JP2015071585A - Muscular atrophy inhibitor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide pharmaceuticals, quasi drugs, food products, and feed having atrogin-1 expression inhibitory action and exhibiting muscular atrophy inhibitory effect, and materials exhibiting the same effect when it is blended in the pharmaceuticals, food products or the like.SOLUTION: An atrogin-1 expression inhibitor comprises one or more kinds of plants selected from cumin and horseradish or extract thereof as an active ingredient.

Description

  The present invention relates to muscle atrophy suppression that suppresses muscle atrophy.

  Skeletal muscle is the largest organ in the human body and plays an important role in energy metabolism, sugar uptake, and exercise. However, it is generally known that the amount of skeletal muscle decreases with age, and in Japan, where we are facing a super-aging society, it is considered important to suppress the decrease in skeletal muscle mass. It is done.

  On the other hand, in recent years, a muscle enhancer for pharmaceutical use (Patent Document 1) and a muscle enhancer that can be taken as a supplement (Patent Document 2) have begun to be provided.

  However, the pharmaceutical muscle-enhancing agent disclosed in Patent Document 1 uses IGF-1, which is a pharmaceutical agent, as an active ingredient and requires appropriate guidance from a doctor, so that it does not become a medical target such as improving the quality of life. It cannot be used for muscle strengthening means. Moreover, since the muscle strengthening agent which is this pharmaceutical is expensive, even if it is a subject, it is difficult to use continuously from an economical viewpoint. The supplement for muscle enhancement disclosed in Patent Document 2 uses amino acids and minerals, which are food ingredients, as active ingredients, but it is indispensable to use a high load exercise called resistance exercise. It is difficult to fully restore the muscles of those who have had muscle atrophy. Therefore, development of a muscle strengthening technique that exhibits a more remarkable effect is awaited.

  Atrogin-1 is a gene whose expression increases during various muscle atrophys, including a decrease in muscle mass associated with aging (Non-Patent Document 1), and is resistant to muscle atrophy in knockout mice. (Non-Patent Document 2), which is thought to play an important role in muscle atrophy. Therefore, it is considered that a material that suppresses the expression of atrodin-1 is effective in suppressing muscle atrophy.

Cuminum (Cuminum cyminum) is an annual herb that originates from Egypt and other countries. Seeds (cumin seeds) are used as a spice in curry powder. In Kampo, it is used as a stomach medicine.
Horseradish (Armoracia rusticana) is a cold-resistant perennial plant of the Brassicaceae family and has been widely used as a condiment since ancient times, and the enzyme peroxidase derived from this species has been widely used in biochemical experiments.
However, it has not been known at all that such cumin and horseradish have an inhibitory action on the expression of atrodin-1 and an inhibitory action on muscle atrophy.

JP 2005-534651 A JP 2004-256513 A

FASEB J.H. 18: 39-51, 2004 Science 294: 1704-1708, 2001

  The present invention provides a drug that has an atrodin-1 expression-suppressing action and exhibits a muscle atrophy-suppressing effect, and when it is blended in a pharmaceutical, quasi-drug, food, feed, pharmaceutical or food, etc. About doing.

  As a result of searching for an effective component for suppression of muscle atrophy, the present inventors have found that cumin extract and horseradish extract have a gene expression inhibitory effect on atrodin-1 which is a gene causing muscle atrophy, which suppresses muscle atrophy. It was found useful as a material capable of exerting an effect.

That is, the present invention relates to the following (1) to (2).
(1) An atrosin-1 expression inhibitor comprising one or more plants selected from cumin and horseradish or an extract thereof as an active ingredient.
(2) A muscle atrophy inhibitor comprising as an active ingredient at least one plant selected from cumin and horseradish or an extract thereof.

  The composition containing the atrosine-1 expression inhibitor and muscle atrophy inhibitor of the present invention suppresses muscle atrophy during daily activities without requiring doctor's guidance or high-load exercise for a wide range of age groups. It is useful as food, medicine, quasi-drug, and feed. In particular, since it is possible to suppress muscle atrophy with foods or supplements, it contributes to QOL improvement of the elderly.

The graph which shows the effect | action with respect to Foxol1 inducible atrosine-1 promoter activation. The graph which shows the effect | action which acts on a dexamethasone-induced atrodin-1 expression. The graph which shows the effect | action with respect to the muscular atrophy by tail suspension treatment.

Cumin, which is a plant of the present invention, is also referred to as a horse mackerel (baki, makin, umazueri), and means a cumin (scientific name: Cuminum cyminum) of the celery family.
Horseradish means horseradish (horseradish, scientific name: Armoracia rusticana).

The plant of the present invention can be used for whole plants, leaves, stems, buds, flowers, buds, roots, rhizomes, seeds, etc., or a combination thereof. It is preferable to use the horseradish, and it is preferable to use the root as it is or after pulverizing.
Such a plant can be used as it is or as a squeezed juice obtained by squeezing it, a dried product obtained by drying the plant itself or a pulverized product thereof, or an extract extracted therefrom. Is preferred.

As the extract, various solvent extracts obtained by a known extraction method such as extraction of plant bodies at room temperature or under heating or extraction using an extraction device such as a Soxhlet extractor, dilutions thereof, A concentrated solution or a dry powder thereof may be mentioned.
Known extraction methods include, for example, immersion, decoction, leaching, reflux extraction, supercritical extraction, ultrasonic extraction, and microwave extraction.

As the extraction solvent used for obtaining the extract, either a polar solvent or a nonpolar solvent can be used. For example, water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; tetrahydrofuran and diethyl ether Linear and cyclic ethers such as polyethylene; polyethers such as polyethylene glycol; halogenated hydrocarbons such as dichloromethane, chloroform and carbon tetrachloride; hydrocarbons such as hexane, cyclohexane and petroleum ether; aroma such as benzene and toluene Group hydrocarbons; pyridines and the like, and these can be used alone or as a mixture. Of these, water, alcohol-based (alcohols and / or polyhydric alcohols) solvents, and water-alcohol mixed solvents are preferably used, and water-alcohol mixed solvents are preferable. Furthermore, as alcohols, methanol, ethanol, propanol, and butanol are more preferable, and ethanol is more preferable. Further, as the polyhydric alcohol, butylene glycol is more preferable.
More preferable water-alcohol mixed solvent is 20% (v / v) or more, preferably 50% (v / v) or more, and 95% (v / v) or less, 90% (v / v) or less. The ethanol aqueous solution of this is mentioned. For example, 20-95% (v / v) ethanol aqueous solution, Preferably 50-95% (v / v) ethanol aqueous solution is mentioned.

  The plant extract of the present invention uses, for example, 5 to 60 parts by mass, preferably 5 to 30 parts by mass of an extraction solvent with respect to 1 part by mass of the plant body, and preferably at 4 to 100 ° C. for 1 hour to 30 days. Can be performed by extracting for 7 to 21 days.

  The above extract can be used as it is, but it can also be used by diluting, concentrating or lyophilizing the extract and preparing it in a powder or paste form. Also, freeze-dry and dilute with a solvent usually used for extraction, such as water, ethanol, propylene glycol, butylene glycol, water / ethanol mixture, water / propylene glycol mixture, water / butylene glycol mixture, etc. It can also be used. It can also be used by encapsulating in vesicles such as liposomes or microcapsules.

  The plant extract of the present invention may be a crude product as long as it conforms to food and pharmaceutical acceptable standards and exhibits the effects of the present invention. These purities may be increased by appropriately combining separation and purification methods. Examples of the purification means include organic solvent precipitation, centrifugation, ultrafiltration membrane, high performance liquid chromatograph, column chromatograph and the like.

  As shown in Examples described later, the plant extract of the present invention suppresses the expression of atrodin-1 (suppresses the promoter activity of atrodin-1 via Foxo and suppresses dexamethasone-induced atrodin-1 expression). , Has an effect of suppressing muscle atrophy. Since Atrodin-1 is a rate-determining enzyme of the ubiquitin / proteasome degradation system, which is one of muscle protein degradation systems, suppressing the expression of Atrodin-1 inhibits muscle protein degradation and contributes to the suppression of muscle atrophy. (See Non-Patent Document 2).

Therefore, the plant of the present invention or an extract thereof can be an atrosin-1 expression inhibitor and a muscle atrophy inhibitor (hereinafter referred to as “atrosin-1 expression inhibitor, etc.”), which suppresses atrosin-1 expression and muscle atrophy. Can be used for. For example, it can be used to suppress muscle atrophy that occurs with aging. Here, the use can be in humans or non-human animals, or specimens derived therefrom, and can be either therapeutic or non-therapeutic. Here, “non-therapeutic” means a concept that does not include medical practice, that is, a concept that does not include a method for operating, treating, or diagnosing a person, more specifically, a doctor or a person who has received instructions from a doctor It is a concept that does not include a method for performing surgery, treatment, or diagnosis on the subject.
Moreover, the plant of this invention or its extract can be used in order to manufacture an atrodin-1 expression inhibitor etc.

In the present invention, the expression suppression of atrodin-1 typically means i) inhibiting or suppressing the transcription of the atrodin-1 gene into atrosin-1 mRNA, ii) atrodin-1 mRNA into atrosin-1 protein Inhibiting or suppressing the translation of.
More specifically, suppression of the promoter activity of atrodin-1 via Foxo, which is a forkhead transcription factor (Test Example 1), and suppression of the expression of Atrodin-1 in dexamethasone-treated cultured myotube cells (Test Example 2) Can be mentioned.
There is a Foxo binding sequence upstream of the Atrodin-1 promoter, and it is known that Foxo directly regulates the transcription of Atrodin-1 by directly binding to the Atrodin-1 promoter (Cell 117: 399- 412, 2004). In addition, Foxo gene expression increases in various muscle atrophy (FEBS Lett. 536: 232-236, 2003). Furthermore, in the skeletal muscle of Foxo1 transgenic mice in which Foxo1 is overexpressed in a muscle-specific manner, As muscle atrophy occurs and an increase in Atrosin-1 gene expression is observed (J Biol
Chem. 279: 41114-41123, 2004), suppressing the expression of Atrodin-1 via Foxo is thought to lead to the suppression of muscle atrophy. Moreover, dexamethasone increases the expression of atrodin-1 in skeletal muscle and induces muscle atrophy (Crit. Care. Med. 35: S602-S608, 2007, J. Cell Biochem. 105: 353-364, 2008) In addition, since the expression of atrodin-1 is also increased by dexamethasone treatment in cultured myotubes, the suppression of the expression of atrosine-1 in dexamethasone-treated cultured myotubes is an index for the suppression of muscle atrophy.

  In the present invention, “muscle atrophy” means that muscle protein decreases or muscle cells decrease due to the degradation rate of muscle protein exceeding the synthesis rate, resulting in a decrease in muscle mass. Specifically, long-term resting bed, cast fixation due to fractures, etc., progressive muscle due to diseases such as muscular atrophy (referred to as disuse muscular atrophy) by microgravity exposure, amyotrophic side sclerosis (ALS), etc. In addition to atrophy, age-related muscle atrophy (sarcopenia) that exhibits the same symptoms as muscle atrophy with age, muscle atrophy that occurs with cancer (cachexia), sepsis, type 1 diabetes, etc. are included The Therefore, “suppression of muscle atrophy” refers to suppression of a decrease in muscle mass due to inactivity, aging, disease, or the like.

  The composition containing the atrosine-1 expression inhibitor of the present invention or the like is a pharmaceutical product for humans or animals, a quasi-drug, a food, or a drug that exhibits an effect of suppressing muscle atrophy when ingested or administered to animals including humans. It becomes a feed, and an atrogin-1 expression inhibitor or the like can be a material or a preparation used by blending with the drug, quasi drug, food or feed.

  In addition, the food is based on the concept of an atrodin-1 expression inhibitor and a muscle atrophy inhibitor for exercise deficient persons, middle-aged and elderly persons, bed rest persons, and the like. Foods for consumers, foods for specified health use, and supplements are included.

  Examples of the administration form of the above pharmaceuticals include oral administration by tablets, capsules, granules, powders, syrups, etc. or parenteral administration by injections, suppositories, inhalants, transdermal absorption agents, external preparations and the like. . In addition, the preparation of such various dosage forms includes the plant of the present invention or an extract thereof and other pharmaceutically acceptable excipients, binders, extenders, disintegrants, surfactants, lubricants. An agent, a dispersant, a buffering agent, a preservative, a flavoring agent, a fragrance, a film agent, a carrier, a diluent, a medicinal component other than the plant of the present invention or an extract thereof, and the like can be appropriately combined. Of these dosage forms, the preferred form is oral administration, and oral liquid preparations can be prepared by conventional methods with the addition of flavoring agents, buffers, stabilizers and the like.

  The content of the plant of the present invention or the extract thereof in the preparation for oral administration (in terms of a dry product of the extract) is generally 0.01% by mass or more, preferably 0.1% by mass or more of the total mass of the formulation. Yes, more preferably 1% by mass or more, and 100% by mass or less, preferably 90% by mass or less. Moreover, it is 0.01-100 mass%, Preferably it is 0.1-100 mass%, Preferably it is 1-100 mass%.

  Other foods such as soft drinks, tea beverages, coffee beverages, fruit juice beverages, carbonated beverages, juices, jelly, wafers, biscuits, breads, noodles, sausages, and other foods such as nutritious foods Furthermore, a nutritional supplement composition in the same form (tablet, capsule, syrup, etc.) as the above-mentioned oral administration preparation can be mentioned.

  Various forms of food include the plant of the present invention or an extract thereof, other food materials, solvents, softeners, oils, emulsifiers, preservatives, fragrances, stabilizers, colorants, antioxidants, moisturizers. , Thickeners, active ingredients other than the present invention, and the like can be appropriately combined.

  Moreover, as food for sick people, for example, food for elderly people who are difficult to supplement with an appropriate amount of nutrition or sick people in bed rest, it is possible to use a nutritional composition such as enteral nutrient.

  Examples of the feed include feed for small animals used for rabbits, rats, mice, etc., feed for pet foods used for dogs, cats, and the like, and can be prepared in the same form as the above foods.

  The content of the plant of the present invention or the extract thereof in the food or feed (in terms of the dry product of the extract) is generally 0.01% by mass or more, preferably 0.1% by mass or more, based on the total mass of the preparation. Yes, more preferably 1% by mass or more, and 100% by mass or less, preferably 90% by mass or less. Moreover, it is 0.01-100 mass%, Preferably it is 0.1-100 mass%, Preferably it is 1-100 mass%.

  The daily dose or intake per adult of the above-mentioned pharmaceutical or food is usually 0.01 mg or more, preferably 0.1 mg or more, as the plant of the present invention or an extract thereof (in terms of a dried product of the extract). And 100 mg or less, preferably 10 mg or less. Moreover, it is 0.01-100 mg, Preferably it is 0.1-10 mg. Moreover, although the intake frequency of the said formulation is arbitrary, it is preferable to take it once to several times a day.

  The subject of administration or ingestion is not particularly limited as long as it is an animal or a human who needs or desires suppression of muscle atrophy, but is particularly limited in those with exercise deficiency, locomotive syndrome, and age-related muscle weakness (sarcopenia) Ingestion is effective.

With respect to the above-described embodiment, the following aspects are disclosed in the present invention.
<1> Atrodin-1 expression inhibitor comprising at least one plant selected from cumin and horseradish or an extract thereof as an active ingredient.
<2> A muscle atrophy inhibitor comprising one or more plants selected from cumin and horseradish or an extract thereof as an active ingredient.
<3> Use of one or more plants selected from cumin and horseradish or an extract thereof for producing an atrosin-1 expression inhibitor.
<4> Use of one or more plants selected from cumin and horseradish or an extract thereof for producing a muscle atrophy inhibitor.
<5> One or more plants or extracts thereof selected from cumin and horseradish for use in suppressing atrodin-1.
<6> One or more plants selected from cumin and horseradish for use in suppressing muscle atrophy or an extract thereof.
<7> A method for suppressing atrodin-1 by administering or ingesting an effective amount of one or more plants selected from cumin and horseradish or an extract thereof.
<8> A method for inhibiting muscle atrophy by administering or ingesting an effective amount of one or more plants selected from cumin and horseradish or an extract thereof.
<9> In the above items <5> to <6>, the use is non-therapeutic use.
<10> In the above <7> to <8>, the method is a non-therapeutic method.
<11> In the above items <7> to <8>, the administration or ingestion target is an animal or a human who needs or desires muscle atrophy suppression.

Production Example 1 Preparation of Cumin Extract To 40 g of seeds of Cuminum cyminum (obtained from Shinwa Bussan), 400 mL of 50% ethanol water was added and extracted for 14 days at room temperature and standing conditions. Then, it isolate | separated from the non-extraction part by filtration and obtained 323 mL of 50% cumin ethanol extract. The evaporation residue of this extract was measured and found to be 1.64% (w / v).

Production Example 2 Preparation of Horseradish Extract 10 g of horseradish powder (trade name, obtained from Yasuma) was added with 100 mL of 50% aqueous EtOH solution, extracted at room temperature for 1 week under standing conditions, and then filtered to obtain an extract. Got. The solid content concentration of the extract was 3.74% (w / v).

Test Example 1 Action on Foxo1-Inducible Atrosin-1 Promoter Activation (1) Cloning of Mouse Atrosin-1 Promoter Region and Reporter Plasmid Construction About 3.5 kb in length upstream of exon 1 as mouse atrosin-1 promoter region In order to clone the region, a forward primer (attggtacctcggtggaaggtctctgta [SEQ ID NO: 1]) and reverse primer (attctcgagacggattgacagccaggaa [SEQ ID NO: 2]) are used, and a mouse BAC clone (RP23-391D2; Children's Hospital Oakland) is used as a template. Using DNA polymerase (TaKaRa LA-taq ^™ ; Takara Shuzo Co., Ltd.), 94 ° C for 1 minute followed by 25 cycles of 94 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 4 minutes followed by 72 ° C for 5 minutes conditions PCR was performed. The obtained PCR product was subcloned into a cloning vector (pGEMR-T Easy Vector Systems; Promega), and a DNA fragment was prepared by treatment with a restriction enzyme (Kpn1, Xho1: Takara Shuzo). The prepared DNA fragment was inserted into the multicloning site (Kpn1 / Xho1) of the pGL3-Basic vector (Promega) to obtain pGL3-Atrodin-1.

(2) Cloning of mouse Foxo1 CDS In mouse Foxo1, Foxo1 CDS (Open Biosystems) inserted into pENTR223.1 vector was inserted into pcDNA-DEST40 vector (Invitrogen) with LR clonase (Invitrogen).

(3) Measurement of promoter activation A mouse skeletal muscle cell line (C2C12) was seeded in a 24-well plate, and DMEM medium (10%
In fetal bovine serum) for 1 day. pGL3-Atrosin-1 plasmid and Renilla-derived luciferase expression vector phRL-TK (Promega) and pcDNA-DEST40-Foxo1 were simultaneously introduced using a transfection reagent (Lipofectamine ^™ Reagent: Invitrogen). Four hours after transfection, the medium was replaced with DMEM (5% charcoal-treated fetal bovine serum). Furthermore, after 4 hours, the medium was replaced with a serum-free medium (DMEM), and at the same time, the plant extract prepared in Production Examples 1 and 2 as a test substance (cumin extract: final concentration 0.0328% (w / v), horseradish extract) : Final concentration 0.0748% (w / v)) was added, and cultured for 22 hours.
After washing with PBS, cells were lysed using a dual luciferase assay system (Promega), a substrate solution containing luciferin was added to the lysate, and firefly and Renilla luciferase activities were measured with a luminometer. The luciferase activity was calculated as the relative value when the firefly luciferase activity / renilla luciferase activity was taken as 100 and the group not subjected to Foxo1 stimulation was taken as 100. Statistics were unpaired student's t-test, and the significance level was P <0.05. The results are shown in FIG.
Foxo1 significantly increased the promoter activity of atrodin-1. Cumin extract and horseradish extract significantly suppressed the activation by Foxo1.

Test Example 2 Effect on Dexamethasone-Induced Atrogin-1 Expression Mouse skeletal muscle cell line C2C12 (ATCC) is cultured in DMEM medium (10% fetal bovine serum), and differentiation is induced in DMEM medium (2% horse serum). It was. The medium was changed every two days, and on the fifth day of differentiation induction, the medium was changed to a differentiation medium containing 1 μM final concentration of dexamethasone (Dex) and cultured for 24 hours. When the dexamethasone was added, the plant extract prepared in Production Examples 1 and 2 had a final concentration of 0.0328% (w / v) for the cumin extract and a final concentration of 0.0748% (w / v) for the horseradish extract. At the same time. RNA was collected 24 hours after dexamethasone treatment.
Cell RNA extraction was performed using RNeasy mini kit (QIAGEN) according to the attached protocol.
After adjusting the concentration of each RNA, heat treatment was performed at 65 ° C. for 10 minutes, and after rapid cooling, reverse transcription reaction was performed using 1 μg of RNA. The reverse transcription reaction was performed according to the attached protocol using High Capacity RNA-to-cDNA Kit (Applied Biosystems). After the reaction, it was rapidly cooled at 4 ° C. Samples were stored at −20 ° C. until use.
Real-time PCR was performed with ABI PRISM 7700 Sequence Detector (Applied Biosystems) using the cDNA obtained by the reverse transcription reaction as a template. The reaction solution composition of real-time PCR is 10 μL Fast SYBR
Green PCR Master Mix (Applied Biosystems), 0.1 μL of 100 μM 5′-primer and 3′-primer, 4.8 μL dH ₂ O, 5 μL of cDNA was added thereto, and the reaction was performed in a 20 μL reaction system. The obtained analysis results were corrected based on the expression level of 36B4 mRNA and expressed as a relative mRNA expression level. The primers used are shown in Table 1. Statistics were unpaired student's t-test, and the significance level was P <0.05. The results are shown in FIG.

  Treatment with dexamethasone significantly increased the gene expression of atrodin-1. The cumin extract and horseradish extract significantly suppressed the increase in the expression of atrodin-1 by dexamethasone.

Test Example 3 Evaluation of Effect on Muscle Atrophy by Tail Suspension Treatment After a 10-week-old BALB / c mouse was bred for 2 weeks, a control-control diet group (n = 8) was prepared so that the body weight (about 27 g) became equal. The tail suspension-control diet group (n = 9), the tail suspension-cumin diet group (n = 7), and the tail suspension-horseradish diet group (n = 7).
Using the plant extracts prepared in Production Examples 1 and 2, each diet having the composition shown in Table 2 (unit: mass%) was prepared, and each diet was bred for 7 days, followed by tail suspension treatment. In the tail suspension treatment, a wire was fixed to the tail of the mouse with a double-sided tape or the like, and the wire was fixed to a cage wire netting so that the hind limb of the mouse floated in the air and left for 7 days. After the tail suspension treatment, the soleus weight of the mouse hind limb was measured. In addition, each diet was fed freely during the tail suspension treatment period. Statistics were unpaired student's t-test, and the significance level was P <0.05. The results are shown in FIG.

  From FIG. 3, the soleus weight of the mouse hind limb was reduced by tail suspension treatment. In the cumin diet intake group, the decrease in soleus muscle weight due to the tail suspension treatment was significantly suppressed. Moreover, also in the horseradish diet, the decrease in the soleus muscle weight by the tail suspension treatment was significantly suppressed. That is, it was confirmed that the cumin extract and the horseradish extract have a muscle atrophy inhibitory action.

Claims (2)

  An atrosin-1 expression inhibitor comprising at least one plant selected from cumin and horseradish or an extract thereof as an active ingredient.   A muscle atrophy inhibitor comprising at least one plant selected from cumin and horseradish or an extract thereof as an active ingredient.

Images