For example, Hiroshi Irie “Radioimmunoassay” (Kodansha, published in 1974), Hiroshi Irie “Sequential Radioimmunoassay” (published in Kodansha, 1979), “Enzyme Immunoassay” edited by Eiji Ishikawa et al. 53)), edited by Eiji Ishikawa et al. "Enzyme Immunoassay" (2nd edition) (Medical Shoin, published in 1982), edited by Eiji Ishikawa et al. "Enzyme Immunoassay" (3rd edition) (Medical Shoin, Showa) 62)), “Methods in ENZYMOLOGY” Vol. 70 (Immunochemical Technologies (Part A)), ibid., Vol. 73 (Immunochemical Technologies (Part B)), ibid., Vol. 74 (Immunochemical Technologies (Part C)), ibid., Vol. 84 (Immunochemical Technologies (Part D: Selected Immunoassays)), ibid., Vol. 92 (Immunochemical Technologies (Part E: Monoclonal Antibodies and General Immunoassay Methods)), Vol. 121 (Immunochemical Technologies (Part I: Hybridoma Technology and Monoclonal Antibodies)) (published by Academic Press).

  As described above, by using the detection antibody of the present invention, the amount of IKAROS in cells can be quantified with high sensitivity.

  For example, in the screening method described above, the expression level (mRNA amount or protein amount) of IKAROS in the presence of the test substance is about 20% or more, preferably about 30%, compared to the case in the absence of the test substance. As mentioned above, when it is inhibited by about 50% or more, the test substance can be selected as an IKAROS expression inhibitory substance, and thus a candidate for an anti-inflammatory substance.

  Alternatively, in the above screening method, a cell containing a reporter gene under the control of the transcriptional regulatory region in the IKAROS gene can be used instead of the cell expressing the IKAROS gene. Such a cell may be a cell, tissue, organ or individual of a transgenic animal into which a reporter gene (eg, luciferase, GFP, etc.) under the control of the transcriptional regulatory region of the IKAROS gene has been introduced. When such cells are used, the expression level of IKAROS can be evaluated by measuring the expression level of the reporter gene using a conventional method.

(Measurement of IKAROS function)
The screening method of the present invention can also be performed using as an index whether or not a test substance inhibits the function of IKAROS.

  Since IKAROS is a protein that is secreted mainly into blood from neutrophils, substances that have the ability to bind to IKAROS protein include IKAROS protein and its binding partner (eg, IKAROS receptor on the target cell surface). It is considered that the function of IKAROS can be inhibited by blocking the interaction with IKAROS. Therefore, a candidate for an IKAROS function inhibitor can be screened using the binding ability to IKAROS as an index.

  For example, a test substance is adsorbed to each well of a well plate, an IKAROS solution labeled with an appropriate labeling agent is added to each well, incubated, the liquid phase is removed, and the amount of label bound to the solid phase after washing is measured. By doing so, a test substance having binding ability with IKAROS can be detected. Instead of directly labeling IKAROS, a labeled anti-IKAROS antibody can be used to detect IKAROS bound to the solid phase. Alternatively, a test substance solution is passed through a carrier (for example, an affinity column) on which IKAROS is immobilized, and the test substance held on the carrier is used as a substance having an ability to bind to IKAROS, that is, an anti-inflammatory substance candidate. Can also be selected.

Whether or not the candidate substance thus obtained actually has an anti-inflammatory action is confirmed by applying the candidate substance to an inflammation model and testing whether or not to suppress the inflammatory reaction in the model. be able to. As such an inflammation model, in vivo and in vitro models can be used. As an in vivo model, for example, a DSS-induced colitis model (by allowing a non-human animal to drink water containing 3 to 5% (w / v) of DSS having a molecular weight of 5,000 to 10,000 for 5 to 10 days) IBD model such as TNBS-induced colitis model (can be prepared by dissolving TNBS in 50% ethanol and administering it intrarectally to a non-human animal in an amount of 50 μg / g body weight, for example) , CIA model (can be prepared by immunizing non-human animals with complete Freund's adjuvant and emulsified type II collagen), CAIA model (non-human monoclonal antibody cocktail recognizing epitopes within CB11 of type II collagen) Can be prepared by injection into animals) DOO but can, without limitation. On the other hand, in vitro models include culture systems (eg, Caco-2 cell culture system, RA patient synovial tissue) of target cells in inflammatory diseases (eg, intestinal epithelial cells in IBD, synovial cells in RA, etc.) And the like, but not limited thereto. These in vitro models can be used to stimulate inflammatory cytokines such as TNFα, active oxygen such as H ₂ O _2, stimulation with LPS, or inflammatory cytokine producing cells such as monocytes, macrophages and neutrophils. Complex culture (eg, using a Transwell ^TM culture system, etc., target cells (eg, Caco-2 cells) in the upper compartment, and inflammatory cytokine-producing cells (macrophage-like THP-1 cells, RAW264.7 cells) in the lower compartment) Inflammatory reaction can be induced by a culture system in which each is monolayer cultured).

  Whether or not the candidate substance has an anti-inflammatory action can be determined by whether or not the inflammatory reaction in the inflammation model is suppressed by the addition of the candidate substance. For example, in the case of the above drug-induced colitis model animal, changes in body weight (inhibition of weight loss due to the onset of colitis, degree of recovery from weight loss, etc.), shortening of the length of the large intestine, epithelial damage at the site of colitis The presence or absence and / or degree of anti-inflammatory effect can be determined using the degree of inflammatory cell infiltration as an index. On the other hand, when a monolayer culture system of intestinal epithelial cells, which is an in vitro inflammatory bowel disease model, is used, the decrease in transepithelial electrical resistance (TER) value, LDH production, and increased IL-8 expression are used as indicators. The degree can be evaluated.

  In another preferred embodiment of the present invention, an inhibitor of IKAROS function can be screened by examining the binding inhibitory activity between an IKAROS protein and a binding protein thereof (eg, IKAROS receptor). Although IKAROS receptors and biological substances that bind to IKAROS have not yet been identified, IKAROS is a protein that is secreted into the blood mainly from neutrophils, so it is expressed on the surface of target cells in inflammatory diseases. It is strongly suggested that there is a physiological binding partner of IKAROS among the proteins that do. Therefore, the membrane fraction of the target cell (for example, in the case of intestinal epithelial cells, the membrane fraction on the mucosal lamina propria side is isolated according to a conventional method, this is immobilized on an appropriate carrier, and is present in the presence of the test substance. In the absence of the test substance, the labeled IKAROS protein is contacted, and compared with the amount of IKAROS bound to the cell membrane fraction in the absence of the test substance, the cell membrane fraction is added to the cell membrane fraction in the presence of the test substance. When the amount of bound IKAROS is significantly low, the test substance can be selected as a candidate for an anti-inflammatory substance, whether or not the candidate substance thus selected has an anti-inflammatory action as described above. It can be confirmed by the method.

  In still another embodiment of the present invention, a substance exhibiting an anti-inflammatory action by inhibiting the function of IKAROS can be screened in one step using the above in vitro inflammation model. The method comprises the following steps (1) to (3): (1) contacting a target cell of an inflammatory disease with a test substance in the presence and absence of IKAROS; (2) under each condition Measuring the degree of the inflammatory reaction in the cells; and (3) suppressing the inflammatory response in the presence of IKAROS and in the absence of IKAROS as compared to the measurement in the absence of the test substance. Provided is a screening method for an anti-inflammatory substance, comprising a step of selecting a test substance that has not suppressed an inflammatory reaction as a candidate for a substance exhibiting an anti-inflammatory action by inhibiting the function of IKAROS.

The method may further include a step of inducing inflammation at the same time as or before or after the step (1), if necessary. Examples of methods for inducing inflammation include polyI: C, inflammatory cytokines such as interleukin-Iα (IL-1α) and TNFα, active oxygen such as H ₂ O ₂ , stimulation by LPS, etc., or monocytes And complex culture with inflammatory cytokine producing cells such as macrophages and neutrophils. In a preferred embodiment, for example, using a Transwell ^TM culture system or the like, target cells (eg, Caco-2 cells) in the upper compartment, and inflammatory cytokine-producing cells (macrophage-like THP-1 cells, RAW264) in the lower compartment are used. .7 cells) each in a monolayer culture. In this case, IKAROS is added to the medium in the lower compartment. In addition, LPS or the like may be added to the medium to induce inflammation. The test substance is usually added to the medium in the lower compartment. For example, screening for ingredients contained in foods that can be absorbed into the intestinal tract and inhibit the function of IKAROS, or orally administered IKAROS function inhibitors For the purpose of the above, a test substance can be added to the medium in the upper compartment.

  In certain embodiments, in the methods of the present invention, it is preferred that the target cell comprises an epithelial cell. More specifically, the epithelial cells are skin epidermal cells, esophageal epithelial cells, gastric epithelial cells, vaginal epithelial cells, uterine epithelial cells, thymic epithelial cells, bladder epithelial cells, prostate epithelial cells, mammary epithelial cells, conjunctival epithelial cells or cornea An epithelial cell, preferably a skin epidermal cell, conjunctival epithelial cell or corneal epithelial cell, but is not limited thereto. Alternatively, the epithelial cells are mucosal epithelial cells that express keratin 5. For cells expressing keratin 5, Okuma et al. , Immunity. (2013) 38: 450-60 and Liang et al. , J Biomed Sci. (2009) 16: 2.

  In a further embodiment, the inflammation targeted by the screening of the present invention is inflammation resulting from increased expression of IKAROS. In a specific embodiment, the inflammation targeted by the screening of the present invention is inflammation involving epithelium caused by IKAROS. In a specific embodiment, the inflammation targeted by the screening of the present invention is inflammation involving IKAROS and TLR3 in the epithelium. In certain embodiments, the inflammation targeted by the present invention is an allergic disease, typically Stevens-Johnson syndrome, asthma, contact dermatitis, acute dermatitis, atopic dermatitis, allergic conjunctivitis and Although atopic keratoconjunctivitis can be mentioned, it is not limited to them.

  A substance that inhibits the expression or function of IKAROS obtained by using any one of the screening methods of the present invention is useful as a medicament for the prevention and / or treatment of inflammatory diseases.

  When the compound obtained by using the screening method of the present invention is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated in the same manner as the low molecular weight compound that inhibits the expression or function of the above-mentioned IKAROS, Dosage can be administered orally or parenterally to humans or mammals (eg, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.). it can.

(IKAROS gene expression increase / enhancement / induction agent)
In one aspect, the present invention provides a composition for increasing or inducing the expression of the IKAROS gene, comprising polyI: C. polyI: C (also denoted as “poly I: C”, “poly I: C polynucleotide”), a poly I: C polynucleotide contains an inosinic acid residue (I) and a cytidylic acid residue (C) A double-stranded polynucleotide molecule (either RNA or DNA or a combination of DNA and RNA) that induces the production of inflammatory cytokines, such as interferons, and is a synthetic double-stranded RNA analog. Generally, it consists of one strand consisting entirely of cytosine-containing nucleotides and one strand consisting entirely of inosine-containing nucleotides, although other configurations are possible. As an example, each strand may contain both cytosine-containing and inosine-containing nucleotides. In some cases, either or both strands may further comprise one or more non-cytosine or non-inosine nucleotides. For polyI: C, see, for example, Non-Patent Document 9 and the like.

  Therefore, in the present specification, “polyI: C”, “polyI: C” or “polyI: C polynucleotide” is a double-stranded polynucleotide molecule (RNA or DNA or a combination of DNA and RNA), and Each strand comprises at least six adjacent inosinic acid or cytidylic acid residues, or six adjacent residues selected from inosinic acid and cytidylic acid in any order (eg, IICIIC or ICICIC) Have the ability to induce or promote the production of at least one inflammatory cytokine, such as interferon. PolyI: C polynucleotides are generally about 8, 10, 12, 14, 16, 18, 20, 22, 24, 25, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75. 80, 85, 90, 95, 100, 150, 200, 250, 300, 500, 1000 or more residues in length. I don't think the upper limit is important. The minimum length of a preferred polyI: C polynucleotide may be about 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30 nucleotides, with a maximum length of about 1000 , 500, 300, 200, 100, 90, 80, 70, 60, 50, 45 or 40 nucleotides.

  Each strand of the polyI: C polynucleotide may be a homopolymer of inosinate or cytidylate residues, or each strand is a heteropolymer containing inosinate and cytidylate residues. Also good. In any case, the polymer may have one or more non-reactive groups if there is at least one contiguous region consisting of 6 I, 6 C or 6 I / C residues, as described above. It may be interrupted by inosinic acid or non-cytidylic acid residues (eg uridine). Generally, each strand of a polyI: C polynucleotide has no more than 1 non-I / C residue per 6 I / C residues, more preferably 8, 10, 12, 14, 16, 18, 20, Contains no more than 1 non-I / C residue for every 22, 24, 26, 28 or 30 I / C residues.

  Inosinic acid or cytidylic acid (or other) residues in a polyI: C polynucleotide can be used in the art if the ability of the polyI: C polynucleotide to promote production of inflammatory cytokines, such as interferons, is retained. It may be derivatized or modified as is known. Non-limiting examples of derivatives or modifications include, for example, azide modifications, fluoro modifications, or the use of thioester (or similar) linkages instead of natural phosphodiester linkages to improve stability in vivo. PolyI: C polynucleotides are also complexed in molecules with, for example, positively charged poly-lysine and carboxymethylcellulose, or with positively charged synthetic peptides, for example to enhance their resistance to degradation in vivo. It may be modified by formation. The polyI: C polynucleotide is generally included in the compositions of the present invention in an amount of about 0.001 mg to 1 mg per unit dose of the composition.

  In one embodiment, the increased or induced expression of the IKAROS gene is in epithelial cells. Although not wishing to be bound by theory, it is possible to develop a novel inflammation control method targeting epithelial cells, and by using epithelial cells as a target, local administration is facilitated and side effects are expected to be drastically reduced. . In addition, by providing a cell model targeting epithelial cells, a novel inflammation control method targeting epithelial cells can be developed. The cells of the present invention are useful for screening for drugs that can be easily administered locally by controlling the kinetics and activation of immune cells using the target as epithelial cells, and have the substantial merit that side effects are expected to be drastically reduced. is there. There is also provided an inflammation control model from a point of interest that has not been performed so far. The development of new inflammation control methods targeting epithelial cells that are completely different from existing inflammation control methods contributes to the realization of a safe and secure society by providing appropriate treatment methods and extending healthy life spans. Cells have significance as development tools. Furthermore, the development of a novel inflammation control method that controls the dynamics and activation of immune cells targeting epithelial cells leads to a major turning point in the inflammation control method. The novel inflammation control method targeting epithelial cells is expected to greatly reduce side effects because local administration with a control compound is easy, and will be a major player in future inflammation treatment.

  The cells of the present invention also facilitate the search for compounds that specifically act on epithelial cells. Elucidation of the mechanism of action at the molecular level reveals the mechanism of inflammation control through epithelial cells to prevent allergic diseases, treatment with drugs and medical supplies, and safe and secure quality (chemical materials, cosmetics, foods, health foods) Connected with As a result, it is possible to directly contribute to the improvement of human life in the future from the viewpoint of a safe and secure society by providing appropriate treatments and extending the healthy life expectancy, and a wide range of industries (medical, pharmaceutical, chemical, food, etc.) A ripple effect can be expected.

(Cells in which expression of IKAROS gene is increased or induced)
In one aspect, a cell is provided wherein expression of the IKAROS gene is increased or induced. Here, “expression of IKAROS gene is increased or induced” means that the level of expression of IKAROS gene is increased or induced more than the level of expression of IKAROS gene in cells existing in a normal state. Although it is considered that such a level may vary depending on the cell type, the expression “IKAROS gene expression is increased or induced” in the present invention is compared with its normal state depending on each cell type. Note that expression is increased or induced.

  The cell of the present invention is preferably an isolated cell. This is the first time that an IKAROS gene expression has been increased or induced in an artificial environment other than the naturally occurring state. As used herein, “isolated” means that the substances naturally associated with it in a normal environment are at least reduced, preferably substantially free. Accordingly, an isolated cell, tissue, or the like refers to a cell, tissue, or the like that is substantially free of other substances (eg, other cells, proteins, nucleic acids, etc.) that accompany it in the natural environment.

  In one embodiment, the cell in which the expression of the IKAROS gene of the present invention is increased or induced is one in which the expression of the IKAROS gene is increased or induced by polyI: C. As polyI: C, any form described in (IKAROS gene expression increase / enhancement / induction agent) can be used.

  In yet another embodiment, the cells of the invention are epithelial cells. In one specific embodiment, the cells of the invention may be keratin 5 positive cells.

(Animals with increased or induced expression of IKAROS gene)
In one aspect, an animal is provided in which expression of the IKAROS gene is increased or induced. Here, “expression of IKAROS gene is increased or induced” means that the level of expression of IKAROS gene is increased or induced more than the level of expression in an animal present in a normal state. Although it is considered that such a level may vary depending on the type of animal, the expression “IKAROS gene expression is increased or induced” in the present invention is compared with its normal state depending on the type of each animal. Note that expression is increased or induced.

  In one embodiment, the animal of the present invention is an inflammation model animal. It is the first time that an inflammation model is provided as an animal in which the expression of IKAROS gene is increased or induced, and the inflammation model is provided by the expression or increase of expression of such an IKAROS gene outside the natural state. First time.

  In one embodiment, the animal in which the expression of the IKAROS gene of the present invention is increased or induced is one in which the expression of the IKAROS gene is increased or induced by polyI: C. As polyI: C, any form described in (IKAROS gene expression increase / enhancement / induction agent) can be used.

  In one embodiment, the inflammation model includes inflammation at the ocular surface. Although not wishing to be bound by theory, as shown in the present invention, when polyI: C is instilled, it is considered that the expression of the IKAROS gene is increased on the ocular surface and inflammation is caused. It has also been shown that dermal mucosal inflammation occurs when expressed specifically in the epithelium. Thus, without wishing to be bound by theory, it is understood that application of polyIC to other mucous membranes or skin will cause inflammation as well. Inflammation caused by polyIC eye drops may be milder than that of Tg mice, but this is thought to be due to the difference in the expression level of IKAROS.

  In another embodiment, the animal in which expression of the IKAROS gene of the present invention is increased or induced is due to genetic modification. Preferably, the genetically modified animal of the present invention comprises a vector operably linked to the keratin 5 promoter and comprising a nucleic acid sequence encoding the IKAROS gene. As a specific embodiment, such a genetically modified animal (transgenic animal (also referred to as Tg animal)) is an IKAROS transgenic animal (also referred to as IKAROS Tg), which is a vector in which the IKAROS gene is inserted into the keratin 5 promoter. Can be prepared by introducing an animal into an animal (eg, mouse) ES cell, and can be said to be an IKAROS overexpressing animal (eg, mouse) specific for keratin 5 expressing cells. This animal (eg, mouse) has been found to cause inflammation in the skin mucosa, and such knowledge is provided for the first time by the present invention.

  In one preferred embodiment, the inflammation model animal has cell infiltration in at least one selected from the group consisting of skin tissue and mucosal tissue.

  Examples of the animal of the present invention include mammals (eg, humans, mice, rats, hamsters, rabbits, cats, dogs, cows, sheep, monkeys, etc.), preferably model animals such as rodents (eg, mice). , Rats, etc.), primates.

(General technology)
Molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M.M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Innis, M .; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M.M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F .; M.M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F .; M.M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, “Experimental Methods for Gene Transfer & Expression Analysis”, Yodosha, 1997, etc., which are related in this specification (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R .; L. et al. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T.A. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

  For example, the oligonucleotides of the present invention can be synthesized herein by standard methods known in the art, for example, by using automated DNA synthesizers (such as those commercially available from Biosearch, Applied Biosystems, etc.). is there. For example, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (Stein et al., 1988, Nucl. Acids Res. 16: 3209) and controlled pore glass polymer supports (Sarin et al. , 1988, Proc. Natl. Acad. Sci. USA 85: 7448-7451), etc., can also be used to prepare methylphosphonate oligonucleotides.

  In this specification, “or” is used when “at least one or more” of the items listed in the text can be adopted. The same applies to “or”. In this specification, when “within the range of two values” is specified, the range includes the two values themselves.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the invention is not limited to the embodiments or examples specifically described herein, but is limited only by the claims.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further, this invention is not limited to these. When applicable, the handling of biological samples, etc. was performed in compliance with the standards stipulated by the Ministry of Health, Labor and Welfare and the Ministry of Education, Culture, Sports, Science and Technology.

(Example 1: Method for inducing expression of IKAROS in human epithelial cells and epidermal cells)
In this example, the induction of IKAROS expression in human epithelial cells and epidermal cells was demonstrated. The experimental technique and results are shown below.

(Materials and methods)
-Cultured human conjunctival epithelial cells Acquisition method: The conjunctival epithelial layer was separated and acquired from unnecessary conjunctival tissue removed at the time of surgery using Dsipase.

Culture method: The separated conjunctival epithelial layer was separated with 0.05% Trypsin-EDTA, and then cultured with CnT-20 (CELLnTEC).
・ Cultivated human epidermal cells Acquisition method: The one purchased from Thermo was used (Product No. C0055C; Human Epidermal Keratinocytes, adult (HEKa))
Culture method: Culture was performed with EpiLife (GIBCO) supplemented with HKGS (GIBCO # S0015).
PolyI: C (Poly I: C) (obtained from Invivogen (Poly (I: C) High Molecular Weight Synthetic analog of dsRNA-TLR3 ligand, Catalog # tlrl-pic)). PolyI: C stimulation was performed by adding the stock solution to the cell culture so that the final concentration was the indicated concentration.
-MRNA was measured as follows. Briefly, RNA was extracted from cells using the RNeasy Mini Kit obtained from Qiagen, and cDNA was transcribed from RNA using ReverTra Ace, random primer, dNTP, and RNase inhibitor obtained from TOYOBO. Quantitative PCR was performed using this cDNA sample. Quantitative PCR was carried out using IKAROS TaqMan probe (Hs00958474) and TaqMan (registered trademark) Fast Advanced Master Mix using Applied Biosystem's StepOne plus.

(result)
The results are shown in FIG. As shown in FIG. 1a, when 10 μg / ml poly I: C (poly I: C) stimulation was applied to cultured human conjunctival epithelial cells, IKAROS mRNA increased with time (the values in the graph are as follows: 0). After 1 hour, 1 hour 0.9, 3 hours 2.5, 6 hours 10.6, 10 hours 121.2). As shown in FIG. 1b, in cultured human conjunctival epithelial cells, IKAROS mRNA expression increased several times after 10 μg / ml poly I: C (poly I: C) stimulation (the values in the graph are as follows) : Medium 1, polyIC 8.8). As shown in FIG. 1c, in cultured human epidermal cells, IKAROS mRNA expression was more than 10 times after 10 μg / ml poly I: C (poly I: C) stimulation (the values in the graph are as follows): It rose to Medium 1, polyIC 11.4).

  Thus, it was demonstrated that the expression of IKAROS can be increased by polyI: C (poly I: C) stimulation. Thus, in this example, a method for inducing IKAROS in cultured human mucosal epithelium and cultured human epidermis was found. Until now, there has been no report on the expression of IKAROS in epithelial cells, and therefore, in this example, an epoch-making discovery was made.

(Example 2: Skin mucosal inflammation due to strong expression of IKAROS)
In this example, it was confirmed that IKAROS was strongly expressed in the mucosal epithelium and epidermal cells, causing cutaneous mucosal inflammation. In the present invention, an IKAROS transgenic mouse was prepared and demonstrated to be used as a mucocutaneous inflammation model. The experimental technique and results are shown below.

(Materials and methods)
(Transgenic animal production)
-Generation of transgenic mice: Genes in which IKAROs Ik1 isoforms (isoforms including all Exon1-7) were added to the promoters of keratin-5 specifically expressed in epidermal cells or mucosal epithelium were introduced into mouse embryos Then, transgenic mice in which the IkAROS Ik1 isoform was strongly expressed in the skin mucosa were prepared. This will be described in detail below.

  First, a K5-Ikzfl-2A-EGFP transgenic mouse (transgene: K5-lkksfl-2A-EGFP) was prepared. First, the construction of an Ikzf1 gene expression vector, which is a used vector, and examination of PCR conditions for selection of founder mice will be described.

(Construction of expression vector)
FIG. 4 shows the structure and construction procedure of the prepared expression vector (pK5-Ikzfl-2A-EGFP). Protein coding region of Ikzfl gene (isoform 1; 1545 bp), pine teschovirus-1 2A (P2A; 57 bp), protein coding region of EGFP gene (720 bp), bGHpolyA signal (bovine group 2) 2663 bp) was prepared by gene synthesis (SEQ ID NO: 5, FIG. 5 shows a schematic diagram of the vector). This was inserted into the Spe1 and NotI sites located downstream of the promoter of pBSK5 (human keratin 5 promoter in pBluescript II KS +) prepared by the inventor to produce an expression vector (pK5-lkzfl-2A-EGFP). (FIG. 4).

  In order to confirm the structure of the produced expression vector, it was digested with a restriction enzyme and the electrophoresis pattern was confirmed. The observed DNA cleavage pattern was consistent with that expected (FIG. 5). Furthermore, the base sequence of the joint portion was determined (SEQ ID NO: 5). When the base sequence of pBSK5 (human keratin 5 promoter in pBluescript II KS +) used in the present invention was confirmed, it was different from the NCBI database at one place within the confirmed range (the 2762 position of SEQ ID NO: 5 is T). There was C in the NCBI database). Since there is a report using this plasmid (Tarutani et al. 1997, Proc. Natl. Acad. Sci. USA 94 7400-7405), the prepared expression vector was used as it is in the next step.

(Examination of PCR conditions for selection of founder mice)
PCR primers were designed to confirm the introduction of the transgene (K5-Ikzfl-2A-EGFP) in the production of transgenic mice, and PCR conditions were examined.

  As Condition 1, a K5p-Fl primer that binds to the Keratin5 promoter and a BGH-R3 primer that binds downstream of bGH polyA were designed (SEQ ID NOs: 6 and 7). Each primer sequence and PCR analysis conditions are shown in FIG. As condition 2, a K5p-F6 primer and a K5p-R2 primer that bind to the upstream site of the Keratin5 promoter were designed (SEQ ID NOs: 8 and 9). Each primer sequence and PCR analysis conditions are shown in FIG. As a result of setting conditions using a sample in which a pK5-Jkzfl-2A-EGFP expression vector and genomic DNA purified from a wild-type mouse were mixed, the analysis conditions were determined with sensitivity that could be detected even when one copy of the transgene was inserted. It was possible to set (FIGS. 6-7).

  With the above, a vector (Ikzll gene expression vector) was constructed, and PCR conditions for founder mouse selection could be confirmed.

(Purification of expression vector)
In order to prepare an expression cassette (K5-Ikzfl-2A-EGFP) to be used for fertilized egg injection, an expression vector (pK5-lkzfl-2A-EGFP) was digested with restriction drunk and a DNA fragment was purified.

(Preparation of transgene)
The expression vector was digested with restriction enzymes SalI and Natl. As a result, the plasmid vector sequence was isolated, and the expression cassette portion (about 17.1 kbp) was purified (FIG. 8). The linear DNA fragment obtained by these operations was used as a transgene, and the amount necessary for fertilized egg injection was prepared.

  From the above, purification of the expression vector as a transgene was completed.

  Next, vector introduction (DNA injection) was performed. The prepared transgene (transgene: K5-lkksfl-2A-EGFP) was injected into a pronuclear fertilized egg and transplanted into a recipient female mouse.

(DNA injection)
The prepared transgene (4.0-6.0 ng / μl) 1-2 pl was injected into 302 pronuclear fertilized eggs (BALB / c strain). Of the transgene infused pregnancies, 217 in good condition were transplanted into 9 recipient female mice (Table 1).

  From the above, it is confirmed that the vector was successfully introduced by DNA injection.

(Observation)
-The prepared transgenic mice were observed with the naked eye to observe the inflammatory state, and photographs were taken as appropriate.

(Observation results)
The results are shown in FIG. When the produced transgenic mouse was observed, it was confirmed with the naked eye that the mouse spontaneously developed inflammation in the skin mucosa. Specifically, it was shown that inflammation occurred in the skin and eyes in transgenic mice in which the IKAROS IK1 isoform was strongly expressed in the skin mucosa. Thus, in this example, it was demonstrated that IKAROS is strongly expressed in mucosal epithelium as well as epidermal cells, causing cutaneous mucosal inflammation.

(Example 3. polyI: a drug that suppresses IKAROS mRNA induced by C stimulation)
In this example, a drug that suppresses IKAROS mRNA induced by polyI: C stimulation in cultured human conjunctival epithelial cells and cultured human epidermal cells was searched.

(Materials and methods)
-Cultured human conjunctival epithelial cells: obtained in the same manner as in Example 1.
-Cultured human epidermal cells: obtained in the same manner as in Example 1.
PolyI: C: Obtained in the same manner as in Example 1.
Prostaglandin (PG) E ₂ (PGE ₂ Cayman Chemical # 14010) was used. )
In the cultured human conjunctival epithelial cells using the same method as in Example 1, polyI: C inducible (10 hour stimulation) IKAROS mRNA expression increase was induced. The expression of IKAROS mRNA was compared between polyI: C alone and the group to which 100 μg / ml PGE ₂ was added. Also in cultured human epidermal cells, polyl: a C alone was compared the expression of IKAROSmRNA between group with addition of 100μg / ml PGE _2.

(result)
The results are shown in FIG. As shown in FIG. 3, 100 μg / ml PGE ₂ suppressed the increase in IKAROS mRNA expression in cultured human conjunctival epithelial cells (FIG. 3a) (the values in the graph are as follows: medium 1, poly I: C 8.8, polyI: C + PGE2 1.9, polyI: C + rebamide 2.7). Similarly, 100 μg / ml PGE ₂ suppressed the increase in IKAROS mRNA expression in cultured human conjunctival epidermal cells (FIG. 3b) (the values in the graph are as follows: medium 1, poly I: C 11.4, polyI: C + PGE2 2.7, polyI: C + rebamide 2.8). Thus, in this example, it was demonstrated that there are drugs that suppress IKAROS mRNA induced by polyI: C stimulation in cultured human conjunctival epithelial cells and cultured human epidermal cells.

(Example 4: Confirmation of IKAROS expression using PCR)
In this example, an experiment was conducted to confirm whether IKAROS can be expressed in the conjunctival tissue in vivo.

(Materials and methods)
The conjunctival epithelium is separated from the conjunctival tissue that is no longer needed during surgery using Dispase.
RNA was extracted with the RNeasy mini kit obtained from In addition, cDNA was transcribed from RNA using ReverTra Ace, random primer, dNTP, and RNase inhibitor obtained from TOYOBO. The cDNA was subjected to PCR under the following method and conditions.
Reagent: TaKaRa Taq CAT # R001B
Instrument: ABI GeneAmp PCR system 9700
・ PCR reaction solution composition
TaKaRaTaq (5units / μl) 0.25μl
10 × PCR Buffer 5 μl
dNTP Mixture (2.5mM each) 4μl
20μM F-Primer 1.5μl (Final 0.6μM)
20μM R-Primer 1.5μl (Final 0.6μM)
Template 2μl
Distilled water 35.75μl
Total 50μl
・ Primers used
GAPDH F 784435 K6148E12 (5′-CCATCACCATCTTCCAGGAG-3 ′; SEQ ID NO: 10)
R 784435 K6148F01 (5'-CCTGCTTCACCACCTTCTTG-3 '; SEQ ID NO: 11)
(The above information is prepared from NM_002046 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA), F is 320-339, and R is 895-876. The size of the purified product is 575 bp. )
Ikaros F Primer A 768773 K5949A11 (GCTGATGAGGGTCAAGACAT; SEQ ID NO: 12)
R Primer C 768773 K5949B01 (AGCTTCGGCCACAATATCCA; SEQ ID NO: 13).
(The information of IKAROS is information of F being Exon 2 and R being information of Exon 6. When these are used, Ik1 is 622 bp, and Ik2 is 361 bp.)
・ PCR conditions
95 ℃ 5min → 95 ℃ 30sec → 72 ℃ 7min → 10 ℃ ∞
57 ℃ 30sec
72 ℃ 30sec × 28 (GAPDH) or 40 (Ikaros) cycle
・ Electrophoresis
1.2% agarose gel
Sample 5μ
Marker 100 base ladder.

(result)
FIG. 9 shows the results of RT-PCR of IKAROS using mononuclear cells and conjunctival epithelium. As shown, expression of IKAROS mRNA (bands in this example indicate IK1 and IK2) was observed in both mononuclear cells and conjunctival epithelium. This result indicates that IKAROS can be expressed in human conjunctival epithelium.

(Example 5: Tissue analysis of IKZF1 transgenic mouse)
In this example, the IKZF1 transgenic (Tg) mouse prepared in Example 2 was further analyzed, and its tissue analysis was performed. The procedure and results are shown below.

(Method)
Various organs (including skin tissue (auricle, back epidermis) from one 5-week-old wild-type mouse (a mouse born with the same parent and not overexpressing the IKZF1 gene) and one IKZF1Tg mouse prepared in Example 2 ), Mucosal tissues (including eyelids and tongues)) were removed, and paraffin-embedded sections were prepared according to conventional methods, and hematoxylin and eosin (HE) tissues were prepared. Changes were observed. The above experiment was commissioned to the Non-clinical Research Department (Eniwa City, Hokkaido), Research Center, Shinyaku Research Center Co., Ltd.

(result)
Histopathological analysis of IKZF1Tg mice revealed the following findings (results of HE tissue staining analysis of one 5-week-old wild type mouse and one IKZF1Tg mouse).
(1) Skin tissue 1 (auricle)
Slight localized intradermal cell infiltration was observed in IKZF1Tg mice (FIG. 10).
(2) Skin tissue 2 (back epidermis)
In IKZF1Tg mice, slight localized epidermal thickening and slight localized intradermal cell infiltration were observed (FIG. 11).
(3) Mucosal tissue 1 (eyelid)
Minor localized blepharitis submucosal cell infiltration was observed in IKZF1Tg mice (FIG. 12).
(4) Mucosal tissue 2 (tongue)
In IKZF1Tg mice, slight localized filamentous papillary spinal cell layer thickening and slight localized subpapillary cell infiltration were observed (FIG. 13).

(Conclusion)
From the above, since the mouse used in this example had the IKZF1 gene bound to the promoter of keratin 5, dermal mucosal inflammation was observed in the mouse overexpressing IKZF1 specifically in keratin 5 positive cells. It can be said that it was a tendency to be.

(Example 6: Expression analysis of IKZF1 protein in human conjunctival tissue)
In this example, expression analysis of IKZF1 protein in human conjunctival tissue was performed. The explanation is described below.

(Method)
The ocular surface conjunctival tissue excised and discarded at the time of surgery from a human patient who had consented to be used for the experiment was frozen and embedded, and a section was prepared. Thereafter, this section was subjected to HE staining and fluorescent immunostaining. In fluorescent immunostaining, Abcam Goat polyclonal ab106787 was used as an anti-IKZF1 antibody after being diluted 100 times, and DAKO Goat IgG was used as an isotype control at the same concentration. As the secondary antibody, Alexa488-labeled anti-Goat IgG antibody was used.

(result)
In addition to the infiltrating cells, the conjunctival epithelial nucleus was stained with anti-IKZF1 antibody in both SJS conjunctival tissue and control conjunctival tissue (conjunctival laxity).
SJS supracorneal scarring conjunctival tissue 1 (FIG. 14)
SJS conjunctival tissue 2 (Fig. 15)
Control conjunctival tissue 1 (FIG. 16)
Control conjunctival tissue 2 (FIG. 17)
(Conclusion)
In human in vivo conjunctival tissue, the expression of IKZF1 protein was confirmed by immunostaining in human conjunctival epithelial cells.

(Example 7. Screening method for novel anti-inflammatory treatment targeting IKAROS of epithelial cells)
The present inventors have reported that TLR3 promotes skin inflammation as well as ocular surface mucosal inflammation (Nakamura N, Tamagawa-Mineoka R, Ueta M, Kinoshita S, Katoh N. Toll-Like Receptor 3 Increases Allergic J IrInvestant Contact Dermatitis. J Invest Dermatol. 2014 Sep 17. doi: 10.1038 / jid.2014.402 .; and Ueta M, Uematsu S, Akira S, Kinoshita S: Toll-like receptor 3 enhances late-phase reaction of experimental allergic conjunctivitis. J Allergy Clin Immunol. 2009; 123 (5): 1187-1189.). It has also been reported that expression of inflammation-related substances such as IFN-beta, TSLP, RANTES, MCP1, IP-1, IL-6, and IL-8 is increased in epithelial cells by polyI: C and TLR3 (Ueta M, Hamuro J, Kiyono H, Kinoshita S: Triggering of TLR3 by polyI: C in human corneal epithelial cells to induce inflammatory cytokines. Biochem Biophys Res Commun. 2005; 331 (1): 285-294; Ueta M, Kinoshita S: Innate immunity of the ocular surface. Brain Res Bull. 2010; 81 (2-3): 219-228; and Ueta M, Mizushima K, Yokoi N, Naito Y, Kinoshita S: Gene-expression analysis of polyI: C-stimulated primary human conjunctival epithelial cells. Br J Ophthalmol. 2010; 94 (11): 1528-1532).

  In the present invention, the expression of IKAROS is induced in dermal mucosal epithelial cells by stimulation with TLR3, and IKAROS is expressed in epithelial cells strongly because of the strong expression of IKAROS in epithelial cells. , Suggesting that it plays an important role in skin mucosal inflammation induced by TLR3. As described above, in this example, an experiment for the purpose of demonstrating a screening method for a drug that can be used for a novel anti-inflammatory treatment targeting IKAROS of epithelial cells is performed.

(Method 1)
A drug exhibiting a suppressive action on polyI: C-induced IKAROS expression using cultured epithelial cells is selected. Specifically, using human epidermal cells in which IKAROS expression is induced by polyI: C, a drug that suppresses polyI: C-induced IKAROS expression is selected. The inhibitory action of IKAROS expression is verified by quantitative PCR.

(Method 2)
Using an epithelial-specific IKAROS transgenic mouse, a drug that suppresses mucocutaneous inflammation of the mouse is selected. Specifically, the candidate drug is applied to the pinna of epithelial-specific IKAROS transgenic mice for a certain period of time, the thickness of the ear is reduced, and the number of inflammatory cells is analyzed to examine the presence or absence of an inhibitory effect on inflammation. Then, a drug having an anti-inflammatory action is selected. In addition, IKAROS expression in the auricle after drug administration is analyzed, and a drug that suppresses IKAROS expression is selected.

(result)
It will be appreciated that any of methods 1-2 can be screened for agents and / or anti-inflammatory agents that modulate IKAROS expression.

(Example 8: Experiment with tetOnsystem IKZF1 shRNA-expressing HaCaT cells)
In this example, tetOnsystem IKZF1 shRNA-expressing HaCaT cells are prepared, and IKAROS expression is knocked down by administration of tetramycin in a state where IKAROS expression is induced with polyI: C, and changes in inflammation-related substances are analyzed. The experimental conditions are shown below.

(Materials and methods)
Poly I: C (polyriboinosinic acid-polyribocytidic acid)
Knockout Single Vector Inducible RNAi System (Clontech 630933)
TetOnsystem IKZF1 shRNA-expressing HaCaT cells are prepared by transfection as follows.

That is, MISSION esiRNA (SIGMA) is used for the IKZF1 gene. The siRNA is transfected into HacaT cells using Lipofectamine RNAiMAX (Life Technologies).
For confirmation of expression, the transfected cells are treated with PolyI: C to induce IKZ1 expression, total RNA is extracted from the cells treated with PolyI: C, and expression of IKZF1 and control genes is quantified by qPCR. .
-Construction of an inducible expression vector by tetON system and confirmation of activity are performed as follows.
-The expression vector is prepared as follows.

Four types of shRNAs against the IKZF1 gene are designed and prepared by incorporating the shRNA into a pSingle-rTS-shRNA vector.
For confirmation of expression, the transfected cells were treated with PolyI: C to induce IKZ1 expression, total RNA was extracted from the cells treated with PolyI: C, and knockdown of IKZF1 gene expression was transiently performed by qPCR. We examine by sex expression.
-Establishment of IKZF1 shRNA-expressing HaCaT cells is performed as follows.
-The inducible shRNA expression vector obtained in the previous step is prepared for transfection, transfected into HaCaT cells, and clones are isolated by limiting dilution and drug selective culture.
-Regarding the expression confirmation, the expression of IKF1 gene in PolyI: C-treated cells is examined using qPCR for the obtained 20 clones, and cell cultures in which knockdown is observed are expanded and cryopreserved.

(result)
From the above, the above-described experimental system of the present example reveals an inflammation suppression mechanism by IKAROS-specific knockdown.

(Example 9. Novel anti-inflammatory therapy targeting IKAROS of epithelial cells)
In this example, a novel anti-inflammatory therapy targeting IKAROS of epithelial cells can be demonstrated using an IKAROS inhibitor as identified in the present invention such as Example 4. The confirmation method of the inflammatory effect is shown below.

(Method 1)
A drug exhibiting a suppressive action on polyI: C-induced IKAROS expression using cultured epithelial cells is selected. Specifically, using human epidermal cells in which IKAROS expression is induced by polyI: C, a drug that suppresses polyI: C-induced IKAROS expression is selected. The inhibitory action of IKAROS expression is verified by quantitative PCR.

(Method 2)
Using an epithelial-specific IKAROS transgenic mouse, a drug that suppresses mucocutaneous inflammation of the mouse is selected. Specifically, the candidate drug is applied to the pinna of epithelial-specific IKAROS transgenic mice for a certain period of time, the thickness of the ear is reduced, and the number of inflammatory cells is analyzed to examine the presence or absence of an inhibitory effect on inflammation.

  (Method 3) Immunostaining is performed using skin tissue collected at the time of acute Stevens-Johnson syndrome biopsy or skin tissue collected at the time of atopic dermatitis biopsy to confirm the presence of increased expression of IKAROS .

(result)
In any of the methods 1 to 3, the inflammatory effect of the anti-inflammatory agent of the present invention can be confirmed.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, it is understood that the scope of this invention should be construed only by the claims. Patents, patent applications, and documents cited herein should be incorporated by reference in their entirety, as if the contents themselves were specifically described herein. Understood.

  According to the present invention, a prophylactic and / or therapeutic agent for a disease related to cell migration targeting IKAROS, which is a factor different from the target of conventional therapeutic agents, is provided. By providing therapeutic agents with new mechanisms of action, diseases that are not reversible in existing therapies, or diseases related to cell migration, inflammatory diseases, and existing Continued use of a therapeutic agent can provide better treatment for patients with inflammatory diseases that have acquired resistance to the therapeutic agent. Furthermore, the present invention can also be used for the purpose of preventing inflammatory diseases in advance, and for the purpose of preventing recurrence of illness in patients whose inflammatory diseases are temporarily in remission. Further, according to the present invention, it is possible to screen for a candidate substance for a novel preventive / therapeutic agent for inflammatory diseases that exerts a therapeutic or preventive action by inhibiting the expression or function of IKAROS.

SEQ ID NO: 1 IKAROS human nucleic acid sequence (NM_001220765.2)
Sequence number 2: IKAROS human amino acid sequence (NP_001207694)
SEQ ID NO: 3: IKAROS mouse nucleic acid sequence (NM_001025597.2)
SEQ ID NO: 4: IKAROS mouse amino acid sequence (NP_001020768)
Sequence number 5: The expression vector (pK5-Ikzfl-2A-EGFP) produced in the Example (FIG. 5)
SEQ ID NO: 6: K5p-F1 primer SEQ ID NO: 7: BGH-R3 primer SEQ ID NO: 8: K5p-F6 primer SEQ ID NO: 9: K5p-R2 primer SEQ ID NO: 10: GAPDH F 784435K6148E12 primer SEQ ID NO: 11: GAPDH R 784435K6148F01 primer SEQ ID NO: 12: Ikaros F PrimerA 768773 K5949A11 primer SEQ ID NO: 13: Ikaros R Primer C 768773 K5949B01 primer

Claims (16)

An anti-inflammatory agent comprising an IKAROS (IKZF1) inhibitor. The anti-inflammatory agent according to claim 1, wherein the IKAROS inhibitor is selected from the group consisting of PGE ₂ , anti-IKAROS siRNA, and anti-IKAROS antibody. The anti-inflammatory drug according to claim 1, wherein the anti-inflammatory drug targets epithelial tissue. The anti-inflammatory drug according to claim 1, wherein the inflammation is inflammation involving epithelium caused by IKAROS. The anti-inflammatory agent according to claim 1, which is a topical agent. The anti-inflammatory agent according to claim 1, wherein the anti-inflammatory agent is for the treatment or prevention of inflammation in skin or mucosal tissue. The following steps (1) to (3):
(1) contacting a cell containing a nucleic acid encoding a reporter protein under the control of the IKAROS gene or the transcriptional regulatory region of the gene of interest with a test substance;
(2) a step of measuring the expression level of an IKAROS gene or an IKAROS protein or reporter protein in the cell; and (3) an IKAROS gene or an IKAROS protein or a reporter protein as compared with a case where measurement is performed in the absence of a test substance. A method for screening an anti-inflammatory substance, comprising a step of selecting a test substance having a reduced expression level of as a candidate for an anti-inflammatory substance.   A method for screening an anti-inflammatory substance, which comprises contacting an IKAROS and a test substance and selecting a test substance capable of binding to IKAROS as a candidate for the anti-inflammatory substance. The following steps (1) to (3):
(1) a step of contacting a target cell of an inflammatory disease with a test substance in the presence and absence of IKAROS;
(2) a step of measuring the degree of inflammatory reaction in the cells under each condition; and (3) suppressing the inflammatory reaction in the presence of IKAROS as compared to the case of measuring in the absence of the test substance. A method for screening an anti-inflammatory substance, comprising a step of selecting a test substance that did not suppress an inflammatory reaction in the absence of IKAROS as a candidate for a substance that inhibits the function of IKAROS and exhibits an anti-inflammatory action. The method according to claim 9, wherein an inflammatory reaction is induced by polyI: C, interleukin-Iα (IL-1α), tumor necrosis factor (TNF) α or H ₂ O ₂ stimulation.   11. A method according to any one of claims 7, 9 or 10, wherein the cells comprise epithelial cells. The method according to any one of claims 7 to 11, wherein the inflammation is inflammation involving epithelium caused by IKAROS. A composition for increasing or inducing IKAROS gene expression, comprising polyI: C. An isolated cell in which expression of the IKAROS gene is increased or induced. An inflammation model animal in which expression of the IKAROS gene is increased or induced. The inflammation model animal according to claim 15, wherein the inflammation model animal has cell infiltration in at least one selected from the group consisting of skin tissue and mucosal tissue.