JP2015171359A - Modified pyranose oxidases - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide modified pyranose oxidases unsusceptible to oxygen, genes thereof, vectors, transformed cells and production methods thereof, as well as methods for measuring pyranose by using the enzyme, reagent compositions and sensors for pyranose measurement.SOLUTION: It was found that modified pyranose oxidases having an excellent feature that being unsusceptible to oxygen can be obtained by substituting amino acids of a pyranose oxidase (POD). Further, it was found that by using a polynucleotide encoding the modified enzyme, the enzyme can be produced with efficiency, and that pyranose measurement unsusceptible to oxygen is enabled by using the enzyme of the invention.

Description

  The present invention relates to a modified pyranose oxidase, a polynucleotide encoding the enzyme, a method for producing the enzyme, a method for measuring pyranose using the enzyme, a measuring reagent composition, and a biosensor.

  Pyranose oxidase is an enzyme that catalyzes a reaction that oxidizes glucose and other pyranose and donates electrons to oxygen to generate hydrogen peroxide (Patent Documents 1 and 2). Since the enzyme uses 1,5-anhydroglucitol (1,5-AG), which is a marker for diabetes, as a substrate, it is used as a diagnostic agent for diabetes.

  1,5-AG is important as a diagnostic marker for diabetes that is not easily affected by meals and the like, and is also attracting attention as a diagnostic marker for postprandial hyperglycemia, which is a diabetic reserve army. Among the measurement methods for 1,5-AG, there is a measurement method mediated by a mediator, including a step in which an enzyme donates an electron of a substrate to the mediator. Since pyranose oxidase donates electrons not only to the mediator but also to oxygen, there is a problem that measurement errors occur due to dissolved oxygen in the blood. For this reason, there has been a demand for an enzyme that is not easily affected by dissolved oxygen in the blood.

  As for pyranose oxidase, various derived enzymes are known, and amino acid sequences are also disclosed (Patent Document 3 and Non-Patent Documents 1 to 5).

Japanese Patent Laid-Open No. 02-42980 JP 2007-300818 A US Pat. No. 6,146,865

Microbial Cell Factories 9:57 (2010) Appl. Environ. Microbiol. 70: 5794-5800 (2004) Appl. Microbiol. Biotechnol. 67: 654-663 (2005) J. et al. Biotechnol. 52: 11-20 (1996) Biotechnol. Lett. 31, 1223-1228 (2009)

  The present invention provides a modified pyranose oxidase that is less susceptible to oxygen and a method for producing the same. Furthermore, it aims at providing the measuring method of a pyranose by this enzyme, a measuring reagent composition, and a sensor.

  The present invention has found that by replacing an amino acid of pyranose oxidase (POD), it is possible to obtain a modified pyranose oxidase having an excellent characteristic that it is hardly affected by oxygen. Furthermore, the present inventors have found that the enzyme can be efficiently produced using a polynucleotide encoding the enzyme, and that it is possible to measure pyranose that is hardly affected by oxygen using the enzyme.

That is, the present invention relates to the following [1] to [9].
[Aspect 1]
In the amino acid sequence of pyranose oxidase,
Comprising substitution at least one amino acid residue among amino acids at positions corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence represented by SEQ ID NO: 2,
Compared to the pyranose oxidase before modification, the ratio (PDH / POD) of pyranose dehydrogenase activity (PDH specific activity) per protein amount and pyranose oxidase activity (POD specific activity) per protein amount is increased. A modified pyranose oxidase.
[Aspect 2]
An amino acid sequence of a protein having pyranose oxidase activity, the amino acid sequence represented by SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14; SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14 An amino acid sequence having at least 95% similarity to the amino acid sequence shown in FIG. 1, or one or several amino acids in the amino acid sequence shown in SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14 is deleted or substituted Or in the added amino acid sequence:
Including substitution at at least one amino acid residue among amino acids at positions corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence represented by SEQ ID NO: 2.
The modified pyranose oxidase according to aspect 1.
[Aspect 3]
The amino acid at the position corresponding to P147 is proline, the amino acid at the position corresponding to L214 is leucine or isoleucine, the amino acid at the position corresponding to L216 is leucine, and the amino acid at the position corresponding to Q421 is glutamine, The modified pyranose oxidase according to embodiment 1 or 2, wherein the amino acid at the position corresponding to H423 is histidine, and the amino acid at the position corresponding to F447 is phenylalanine.
[Aspect 4]
The modified pyranose oxidase according to any one of aspects 1 to 3, wherein at least one amino acid residue at a position corresponding to P147, L214, L216, Q421, H423 or F447 is substituted with alanine.
[Aspect 5]
The modified pyranose oxidase according to any one of Embodiments 1 to 4, wherein PDH / POD is at least twice when PDH / POD of the enzyme having the amino acid sequence represented by SEQ ID NO: 2 is made 1 time .
[Aspect 6]
A polynucleotide encoding the modified pyranose oxidase according to any one of aspects 1 to 5.
[Aspect 7]
A recombinant vector comprising the polynucleotide according to aspect 6.
[Aspect 8]
A transformed cell transformed with the vector according to aspect 7.
[Aspect 9]
A method for producing a modified pyranose oxidase, comprising culturing the transformed cell of aspect 8 and collecting the modified pyranose oxidase from the obtained culture.
[Aspect 10]
A pyranose measurement method using the modified pyranose oxidase according to any one of aspects 1 to 5.
[Aspect 11]
A reagent composition for measuring pyranose comprising the modified pyranose oxidase according to any one of aspects 1 to 5.
[Aspect 12]
A biosensor for measuring pyranose comprising the modified pyranose oxidase according to any one of aspects 1 to 5.

  According to the present invention, it is possible to use a modified pyranose oxidase having an excellent characteristic that it is hardly affected by oxygen. Furthermore, the modified pyranose oxidase of the present invention can be efficiently produced, and even in a sample in which oxygen is present, more accurate pyranose measurement can be performed using the enzyme.

It is a figure which shows the evaluation result of the modified | denatured pyranose oxidase of this invention. The POD specific activity (POD activity per protein amount) of each enzyme is indicated by a white bar, and the PDH specific activity (PDH activity per protein amount) of each enzyme is indicated by a stripe bar. Triangles and numerical values show the modification rate (fold) of each modified enzyme when the modification rate (fold) of WT is set to 1. It is a figure which shows the measurement result of 1, 5-AG by the modified | denatured pyranose oxidase of this invention. It is a figure which shows the measurement result of glucose by the modified | denatured pyranose oxidase of this invention. FIG. 5 is a diagram showing the result of Run Alignment of SEQ ID NOs: 2, 9, 10, 11, 12, 13, and 14 with UniProt Align, and the modification positions surrounded by squares.

The “modified enzyme” in the present specification is an enzyme obtained by substituting a part of amino acids constituting a pyranose oxidase with another amino acid.
As used herein, “electron donating ability to oxygen” refers to the ability of an enzyme to donate electrons received from a substrate pyranose to oxygen. In this invention, it measured with the below-mentioned pyranose oxidase activity measuring method.
As used herein, “electron donating ability to mediator” is the ability of an enzyme to donate electrons received from a substrate pyranose to a mediator. In the present invention, the measurement was performed by a pyranose dehydrogenase activity measurement method described later.
The “modification rate (times)” of the present invention is the ratio (PDH / activity) of pyranose dehydrogenase activity (PDH specific activity) per protein amount and pyranose oxidase activity (POD specific activity) per protein amount of each enzyme. POD) is a ratio of PDH / POD of each modified enzyme when PDH / POD of the enzyme (WT) having the amino acid sequence represented by SEQ ID NO: 2 is set to 1. The PDH / POD of the enzyme (WT) having the amino acid sequence represented by SEQ ID NO: 2 is 0.63.

  In the present specification, amino acid residues may be expressed by single letter notation. Alanine is represented by A, leucine is represented by L, isoleucine is represented by I, phenylalanine is represented by F, glutamine is represented by Q, histidine is represented by H, and proline is represented by P.

The modified pyranose oxidase of the present invention is
In the amino acid sequence of pyranose oxidase,
It includes substitution at at least one amino acid residue among amino acids at positions corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence shown in SEQ ID NO: 2. The modified pyranose oxidase has a higher PDH / POD than the unmodified pyranose oxidase.

  The amino acid sequence of the pyranose oxidase before modification is not particularly limited as long as it is an amino acid sequence of a protein having pyranose oxidase activity, and a known pyranose oxidase sequence can be used. For example, UniProt's P59097, Q75ZP8, Q6QWR1, Q6UG02, P79076 and B9V8M9 sequences can be exemplified. Preferably, it is an amino acid sequence represented by SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14, and may be a sequence having homology with the sequence. Furthermore, the protein having the sequence has pyranose oxidase activity.

The modified pyranose oxidase of the present invention is
(A) the amino acid sequence represented by SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14,
(B) an amino acid sequence having homology with the amino acid sequence represented by SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14, or (c) SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14 In the amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown by the above, the position corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence shown in SEQ ID NO: 2 A protein having an amino acid sequence containing a substitution in at least one amino acid residue among amino acids. In addition, the protein which has an amino acid sequence as described in said (a), (b) and (c) which is a protein before modification has all pyranose oxidase activity.

  Homology is an amino acid sequence that preferably has at least 90%, or 95% similarity, more preferably at least 96%, 97%, or 98%. Or the identity is preferably at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92% or 95% amino acid sequence.

Similarity is based on the value of Similarity calculated by homology analysis between amino acid sequences of GENETYX (manufactured by GENETICS).
The identity is based on the value of identity calculated by homology analysis between the base sequences of GENETYX (manufactured by Genetics Co., Ltd.) or between amino acid sequences.

  A deletion, substitution or addition of one or several amino acids is preferably at most 60, more preferably at most 55, 50, 40, 30, 20, 10, or 5 Amino acid deletion, substitution and / or addition.

  In the amino acid sequence of pyranose oxidase, the expression “position corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence represented by SEQ ID NO: 2” is the starting amino acid of the amino acid sequence represented by SEQ ID NO: 2. The amino acid corresponding to 147th proline, 214th leucine, 216th leucine, 421th glutamine, 423th histidine or 447th phenylalanine when methionine (M) is the first is represented by SEQ ID NO: Can be identified by sequence alignment with 2. For example, the corresponding position can be specified as shown in FIG.

  The amino acid at the corresponding position is preferably proline corresponding to P147, preferably leucine corresponding to L214, preferably leucine or isoleucine corresponding to L216, More preferably, Qamine corresponds to glutamine, H423 preferably corresponds to histidine, and F447 preferably corresponds to phenylalanine.

  Moreover, it is preferable that it is alanine about the amino acid to substitute. That is, it is preferable that at least one amino acid residue at a position corresponding to P147, L214, L216, Q421, H423, or F447 is substituted with alanine.

  The modified pyranose oxidase of the present invention has a ratio (PDH / POD) of pyranose dehydrogenase (PDH) specific activity and pyranose oxidase (POD) specific activity larger than that of the pyranose oxidase before modification, preferably at least 1 0.0, more preferably at least 1.2, 1.5 or 2.0, which is less susceptible to oxygen than the pyranose oxidase prior to modification. Furthermore, the modified pyranose oxidase of the present invention preferably has a POD specific activity of at most 90%, 80%, 70 when the POD specific activity of the enzyme having the amino acid sequence represented by SEQ ID NO: 2 is 100%. % Or 60%.

  The modified pyranose oxidase of the present invention is preferably PDH / POD when the ratio of the PDH specific activity to the POD specific activity (PDH / POD) of the enzyme having the amino acid sequence represented by SEQ ID NO: 2 is 1-fold. Is at least 2 times, more preferably at least 2.5 times, 3 times, 4 times or 5 times. That is, the modification rate (times) is preferably at least 2 times, more preferably at least 2.5 times, 3 times, 4 times or 5 times.

  The polynucleotide of the present invention is a polynucleotide encoding the modified pyranose oxidase according to any one of Embodiments 1 to 5. The polynucleotide may be a sequence containing an intron or may be cDNA. For example, the polynucleotide which codes the amino acid sequence shown by sequence number 2, 9, 10, 11, 12, 13, or 14 or the amino acid sequence which has homology with this amino acid sequence can be illustrated.

  The polynucleotide of the present invention can be easily prepared by a known method. For example, it can be prepared by introducing mutations using the polynucleotide of the present invention as a template and various known PCR methods using appropriate primer sets. Or you may synthesize | combine artificially. The polynucleotide may be a codon usage optimized according to the transformed cell.

  As the template polynucleotide, the sequence described in SEQ ID NO: 1 may be synthesized. Alternatively, a gene that encodes an amino acid sequence having similarity and / or identity by hitting a homology search such as BLAST (blastp or tblastn) to the public sequence using the amino acid sequence described in SEQ ID NO: 2 Arrays are also available. Primers can be designed from the public sequence and amplified by PCR or RT-PCR using the DNA or RNA of the strain derived from the gene sequence as a template. It can also be obtained from strains of the same species or genus as the strain derived from the public sequence. Alternatively, it can be synthesized artificially from public sequence information. The similarity is preferably at least 90%, 95%, 97% or 98%. The identity is preferably at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 92% or 95%. The sequence described in SEQ ID NO: 1 is a base sequence encoding the sequence of SEQ ID NO: 2, which is the amino acid sequence of wild-type pyranose oxidase.

  The recombinant vector of the present invention is a cloning vector or an expression vector, and the vector is appropriately selected and contains the polynucleotide of the present invention as an insert. The insert may contain an intron when the host is a eukaryotic cell. The expression vector may be either a prokaryotic expression vector or a eukaryotic expression vector, and examples thereof include a pUC system, pBluescript II, pET expression system, pGEX expression system, pCold expression system, etc. Preferred vectors. If necessary, a polynucleotide that contributes to the expression of chaperone, lysozyme, etc. can be introduced into the same and / or different vector as the polynucleotide of the present invention.

  Examples of the transformed cells of the present invention include prokaryotic cells such as Escherichia coli and Bacillus subtilis, eukaryotic cells such as fungi (yeast, Aspergillus genus Ascomycetes, basidiomycetes, etc.), insect cells, mammalian cells and the like. And can be obtained by transformation with the vector of the present invention.

  A recombinant modified pyranose oxidase can be produced by collecting the modified pyranose oxidase from a culture obtained by culturing the transformed cell of the present invention.

  For culturing the modified pyranose oxidase-producing bacterium used in the present invention, a normal microorganism culture medium can be used. For example, any of a synthetic medium and a natural medium can be used as long as they contain moderate amounts of carbon sources, nitrogen sources, vitamins, inorganic substances, and other micronutrients required by microorganisms to be used. As the carbon source, glucose, sucrose, dextrin, starch, glycerin, molasses and the like can be used. Nitrogen sources include inorganic salts such as ammonium chloride, ammonium nitrate, ammonium sulfate, and ammonium phosphate, amino acids such as DL-alanine and L-glutamic acid, nitrogen containing peptone, meat extract, yeast extract, malt extract, corn steep liquor, etc. Natural products can be used. As vitamins, riboflavin, pyridoxine, niacin (nicotinic acid), thiamine and the like can be used. As the inorganic substance, monosodium phosphate, disodium phosphate, monopotassium phosphate, dipotassium phosphate, magnesium sulfate, ferric chloride and the like can be used. Furthermore, compounds necessary for adjusting protein expression may be added as appropriate.

  The culture for obtaining the modified pyranose oxidase of the present invention is usually preferably performed by a method such as shaking culture or aeration stirring. Based on the characteristics of the modified pyranose oxidase-producing bacterium, culture conditions suitable for production of the modified pyranose oxidase may be set. For example, the culture temperature is preferably 10 to 45 ° C. and pH 4 to pH 10, and the pH may be adjusted during the culture in consideration of productivity. If the culture period is batch culture, the range of 1 to 6 days is preferable, but if the amount of production is increased by fed-batch culture or continuous culture, the period is extended within the range where productivity is judged to be optimal. Can do.

  As a method for obtaining the modified pyranose oxidase from the culture, an ordinary protein production method can be used. For example, after first cultivating a modified pyranose oxidase-producing bacterium, a culture supernatant is obtained by centrifugation. Alternatively, cultured cells are obtained, the cultured microorganisms are crushed by an appropriate method, and a supernatant is obtained from the crushed liquid by centrifugation or the like. Next, the modified pyranose oxidase contained in these supernatants can be purified by an ordinary protein purification method to obtain a purified enzyme. For example, it can be purified by combining purification operations such as ultrafiltration, salting out, solvent precipitation, heat treatment, dialysis, ion exchange chromatography, hydrophobic chromatography, gel filtration, and affinity chromatography.

  Pyranose can be measured using the modified pyranose oxidase of the present invention. The pyranose measurement method of the present invention includes a step of bringing a test sample containing pyranose into contact with the modified pyranose oxidase of the present invention, whereby the pyranose in the test sample can be quantified. The measurement target is not particularly limited as long as it is a pyranose on which the enzyme of the present invention acts. For example, it is useful for glucose measurement, xylose measurement, galactose measurement, or 1,5-AG measurement. Since the enzyme of the present invention is hardly affected by oxygen, an accurate measurement value can be obtained by using the enzyme of the present invention even in a measurement system that is affected by dissolved oxygen. Although the measuring object of this invention is not specifically limited, For example, a biological sample can be illustrated and a blood sample can be illustrated as a specific example. Furthermore, the measurement method of the present invention can be combined with a step of eliminating, separating or removing impurities present in the test sample that affect the measurement. For example, when 1,5-AG is a measurement target, it can be combined with a step of eliminating, separating or removing glucose.

  Using the modified pyranose oxidase of the present invention, a pyranose measuring reagent composition can be produced, and a pyranose measuring reagent composition containing the enzyme can be easily produced. The reagent composition of the present invention may be a reagent composition containing the modified pyranose oxidase of the present invention as an enzyme. The amount of enzyme in the composition is not particularly limited as long as the measurement target can be measured, but is preferably about 0.0001 to 50 U, more preferably about 0.001 to 20 U. Furthermore, arbitrary mediators (electron acceptors) can be included, and examples include ferricyanide compounds, quinone compounds, osmium compounds, phenazine compounds, phenothiazine compounds, and the like. In addition, the composition may appropriately contain other optional components known to those skilled in the art such as a stabilizer or a buffering agent, thereby enhancing the thermal stability and storage stability of the enzyme and reagent components. Examples include bovine serum albumin (BSA) or ovalbumin, saccharides or sugar alcohols having no activity with the enzyme, carboxyl group-containing compounds, alkaline earth metal compounds, ammonium salts, sulfates or proteins. Furthermore, a known substance that suppresses the influence of contaminants that affect the measurement present in the test sample can be included in the measurement reagent.

  A biosensor using the modified pyranose oxidase of the present invention can be produced. The biosensor of the present invention may be any sensor that includes the modified pyranose oxidase of the present invention in the reaction layer as an enzyme. For example, the biosensor is manufactured by forming an electrode system on an insulating substrate using a method such as screen printing or vapor deposition, and further including the enzyme and a mediator. In addition, it is possible to construct a biosensor that detects color development intensity or pH change. A glucose sensor, a xylose sensor, a galactose sensor, a 1,5-AG sensor, or the like that is hardly affected by oxygen can be manufactured.

  Furthermore, the modified pyranose oxidase of the present invention can be used in a biobattery. The biobattery according to the present invention includes an anode electrode that performs an oxidation reaction and a cathode electrode that performs a reduction reaction, and includes an electrolyte layer that separates the anode and the cathode as necessary. An enzyme electrode containing the above-mentioned electron mediator and modified pyranose oxidase is used as an anode electrode, and electrons generated by oxidizing the substrate are taken out to the electrode and protons are generated. On the other hand, an enzyme generally used for the cathode electrode may be used on the cathode side, for example, by using laccase, ascorbate oxidase or bilirubin oxidase, and reacting protons generated on the anode side with oxygen. Generate water. As the electrode, an electrode generally used for a bio battery such as carbon, gold, or platinum can be used.

  Hereinafter, the present invention will be described in more detail with reference to examples. The technical scope of the present invention is not limited by these descriptions. Moreover, the content described in the literature referred in this specification comprises the content disclosed by this specification as a part of this specification.

[Example 1]
(Acquisition of mutation transgene)
Mutagenesis was performed by PCR using the mutagenesis primer. Specifically, a primer phosphorylated on the 5 ′ side was annealed to the antisense strand of the template and extended with a polymerase. The extended DNA fragment was ligated in the same reaction solution using DNA ligase, and a method in which a portion other than the mutated portion was complementary to the template was obtained.

(1) Primer for introducing mutation In order to introduce site-specific mutation into the pyranose oxidase (POD) gene, the following primers were designed and synthesized.
PROD-P147A (SEQ ID NO: 3) was used as a primer for replacing the 147th proline (P) in the amino acid sequence of SEQ ID NO: 2 with alanine (A) (P147A). Similarly, other primers for amino acid substitution were PROD-L214A, PROD-L216A, PROD-Q421A, PROD-H423A and PROD-F447A (SEQ ID NOs: 4 to 8).
PROD-P147A: 5'TGGACCTGCGCTACAGCGGAGTTCTTCAAGGAA 3 '(SEQ ID NO: 3)
PROD-L214A: 5'CGCGGTATCAAACCTGCCCCGCTCGCATGTCAT 3 '(SEQ ID NO: 4)
PROD-L216A: 5'ATCAAACCTCTCCCGGCCGCATGTCATCGTCTT 3 '(SEQ ID NO: 5)
PROD-Q421A: 5'TTCCCTTGGCACGCAGCGATTCATCGCGACGCG 3 '(SEQ ID NO: 6)
PROD-H423A: 5'TGGCACGCACAGATTGCTCGCGACGCGTTCAGC 3 '(SEQ ID NO: 7)
PROD-F447A: 5'GTCGACCTAAGGTTCGCTGCTCGTCAGGCCAGA 3 '(SEQ ID NO: 8)

(2) Primer 5 ′ phosphorylation 100 μM Primer 2 μl, 10 × T4 polynucleotide kinase buffer 5 μl, 0.1 M ATP 1.0 μl, sterile water 41 μl and 10 U / μl T4 polynucleotide kinase 1 μl were mixed at 37 ° C. for 60 minutes. did. Thereby, a 5 ′ phosphorylated primer was prepared.

(3) PCR for mutation introduction
Plasmid pET21a (+) / POD, in which the unmutated POD gene was inserted into the NdeI-EcoRI site at the multiple cloning site of plasmid pET21a (+), was used as a template for mutagenesis PCR. The POD gene sequence is the base sequence set forth in SEQ ID NO: 1.

  5 ′ phosphorylated primer 4 μl, template (pET21a (+) / POD) 100 ng, 10 × polymerase buffer 2.5 μl, 10 × DNA ligase buffer 2.5 μl, 2.5 mM dNTPs 1 μl, 2.5 U / μl polymerase (pfu) Sterile water was added to 1 μl and 40 U / μl Taq DNA ligase 0.5 μl to obtain 50 μl of a PCR reaction solution. A PCR reaction solution was prepared for each primer, and PCR was performed under the following reaction conditions.

(Reaction conditions)
1) 65 ° C for 5 minutes 2) 95 ° C for 2 minutes 3) 95 ° C for 30 seconds 4) 50 ° C for 30 seconds 5) 65 ° C for 10 minutes Repeat the above 3) to 5) for 30 cycles 6) 75 ° C for 10 minutes

(4) DpnI treatment The template plasmid was decomposed by adding 1 μl of DpnI to each PCR product and incubating at 37 ° C. for 1 hour.

(5) Acquisition of Mutation Transgene Each E. coli JM109 was transformed with each sample after DpnI treatment. Plasmid extraction was performed from each cultured Escherichia coli. As a result of analyzing the base sequence of the inserted portion of each extracted plasmid vector, it was confirmed that the target mutation was introduced into the POD gene in the inserted portion. Each plasmid vector containing the mutagenesis gene was transformed into pET21a (+) / P147A, pET21a (+) / L214A, pET21a (+) / L216A, pET21a (+) / Q421A, pET21a (+) / H423A and pET21a (+) / It was set to F447A.

[Example 2]
(Evaluation of activity of modified enzyme)
(1) Acquisition of Mutant Strains Each Escherichia coli BL21 (DE3) was transformed with each plasmid vector containing the mutant transgene obtained in Example 1. Each transformed Escherichia coli containing a mutation transgene was used as a mutant. Each mutant strain was cultured in a liquid medium and then collected by centrifugation. The liquid medium contains ampicillin at a final concentration of 100 μg / mL and IPTG at a final concentration of 0.1 mM.

(2) Acquisition of modified enzyme 50 mM phosphate buffer (KPB) to which each of the collected mutant strains was added with DNase I to a final concentration of 2.5 μg / mL and lysozyme to a final concentration of 0.1 mg / mL ( suspended in pH 7.5). 0.4 mL of this suspension was dispensed into 96 deep wells and incubated at 37 ° C. for 15 minutes. Next, Tween 20 (polyoxyethylene (20) sorbitan monolaurate, manufactured by Wako Pure Chemical Industries, Ltd.) was added to a final concentration of 1% and incubated at 37 ° C. for 15 minutes. Furthermore, the liquid was frozen at −80 ° C. and thawed at 37 ° C. Subsequently, each precipitate was removed by centrifugation, and the supernatant (CFE) was collected. Each collected CFE was used as a modified enzyme solution. Each modified enzyme was P147A, L214A, L216A, Q421A, H423A, and F447A.

(3) Pyranose oxidase activity measurement method Water 2.1 mL, 10 mM KPB (pH 7.0) 0.1 mL, 50 U / mL peroxidase 0.2 mL, 12.4 mM 4-aminoantipyrine 0.2 mL, 210 mM phenol 0.2 mL and 0.1 mL of 1M D-glucose was mixed and incubated at 37 ° C. for 10 minutes. Next, 0.1 mL of the enzyme sample was added thereto, ΔOD / min at 500 nm was measured, and the activity was calculated by the following equation using the initial velocity method.
Pyranose oxidase (POD) activity (U / mL) = (ΔOD / min × 3.0 (mL) × dilution ratio of enzyme) / (10.66 × 1/2 × 1.0 × enzyme addition amount (mL) )
* 10.66: Molecular extinction coefficient of quinoneimine dye at 500 nm * 1.0: Optical path length (cm)
By this method, the ability to donate electrons to oxygen was measured.

(4) Pyranose dehydrogenase activity assay method 0.61 mL of water, 1 mL of 100 mM KPB (pH 7.0), 3 mM DCIP 0.14 mL, 3 mM 1-m-PMS 0.2 mL, 1 M D-glucose 1 mL are mixed, and 37 ° C. Incubated for 10 minutes. Next, 0.05 mL of the enzyme sample was added thereto, ΔOD / min at 600 nm was measured, and the activity was calculated by the following equation using the initial velocity method.
Pyranose dehydrogenase (PDH) activity (U / mL) = (ΔOD / min × 3.0 (mL) × dilution ratio of enzyme) / (16.3 × 1.0 × addition amount of enzyme (mL))
* 16.3: Molecular extinction coefficient of DCIP at 600 nm * 1.0: Optical path length (cm)
By this method, the ability to donate electrons to the mediator was measured.

(5) Protein concentration measurement The protein concentration was measured by the Bradford method using a BIO-RAD protein assay kit. The measured value was used for calculation of specific activity.

(6) Evaluation of each modified enzyme About each modified enzyme obtained in (2), POD activity, PDH activity, and protein concentration were measured by the above-mentioned method. The transformed E. coli containing the POD structural gene used in Example 1 as a PCR template was used as an unmutated strain. Similarly to the modified enzyme solution, CFE was prepared from the unmutated strain and used as an unmutated enzyme solution (WT).

From each measured value, the POD specific activity (U / mg) and PDH specific activity (U / mg) of each sample were calculated. Furthermore, the relative value (%) of the POD specific activity of each sample was calculated with the POD specific activity of WT as 100%. Table 1 shows the results.
In all the modified enzymes, the POD specific activity is reduced, and the amino acid substitution P147A, L214A, L216A, Q421A, H423A or F447A reduces the ability of the modified enzyme to donate electrons to oxygen by 60% or less compared to WT. It turned out that it fell.

Further, the ratio of PDH specific activity to POD specific activity (PDH / POD) was calculated and shown in Table 1.
WT PDH / POD was 0.629. This means that WT has a higher ability to donate electrons to oxygen than to give electrons to the mediator. In contrast, the obtained modified enzymes P147A, L214A, L216A, Q421A, H423A or F447A have PDH / POD of 1.46, 4.39, 3.14, 5.33, 44.4 or 23.1. In both cases, PDH / POD was larger than that of pyranose oxidase (WT) before modification, and specifically, PDH / POD was 1.0 or more in all cases.

Furthermore, the PDH / POD of each modified enzyme when the PDH / POD of WT is 1-fold was calculated as the modification rate (fold) and shown in Table 1.
The obtained modified enzymes P147A, L214A, L216A, Q421A, H423A or F447A have a modification rate (times) of 2.3, 7.0, 5.0, 8.5, 71, or 37, each of which is twice. That was all.
From this, it was found that all of the modified enzymes obtained in the present application were more than twice as capable of donating electrons to the mediator as compared to WT.

  From the above, it was found that a modified pyranose oxidase that was not easily affected by oxygen was obtained.

[Example 3]
(Purification of modified enzyme)
The cultured cells of the mutant strain transformed with pET21a (+) / H423A were suspended in a phosphate buffer and sonicated. Subsequently, the precipitate was removed by centrifugation, and the supernatant (CFE) was collected. The recovered CFE was heat treated and then subjected to an ammonium sulfate fraction treatment. The sample after the treatment was desalted, and finally the contaminating protein was removed with an anion exchange resin (trade name: DEAE Cellulofine A500m, manufactured by Tosoh Corporation) column to obtain a purified enzyme. When the purified enzyme was subjected to SDS-polyacrylamide electrophoresis, it was confirmed to show a single band of about 70 kDa.

[Example 4]
(Measurement of 1,5-AG using a modified enzyme)
Using the purified enzyme obtained in Example 3, 1,5-AG was quantified using a spectrophotometer based on the PDH activity measurement method of Example 2 (4). 1,5-AG was added as a substrate so that the final concentrations were 0.01, 0.05, 0.1, 1.0, 10, 20, 50 mM. The enzyme activity was calculated from the measurement results, and plotted as relative values (%) against 1,5-AG concentrations (0.01, 0.05, 0.1, 1.0, 10, 20, 50 mM) Is shown in FIG.
As shown in FIG. 2, it was found that 1,5-AG can be quantified in the concentration range of at least 0.01 to 50 mM using the modified pyranose oxidase of the present invention.

[Example 5]
(Measurement of glucose using a modified enzyme)
Using the purified enzyme obtained in Example 3, glucose was quantified using a spectrophotometer based on the PDH activity measurement method of Example 2 (4). Glucose was added as a substrate so that the final concentrations were 1.0, 3.0, 10, 20, and 55 mM. The enzyme activity was calculated from the measurement result, and the result plotted with the relative value (%) against the glucose concentration (1.0, 3.0, 10, 20, 55 mM) is shown in FIG.
As shown in FIG. 3, it was found that glucose can be quantified in the concentration range of at least 1.0 to 55 mM using the modified pyranose oxidase of the present invention.

Claims (12)

In the amino acid sequence of pyranose oxidase,
Comprising substitution at least one amino acid residue among amino acids at positions corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence represented by SEQ ID NO: 2,
Compared to the pyranose oxidase before modification, the ratio (PDH / POD) of pyranose dehydrogenase activity (PDH specific activity) per protein amount and pyranose oxidase activity (POD specific activity) per protein amount is increased. A modified pyranose oxidase. It has at least 95% similarity with the amino acid sequence shown by SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14 and the amino acid sequence shown by SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14. In an amino acid sequence or an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2, 9, 10, 11, 12, 13 or 14,
Including substitution at at least one amino acid residue among amino acids at positions corresponding to P147, L214, L216, Q421, H423 or F447 of the amino acid sequence represented by SEQ ID NO: 2.
The modified pyranose oxidase according to claim 1. The amino acid at the position corresponding to P147 is proline, the amino acid at the position corresponding to L214 is leucine or isoleucine, the amino acid at the position corresponding to L216 is leucine, and the amino acid at the position corresponding to Q421 is glutamine, The modified pyranose oxidase according to claim 1 or 2, wherein the amino acid at the position corresponding to H423 is histidine, and the amino acid at the position corresponding to F447 is phenylalanine. The modified pyranose oxidase according to any one of claims 1 to 3, wherein at least one amino acid residue at a position corresponding to P147, L214, L216, Q421, H423 or F447 is substituted with alanine. The modified pyranose oxidation according to any one of claims 1 to 4, wherein PDH / POD is at least doubled when PDH / POD of the enzyme having the amino acid sequence represented by SEQ ID NO: 2 is multiplied by 1. enzyme. A polynucleotide encoding the modified pyranose oxidase according to any one of claims 1 to 5. A recombinant vector comprising the polynucleotide according to claim 6. A transformed cell transformed with the vector according to claim 7. A method for producing a modified pyranose oxidase, comprising culturing the transformed cell of claim 8 and collecting the modified pyranose oxidase from the obtained culture. The pyranose measuring method using the modified pyranose oxidase of any one of Claims 1-5. A reagent composition for measuring pyranose comprising the modified pyranose oxidase according to any one of claims 1 to 5. The biosensor for a pyranose measurement containing the modified pyranose oxidase of any one of Claims 1-5.

Images