JP2014508514A - SCN5A splice variant for use in methods associated with sudden cardiac death - Google Patents

Abstract

Determining a subject's need for an implantable defibrillator, determining a subject's risk for sudden cardiac death (SCD), arrhythmia or heart failure, determining a subject's need for an antiarrhythmic agent, such as a sodium channel blocker Methods for determining and methods for reducing the risk of SCD in a subject are disclosed. Each of these methods determines the level of truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of full-length SCN5A exon 28 transcript in the biological sample, and (ii) total SCN5A exon 28 in the biological sample. Determining a ratio Rs that compares to the level of transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts can be included. Further provided are systems, computer readable media and methods implemented by a processor in a computer.

Description

Citation of Related Application No. 61 / 430,462, filed January 6, 2011, US Provisional Application 61 / 527,890, filed August 26, 2011, Claims priority to US Provisional Application No. 61 / 527,916, filed August 26, 2011, and US Provisional Application No. 61 / 557,203, filed November 8, 2011. The disclosure of each of these applications is incorporated herein by reference in its entirety.

US Government Statement of Benefits The present invention is supported by the US Government with the support of the National Institutes of Health (NIH) National Heart, Lung and Blood Institute (NHLBI) Grant No. R01 HL1024025. -01A1 and NIH under the Small Business Technology Transfer (STTR) grant number 1R41HL112355-01A1. The US government has certain rights to the invention.

INCORPORATION-BY-REFERENCE OF ELECTRONIC SUBMITTED MATERIALS Computer readable nucleotides filed concurrently with this specification, identified as a 2 megabyte ASCII (text) file named “46463A_SeqListing.txt” created on January 6, 2012 The amino acid sequence listing is hereby incorporated by reference in its entirety as part of this specification.

  Heart failure (HF) represents a major medical concern in the United States. It is estimated that approximately 5 million patients in the United States have HF and that an additional 550,000 people are diagnosed with this disease each year (Non-Patent Document 1). Of course, HF is the most common diagnosis in hospitalization.

  HF patients have a 6-9 fold higher risk of sudden cardiac death (SCD) than non-HF patients, and cardiac arrhythmias are the leading cause of death in HF patients (2); ). The “gold standard” for preventing SCD is the implantation of an implanted cardiac defibrillator (ICD). Extensive clinical trials support the longevity of ICD implantation.

  Currently, ICD is indicated for any patient with a chronic left ventricular ejection fraction (EF) of less than 35% (Non-Patent Document 4). New York Heart Association with non-ischemic dilated cardiomyopathy or ischemic heart disease at least 40 days after myocardial infarction, with an EF of 35% or less and receiving chronic optimal medical therapy Association (NYHA) American College of Cardiology (American College of Cardiology) to reduce overall mortality in patients with functional class II or III symptoms who have reasonable functional survival expectations over a year of Cardiology and the American Heart Association both recommend the installation of an implantable cardioverter defibrillator (ICD) for primary prevention of sudden cardiac death (Level of Evidence: A; ).

  Despite the wide acceptance and implementation of these guidelines, over 60% of patients with ICD have not experienced a shock from ICD because it is not necessary (Non-Patent Document 5). Thus, there are many patients who unnecessarily received ICDs.

  On average, ICDs cost between $ 20,000 and $ 50,000, excluding expenses for surgery, follow-up and complications. Implanted surgery itself also poses additional patient risks of complications such as massive bleeding, pneumothorax, heart perforation, arrhythmia induction, stroke, heart attack, need for emergency cardiac surgery and death.

  Current methods for determining the need for SCD risk stratification and ICD placement in patients have not been able to provide a simple and cost-effective way to achieve this goal. The method basically assesses only the ejection fraction (EF), which oversimplifies the complexity of SCD risk stratification, or whether the method is overly complex. Bloody or expensive. EF-focused methods do not adequately distinguish between low-risk and high-risk patients, probably because they do not directly reflect proarrhythmic pathophysiological processes, while being approved by other FDAs Techniques such as mean addition electrocardiogram (SAECG) and T-wave alternans are not widely used because the equipment and labor costs to implement them are too high. Some studies have also demonstrated that they lack utility (8-10). In addition, for the same reason, the majority of open electrophysiological tests have also been abandoned. Because risks can change over time, many of these techniques, if used at all, are often limited to a single assessment per patient.

Hunt et al., Circulation 112: e154-E235 (2005) Roger et al., Circulation 121 (7): e46-e215 (2010) Kannel et al., Am Heart J 115: 869-875 (1988) Hunt et al., Circulation 119: e391-E479 (2009) Bardy et al., N Eng J Med 352: 225-237 (2005)

  In view of the foregoing, there is a need in the art for a simple and inexpensive blood test to determine SCD risk and to determine a patient's need for an ICD implant.

  The invention provided herein shows that patients with an implantable cardioverter defibrillator (ICD) that shocks the patient exhibit increased levels of truncated SCN5A exon 28 splice variant transcripts, and full-length SCN5A Based in part on data demonstrating reduced levels of exon 28 transcripts.

  Thus, the present invention provides a method for determining a subject's need for an implantable defibrillator (ICD). In an exemplary embodiment, the method includes determining the level of full-length SCN5A exon 28 transcript and the level of truncated SCN5A exon 28 transcript in a biological sample obtained from the subject. In an exemplary embodiment, the method determines the level of total SCN5A exon 28 transcript, including all of the wild type (WT) exon 28 transcript, E28A transcript, E28B transcript, E28C transcript, and E28D transcript. Including the steps of:

In an exemplary embodiment, a method for determining a subject's need for ICD comprises determining the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, and (i) a full length SCN5A exon 28 transcript in the biological sample. Or (ii) the level of total SCN5A exon 28 transcript in a biological sample or (iii) the level of full length SCN5A exon 28 transcript in a biological sample and the level of one or more truncated SCN5A exon 28 transcripts , Determining the ratio R _s . In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

The invention also relates to (A) the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject, the level of (i) the full-length SCN5A exon 28 transcript in the biological sample, or (ii) the total SCN5A Determining the ratio R _s compared to the level of exon 28 transcript or (iii) the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample; B) comparing the R _s determined in (A) with a threshold ratio R _T determined by the system, to provide a method for determining a subject's need for ICD. In an exemplary aspect, a system includes a processor and a memory device coupled to the processor, the memory device being executed by the processor,
(I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a subject of the first population, wherein the ratio represents the level of truncated SCN5A exon 28 transcript (a Subjects known to have each subject in the first population have an ICD that has shocked, as compared to)) the level of full length SCN5A exon 28 transcript or (b) the level of total SCN5A exon 28 transcript To receive multiple data values,
(Ii) fitting a plurality of data values to a first Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the first Gaussian distribution;
(Iv) Let the first threshold ratio _{RT be set} to μ−Xσ (where X is a number between 0.7 and 4.0),
Store machine-readable instructions.

  The system is provided herein along with other related systems, related computer-readable storage media storing machine-readable instructions executable by the processor, and related methods implemented by the processor in the computer.

Patients who are shocked from ICD are at increased risk of sudden cardiac death. Thus, the present invention further provides a method for determining a subject's risk for sudden cardiac death. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject, (i) the level of a full length SCN5A exon 28 transcript in the biological sample, or (ii) Determining a ratio R _s that compares the level of SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of a biological sample. . In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

Patients at risk for sudden cardiac death are prescribed a form of antiarrhythmic therapy. Thus, the present invention additionally provides a method for determining a subject's need for antiarrhythmic therapy. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (ii) the level of the biological sample. Determining a ratio R _s that is compared to the level of total SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample. Including. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

The present invention further provides a method of reducing the risk of sudden cardiac death (SCD) in a subject. In an exemplary embodiment, the method comprises (A) the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject, (i) the level of a full length SCN5A exon 28 transcript in a biological sample, or (ii) Determine the ratio R _s that compares the level of total SCN5A exon 28 transcript in the biological sample or (iii) the level of full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcripts And (B) if R _S is greater than or equal to the threshold ratio R _T , administering an ICD or antiarrhythmic agent to the subject. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

The present invention provides a method of determining whether administration of antiarrhythmic therapy to a subject is safe. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (ii) the level of the biological sample. Determining a ratio R _s that is compared to the level of total SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample. Including. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

A method of determining a subject's risk for arrhythmia is also provided. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (ii) the level of the biological sample. Determining a ratio R _s that is compared to the level of total SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample. Including. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

The present invention still further provides a method for determining a subject's risk for heart failure. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (ii) the level of the biological sample. Determining a ratio R _s that is compared to the level of total SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample. Including. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant C (E28C) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A) Compare. In an exemplary embodiment, R _s compares the level of E28C in a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D. In an exemplary embodiment, R _s is the level of SCN5A exon 28 splice variant D (E28D) in a biological sample obtained from a subject, and the total level of WT SCN5A exon 28 transcript and SCN5A exon 28 splice variant A (E28A). Compare. In an exemplary embodiment, R _s compares the E28D level of a biological sample obtained from the subject with the total level of all SCN5A exon 28 transcripts: WT, E28A, E28B, E28C, E28D.

  As used herein, to determine a subject's need for an ICD or antiarrhythmic agent, to determine a subject's risk for SCD, heart failure or arrhythmia, or to determine whether administration of an antiarrhythmic agent to a subject is safe Further useful kits are further provided. In an exemplary embodiment, the kit measures (i) a reagent for measuring the level of full-length SCN5A exon 28 transcript in a biological sample and (ii) the level of a truncated SCN5A exon 28 transcript in the biological sample. And a reagent for. In an exemplary embodiment, the kit includes instructions for use or access to it. In exemplary aspects, as further described herein, the kit includes a computer readable storage medium having stored machine readable instructions executable by the system or processor.

FIG. 1 is a schematic representation of a splice variant identified at the 5 'end of the human SCN5A gene. The map shows the genomic structure of SCN5A with untranslated (white bars) or translated (closed bar) transcribed and untranscribed sequences (lines). Splicing patterns for each of the three exon 1 isoforms are identified. FIG. 2 shows the cDNA sequences of E1A, E1B1, E1B2, E1B3, E1B4, E2A, E2B1 and E2B2. FIG. 3 is a schematic representation of a splice variant identified at the 3 'end of the human SCN5A gene. Above the map is shown the genomic structure of SCN5A with untranslated (white bars) or translated (black bars) transcribed and untranscribed sequences (lines). Splicing patterns for each of the four exon 28 isoforms are identified. FIG. 4 shows the cDNA sequences of E28A (FIGS. 4A and 4B), E28B (FIG. 4C), E28C (FIG. 4D) and E28D (FIG. 4E). FIG. 4 shows the cDNA sequences of E28A (FIGS. 4A and 4B), E28B (FIG. 4C), E28C (FIG. 4D) and E28D (FIG. 4E). FIG. 4 shows the cDNA sequences of E28A (FIGS. 4A and 4B), E28B (FIG. 4C), E28C (FIG. 4D) and E28D (FIG. 4E). FIG. 4 shows the cDNA sequences of E28A (FIGS. 4A and 4B), E28B (FIG. 4C), E28C (FIG. 4D) and E28D (FIG. 4E). FIG. 4 shows the cDNA sequences of E28A (FIGS. 4A and 4B), E28B (FIG. 4C), E28C (FIG. 4D) and E28D (FIG. 4E). FIG. 5 is a gel photograph showing the results of PCR for detecting the transcription start site (TSS) and exon 1 variant of the human cardiac SCN5A gene. Total RNA from fetal and adult hearts was used to establish TSS and exon 1 isoforms with SCN5A specific primers. RACE-PCR results show that a total of three hands (380, 200 and 100 bp) in both fetal heart (FH) and adult heart (AH) contained cardiac specific Na + channel sequences. . The first band, 380 bp, corresponds to exon 1A reported previously. The second band 200 bp is a new exon 1 isoform referred to as exon 1B (E1B) with multiple TSS, while the third 100 bp band is exon 2B with multiple TSS ( Exon 1 isoform, designated E2B). FIG. 6 is a gel photograph showing the results of RACE-PCR for detecting the 3′UTR isoform of the human cardiac SCN5A gene. 3'UTR was determined by SCN5A gene-specific primer GSP3 'using total RNA from human fetus and adult heart. The first two lanes are the first PCR of the RACE product, the last two bands are the second RACE-PCR results, the fetal heart lane (FH) shows three bands, The larger visible band among them corresponds to the 834 bp short 3′UTR of the human cardiac Na + channel sequence. The second band (approximately 1.4 kb) is found only in the fetal heart (FH), while the third band is found in both fetal and adult hearts as the 0.25 and 0.3 kb bands. The last band was 0.2 kb, which was only detected in adult hearts. The presence of four exon 28 isoforms was confirmed by sequencing. FIG. 7 is a chart showing the alignment of nucleotide and amino acid sequences (single letter notation) of the four SCN5A transcription isoforms. The isoform name and nucleotide base pair numbering starting from the first AUG codon are shown on the left. The sequence starts with exon 27 (shaded) and continues to the poly A tail. Introns are shown as dotted lines. Splicing of exons B, C and D results in a frameshift and an immature stop codon. Methionine at amino acid 1652 is shown in bold and the stop codon introduction site in gene targeted mice is shown. FIG. 8 is a drawing showing the presumed secondary structure of cardiac Na + channel. FIG. 9 is a set of graphs showing the developmental control of the human SCN5A exon 28 isoform. The relative abundance of the four isoforms in the fetus (FH, white bar) and adult heart (AH, black bar) is shown in FIG. 9A. FIG. 9B shows the abundance of each isoform as a percentage of total SCN5A mRNA. In all cases, full length transcript (E28A) was most abundant. Exon 28D (E28D) was the next most abundant. Exon 28B (E28B) was the least in the fetal heart and exon 28C (E28C) was the least in the adult heart. E28B and E28D were increased in adult hearts compared to fetal hearts. * P <0.05 when FH is compared to AH. FIG. 10 is a set of graphs showing that C-terminal isoform mRNA abundance varies between control and diseased hearts. Real-time PCR results show isoform abundance relative to total mRNA abundance in each sample. For each total ventricle (FIG. 10A), left ventricle (FIG. 10B), and right ventricle (FIG. 10C), changes in four exon 28 variants in control (black bar) and HF (white bar) patients were determined. Comparing the left and right ventricles in FIGS. 10B and 10C, respectively, shows that the isoform abundance change is more pronounced in the left ventricle. Beta-actin was used as a reference in all cases. All mRNA abundances were normalized to one of normal human ventricular exon 28D mRNA abundances. * P <0.05 when the control is compared to the HF heart. FIG. 11 is a set of gel photographs showing tissue specific expression of human SCN5A exon 28 isoform. _RT- PCR results indicate that isoforms E28A and D were expressed not only in the human heart but also in skeletal muscle (SKM). All four isoforms were found in lymphoblasts. Beta-actin was used as an internal reference. FIG. 12 is a set of graphs showing model cuts that reduce cardiac Na + channel current. To examine the physiological role of splice variants, model cleavage was introduced into a single allele of mouse ES cells by gene targeting. FIG. 12A shows that cardiomyocytes with or without allelic changes were electrophysiologically tested. Wild type (black squares) and truncated (white squares) Na + channel current-voltage curves are shown. FIG. 12B shows a comparison of peak currents between the two cell types. Introducing cleavage in the region of the mRNA splice variant resulted in a significant reduction in peak Na + current. FIG. 12C shows action potentials (AP) recorded in current clamp mode for spontaneously beating wild type (grey line) and mutant CM (black line). FIG. 12D compares the number of beats, AP amplitude and AP rise speed between the two CMs. The truncation mutant shows a decrease in the number of beats (beats per second), AP amplitude (mV / 10) and maximum AP rise rate (mV / ms), which is consistent with a Na + current drop. *, P <0.05. FIG. 13 is a set of graphs showing a multi-electrode array (MEA) analysis of differentiated CM with and without the introduction of model cutting. FIG. 13A illustrates representative field potentials (FP) of syncytium wild type and truncated containing CM recorded from a single MEA electrode. FIG. 13B compares the field potential minimum (FPmin) recorded on day 19. FPmin was significantly reduced with the introduction of cleavage. FIG. 13C shows that the time to FP _min (ie, field potential rise time, FP _rise ) is slower in the truncated CM compared to the wild type. The conduction velocity was greatly reduced in truncated cardiomyocytes (FIG. 13D). Any change is consistent with Na + current drop. * P <0.05, between wild type and truncated. FIG. 13 is a set of graphs showing a multi-electrode array (MEA) analysis of differentiated CM with and without the introduction of model cutting. FIG. 13A illustrates representative field potentials (FP) of syncytium wild type and truncated containing CM recorded from a single MEA electrode. FIG. 13B compares the field potential minimum (FPmin) recorded on day 19. FPmin was significantly reduced with the introduction of cleavage. FIG. 13C shows that the time to FP _min (ie, field potential rise time, FP _rise ) is slower in the truncated CM compared to the wild type. The conduction velocity was greatly reduced in truncated cardiomyocytes (FIG. 13D). Any change is consistent with Na + current drop. * P <0.05, between wild type and truncated. FIG. 14 is a set of graphs showing a cell viability test. FIG. 14A: H9c2 cardiomyocyte viability at 48 hours as a function of angiotensin II concentration. FIG. 14B: H9c2 cardiomyocyte viability at 48 hours as a function of H ₂ O ₂ . *, P <0.05, 10. mu. When compared with mol / L H ₂ O ₂ . FIG. 15 is a set of graphs showing down-regulation of cardiac Na + channel mRNA by AngII and H ₂ O ₂ . Cultured in serum-free medium (SFM) or 48 hours in AngII (100 nM or 2 nM), H ₂ O ₂ (20.mu.M or 40 nM) or AngII (100 nM or 2 nM) and PEG-catalase (250 U / mL) Exposed H9c2 or acutely removed neonatal cardiomyocytes. AngII and H ₂ O ₂ resulted in decreased Na + channel mRNA abundance in both H9c2 (FIG. 15A) and neonatal cardiomyocytes (FIG. 15B). In both cases, the AngII effect could be prevented by PEG-catalase (AngII + CAT). *, P <0.05. FIG. 16 is a set of graphs showing that cardiac Na + channel current is down-regulated by H ₂ O ₂ . FIG. 16A shows representative Na + currents recorded from H9c2 CM with voltage steps up to −10 mV before and after 48 hours of H ₂ O ₂ exposure. FIG. 16B shows that H ₂ O ₂ exposure (20.mu.M, 48 hours) resulted in a 46% (. + −. 2.9%, p = 0.01) reduction in peak Na + current. . *, P <0.05. FIG. 17 shows that mutations in the NF-kappa B binding site in the Na + channel promoter eliminate the effects of AngII and H ₂ O ₂ . FIG. 17A shows the relationship of the promoter-reporter fragment used for the mouse scn5a promoter (GenBank AY7699981). The top line shows the structural organization of this region of the scn5a promoter (3.0 kb). Note the presence of untranslated exon 1C and a portion of exon 2 containing the translation initiation point. Nucleotide numbering begins at +1 corresponding to the protein translation start point. Construct APS3 containing the NF-Kappa B site (diamond-solid) is 100 nM AngII or 20. mu. There was a decrease in activity after 48 hours exposure to MH ₂ O ₂ . Mutations in the NF-kappa B binding site prevented the AngII or H ₂ O ₂ effect (FIG. 17B). Data are average values. + −. S. E. Presented as M and based on 4 separate experiments in both groups. FIG. 18 is a set of photographs of a gel showing that AngII and H ₂ O ₂ induce NF-kappa B binding to the scn5a promoter. FIG. 18A shows that electrophoretic mobility shift assay with nuclear extracts of H9c2 cardiomyocytes showed little binding of NF-kappa B to the scn5a promoter under basic conditions (SFM). Show. H ₂ O ₂ or AngII exposure resulted in NF- kappa B binding to the promoter. TNF-alpha activated H9c2 nuclear extract (5.mu.g) was used as a positive control. NF- a kappa B inhibitor CAPE (caffeic acid phenethyl ester) prevented _the binding in response to H 2 _{O 2.} AngII-induced NF-kappa B binding was inhibited by the unlabeled probe, but not by the mutant unlabeled probe. FIG. 18B shows that AngII and H ₂ O ₂ promote binding of the p50 subunit of NF-kappa B to the cardiac Na + channel promoter. Chromosomal immunoprecipitation assays using primers specific for the scn5a promoter indicate that the p65 subunit of NF-kappa B is constitutively bound to the channel promoter, whereas the p50 subunit is either AngII or H ₂ Shows binding in response to O ₂ . Inhibitors of CAPE and NF-kappa B were able to prevent the binding of both subunits to the channel promoter. Lanes 1 and 2 are positive and negative controls, respectively. Input DNA was diluted 1:10. FIG. 19 shows that overexpression of p50 NF-kappa B subunit results in Na + channel transcriptional downregulation. Panel A shows the presence of p50 or p65 NF-kappa B subunit RNA in H9c2 cells stably transfected with vectors encoding p50, p65 or both. Con represents control cells. Panel B: Quantitative real-time R _T -PCR results show that relative scn5a mRNA abundance is reduced in cell lines expressing the p50 subunit compared to control (Con). * P <0.05 vs. Control. FIG. 20 is a graph showing a comparison of the abundance of SCN5A splice variants according to age. After dividing the subjects into three age groups, 40-49 (40s), 50-59 (50s) and 60-69 (60s), comparing the relative mRNA abundance of splice variants, splice variant presence It is shown that the quantity cannot be considered a function of age. FIG. 21 is a set of diagrams showing a targeting strategy for creating a mouse SCN5A cleavage model. FIG. 21A: Targeting vector pBSK. SCN5A 1652 ^stop was ^mapped to native SCN5A exon 28 region (WT SCN5A allele). FIG. 21B: Map showing incorporation of targeting vector into WT allele. FIG. 21C: Map of truncation mutations introduced into the WT SCN5A allele after Cre-mediated excision of the neomycin resistance cassette to generate SCN5A ^1652stop . Restriction digests for genotyping, PCR primers and hybridization probes A (3.1 kb PvuII fragment) and B (3.71 kb PvuII fragment) are displayed. FIG. 22 is a set of gel photographs showing genotyping of homologous recombination of SCN5A ^1652stop . FIG. 22A: PCR analysis using upper and lower PCR amplicons (see method and FIG. S2) shows that there is proper recombination in the heterozygous (. + −.) Wild type (WT ) Demonstrates that it is not a mouse (+ / +). Figures 22B and 22C: Southern blot analysis with external probes A and B showing proper uptake (. +-.) Of the cleavage vector in a single allele of target ES cells. Figure 22D: PCR results of appropriately targeted ES cell clones before (neo +) and after (neo-) successful excision of the neomycin resistance cassette. A targeting vector was used as a control. Figure 22E: BspHI restriction digest to demonstrate incorporation of targeting vector. The introduction of the coding mutation resulted in the elimination of the BspHI restriction site. Thus, suitable targeted alleles are targeted alleles when subjected to BspHI digestion of PCR amplicons spanning this region compared to the 395 bp and 150 bp fragments resulting from the native sequence (wild type, WT). An additional 545 bp fragment representing (heterojunction,. +-.) Was presented. FIG. 22 is a set of gel photographs showing genotyping of homologous recombination of SCN5A ^1652stop . FIG. 22A: PCR analysis using upper and lower PCR amplicons (see method and FIG. S2) shows that there is proper recombination in the heterozygous (. + −.) Wild type (WT ) Demonstrates that it is not a mouse (+ / +). Figures 22B and 22C: Southern blot analysis with external probes A and B showing proper uptake (. +-.) Of the cleavage vector in a single allele of target ES cells. Figure 22D: PCR results of appropriately targeted ES cell clones before (neo +) and after (neo-) successful excision of the neomycin resistance cassette. A targeting vector was used as a control. Figure 22E: BspHI restriction digest to demonstrate incorporation of targeting vector. The introduction of the coding mutation resulted in the elimination of the BspHI restriction site. Thus, suitable targeted alleles are targeted alleles when subjected to BspHI digestion of PCR amplicons spanning this region compared to the 395 bp and 150 bp fragments resulting from the native sequence (wild type, WT). An additional 545 bp fragment representing (heterojunction,. +-.) Was presented. FIG. 23 demonstrates the effect of RBM25 and LUC7L3 expression in human HF tissue. (A) qPCR demonstrates upregulation of RBM25 and LUC7L3 in human HF tissue. The relative expression changes of RBM25 and LUC7L3 in both normal controls (white bars) and failing heart tissue (black bars) are shown. All mRNA abundances are normalized by β-actin. * P <0.05 when compared to control. (B) Quantification of Western blot confirms upregulation of RBM25 and LUC7L3 in human HF tissue. The control represents a mixture of 4 normal human heart tissue samples. HF1, HF2, HF3, and HF4 represent HF tissue sample 1, sample 2, sample 3, and sample 4, respectively. Quantification is based on 3 replicates per sample. All protein levels are normalized by GAPDH. * P <0.05 when compared to control. FIG. 24 provides an illustration of the C-terminal structure of SCN5A and variants E28C and E28D. (A) * indicates the RBM25 binding site CGGGCA (982 bp to 987 bp) in exon 28. Gel mobility shift assays were performed using biotinylated wild type (WT) probe (B) or mutant (Mu) probe (C) and purified RBM25 protein. Each time the sample is loaded from left to right, the amount of RBM25 in each binding reaction increases fold. For competition assays (D), a 0, 1, 5 or 20-fold molar excess of unlabeled WT or Mu probe is added in each binding reaction. FIG. 25 demonstrates that RBM25 and LUC7L3 are involved in SCN5A regulation in Jurkat cells. (A) qPCR demonstrates upregulation of RBM25 and LUC7L3. Hypoxic treatment (shaded bar) and Ang II treatment (black bar) vs. Shown are changes in RBM25 and LUC7L3 expression at 48 hours in normal control Jurkat cells (white bars). HIF-1α is an indicator of hypoxia. mRNA abundance is normalized by β-actin. * P <0.05, compared to control (N = 6). (B) Western blot quantification confirms upregulation of RBM25 and LUC7L3 in Jurkat cells. The expression of RBM25 and LUC7L3 has been analyzed over time. * P <0.05, compared to control (N = 6). (C) Hypoxic treatment (shaded bar) and AngII treatment (black bar) vs. Shown are changes in expression of SCN5A and variants E28C and E28D at 48 hours in untreated Jurkat cells (white bars). * P <0.05, compared to control (N = 6). Western blot shows downregulation of SCN5A in Ang II or hypoxia treated Jurkat cells. (D) qPCR demonstrates that RBM25 and LUC7L3 siRNA were able to block the induction of hypoxia in variants E28C and E28D. Representative results at 24 hours are shown. * P <0.05, compared to control (N = 6). (E) qPCR demonstrates that RBM25 and LUC7L3 siRNA were able to block the induction of variants E28C and E28D by AngII. Representative results at 48 hours are shown. * P <0.05, compared to control (N = 6). Scrambled siRNA had no effect on induction by Ang II (data not shown). The knockdown efficiency of RBM25 and LUC7L3 siRNA is assessed by Western blot and compared to control and scrambled RNA. (F) qPCR demonstrates that RBM25 and LUC7L3 overexpression decreases full-length SCN5A transcripts and increases variants E28C and E28D at 48 hours. * P <0.05, compared to control (N = 6). Exogenously expressed RBM25-GFP and LUC7L3-GFP are detected by Western blot analysis using anti-GFP 48 hours after transfection in Jurkat cells. A representative Western blot shows down-regulation of full-length SCN5A transcripts in Jurkat cells with exogenously expressed RBM25 and LUC7L3 compared to the control group. Full length SCN5A RNA is not altered by GFP expression alone. FIG. 26 demonstrates the effect of RBM25 shRNA on expression of SCN5A and variants E28C and E28D in AngII-treated hESC-CM. (A) On the third day of infection, all experimental groups were treated with Ang II (200 nmol / L). _RT- PCR measurement is performed 24 hours after AngII treatment and normalized by β-actin. RBM25 pLKO. At 24 hours. Ang II treated cardiomyocytes pre-infected with shRNA (shaded bars) and pre-infected with scrambled shRNA (black bars) vs. The expression changes of SCN5A and variants E28C and E28D in normal AngII-treated cardiomyocytes (white bars) are shown. * P <0.05, compared with normal AngII treated cardiomyocytes (N = 6). (B) Confocal microscope shows hESC-CM. GFP fluorescence indicates infection with pGIPZ lentivirus shRNAmir. RBM25 knockdown efficiency is assessed by qPCR and Western blot (N = 6). Scrambled shRNA had no effect on RBM25. FIG. 27 demonstrates the effect of Ang II (200 nmol / L) on Na + current in hESC-CM 24 hours after treatment. Representative current traces in control (A), AngII treated (B), AngII treated, pre-infected with RBM25 shRNA (C) and TTX treated group (D) are shown. The peak current statistics of three experimental groups are shown in the IV curve (E). In the figure, the control group (n = 3) is a black square, and the Ang II treatment group (n = 3) is black Circles, AngII treated group, pre-infection with RBM25 shRNA (n = 3) are represented by white triangles. Data are expressed as mean ± SEM. The peak current was significantly reduced from −40 to +30 mV in the AngII treated group compared to the control group (P <0.05), with the maximum decrease being 91.1 ± 9.3% at −30 mV. No difference is observed between the AngII treated group, RBM25 shRNA pre-infection and the control group (E). In group D, the specificity of the sodium channel current is examined by TTX (specific sodium channel blocker). The scrambled shRNA had no effect on the IV relationship compared to AngII alone (data not shown). FIG. 28 shows a control patient, a heart failure (HF) patient, a patient with a non-shocked ICD (ICD (−) shock) and a patient with a shocked ICD (ICD (+) shock). Is a bar graph of the relative ratios of variants E28C ("VC") or E28D ("VD"). FIG. 29 presents two graphs demonstrating the correlation of cardiac tissue and blood abundance of SCN5A splice variants normalized to total SCN5A expression. Left panel: Variant E28C (VC) correlation. Right panel: Variant E28D (VD) correlation. FIG. 30 presents two graphs of the Gaussian distribution of SCN5A splice variant abundance in a control patient, a patient with an ICD that shocks the patient, and a patient with an ICD that does not shock the patient. Left panel: Distribution of variant E28C (VC). Right panel: Distribution of variant E28D (VD). FIG. 31 is a visitor operating characteristic (ROC) curve of SCN5a variant D as a predictor of reasonable ICD discharge. The line of identity is shown. FIG. 32 shows patients with higher VC, higher VD, NYHA class III / IV heart failure, taking ACE inhibitors, receiving antiarrhythmic drugs, or less than 30% EF. FIG. 6 depicts a graph of univariate odds ratio of sudden death when having or having a QRS duration that extends beyond 120 ms. FIG. 33 depicts two graphs of the Gaussian distribution of SCN5A splice variant abundance in a control patient, a patient with an ICD that shocks the patient, and a patient with an ICD that does not shock the patient, where the abundance Is neither normalized to the housekeeping gene nor relative to the level of full-length SCN5A transcript. Left panel: Distribution of variant E28C (VC). Right panel: Distribution of variant E28D (VD). FIG. 34 is a diagram of an exemplary embodiment 101 of a system 100 for assessing a subject's need for an implantable defibrillator (ICD).

SCN5A transcripts As described herein and in the art (eg, US 2007/0212723 (A1)), the promoter of the SCN5A gene and the 5 ′ and 3 ′ untranslated regions (UTRs) ) Analysis in or near resulted in the identification of multiple specific 5 ′ and 3 ′ mRNA splice variants. As shown in FIGS. 1-4, splice variants include exon 1 splice variants: E1B1 (SEQ ID NO: 1), E1B2 (SEQ ID NO: 2), E1B3 (SEQ ID NO: 3) and E1B4 (SEQ ID NO: 4), exon 2 Also includes splice variants: E2B1 (SEQ ID NO: 5), E2B2 (SEQ ID NO: 6), as well as exon 28 splice variant E28B (SEQ ID NO: 7), E28C (SEQ ID NO: 8) or E28D (SEQ ID NO: 9) To do.

  The E1B1, E1B2, E1B3, E1B4, E2B1 and E2B2 splice variants are derived from the 5 'region and their position in the SCN5A gene and mRNA is depicted in FIG. The nucleic acid sequences of E1B1, E1B2, E1B3, E1B4, E2B1 and E2B2 are shown in FIG. E1A (SEQ ID NO: 10) is a wild-type (or full-length) isoform in and / or near the 5′UTR of exon 1, whereas E1B1, E1B2, E1B3, E1B4 are its various splice forms. (Or truncated) variant. Similarly, E2A (SEQ ID NO: 11) is a wild type (full length) isoform within and / or near the 5'UTR of exon 2, while E2B1 and E2B2 are various variants thereof.

The E28B, E28C or E28D splice variant is derived from or near the 3 ′ untranslated region and its position in the SCN5A mRNA is depicted in FIG. The nucleic acid sequences of E28B, E28C, and E28D are shown in SEQ ID NOs: 7 to 9, respectively. Each of E28B, E28C, and E28D is a truncated splice variant that encodes a truncated, dysfunctional channel. Both E28B and E28C contain untranslated and translated regions, while E28D contains only the translated region of exon 28. The physiological significance of E28B, E28C and E28D splice variants is supported by an immature stop codon in exon 28 of one of the two SCN5A alleles, resulting in an 86% reduction in Na ⁺ current (Shang et al., Circ. Res., 101: 1146-1154, 2007).

  The E28A splice variant is another isoform of the 3 'region of SCN5A exon 28. There are two isoforms of E28A. E28A-short (E28A-S) (SEQ ID NO: 12) and E28A-long (E28A-L) (SEQ ID NO: 13). Both isoforms of E28A contain 1239 base pairs in the translation region. The difference between E28-L and E28-S is in the UTR, E28A-L contains 2295 base pairs of 3'UTR, while E28A-S contains 834 base pairs of 3'UTR To do. E28A-S contains only the first 834 base pairs of the 3'UTR. E28A-L represents the wild type (WT) isoform. For purposes herein, outside of this paragraph, the description of “E28A” refers to E28A-S, and E28A-L will be referred to as wild type or WT.

  As used herein, the term “truncated SCN5A exon 28 transcript” refers to a transcript comprising a truncated or truncated translation region of exon 28 of the SCN5A gene. In an exemplary embodiment, the truncated SCN5A exon 28 transcript comprises an E28B transcript, E28C transcript, or E28D transcript that may be referred to herein as “E28B”, “E28C”, and “E28D”, respectively. It is. In an exemplary embodiment, the truncated SCN5A exon 28 transcript is a transcript comprising one of an E28C transcript or an E28D transcript.

  As used herein, the term “full-length SCN5A exon 28 transcript” refers to a transcript comprising the full-length translation region of exon 28 of the SCN5A gene. In an exemplary embodiment, the full length SCN5A exon 28 transcript is a WT SCN5A exon 28 transcript. In an exemplary embodiment, the full-length SCN5A exon 28 transcript is a spliced transcript that is truncated or truncated compared to the WT SCN5A exon 28 transcript, but the spliced transcript is SCN5A It still contains the full length translation region of exon 28. In an exemplary embodiment, the full length SCN5A exon 28 transcript is a transcript comprising an E28A transcript (E28A-S).

Implantable cardioverter defibrillator As used herein, the term “implantable cardioverter defibrillator” or “ICD” refers to “implantable cardiac defibrillator” or “implanted cardiac device”. "Or" implantable cardiac device "or" implantable cardioverter-defibrillator device "synonymous to deliver an electrical shock when cardiac arrhythmia is detected Refers to a small, programmed battery-powered electrical impulse generator. ICDs are implanted in patients at risk for sudden cardiac death due to ventricular fibrillation and ventricular tachycardia. Outlined in current standards (Hunt et al., Circulation 119: e391-e479 (2009)) and Epstein et al., J Am Coll Cardol 51: e1-e62 (2008) used to identify patients in need of ICD )), Approximately 60% of patients receiving ICD will not be shocked by ICD, perhaps because the patient does not show arrythmia. Thus, approximately 60% of patients who accept an ICD do not actually require an ICD.

  The data described herein indicates that a patient with an ICD that shocks the patient differs from the level profile of the SCN5A exon 28 transcript of a patient with an ICD that does not shock the patient. To demonstrate a level profile. The data demonstrates that patients with ICD shocking patients show increased levels of truncated SCN5A exon 28 splice variant transcripts and reduced levels of full-length SCN5A exon 28 transcripts. Thus, these data suggest a basis on which two patient populations (patients who really need ICD vs. patients who do not need ICD) can be identified.

  Accordingly, the present invention provides a method for determining a subject's need for an ICD. In an exemplary embodiment, the method includes determining the level of truncated SCN5A exon 28 transcript and the level of full length SCN5A exon 28 transcript of a biological sample obtained from the subject. In an exemplary embodiment, the method includes determining the level of total SCN5A exon 28 transcript, including WT, E28A, E28B, E28C, E28D. In exemplary embodiments, as further described herein, the level of SCN5A exon 28 transcript referred to in the methods herein is at the level of a transcript of a reference gene, eg, a housekeeping gene. Normalized against.

In an exemplary embodiment, a method for determining a subject's need for ICD comprises determining the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the full-length SCN5A exon 28 transcript of the biological sample. Comparing the level or (ii) the level of the total SCN5A exon 28 transcript in the biological sample or (iii) the level of the full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcripts. Determining a ratio R _S. In an exemplary aspect, if R _S is greater than or equal to the threshold ratio R _T , the subject is determined to require ICD. See below for further description of each of these ratios.

Ratio R _S
In an exemplary embodiment, the method of the present invention determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject, (i) the level of a full-length SCN5A exon 28 transcript in a biological sample, or (ii) Determine the ratio R _S compared to the level of total SCN5A exon 28 transcript in the sample or (iii) the level of full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcripts Includes steps.

Accordingly, in some embodiments, R _S is the ratio of [level of truncated SCN5A exon 28 transcript of biological sample obtained from subject] to [full length SCN5A exon 28 transcript of biological sample]. As described herein, full-length SCN5A exon 28 transcript refers to either WT SCN5A exon 28 transcript or E28A-S. Thus, in a particular embodiment, R _S is the ratio of [the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the subject] to [the level of WT SCN5A exon 28 transcript of the biological sample], or R _S Is the ratio of [level of truncated SCN5A exon 28 transcript of biological sample obtained from subject] to [level of E28A (E28A-S) of biological sample].

In other embodiments, R _S is [a level of a truncated SCN5A exon 28 transcript of a biological sample obtained from a subject] vs. a level of all SCN5A exon 28 transcripts of a biological sample: WT, E28A, E28B, E28C, E28D. ]. Thus, _RS can be a ratio of [the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to [the level of (WT SCN5A exon 28 + E28A (E28A-S) + E28B + E28C + E28D) in a biological sample].

In an exemplary embodiment, R _S is [a level of a truncated SCN5A exon 28 transcript of a biological sample obtained from a subject] vs. a level of a full length SCN5A exon 28 transcript of a biological sample and one or more truncated SCN5A. Exon 28 transcript level]. In certain embodiments, R _S is [a level of a truncated SCN5A exon 28 transcript of a biological sample obtained from a subject] vs. [WT SCN5A exon 28 and one, two or all of E28B, E28C, E28D] Level] ratio. In certain embodiments, R _S is the ratio of [the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to [the level of all species of WT SCN5A exon 28 and E28B, E28C, E28D]. . In certain embodiments, R _S is the ratio of [the level of truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to [the level of WT SCN5A exon 28 and (E28B and E28C)]. In a particular embodiment, R _S is the ratio of [the level of truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to [the level of WT SCN5A exon 28 and (E28C and E28D)]. In certain embodiments, R _S is the ratio of [the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to [the level of WT SCN5A exon 28 and (E28B and E28D)]. In certain embodiments, R _S is the ratio of [the level of a truncated SCN5A exon 28 transcript of a biological sample obtained from a subject] to [the level of all species of E28A (E28A-S) and E28B, E28C, E28D]. It is. In certain embodiments, R _S is the ratio of [the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to [the level of E28A (E28A-S) and (E28B and E28C)]. In a particular embodiment, R _S is the ratio of [the level of a truncated SCN5A exon 28 transcript of a biological sample obtained from a subject] to the level of [E28A (E28A-S) and (E28C and E28D)]. In certain embodiments, R _S is the ratio of [the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject] to the level of [E28A (E28A-S) and (E28B and E28D)].

In an exemplary embodiment, each level of SCN5A exon 28 transcript structured R _S, the level is a reference gene, e.g., a housekeeping gene normalized or calibrated calibration level for level (calibration abundance). Suitable housekeeping genes are known in the art, some of which are further described herein.

In an exemplary embodiment, each level of SCN5A exon 28 transcript structured _{R S} are in contrast normalization level. The control normalization level in the exemplary embodiment is a level that is the difference between the level of the subject and the level of the control subject. Control subjects are further described herein. In exemplary embodiments, the control subject is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (iv) no diastolic dysfunction, or ( v) A subject known to be a combination of these.

In an exemplary embodiment, determining _RS includes calculating a value obtained from real-time polymerase chain reaction (real-time PCR). In an exemplary embodiment, the calibration level (calibration abundance) of the truncated SCN5A exon 28 transcript = 2 is also expressed as a −ΔΔCt power of the truncated SCN5A exon 28 transcript (2- ^{ΔΔCt truncated SCN5A exon 28 transcript).} (Where ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _{truncated SCN5A exon 28 transcript} —ΔCt _{housekeeping gene} ) is applied (ΔΔCt mathematical model for real-time PCR data analysis) Livak et al., Methods 25: 402-408 (2001) and Yuan et al., BMC Bioinformatics 7:85 (2006)). In an exemplary embodiment, the ΔCt _{truncated SCN5A exon 28 transcript} is ([Ct of the truncated SCN5A exon 28 transcript of the subject sample] minus [Ct of the truncated SCN5A exon 28 transcript of the control sample] and ΔCt _{The housekeeping gene} is ([Ct of the housekeeping gene of the subject sample] minus [Ct of the housekeeping gene of the control sample]. In an exemplary embodiment, the control sample has (i) no ICD, A biological sample obtained from a control subject known to be (ii) not a heart disease, (iii) have normal left ventricular function, (iv) have no diastolic dysfunction, or (v) a combination thereof .

Thus, in an exemplary embodiment, R _S =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject, and a “control sample” is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (Iv) a biological sample obtained from a control subject known to be free of diastolic dysfunction, or (v) a combination thereof, and “full length” is a WT SCN5A exon 28 transcript or E28A-S transcript Or refers to both WT SCN5A exon 28 transcript and E28A-S transcript.

Also, in an exemplary embodiment, R _S =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject, and a “control sample” is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination of these, and “total SCN5A exon 28 transcript” refers to WT, E28A-S, E28B, Refers to all of E28C and E28D.

  In an exemplary embodiment, the level of truncated SCN5A exon 28 transcript comprises the level of SCN5A exon 28 splice variant C (E28C) in the biological sample. In an exemplary embodiment, the level of truncated SCN5A exon 28 transcript comprises the level of SCN5A exon 28 splice variant C (E28D). In an exemplary embodiment, the level of truncated SCN5A exon 28 transcript is the level of E28C in the biological sample and the level of E28D in the biological sample.

  In an exemplary embodiment, the level of full length SCN5A exon 28 transcript is the level of WT SCN5A exon 28 transcript. In an exemplary embodiment, the level of full-length SCN5A exon 28 transcript is the sum of [WT SCN5A exon 28 transcript level] + [SCN5A exon 28 splice variant A (E28A) level]. In an exemplary embodiment, the level of full length SCN5A exon 28 transcript is that of E28A (E28-S). In an alternative embodiment, the level of total SCN5A exon 28 transcript is [WT SCN5A exon 28 transcript level] + [E28A level] + [E28B level] + [E28C level] + [E28D level]. Is the total level.

In an exemplary embodiment, R _S is the level of E28C in a biological sample obtained from a subject, the sum of (i) [WT SCN5A exon 28 transcript level] + [E28A-S level] or (ii) Compare with E28A-S level or (iii) WT level. In an exemplary embodiment, R _S = R _E28C =

Where
Calibration abundance of ^{E28C transcript} = 2- ^{ΔΔCtE28C transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{E28C transcript} = ΔCt _{E28C transcript} -ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _E28C = ([Ct of E28C transcript of target sample] − [Ct of E28C transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject, and a “control sample” is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (Iv) a biological sample obtained from a control subject known to be free of diastolic dysfunction, or (v) a combination thereof, and “full length” is a WT SCN5A exon 28 transcript or E28A-S transcript Or refers to both WT SCN5A exon 28 transcript and E28A-S transcript.

In an exemplary embodiment, R _S compares the level of E28C in a biological sample obtained from the subject with the level of [total SCN5A exon 28 transcripts: WT, E28A-S, E28B, E28C and E28D. In an exemplary embodiment, R _S = R _E28C =

Where
Calibration abundance of ^{E28C transcript} = 2- ^{ΔΔCtE28C transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{E28C transcript} = ΔCt _{E28C transcript} -ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _E28C = ([Ct of E28C transcript of target sample] − [Ct of E28C transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject, and a “control sample” is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination of these, and “total SCN5A exon 28 transcript” refers to WT, E28A-S, E28B, Refers to all of E28C and E28D.

In an exemplary embodiment, R _S is the level of E28D in a biological sample obtained from a subject, (i) the total level of [WT SCN5A exon 28 transcript] + [level of E28A-S] or (ii) Compare with E28A-S level or (iii) WT level. In an exemplary embodiment, R _S = R _E28D =

Where
Calibration abundance of ^{E28D transcript} = 2- ^{ΔΔCtE28D transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{E28D transcript} = ΔCt _{E28D transcript} -ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _E28D = ([Ct of E28D transcript of target sample] − [Ct of E28D transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject, and a “control sample” is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (Iv) a biological sample obtained from a control subject known to be free of diastolic dysfunction, or (v) a combination thereof, and “full length” is a WT SCN5A exon 28 transcript or E28A-S transcript Or refers to both WT SCN5A exon 28 transcript and E28A-S transcript.

In an exemplary embodiment, R _S compares the level of E28D in a biological sample obtained from the subject with the level of [total SCN5A exon 28 transcript: WT, E28A-S, E28B, E28C and E28D]. In an exemplary embodiment, R _S = R _E28D =

Where
Calibration abundance of ^{E28D transcript} = 2- ^{ΔΔCtE28D transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{E28D transcript} = ΔCt _{E28D transcript} -ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _E28D = ([Ct of E28D transcript of target sample] − [Ct of E28D transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject, and a “control sample” is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination of these, and “total SCN5A exon 28 transcript” refers to WT, E28A-S, E28B, Refers to all of E28C and E28D.

In an exemplary embodiment, the method includes determining a first R _S and a second R _S , wherein the first R _S compares the level of E28C with the level of the total SCN5A exon 28 transcript; the second _{R S,} comparing the level of E28D and levels of total SCN5A exon 28 transcript. In an exemplary embodiment, as noted above, the first R _S is R _E28C and the second R _S is R _E28D .

Threshold ratio R _T
As described herein, the method of the present invention involves a ratio R _S , and in an exemplary embodiment, the interpretation of R _S is made by its comparison to a threshold ratio R _T. For example, as described further herein, if R _S is greater than or equal to R _T , the subject requires ICD. Further interpretations of R _S relative to R _T are described herein.

In an exemplary embodiment, R _T is serve as a direct reference point R _S, R _T is matched to the R _S. For example, if R _S is the ratio of [the level of the truncated SCN5A exon 28 transcript of the biological sample obtained from the subject] to [the level of the full length SCN5A exon 28 transcript of the biological sample obtained from the subject], then Rs _T is a matched ratio, eg, [level of truncated SCN5A exon 28 transcript of biological sample obtained from control subject] vs. level of full length SCN5A exon 28 transcript of biological sample obtained from control subject] Is the ratio. Also, for example, when _RS is [the level of a truncated SCN5A exon 28 transcript of a biological sample obtained from a subject] vs. [the total SCN5A exon 28 transcript of a biological sample obtained from a subject], _RT is [Level of truncated SCN5A exon 28 transcript of biological sample obtained from control subject] vs. [Total SCN5A exon 28 transcript of biological sample obtained from control subject].

Also, like _RS , in exemplary embodiments, each level of _RT is a calibration level (calibration abundance) in which the level is normalized or calibrated to the level of a reference gene, eg, a housekeeping gene. Suitable housekeeping genes are known in the art, some of which are further described herein.

Also, like _RS , in an exemplary embodiment, each level of _RT is a control normalization level. The control normalization level in the exemplary embodiment is a level that is the difference between the level of the subject and the level of the control subject. Control subjects are further described herein. In exemplary embodiments, the control subject is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (iv) no diastolic dysfunction, or ( v) A subject known to be a combination of these.

_RT can be defined in one of a variety of ways depending on factors, including, for example, the application of a comparison between _RS and _RT (e.g., determining a subject's need for ICD vs. SCD). Subject risk determination vs. use in determining the need for antiarrhythmic agents), guidelines established by regulatory agencies in the area in which the method of the invention is implemented (eg, the Food and Drug Administration or similar agencies), requirements Or, including, but not limited to, policies, current standard medical practice in the area where the method of the present invention is implemented, etc.

In an exemplary embodiment, _RT is the level of truncated SCN5A exon 28 transcript, (i) the level of full-length SCN5A exon 28 transcript of the biological sample, or (ii) of all SCN5A exon 28 transcripts of the biological sample. Or (iii) the ratio of the level of the full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of the biological sample, wherein the biological sample has (i) ICD No, (ii) not heart disease, (iii) normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination of these is obtained from a known control subject.

In an alternative embodiment, R _T = μ + 4.0σ, where μ = is the mean of a Gaussian distribution of a set of data values, and each data value of the set is a biological sample obtained from a control subject The level of the truncated SCN5A exon 28 transcript of (i) the level of the full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample or (iii) the organism of the control subject Represents the ratio of the sample to the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts, the control subjects are (i) have no ICD, (ii) heart Is not a disease, (iii) has normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof There is a known object, sigma is the standard deviation of the Gaussian distribution of the data values. In exemplary embodiments, the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the total SCN5A exon in the biological sample. The ratio of the level of 28 transcripts or (iii) the level of the full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts obtained from a control subject is compared to this and that is to match and R _S.

In another alternative embodiment, _RT is the level of truncated SCN5A exon 28 transcript obtained from a control subject known to have an ICD that has not been shocked, and (i) the full length of the biological sample. Level of SCN5A exon 28 transcript or (ii) level of total SCN5A exon 28 transcript in biological sample or (iii) level of full length SCN5A exon 28 transcript in biological sample and one or more truncated SCN5A exon 28 transcript This is the ratio to compare with the level.

In an exemplary embodiment, _RT is determined by real time PCR. In an exemplary embodiment, _RT is as follows:

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject known to have an ICD that has not shocked the subject, and a “control sample” is (i) has no ICD, (ii) A biological sample obtained from a subject who is not heart disease, (iii) has normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, "Refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.

Also, in an exemplary embodiment, R _T =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
A “subject sample” is a biological sample obtained from a subject known to have an ICD that has not shocked the subject, and a “control sample” is (i) has no ICD, (ii) A biological sample obtained from a control subject that is not heart disease, (iii) has normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, “SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.

In still yet another aspect, R _T = μ + Xσ, where μ = is the mean value of a Gaussian distribution of a set of data values, and each data value of the set is a biological sample obtained from a control subject The level of the truncated SCN5A exon 28 transcript is determined by: (i) the level of the full length SCN5A exon 28 transcript of the biological sample or (ii) the level of the total SCN5A exon 28 transcript of the biological sample or (iii) the full length of the biological sample. The ratio of SCN5A exon 28 transcript and the ratio compared to the level of one or more truncated SCN5A exon 28 transcript, the control subject is a subject known to have an ICD that has never shocked, σ is the standard deviation of the Gaussian distribution of data values, and X is a number between about 0.7 and about 4.0 (eg, 0.7, 0.8 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2 .1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0).

In an exemplary embodiment, where R _T = μ + Xσ, each data value in the set indicates the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length SCN5A exon of the biological sample. 28 transcript level or (ii) level of total SCN5A exon 28 transcript in biological sample or (iii) level of full length SCN5A exon 28 transcript in biological sample and level of one or more truncated SCN5A exon 28 transcript Represents the ratio to compare with, ratio =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([ICt patient (−) full length SCN5A exon 28 transcript Ct of shock] − [control sample full length SCN5A exon 28 transcript Ct])
ΔCt _{truncation type} = ([Ct of ICD patient (−) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (−) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (−) shock” is a biological sample obtained from a subject known to have an ICD that has never been shocked, and a “control sample” is (i) without an ICD ( a biological sample obtained from a control subject known to be ii) not heart disease, (iii) have normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, “Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.

In an exemplary embodiment, where R _T = μ + Xσ, each data value in the set indicates the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length SCN5A exon of the biological sample. 28 transcript level or (ii) level of total SCN5A exon 28 transcript in biological sample or (iii) level of full length SCN5A exon 28 transcript in biological sample and level of one or more truncated SCN5A exon 28 transcript Represents the ratio to compare with, ratio =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in ICD patients (-) shock]-[Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (−) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (−) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (−) shock” is a biological sample obtained from a subject known to have an ICD that has never been shocked, and a “control sample” is (i) without an ICD ( a biological sample obtained from a control subject known to be ii) not heart disease, (iii) have normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, “Total SCN5A exon 28 transcript” refers to all species of WT, E28A-S, E28B, E28C and E28D.

Alternatively, R _T = μ−Xσ, where μ = is an average value of a Gaussian distribution of a set of data values, and each data value of the set is a truncated SCN5A of a biological sample obtained from a control subject The level of exon 28 transcript is determined by (i) the full-length SCN5A exon 28 transcript level of the biological sample or (ii) the level of all SCN5A exon 28 transcripts of the biological sample or (iii) the full-length of the control biological sample. A ratio of SCN5A exon 28 transcript and the ratio compared to the level of one or more truncated SCN5A exon 28 transcript, wherein the control subject is a subject known to have an ICD that has shocked the control subject Σ is the standard deviation of the Gaussian distribution of the data values, and X is a number between about 0.7 and about 4.0 (eg, 0.7,. 8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3. 3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0). In exemplary embodiments, X is a number between about 0.7 and about 1.0, or a number between about 2.0 and about 4.0, or a number between about 2.3 and about 4.0. It is. In an exemplary embodiment, X is 2.326.

In an exemplary embodiment, if R _T = μ−Xσ, each data value in the set represents the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length of the biological sample. Level of SCN5A exon 28 transcript or (ii) level of total SCN5A exon 28 transcript of biological sample or (iii) level of full length SCN5A exon 28 transcript of control subject and one or more truncated SCN5A exons 28 represents the ratio compared to the transcript level, ratio =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of ICD patient (+) shock] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (+) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (+) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (+) shock” is a biological sample obtained from a subject known to have a shocked ICD, and a “control sample” is (ii) no ICD, (ii) a heart A biological sample obtained from a control subject that is not diseased, (iii) has normal left ventricular function, (iv) has no diastolic dysfunction, or (v) a combination thereof, "Refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.

In an exemplary embodiment, if R _T = μ−Xσ, each data value in the set represents the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length of the biological sample. SCN5A exon 28 transcript level or (ii) total SCN5A exon 28 transcript level of biological sample or (iii) full length SCN5A exon 28 transcript level and one or more truncated SCN5A exons of control biological sample Represents the ratio compared to the level of 28 transcripts,

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in ICD patient (+) shock]-[Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (+) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (+) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (+) shock” is a biological sample obtained from a subject known to have an ICD that has shocked, and a “control sample” is (i) not having an ICD ( a biological sample obtained from a control subject known to be ii) not heart disease, (iii) have normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, “Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.

In an exemplary aspect, _RT is determined by the system. In an exemplary aspect, a system includes a processor and a memory device coupled to the processor, the memory device being executed by the processor,
(I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a subject of the first population, wherein the ratio represents the level of truncated SCN5A exon 28 transcript (a) Levels of full-length SCN5A exon 28 transcripts in biological samples or (b) levels of total SCN5A exon 28 transcripts in biological samples or (c) levels of full-length SCN5A exon 28 transcripts in biological samples and one or more truncated forms Compared to the level of SCN5A exon 28 transcript, each subject of the first population receives a plurality of data values that are subjects known to have an ICD that has shocked;
(Ii) fitting a plurality of data values to a first Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the first Gaussian distribution;
(Iv) store machine readable instructions that cause the first threshold ratio _RT to be set to μ−Xσ, where X is a number between 0.7 and 4.0.

Further descriptions of suitable systems that can be used to determine _RT are described later in this document.

Sudden cardiac death and methods related thereto Sudden cardiac death (SCD) is responsible for approximately 325,000 deaths annually in the United States due to lung cancer, breast cancer or acquired immune deficiency syndrome (AIDS) More than the number of deaths. SCD is responsible for about 50% of deaths from heart failure and is often the first manifestation of coronary disease. See Sovari et al., “Sudden Cardiac Death”, e-medicine Cardiology, article 151907, updated 4 November 2010; and Zheng et al., Circulation 104: 2158-2163 (2001). Common causes of SCD include, for example, ventricular tachycardia (VT), where the resting heart rate is faster than normal, uncoordinated contraction of the ventricular myocardium in the heart, and ventricular fibrillation that causes the muscles to tremble instead of proper contraction ( VF) or ventricular arrhythmias, such as arrhythmia conditions where both VT and VF are present. See Wedro, B., “Sudden Cardiac Arrest (Sudden Cardiac Death)”, edited by medicine.net, Kulick and Soppler. Current methods of treating ventricular fibrillation include defibrillation by cardioverter defibrillator or thorax thump. Antiarrhythmic therapy aims to treat or prevent ventricular arrhythmias, thereby preventing SCD. One type of antiarrhythmic therapy involves the implantation of an ICD in a patient. ICDs are further described herein.

As described, the data provided herein supports a means by which patients who are shocked from ICD can be identified based on the level of SCN5A exon 28 transcript levels. Because patients who are shocked from ICD are at increased risk of sudden cardiac death (SCD), the data provided herein is in part a means by which patients at risk for SCD can be identified. I also support. Accordingly, the present invention provides a method for identifying patients at risk for sudden cardiac death. Stated in an alternative manner, the present invention also provides a method for determining a subject's risk for sudden cardiac death (SCD). In an exemplary embodiment, such a method comprises determining the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject, (i) the level of a full length SCN5A exon 28 transcript in the biological sample, or (ii) Determine the ratio R _s that compares the level of total SCN5A exon 28 transcript in the biological sample or (iii) the level of full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcripts Including the steps of: In an exemplary aspect, a subject is determined to be at risk for SCD if R _S is greater than or equal to the threshold ratio R _T.

With respect to the methods of determining a subject's risk for sudden cardiac death provided herein, R _S is, in an exemplary embodiment, R _S (eg, title: “ratio R”) as described herein. Is identical to any one of the above mentioned R _S ) in the sub-section of “ _{S 2} ”. Further, in the exemplary embodiment, the threshold ratio R _T is, R _{T (e.g.,} title, above R _T in section "threshold ratio R _T") as described herein in any one identical is there.

Method for Monitoring Sudden Cardiac Death Risk In an exemplary embodiment, the step of determining the ratio R _s is repeated at least once, or more than once. In an exemplary embodiment, the ratio R _s is determined 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times. In such cases, the method can be considered as a method of monitoring a subject's risk for SCD. In an exemplary embodiment, the ratio R _s is determined every 6-12 months (eg, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months). Each time, R _s is based on different biological samples obtained from the same subject.

Methods for Determining Needs for Antiarrhythmic Therapy In some cases, patients who have been determined to be at risk for SCD are given antiarrhythmic therapy. Since the methods of the present invention provide a means for determining a subject's risk for SCD, the methods of the present invention also provide a means for determining a subject's need for antiarrhythmic therapy. Thus, the present invention provides a method for determining a subject's need for antiarrhythmic therapy. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (ii) the level of the biological sample. Determining a ratio R _s that is compared to the level of total SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample. Including. In an exemplary embodiment, if R _S is greater than or equal to the threshold ratio R _T , the subject is determined to require antiarrhythmic therapy.

With respect to the methods of determining a subject's need for antiarrhythmic therapy provided herein, R _S is, in an exemplary embodiment, R _S (eg, title: “ratio R” described herein). Is identical to any one of the above mentioned R _S ) in the sub-section of “ _{S 2} ”. Further, in the exemplary embodiment, the threshold ratio R _T is, R _{T (e.g.,} title, above R _T in section "threshold ratio R _T") as described herein in any one identical is there.

  In an exemplary embodiment, the antiarrhythmic therapy is implantation of an ICD or related device. In an exemplary embodiment, the antiarrhythmic therapy is administration of an antiarrhythmic agent.

Antiarrhythmic Agents For purposes herein, antiarrhythmic agents are a group of pharmaceuticals used to suppress abnormal cardiac rhythms (cardiac arrhythmias) such as atrial fibrillation, atrial flutter, ventricular tachycardia and ventricular fibrillation. One of them. In exemplary embodiments, the antiarrhythmic agent is a Singh Vaghan Williams (SVW) class I, II, III, IV or V antiarrhythmic agent. In exemplary embodiments, the antiarrhythmic agent is an SVW class IA, IB, IC or III antiarrhythmic agent. The antiarrhythmic agent can be a fast channel blocker, beta blocker, slow channel blocker, sodium channel blocker, potassium channel blocker or calcium channel blocker. In some embodiments, the antiarrhythmic agent is quinidine, procainamide, disopyramide, lidocaine, phenytoin, mexiletine, tocainide, flecainide, propaphenone, moricidin, propranolol, esmolol, timolol, metoprolol, atenolol, bisoprolol, amiodarone, sotalol, One of dofetilide, dronedarone, E-4031, verapamil, diltiazem, adenosine, digoxin or magnesium sulfate. In some embodiments, the SVW class IA is quinidine, procainamide, or disopyramide. In some embodiments, the SVW class IB antiarrhythmic agent is lidocaine, phenytoin, mexiletine, or tocainide. In some embodiments, the SVW class IC antiarrhythmic agent is flecainide, propafenone, moricidin or encainide. In some embodiments, the SVW class III antiarrhythmic agent is dronedarone, amiodarone or ibutilide. In some embodiments, the antiarrhythmic agent is NAD + or mitoTEMPO.

Methods for reducing the risk of sudden cardiac death The present invention additionally provides methods for reducing the risk of SCD in a subject. The method includes determining a subject's risk for SCD and treating the subject if the subject is determined to be at risk for SCD. In an exemplary embodiment, a method of reducing the risk of SCD in a subject provided herein comprises (A) the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) Level of full-length SCN5A exon 28 transcript in biological sample or (ii) level of total SCN5A exon 28 transcript in biological sample or (iii) level of full-length SCN5A exon 28 transcript in biological sample and one or more truncated forms Determining a ratio R _s to compare with the level of SCN5A exon 28 transcript; and (B) providing therapy to the subject if R _S is greater than or equal to a threshold ratio R _T.

With respect to methods for reducing the risk of SCD provided herein, R _S is, in an exemplary embodiment, R _S (eg, a subsection of the title: “Ratio R _S ”) as described herein. And any one of the above-mentioned R _S ). Further, in the exemplary embodiment, the threshold ratio R _T is, R _{T (e.g.,} title, above R _T in section "threshold ratio R _T") as described herein in any one identical is there.

In an exemplary embodiment, the therapy given to the subject is antiarrhythmic therapy. In an exemplary embodiment, the therapy is ICD implantation. Accordingly, the methods for reducing the risk of SCD provided herein can include implanting an ICD if R _S is greater than or equal to a threshold ratio R _T. In an exemplary embodiment, the therapy is administration of an antiarrhythmic agent. Suitable antiarrhythmic agents are known in the art and are described herein in the section entitled “Antiarrhythmic Agents”. In exemplary embodiments, the therapy is an angiotensin blocker, ACE inhibitor, sodium channel inhibitor, NAD +, mitochondrial targeted antioxidant, mitoQ, midTEMPO, activator of protein kinase A, forskolin, BH4 or Src inhibitor It is.

Heart failure and related methods Heart failure (HF) is defined as the ability of the heart to provide sufficient blood flow to meet the needs of the body. In some embodiments, signs and symptoms of heart failure include dyspnea (eg, sitting breathing, paroxysmal nocturnal dyspnea), cough, cardiac asthma, wheezing, dizziness, confusion, cold limbs at rest, chronic veins Congestion, ankle swelling, peripheral or systemic edema, nocturnal polyuria, ascites, heptomegaly, jaundice, coagulopathy, fatigue, exercise intolerance, jugular venous distension, lung rales Peripheral edema, pulmonary vascular redistribution, interstitial edema, pleural effusion or combinations thereof. In some embodiments, the heart failure symptom is one of the symptoms listed in the following table that provides a classification basis for heart failure according to the New York Heart Association (NYHA).

  In exemplary embodiments, the heart failure is systolic heart failure, which is heart failure caused by or characterized by systolic dysfunction. Briefly, systolic dysfunction is a condition in which the heart's pumping function or contraction (ie, systole) has failed. Systolic dysfunction can be characterized by a decrease or decrease in ejection fraction, eg, ejection fraction less than 45% and increased ventricular end-diastolic pressure and volume. In some embodiments, the strength of the ventricular contraction is weakened and insufficient to produce a reasonable stroke volume, resulting in less cardiac output. In some embodiments, the systolic heart failure is ischemic heart failure. In an alternative embodiment, the systolic heart failure is non-ischemic heart failure.

As noted herein, heart failure patients presented with increased levels of truncated SCN5A exon 28 transcript and increased levels of full-length SCN5A exon 28 transcript. Such findings support a means by which heart failure patients can be identified. Accordingly, the present invention provides a method for identifying patients at risk for heart failure. Stated in an alternative manner, the present invention also provides a method for determining a subject's risk for heart failure. In an exemplary embodiment, such a method comprises determining the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject, (i) the level of a full length SCN5A exon 28 transcript in the biological sample, or (ii) Determine the ratio R _s that compares the level of total SCN5A exon 28 transcript in the biological sample or (iii) the level of full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcripts Including the steps of: In an exemplary aspect, if R _S is greater than or equal to the threshold ratio R _T , the subject is determined to be at risk for HF.

With respect to the methods of determining a subject's risk for HF provided herein, R _S is, in an exemplary manner, R _S (eg, a title: “Ratio R _S ”) as described herein. It is the same as any one of the aforementioned R _S ) in the subsection. In some instances, except that differ from those described in a control sample or control subject or subject that section, the threshold ratio R _T is, R _{T (e.g.,} as described herein, the title, " This is basically the same as R _T ) described above in the section “Threshold Ratio R _T ”. For example, with respect to the methods of determining a subject's risk for HF as provided herein, _RT in an exemplary embodiment is the level of truncated SCN5A exon 28 transcript in a biological sample: (i) Level of full-length SCN5A exon 28 transcript or (ii) level of total SCN5A exon 28 transcript of biological sample or (iii) level of full-length SCN5A exon 28 transcript of biological sample and one or more truncated SCN5A exons 28 A ratio relative to the level of transcript, the biological sample is (i) not having ICD, (ii) not having heart disease, eg heart failure, (iii) having normal left ventricular function, (iv It is obtained from a control subject that is known to have no) diastolic dysfunction or (v) a combination of these.

In an alternative embodiment, R _T = μ + 4.0σ, where μ = is the mean of a Gaussian distribution of a set of data values, and each data value of the set is a biological sample obtained from a control subject The level of the truncated SCN5A exon 28 transcript of (i) the level of the full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample or (iii) the organism of the control subject Represents the ratio of the sample to the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts, the control subjects are (i) have no ICD, (ii) heart Disease, eg, not heart failure, (iii) have normal left ventricular function, (iv) no diastolic dysfunction, or (v) a set of these It is combined is known object, sigma is the standard deviation of the Gaussian distribution of the data values. In exemplary embodiments, the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the total SCN5A exon in the biological sample. The ratio of the level of 28 transcripts or (iii) the level of the full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts obtained from a control subject is compared to this and that is to match and R _S.

Alternatively, R _T = μ−Xσ, where μ = is an average value of a Gaussian distribution of a set of data values, and each data value of the set is a truncated SCN5A of a biological sample obtained from a control subject The level of exon 28 transcript can be expressed as (i) the full-length SCN5A exon 28 transcript level of the biological sample or (ii) the level of all SCN5A exon 28 transcripts in the biological sample or (iii) the full-length of the control biological sample. SCN5A exon 28 transcript level and ratio compared to the level of one or more truncated SCN5A exon 28 transcripts, the control subject is a subject known to have heart failure, and σ is the gauss of the data value The standard deviation of the distribution, where X is a number between about 0.7 and about 4.0 (eg, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2. 5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0). In exemplary embodiments, X is a number between about 0.7 and about 1.0, or a number between about 2.0 and about 4.0, or a number between about 2.3 and about 4.0. It is. In an exemplary embodiment, X is 2.326.

In an exemplary embodiment, if R _T = μ−Xσ, each data value in the set represents the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length of the biological sample. SCN5A exon 28 transcript level or (ii) total SCN5A exon 28 transcript level of biological sample or (iii) full length SCN5A exon 28 transcript level and one or more truncated SCN5A exons of control biological sample Represents the ratio compared to the level of 28 transcripts,

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of heart failure patient sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{cleavage type} = ([Ct of truncated SCN5A exon 28 transcript of heart failure patient sample] − [Ct of truncated SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Housekeeping gene Ct of heart failure patient sample] − [Ct of housekeeping gene of control sample])
A “heart failure patient sample” is a biological sample obtained from a subject known to have heart failure, and a “control sample” is (i) has no ICD, (ii) is not heart disease, eg, heart failure A biological sample obtained from a control subject known to have (iii) normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 and E28A-S transcripts.

In an exemplary embodiment, if R _T = μ−Xσ, each data value in the set represents the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length of the biological sample. SCN5A exon 28 transcript level or (ii) total SCN5A exon 28 transcript level of biological sample or (iii) full length SCN5A exon 28 transcript level and one or more truncated SCN5A exons of control biological sample Represents the ratio compared to the level of 28 transcripts,

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in heart failure patient sample] − [Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{cleavage type} = ([Ct of truncated SCN5A exon 28 transcript of heart failure patient sample] − [Ct of truncated SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Housekeeping gene Ct of heart failure patient sample] − [Ct of housekeeping gene of control sample])
A “heart failure patient sample” is a biological sample obtained from a subject known to have heart failure, and a “control sample” is (i) has no ICD, (ii) is not heart disease, eg, heart failure A biological sample obtained from a control subject known to have (iii) normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination of these, “total SCN5A exon 28 transcription” “Product” refers to all of WT, E28A-S, E28B, E28C and E28D.

In an exemplary aspect, _RT is determined by the system. In an exemplary aspect, a system includes a processor and a memory device coupled to the processor, the memory device being executed by the processor,
(I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a subject of the first population, wherein the ratio represents the level of truncated SCN5A exon 28 transcript (a ) Level of full-length SCN5A exon 28 transcript in biological sample or (b) level of total SCN5A exon 28 transcript in biological sample or (c) level of full-length SCN5A exon 28 transcript in biological sample and one or more cleavages Comparing a level of type SCN5A exon 28 transcript with each subject of the first population receiving a plurality of data values that are subjects known to have heart failure;
(Ii) fitting a plurality of data values to a first Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the first Gaussian distribution;
(Iv) store machine readable instructions that cause the first threshold ratio _RT to be set to μ−Xσ, where X is a number between 0.7 and 4.0.

Further descriptions of suitable systems that can be used to determine _RT are described later in this document.

Method for Monitoring the Risk of HF In an exemplary embodiment, the step of determining the ratio R _s is repeated at least once, or more than once. In an exemplary embodiment, the ratio R _s is determined 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times. In such cases, the method can be considered as a method of monitoring a subject's risk for HF. In an exemplary embodiment, the ratio R _s is determined every 6-12 months (eg, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months). In each round, R _s is based on different biological samples obtained from the same subject.

Methods for Determining Needs for Anti-HF Therapy The present invention also provides methods for determining a subject's need for HF therapy or prophylaxis. In an exemplary embodiment, the method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (ii) the level of the biological sample. Determining a ratio R _s that is compared to the level of total SCN5A exon 28 transcript or (iii) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in a biological sample. Including. In an exemplary aspect, if R _S is greater than or equal to the threshold ratio R _T , the subject is determined to require therapy.

With respect to the methods of determining a subject's need for anti-HF therapy provided herein, R _S is, in an exemplary embodiment, R _S (eg, title: “Ratio R”) as described herein. Is identical to any one of the aforementioned R _S ) in the sub-section of “ _{S 2} ”. Also, in an exemplary embodiment, the threshold ratio R _T is the same as any one of R _T described herein in the section titled “Heart Failure and Related Methods”.

Methods for reducing the risk of HF The present invention additionally provides methods of reducing the risk of HF in a subject. The method includes determining a subject's risk for HF and treating the subject if the subject is determined to be at risk for HF. In an exemplary embodiment, a method for reducing the risk of HF in a subject provided herein comprises (A) the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) Level of full-length SCN5A exon 28 transcript in biological sample or (ii) level of total SCN5A exon 28 transcript in biological sample or (iii) level of full-length SCN5A exon 28 transcript in biological sample and one or more truncated forms Determining a ratio R _s to compare with the level of SCN5A exon 28 transcript; and (B) providing therapy to the subject if R _S is greater than or equal to a threshold ratio R _T.

With respect to the methods of reducing a subject's risk for HF provided herein, R _S is, in an exemplary embodiment, R _S (eg, a title: “Ratio R _S ”) as described herein. It is the same as any one of the aforementioned R _S ) in the subsection. Also, in an exemplary embodiment, the threshold ratio R _T is the same as any one of R _T described herein in the title, “Heart Failure and Related Methods” section.

Heart Failure Therapy Anti-HF therapy is well known in the art. See, for example, Abraham and Krum, “Heart Failure: A Practical Approach to Treatment”, McGraw Hill Professional, 2007. Anti-HF therapy in exemplary embodiments comprises an angiotensin converting enzyme (ACE) inhibitor, angiotensin II receptor blocker (ARB), beta-blocker, digoxin, diuretic, vasodilator, potassium or magnesium, aldacton inhibitor Including administration of one or more of calcium channel blockers and cardiac pump medications. In exemplary embodiments, anti-HF therapy includes one or more surgical procedures including, but not limited to, bypass surgery, left ventricular assist device, heart valve surgery, infarct removal surgery, heart transplantation, and the like. To do.

Arrhythmia and methods related thereto Arrhythmia Furthermore, the present invention provides a method for determining a subject's risk for arrhythmia. As used herein, the term “arrhythmia” is a synonym for “cardiac rhythm disorder” or “cardiac arrhythmia” and refers to any condition in which abnormal electrical activity is present in the heart. In an exemplary embodiment, the cardiac arrhythmia is a ventricular arrhythmia, such as ventricular fibrillation, ventricular tachycardia or an arrhythmia condition in which both ventricular fibrillation and ventricular tachycardia are present. In an exemplary embodiment, the cardiac arrhythmia is an atrial arrhythmia, eg, an arrhythmia condition in which atrial fibrillation, atrial tachycardia or both atrial fibrillation and atrial tachycardia are present. Other types of cardiac arrhythmias will be described later.

  In an exemplary embodiment, cardiac arrhythmia is characterized by an abnormal heart rate. In an exemplary embodiment, cardiac arrhythmia is characterized by bradycardia or tachycardia.

Bradycardia In an exemplary embodiment, the cardiac arrhythmia is a bradycardia with a resting heart rate that is slower than normal. In an exemplary embodiment, bradycardia is characterized by a resting heart rate that is slower than 60 beats per minute in an adult. In an exemplary embodiment, the bradycardia is sinus bradycardia. In exemplary embodiments, the bradycardia is due to sinus arrest or AV block or cardiac block. In an exemplary embodiment, bradycardia is due to delayed electrical conduction in the heart. In an exemplary embodiment, the bradycardia is not a bradycardia presented by a normal functioning heart of an athlete or sportsman.

Tachycardia In an exemplary embodiment, the cardiac arrhythmia is a tachycardia where the resting heart rate is faster than normal. In an exemplary embodiment, tachycardia is characterized by a resting heart rate that is faster than 100 beats per minute in an adult. In an exemplary embodiment, the tachycardia is sinus tachycardia. In exemplary embodiments, sinus tachycardia is not due to ingestion or injection of substances such as physical exercise, emotional stress, hyperthyroidism, caffeine or amphetamine. In exemplary aspects, the tachycardia is not sinus tachycardia, but is a tachycardia resulting from, for example, automatic ability, reentry (eg, fibrillation), or firing activity. In an exemplary embodiment, tachycardia is due to a delay in electrical conduction in the heart. In an exemplary embodiment, the tachycardia is due to an ectopic focus. In an exemplary embodiment, tachycardia is combined with abnormal rhythm.

  In an exemplary embodiment, cardiac arrhythmia is characterized by the mechanism by which it occurs. In an exemplary embodiment, the cardiac arrhythmia is due to automaticity, reentry or fibrillation.

Automatic ability In an exemplary embodiment, the cardiac arrhythmia is an abnormal rhythm or tachycardia caused by automatic ability, where myocardial cells other than the myocardium of the conduction system emit their own impulse. In exemplary embodiments, cardiac arrhythmias are caused by muscle cells other than cells of sinoatrial (SA), atrioventricular (AV), His bundles or Purkinje fibers that emit unique impulses.

Reentry In an exemplary embodiment, a cardiac arrhythmia is a reentry arrhythmia in which an electrical impulse is recursively transmitted through the heart rather than moving from one end of the heart to the other and ending there. In exemplary embodiments, the cardiac arrhythmia is cardiac flutter, paroxysmal supraventricular tachycardia or ventricular tachycardia.

Fibrillation In an exemplary embodiment, the cardiac arrhythmia is fibrillation. In an exemplary embodiment, the fibrillation is atrial fibrillation. In an exemplary embodiment, the fibrillation is ventricular fibrillation.

Triggered beat
In an exemplary embodiment, a cardiac arrhythmia is a beating beat that occurs when an ion channel in a heart cell becomes dysfunctional, resulting in abnormal propagation of electrical activity and possibly abnormal rhythm.

  In an exemplary embodiment, cardiac arrhythmias are classified by origin site. In exemplary embodiments, the cardiac arrhythmia is an atrial arrhythmia (eg, atrial premature contraction, wandering atrial pacemaker, multi-source atrial tachycardia, atrial flutter, atrial fibrillation). In exemplary embodiments, the cardiac arrhythmia is a junction arrhythmia (eg, supraventricular tachycardia, AV nodal reentrant tachycardia, paroxysmal supraventricular tachycardia, junction rhythm, junction tachycardia, junction phase). Premature junctional complex). In an exemplary embodiment, the cardiac arrhythmia is atrioventricular arrhythmia (eg, AV reentrant tachycardia). In exemplary embodiments, the cardiac arrhythmia is a ventricular arrhythmia (eg, ventricular premature contraction or ventricular extra beat, accelerated ventricular intrinsic rhythm, monomorphic ventricular tachycardia, polymorphic ventricular tachycardia , Ventricular fibrillation). In exemplary aspects, the cardiac arrhythmia is a heart block (eg, a first degree block, a type I second degree block, a type 2 second degree block, a third degree heart block). In an exemplary embodiment, the cardiac arrhythmia is an extrasystole.

  In an exemplary embodiment, the cardiac arrhythmia is a condition where there are two or more cardiac arrhythmias. In an exemplary embodiment, cardiac arrhythmia is a condition in which both ventricular tachycardia and ventricular fibrillation are present. In an exemplary embodiment, the cardiac arrhythmia is a condition where there is no bradycardia.

In an exemplary embodiment, a method for determining a subject's risk for arrhythmia comprises determining a level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, and (i) a level of a full-length SCN5A exon 28 transcript in the biological sample. Or (ii) the ratio of the total SCN5A exon 28 transcript level of the biological sample or (iii) the level of the full length SCN5A exon 28 transcript of the biological sample and the level of one or more truncated SCN5A exon 28 transcripts Determining R _s . In an exemplary aspect, if R _S is greater than or equal to the threshold ratio R _T , the subject is determined to be at risk for arrhythmia.

With respect to the methods of determining a subject's risk for an arrhythmia provided herein, R _S is, in an exemplary embodiment, R _S (eg, a title: “Ratio R _S ”) as described herein. It is the same as any one of the aforementioned R _S ) in the subsection. In some instances, except that differ from those described in a control sample or control subject or subject that section, the threshold ratio R _T is, R _{T (e.g.,} as described herein, the title, " This is basically the same as R _T ) described above in the section “Threshold Ratio R _T ”. For example, with respect to the methods of determining a subject's risk for HF as provided herein, _RT in an exemplary embodiment is the level of truncated SCN5A exon 28 transcript in a biological sample: (i) Level of full-length SCN5A exon 28 transcript or (ii) level of total SCN5A exon 28 transcript of biological sample or (iii) level of full-length SCN5A exon 28 transcript of biological sample and one or more truncated SCN5A exons 28 A ratio relative to the level of transcript, the biological sample is (i) not having ICD, (ii) not having heart disease, eg heart failure, (iii) having normal left ventricular function, (iv It is obtained from a control subject that is known to have no) diastolic dysfunction or (v) a combination of these.

In an alternative embodiment, R _T = μ + 4.0σ, where μ = is the mean of a Gaussian distribution of a set of data values, and each data value of the set is a biological sample obtained from a control subject The level of the truncated SCN5A exon 28 transcript of (i) the level of the full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample or (iii) the organism of the control subject Represents the ratio of the sample to the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts, the control subjects are (i) have no ICD, (ii) heart Disease, eg, not heart failure, (iii) have normal left ventricular function, (iv) no diastolic dysfunction, or (v) a set of these It is combined is known object, sigma is the standard deviation of the Gaussian distribution of the data values. In exemplary embodiments, the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the total SCN5A exon in the biological sample. The ratio of the level of 28 transcripts or (iii) the level of the full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts obtained from a control subject is compared to this and that is to match and R _S.

Alternatively, R _T = μ−Xσ, where μ = is an average value of a Gaussian distribution of a set of data values, and each data value of the set is a truncated SCN5A of a biological sample obtained from a control subject The level of exon 28 transcript can be expressed as (i) the full-length SCN5A exon 28 transcript level of the biological sample or (ii) the level of all SCN5A exon 28 transcripts in the biological sample or (iii) the full-length of the control biological sample. SCN5A exon 28 transcript level and ratio compared to the level of one or more truncated SCN5A exon 28 transcripts, the control subject is a subject known to have arrhythmia, and σ is the gauss of the data value The standard deviation of the distribution, where X is a number between about 0.7 and about 4.0 (eg, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2. 5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0). In exemplary embodiments, X is a number between about 0.7 and about 1.0, or a number between about 2.0 and about 4.0, or a number between about 2.3 and about 4.0. It is. In an exemplary embodiment, X is 2.326.

In an exemplary embodiment, if R _T = μ−Xσ, each data value in the set represents the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length of the biological sample. SCN5A exon 28 transcript level or (ii) total SCN5A exon 28 transcript level of biological sample or (iii) full length SCN5A exon 28 transcript level and one or more truncated SCN5A exons of control biological sample Represents the ratio compared to the level of 28 transcripts,

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of arrhythmia patient sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{cleavage type} = ([Ct of the truncated SCN5A exon 28 transcript of the arrhythmia patient sample] − [Ct of the truncated SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of arrhythmia patient sample] − [Ct of housekeeping gene of control sample])
An “arrhythmic patient sample” is a biological sample obtained from a subject known to be arrhythmic, and a “control sample” is (i) has no ICD, (ii) is not a heart disease, eg, an arrhythmia A biological sample obtained from a control subject known to have (iii) normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination thereof, WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 and E28A-S transcripts.

In an exemplary embodiment, if R _T = μ−Xσ, each data value in the set represents the level of truncated SCN5A exon 28 transcript of the biological sample obtained from the control subject, and (i) the full length of the biological sample. SCN5A exon 28 transcript level or (ii) total SCN5A exon 28 transcript level of biological sample or (iii) full length SCN5A exon 28 transcript level and one or more truncated SCN5A exons of control biological sample Represents the ratio compared to the level of 28 transcripts,

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcript in arrhythmia patient sample]-[Ct of all SCN5A exon 28 transcript in control sample])
ΔCt _{cleavage type} = ([Ct of the truncated SCN5A exon 28 transcript of the arrhythmia patient sample] − [Ct of the truncated SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of arrhythmia patient sample] − [Ct of housekeeping gene of control sample])
An “arrhythmic patient sample” is a biological sample obtained from a subject known to have heart failure, and a “control sample” is (i) has no ICD, (ii) is not a heart disease, eg, an arrhythmia A biological sample obtained from a control subject known to have (iii) normal left ventricular function, (iv) no diastolic dysfunction, or (v) a combination of these, “total SCN5A exon 28 transcription” “Product” refers to all of WT, E28A-S, E28B, E28C and E28D.

In an exemplary aspect, _RT is determined by the system. In an exemplary aspect, a system includes a processor and a memory device coupled to the processor, the memory device being executed by the processor,
(I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a subject of the first population, wherein the ratio represents the level of truncated SCN5A exon 28 transcript (a ) Level of full-length SCN5A exon 28 transcript in biological sample or (b) level of total SCN5A exon 28 transcript in biological sample or (c) level of full-length SCN5A exon 28 transcript in biological sample and one or more cleavages Comparing a level of type SCN5A exon 28 transcript with each subject of the first population receiving a plurality of data values that are subjects known to have arrhythmia;
(Ii) fitting a plurality of data values to a first Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the first Gaussian distribution;
(Iv) store machine readable instructions that cause the first threshold ratio _RT to be set to μ−Xσ, where X is a number between 0.7 and 4.0.

Further descriptions of suitable systems that can be used to determine _RT are described later in this document.

Method for Monitoring Arrhythmia Risk In an exemplary embodiment, the step of determining the ratio R _s is repeated at least once, or more than once. In an exemplary embodiment, the ratio R _s is determined 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times. In such instances, the method can be considered as a method of monitoring a subject's risk for arrhythmia. In an exemplary embodiment, the ratio R _s is determined every 6-12 months (eg, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months). In each round, R _s is based on different biological samples obtained from the same subject.

Methods for Reducing Arrhythmia Risk The present invention additionally provides methods for reducing the risk of arrhythmia in a subject. The method includes determining a subject's risk for arrhythmia and treating the subject if the subject is determined to be at risk for arrhythmia. In an exemplary embodiment, a method for reducing the risk of arrhythmia in a subject provided herein comprises (A) the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (i) Level of full-length SCN5A exon 28 transcript in biological sample or (ii) level of total SCN5A exon 28 transcript in biological sample or (iii) level of full-length SCN5A exon 28 transcript in biological sample and one or more truncated forms Determining a ratio R _s to compare with the level of SCN5A exon 28 transcript; and (B) providing antiarrhythmic therapy to the subject if R _S is greater than or equal to a threshold ratio R _T.

With respect to the methods of reducing a subject's risk for arrhythmias provided herein, R _S is, in an exemplary embodiment, R _S (eg, a title: “Ratio R _S ”) as described herein. It is the same as any one of the aforementioned R _S ) in the subsection. Also, in an exemplary embodiment, the threshold ratio R _T is the same as any one of R _T described herein in the title, section “Arrhythmia and Related Methods”. The antiarrhythmic therapy provided in the method for reducing the risk of arrhythmia can be any suitable antiarrhythmic therapy known in the art, some of which are described herein .

Methods for Determining Safe Use of Therapy The present invention still further provides a method for determining whether administration of an antiarrhythmic agent to a subject is safe. The method determines the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, either (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the total SCN5A exon 28 transcript in the biological sample. Determining the level or (iii) the ratio R _S compared to the level of the full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of the biological sample. In an exemplary embodiment, if R _S is greater than or equal to the threshold ratio R _T , administration of the antiarrhythmic agent to the subject is safe.

With respect to methods for determining whether administration of an antiarrhythmic agent to a subject provided herein is safe, R _S is, in an exemplary embodiment, R _S (eg, title) as described herein. : Same as any one of the above-mentioned R _S ) in the subsection “Ratio R _S ”. Also, in an exemplary aspect, the threshold ratio R _T is the same as any one of R _T described herein in the title, “Threshold Ratio R _T ” section. The antiarrhythmic agent provided in the method for reducing the risk of arrhythmia can be any suitable antiarrhythmic agent known in the art, some of which are described herein. . In an exemplary embodiment, the antiarrhythmic agent is a sodium channel blocker, such as NAD +, mitoTEMPO.

Levels of SCN5A Exon 28 Transcripts The methods described herein refer to one or more levels of SCN5A exon 28 transcripts. The method may include, for example, the level of a truncated SCN5A exon 28 transcript in a biological sample, (i) the level of a full-length SCN5A exon 28 transcript in a biological sample, or (ii) the level of all SCN5A exon 28 transcripts in a biological sample, or (Iii) determining the level associated with the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in the biological sample. The level of SCN5A exon 28 transcript can be determined or obtained by any suitable means. In an exemplary embodiment, the level is determined by measuring the level from a biological sample. For example, either the full-length transcript level of the SCN5A gene and the level of the truncated SCN5A exon 28 transcript can be measured using techniques suitable for measuring transcripts known in the art. . Measurement of these levels can be a direct measurement of SCN5A exon 28 transcript. Such a method can be considered as involved in measuring the expression level of the SCN5A exon 28 transcript. In exemplary embodiments, the level measured is mRNA transcript level or the level of product encoded by the mRNA transcript, eg, protein or peptide expression level. Suitable methods for determining protein expression levels are known in the art and include immunoassays such as Western blotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry. Assay). Suitable methods for determining the expression level of nucleic acids (eg, mRNA) are known in the art and include, but are not limited to, quantitative polymerase chain reaction (qPCR), Northern PCR and the like, Includes blotting and Southern blotting.

  In an alternative embodiment, measurement of SCN5A exon 28 transcript can be an indirect measurement in which something other than SCN5A exon 28 transcript is measured. For example, SCN5A exon 28 transcript levels can be determined by measuring the expression level or biological activity level of a related protein, eg, a protein that acts upstream or downstream of the SCN5A exon 28 transcript. For example, the data provided herein demonstrates that the splicing factors hLuc7A and RBM25 and the endoplasmic reticulum stress response (UPR) transducer, PERK, are associated with aberrant splicing of the SCN5A gene. Thus, the level can be determined by measuring the expression level of splicing factor hLuc7a, splicing factor RBM25 and / or PERK. The expression level of splicing factor hLuc7a, splicing factor RBM25 and / or PERK can be measured by measuring gene expression or gene product expression (eg, mRNA, protein). Thus, in an exemplary embodiment, the methods described herein include splicing factor hLuc7a protein, splicing factor RBM25 protein and / or PERK protein, or splicing factor hLuc7a mRNA, splicing factor RBM25 mRNA and / or PERK mRNA. A step of measuring the level can be included.

  Luc7A (NCBI gene ID number 51747) is also known as LUC7L3; LUC7-like 3; CRA; CROP; LUC7A; hLuc7A; CREAP-1; and OA48-18. Exemplary mRNA sequences for hLuc7A are referred to herein as SEQ ID NOs: 34 and 35, but can also be found in the NCBI nucleotide database as accession number NM_006107.3 and accession number NM_01624.4. Exemplary amino acid sequences of hLuc7A are represented herein as SEQ ID NOs: 36 and 37, but can also be found in the NCBI protein database as accession number NP_006098.2 and accession number NP_057508.2. RBM25 (NCBI gene ID number 58517) is also known as RNA-binding motif protein 25; S164; NET52; RNPC7; Snu71; RED120; fSAP94; MGC105088; and MGC117168. An exemplary mRNA sequence of RBM25 is represented herein as SEQ ID NO: 38, but can be found in the NCBI nucleotide database as accession number NM — 01239.2. An exemplary amino acid sequence of RBM25 is represented herein as SEQ ID NO: 39, but can be found in the NCBI protein database as accession number NP_067062.1. PERK (NCBI gene ID number 9451) is also known as eukaryotic translation initiation factor 2-alpha kinase 3, EIF2AK3, protein kinase R-like endoplasmic reticulum kinase, PKR-like ER kinase; PEK; WRS; and DKFZp781H1925. An exemplary mRNA sequence of PERK is represented herein as SEQ ID NO: 40, but can also be found in the NCBI nucleotide database as accession number NM_004836.5. An exemplary amino acid sequence of PERK is represented herein as SEQ ID NO: 41, but can also be found in the NCBI protein database as accession number NP_004827.4.

  Also, for example, SCN5A exon 28 transcript levels can be determined by measuring the expression level or biological activity level of chaperone proteins (eg, calnexin, CHOP) because these proteins Is up-regulated when activated by PERK, and that PERK is activated by a specific truncated SCN5A transcript. Thus, in an exemplary embodiment, the methods described herein can include measuring chaperone protein levels in a biological sample. In an exemplary embodiment, the chaperone protein is CHOP or calnexin.

  In an exemplary embodiment, the chaperone protein is CHOP. CHOP (NCBI gene ID number 1649) is also known as DDIT3, DNA damage-inducible transcript 3, CEBPZ; CHOP10; CHOP-10; GADD153; MGC4154. Exemplary amino acid sequences of CHOP are represented herein as SEQ ID NOs: 42-47, but in the NCBI protein database, accession numbers NP_001181982.1, NP_001181983.1, NP_001181984.1, NP_001181985.1. , NP_001181986.1, NP_004074.2. Exemplary nucleotide sequences for CHOP are referred to herein as SEQ ID NOs: 48-53, but in the NCBI nucleotide database, accession numbers NM_001195053.1, NM_001195054.1, NM_001195055.1, NM_001195056.1. , NM_001195057.1 and NM_004083.5.

  In an exemplary embodiment, the chaperone protein is calnexin. Calnexin (NCBI gene ID number 821) is also known as CANX; CNX; P90; IP90; FLJ26570. Exemplary amino acid sequences of calnexin are represented herein as SEQ ID NOs: 54 and 55, but can also be found in the NCBI protein database as accession numbers NP_001019820.1 and NP_001737.1. Exemplary nucleotide sequences for calnexin are referred to herein as SEQ ID NOs: 56 and 57, but can also be found in the NCBI nucleotide database as accession numbers NM_00102464649.1 and NM_001746.3.

  In a method in which the level of splicing factor hLuc7a, splicing factor RBM25, PERK and / or chaperone protein is measured, the level is the expression level of splicing factor hLuc7a, splicing factor RBM25, PERK or chaperone protein (eg, protein level, mRNA level, Gene expression level). Alternatively, the level can be a biological activity level, such as an enzyme activity level or a binding activity level. In an exemplary embodiment, the measurement can be performed by measuring the amount of RBM25 that is bound to the SCN5A gene or gene transcript.

Medical Record In an exemplary embodiment, the level is determined by obtaining the level from the medical record. For example, the level may be measured and recorded before the steps of the method of the present invention are performed, for example, at a time before R _S is determined. In an exemplary embodiment, the level is obtained from a medical record of the subject containing the recorded level measured and recorded within 6 months prior to the time the method steps of the invention are performed. In exemplary embodiments, the level is obtained from a medical record of a subject containing the recorded level measured within 5 months, 4 months, 3 months or 2 months prior to the time the method steps of the invention are performed. It is done. In exemplary embodiments, the level is obtained from a medical record of a subject containing the recorded level measured and recorded within one month, three weeks, two weeks, or one week prior to the time the method steps of the invention are performed. It is done.

  In an exemplary embodiment, a portion of the level is determined by obtaining the level from a medical record and a portion is measured. In an exemplary embodiment, the method comprises the steps of measuring the level of a full-length transcript of the SCN5A gene and, from the subject's medical record, an SNC5A splice variant produced from alternative splicing within exon 28 of the SCN5A gene. Obtaining a level of. Alternatively, the method comprises obtaining from the subject medical record the level of a full-length transcript of the SCN5A gene and measuring the level of SNC5A splice variant produced from alternative splicing within exon 28 of the SCN5A gene. Including.

Additional Steps With respect to the method of the present invention, the method can include additional steps. For example, the method can include repeating one or more of the described step (s) of the method. Thus, in an exemplary aspect, the method includes redetermining the ratio R _S. In an exemplary aspect, the method includes the step of redetermining the ratio R _S every 6-12 months, wherein each R _S determination is based on a different biological sample obtained from the same subject. In some aspects, the method includes obtaining a biological sample from the subject every 6-12 months and determining an R _S for each obtained biological sample.

  In an exemplary embodiment, the method includes administering a therapeutic agent or device once its need or risk has been determined. For example, the methods described herein optionally include the step of giving a reasonable therapy to a subject determined to be in need (administering a pharmaceutical formulation or implementing a care standard). be able to. In an exemplary embodiment, the method of the invention includes one or more steps related to providing a reasonable therapy. The method can include, for example, implanting an ICD in the subject or administering an antiarrhythmic agent to the subject. The antiarrhythmic agent can be any known in the art, some of which are described herein. The antiarrhythmic agent can be administered to the subject by any suitable route of administration known in the art, some of which are described later herein.

  In an exemplary embodiment, the method includes determining the level of SCN5A exon 28 transcript in two or more ways. In an exemplary embodiment, the method comprises (i) measuring the level of SCN5A exon 28 transcript from a biological sample obtained from the subject; and (ii) obtaining the level of SCN5A exon 28 transcript from the subject's medical record. Including. In an exemplary embodiment, the method comprises measuring the level of SCN5A exon 28 transcript by measuring SCN5A exon 28 mRNA transcript and measuring the protein product encoded by SCN5A exon 28 mRNA transcript. In exemplary aspects, the method includes measuring two, three, four, five, six, seven, eight, or all levels of: (I) SCN5A exon 28 mRNA transcript, (ii) SCN5A exon 28 protein, (iii) expression level of hLuc7A, (iv) expression level of RBM25, (v) binding level of RBM25 to SCN5A gene or gene transcript, ( vi) PERK expression level, (vii) PERK bioactivity level, (viii) chaperone protein expression level, (ix) chaperone protein bioactivity level. In an exemplary embodiment, the method includes measuring the level of two or more truncated SCN5A exon 28 transcripts, eg, measuring the level of both E28C and E28D.

  In exemplary embodiments, the methods include two or more of truncated SCN5A exon 28 transcripts (eg, E28C and E28D) and / or two or more of full-length SCN5A exon 28 transcripts (eg, E28A-S and Determining the level of WT SCN5A exon 28).

  For the purposes of the method of the present invention, any and all possible combinations of the steps described herein are contemplated.

Biological Samples With respect to the methods disclosed herein, in some embodiments, a sample comprises a body fluid, and as a body fluid, blood, plasma, serum, lymph, breast milk, saliva, mucus, semen obtained from a subject, Examples include, but are not limited to, vaginal secretions, cell extracts, inflammatory fluids, cerebrospinal fluid, feces, vitreous humor or urine. In some embodiments, the sample is a composite panel of at least two of the aforementioned samples. In some embodiments, the sample is a composite panel of at least two of a blood sample, a plasma sample, a serum sample, and a urine sample. In exemplary embodiments, the sample comprises blood or a fraction thereof (eg, a fraction obtained by plasma, serum, leukocyte pheresis). In an exemplary embodiment, the sample includes white blood cells obtained from the subject. In an exemplary embodiment, the sample contains only white blood cells. In an exemplary embodiment, the sample is muscle tissue (eg, skeletal muscle tissue). In an exemplary embodiment, the sample is cardiac tissue (eg, myocardial tissue).

Subjects With respect to the methods disclosed herein, the subject in an exemplary embodiment is a mammal. Mammals derived from Carnivora including mammals such as mice and hamsters, rodents (Rodentia), rabbits, mammals from the order of Logomorpha, Feline (cat) and Canine (dog) Examples include, but are not limited to, mammals, mammals derived from Artiodactyla including Bovine (bovine) and Sine (pig) or Perssodactyla including Equine (horse). In some embodiments, the mammal is a primates mammal, a ceboid or simoid (monkey) or an anthropoids mammal (human and ape). In some embodiments, the mammal is a human.

Control In the methods described herein, the level determined is the same as the control level or cutoff level or threshold level, or is increased or decreased compared to the control level or cutoff level or threshold level. May be. In some embodiments, the control subject is a control matched for the same species, gender, ethnicity, age group, smoking status, BMI, current therapy regimen status, medical history, or a combination thereof, It differs from the subject being diagnosed in that it does not suffer from the disease in question or is not at risk for the disease.

  The level determined can be an increased level compared to the control level. As used herein, the term “increased” with respect to a level (eg, expression level, bioactivity level) refers to any% increase over the control level. The increased level is at least or about 5% increase, at least or about 10% increase, at least or about 15% increase, at least or about 20% increase, at least or about 25% increase, at least or about 30 compared to the control level. % Increase, at least or about 35% increase, at least or about 40% increase, at least or about 45% increase, at least or about 50% increase, at least or about 55% increase, at least or about 60% increase, at least or about 65% There may be an increase, at least or about 70% increase, at least or about 75% increase, at least or about 80% increase, at least or about 85% increase, at least or about 90% increase, at least or about 95% increase.

  The level determined can be a reduced level compared to the control level. As used herein, the term “reduced” with respect to levels (eg, expression level, bioactivity level) refers to any% decrease below the control level. The reduced level is at least or about 5% reduction, at least or about 10% reduction, at least or about 15% reduction, at least or about 20% reduction, at least or about 25% reduction, at least or about 30 compared to the control level. % Reduction, at least or about 35% reduction, at least or about 40% reduction, at least or about 45% reduction, at least or about 50% reduction, at least or about 55% reduction, at least or about 60% reduction, at least or about 65% Reduction, at least or about 70% reduction, at least or about 75% reduction, at least or about 80% reduction, at least or about 85% reduction, at least or about 90% reduction, at least or about 95% reduction.

Housekeeping gene For purposes herein, the level of SCN5A transcript is determined (obtained or measured) and the level is normalized or calibrated to the level of the housekeeping gene. The housekeeping gene in some embodiments is β-actin or GAPDH. In an exemplary embodiment, the housekeeping gene is any one of the genes described as SEQ ID NOs: 61-635 in the sequence listing, or any one of the genes listed in Table 1 below.

Route of Administration The following description of the route of administration is provided merely to illustrate exemplary embodiments and should not be construed as limiting its scope in any way.

  Formulations suitable for oral administration include: (a) a liquid solution such as an effective amount of an analog of the present disclosure dissolved in a diluent such as water, physiological saline or orange juice; Or it may consist of capsules, sachets, tablets, medicated candy and lozenges, (c) powders, (d) suspensions in suitable liquids and (e) suitable emulsions contained as granules. Liquid formulations can include diluents such as water and alcohols such as ethanol, benzyl alcohol and polyethylene alcohol, with or without the addition of pharmaceutically acceptable surfactants. Capsule forms can be normal hard or soft shell gelatin type capsules containing, for example, surfactants, lubricants and inert fillers such as lactose, sucrose, calcium phosphate and corn starch. Tablet form is lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, gum arabic (acacia), gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate , Zinc stearate, stearic acid and other excipients, colorants, diluents, buffers, disintegrants, moistening agents, preservatives, flavoring agents and other pharmacologically compatible excipients One or more of the agents can be included. Medicinal candy forms can include analogs of the present disclosure in flavor, usually sucrose and gum arabic or tragacanth, and pastilles are gelatins that additionally contain excipients known in the art And an analog of the present disclosure in an inert base such as glycerin or sucrose and gum arabic, emulsion, gel and the like.

  The analogs of the present disclosure can be delivered by pulmonary administration alone or in combination with other suitable components, and can be made into aerosol formulations for administration by inhalation. Such aerosol formulations can be placed in pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like. It can also be formulated as a medicament for a non-pressurized preparation, such as a preparation in a nebulizer or atomizer. Such spray formulations may be used for mucosal spraying. In some embodiments, the analog is formulated into a powder blend or into microparticles or nanoparticles. Suitable pulmonary formulations are those known in the art. For example, Qian et al., Int J Pharm 366: 218-220 (2009); Adjei and Garren, Pharmaceutical Research, 7 (6): 565-569 (1990); Kawashima et al., J Controlled Release 62 Volume (1-2): 279-287 (1999); Liu et al., Pharm Res 10 (2): 228-232 (1993); International Patent Application Publication No. 2007/133747. Please refer to the pamphlet and the pamphlet of International Publication No. 2007/141411.

  Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic aseptics that may contain antioxidants, buffers, bacteriostatic agents and solutes that impart isotonicity to the intended recipient's blood to the formulation. Injectable solutions and aqueous and non-aqueous sterile suspensions that may include suspensions, solubilizers, thickeners, stabilizers and preservatives are included. The term “parenteral” means not via the gastrointestinal tract but by other routes such as subcutaneous, intramuscular, intraspinal or intravenous. Analogs of the present disclosure may be added with pharmaceutically acceptable surfactants such as soap or detergent, suspending agents such as pectin, carbomer, methylcellulose, hydroxypropylmethylcellulose or carboxymethylcellulose or emulsifiers and other pharmaceutical adjuvants Or not, water, saline, dextrose water and related sugar solutions, alcohols such as ethanol or hexadecyl alcohol, glycols such as propylene glycol or polyethylene glycol, dimethyl sulfoxide, glycerol, 2,2-dimethyl-1, Ketals such as 3-dioxolane-4-methanol, ethers, poly (ethylene glycol) 400, oils, fatty acids, fatty acid esters or glycerides or acetylated fats It can be administered with a physiologically acceptable diluent in a pharmaceutical carrier, such as a sterile liquid or liquid mixture, including fatty acid glycerides.

  Oils that can be used in parenteral formulations include petroleum, animal oils, vegetable oils or synthetic oils. Specific examples of oils include peanuts, soybeans, sesame, cottonseed, corn, olives, petrolatum and minerals. Fatty acids suitable for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.

  Soaps suitable for use in parenteral formulations include fatty alkali metal, ammonium and triethanolamine salts, and suitable detergents include (a) positive agents such as dimethyldialkylammonium halides and alkylpyridinium halides. Ionic detergents, (b) anionic detergents such as alkyl, aryl and olefin sulfonates, alkyls, olefins, ethers and monoglyceride sulfates and sulfosuccinates, (c) eg aliphatic amine oxides, fatty acid alkanols Nonionic detergents such as amides and polyoxyethylene polypropylene copolymers, (d) amphoteric detergents such as alkyl-β-aminopropionates and 2-alkyl-imidazoline quaternary ammonium salts And (e) mixtures thereof.

  Parenteral formulations will typically contain from about 0.5% to about 25% by weight of an analog of the present disclosure in solution. Preservatives and buffers may be used. To minimize or eliminate irritation at the site of injection, such compositions can contain one or more nonionic surfactants having a hydrophilic lipophilic balance (HLB) of about 12 to about 17. . The surfactant content in such formulations will typically range from about 5% to about 15% by weight. Suitable surfactants include polyethylene glycol sorbitan fatty acid esters, such as sorbitan monooleate, and high molecular weight adducts of hydrophobic bases and ethylene oxide produced by the condensation of propylene oxide and propylene glycol. Parenteral preparations can be presented in unit dose or multiple dose sealed containers, such as ampoules and vials, and are freeze-dried that require only the addition of sterile liquid excipients for injection, such as water, just prior to use. It can be stored in a (freeze-dried) state. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described.

  Injectable formulations are consistent with the present invention. The requirements for effective pharmaceutical carriers for injectable compositions are well known to those skilled in the art (eg, Pharmaceuticals and Pharmacy Practice, JB Lippincott Company, Philadelphia, PA, Ed. Banker and Chalmers, pages 238-250 ( 1982) and ASHP Handbook on Injectable Drugs, Toissel, 4th edition, pages 622-630 (1986)).

  Moreover, the analogs of the present disclosure can be made into suppositories for rectal administration by mixing with a variety of bases such as emulsifying bases or water-soluble bases. Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing, in addition to the active ingredient, carriers known to be appropriate in the art. it can.

  One skilled in the art will recognize that, in addition to the pharmaceutical compositions described above, the analogs of the present disclosure can be formulated as inclusion complexes, such as cyclodextrin inclusion complexes or liposomes.

Treatment and Prevention The terms “treatment” and “prevention”, together with phrases derived from them, do not necessarily imply 100% or complete treatment or prevention herein. Rather, there are varying degrees of treatment or prevention that those skilled in the art will recognize as having a potential benefit or therapeutic effect. In this regard, the methods of the invention can provide any amount of any level of treatment or prevention in a mammal. Still further, treatment or prevention can include treatment or prevention of one or more conditions or symptoms of the disease being treated or prevented. Also, for purposes herein, “prevention” can encompass delaying the onset of the disease or its symptoms or conditions.

System, Computer-Readable Storage Medium, and Method Implemented by Computer Processor FIG. 34 illustrates an exemplary embodiment 101 of the system 100 for assessing a subject's need for an implantable defibrillator (ICD). In general, the system 100 can include one or more client devices 102, a network 104, and a database 108. For example, the connection may be compliant with a standard such as one of the IEEE 802.11 standard ("Wi-Fi"), the Ethernet (Ethernet) standard, or any other suitable network connection. Each client device 102 may be communicatively coupled to the network 104 by one or more wired or wireless network connections 112. Similarly, database 108 can be communicatively coupled to network 104 via one or more connections 114. (Of course, the database may alternatively be internal to one or more of the client devices 102.) The database 108 may store data related to determining subject needs for the ICD. it can. Such data may include biological sample data obtained from a subject, biological sample data obtained from a control or test population, Gaussian distribution data associated with the biological sample data, biological sample (s) and / or Gaussian distribution. The data of one or a plurality of threshold values related to the data is not limited to these. As will be described in more detail below, the biological sample data may be one or more of, for example, a truncated SCN5A exon 28 transcript level, a full-length SCN5A exon 28 transcript level, a plurality of SCN5A exon 28 transcript levels, etc. Can be related to.

  As will be appreciated, the network 104 may be a local area network (LAN) or a wide area network (WAN). That is, the network 104 may include only local (eg, intra-organization) connections, or the network 104 may cross one or more public networks (eg, the Internet). ) May be included. In some embodiments, for example, client device 102 and database 108 may reside in a network operated by one company (Company A). In other embodiments, for example, client device (s) 102 may reside in a network operated by company A, while database 108 resides in a network operated by a second company (company B). The network of company A and company B may be connected by a third network such as the Internet, for example.

  Still referring to FIG. 34, the client device 102 includes a processor 128 (CPU), a RAM 130, and a non-volatile memory 132. Non-volatile memory 132 may be any suitable memory device including, but not limited to, a magnetic disk (eg, hard disk drive), a solid state drive (eg, flash memory), and the like. Moreover, it will be appreciated that the database 108 need not be distinct from the client device 102, at least with respect to FIG. Instead, in some embodiments, database 108 is part of non-volatile memory 132 and data 122, 124, 126 can be stored as data in memory 132. For example, the data 122 may be included as data in a spreadsheet file stored in the memory 132 rather than as data in the database 108. In addition to storing records in the database 108 (in some embodiments), the memory 132 analyzes data for one or more sample and / or control populations, determines Gaussian fit of data, and compares data of interest. Stores program data and other data necessary to determine the threshold value to obtain and / or to determine the need for the subject with respect to the ICD. For example, in one embodiment, the memory 132 stores a first routine 134, a second routine 136, and a third routine 138. The first routine 134 can receive data values related to one or more sample and / or control populations, and the data values received by the routine 134 can be fitted to a Gaussian distribution. The second routine 136 can compute one or more statistical parameters of the data collected by the first routine 134, such as determining the mean value, standard deviation value, etc. of the Gaussian distribution. Additionally and / or alternatively, the second routine 136 can set a first threshold that can be compared to the data of one or more subjects to determine whether each subject should accept an ICD. The third routine 138, for example, receives data for one or more objects, compares the data for one or more objects with the threshold (s) determined by the second routine 136, and / or It can be determined whether each subject should accept an ICD according to a comparison of the data and a threshold. Nevertheless, each of the routines includes a series of compiled or compilable machine-readable instructions that are executable by the processor 128 and stored in the memory 132. In addition, the memory 132 can store a generated report or record of data output by one of the routines 134 or 136. Alternatively, the report or record may be output to the database 108. As is generally known, one or more display / output devices 140 (eg, a printer, display, etc.) and one or more input devices 142 (eg, a mouse, keyboard, tablet, touch-sensitive interface, etc.) are connected to the client device. 102 may be coupled.

  As will be appreciated, although individual operations of one or more methods are described and described as separate operations, one or more of the individual operations may be performed simultaneously and operated in the order described. Need not be done. Structures and functionality presented as separate components in the exemplary configurations can be implemented as a combined structure or component. Similarly, structure and functionality presented as a single component can be implemented as separate components. The above described and other changes, modifications, additions and improvements fall within the scope of the subject matter herein.

  For example, the network 104 includes, but is not limited to, any combination of LAN, MAN, WAN, mobile, wired or wireless network, private network, or virtual private network. Moreover, for simplicity and clarity of explanation, only two clients 102 are illustrated in FIG. 34, but any number of client computers are supported and one or more servers (not shown). I understand that I can contact you.

  Moreover, certain embodiments are described herein as including logic or a number of routines. The routine can constitute either a software routine (eg, code embodied in a machine-readable medium or transmission signal) or a hardware routine. A hardware routine is a tangible unit that can perform a specific operation and can be configured or arranged in a specific form. In an exemplary embodiment, one or more computer systems (eg, stand-alone, client or server computer systems) or one or more hardware routines (eg, a processor or group of processors) of a computer system may be software (eg, Depending on the application or application portion, it can be configured as a hardware routine that operates to perform the specific operations described herein.

  Similarly, the methods or routines described herein may be at least partially processor-implemented. For example, at least some operations of the method can be performed by one or more processors or processor-implemented hardware modules. The performance of a particular operation can be distributed across one or more processors and not only resides within a single machine, but is spread across many machines. In some exemplary embodiments, the processor (s) may be located in a single location (eg, in a home environment, work environment or as a server farm), while in other embodiments The processors can be distributed in a number of locations.

  The performance of a particular operation can be distributed across one or more processors and not only resides within a single machine, but is spread across many machines. In some exemplary embodiments, one or more processors or processor implementation modules may be located in a single geographic location (eg, within a home environment, work environment, or server farm). In other exemplary embodiments, one or more processors or processor implementation modules can be distributed in a number of geographic locations.

  Some embodiments may be described using the expressions “linked” and “connected” and their derivatives. For example, some embodiments may be described using the term “coupled” to indicate that two or more components are in direct physical or electrical contact. However, the term “coupled” can also mean that two or more components are not in direct contact with each other, but still cooperate or interact with each other. Embodiments are not limited to this context.

  As used herein, the terms “including”, “including”, “including”, “including”, “having”, “having” or any other variants thereof are non-exclusive The purpose is to cover global inclusion. For example, a process, method, article, or device that includes a list of components is not necessarily limited to only those components, but is unique to a component or such process, method, article, or device not specifically listed. Other components may be included. Further, unless stated to the contrary, “or” refers to inclusiveness or non-exclusiveness. For example, the condition A or B satisfies the requirement by any one of the following. A is true (or present) and B is false (or absent); A is false (or absent) and B is true (or present); and A and B are Both are true (or exist).

  In addition, the use of the singular ("a" or "an") is utilized in describing the components and components of embodiments herein. This is done merely for convenience and to give a general sense of the description. This description should be read to include one or at least one and the singular also includes the plural unless it is obvious that it is meant otherwise.

  Furthermore, the drawings depict a preferred embodiment of a map editor system for illustrative purposes only. Those skilled in the art can readily appreciate from the following description that alternative embodiments of the structures and methods described herein may be used without departing from the principles described herein. Will recognize.

  After reading this disclosure, one of ordinary skill in the art will recognize, in accordance with the principles disclosed herein, additional additional alternative structural and systematic systems and processes for identifying terminal road segments. Recognize functional design. Thus, although specific embodiments and applications have been described and described, it is to be understood that the disclosed embodiments are not limited to the precise constructions and components disclosed herein. Various modifications, changes and variations apparent to those skilled in the art in the arrangement, operation and details of the methods and apparatus disclosed herein may be made without departing from the spirit and scope as defined in the appended claims. Changes can be made.

The present invention provides a system that includes a processor, a memory device coupled to the processor, and machine-readable instructions stored in the memory device. In an exemplary embodiment, machine-readable instructions, when executed by a processor,
(I) Each data value is a plurality of data values that are ratios determined from a biological sample obtained from a subject of the first population, wherein the ratio is a truncated SCN5A exon 28 transcript of the biological sample obtained from the subject. The level of product can be determined by: (A) the level of the full length SCN5A exon 28 transcript of the biological sample or (B) the level of the total SCN5A exon 28 transcript of the biological sample or (C) the full length SCN5A exon 28 transcript of the biological sample. Compared to the level and level of one or more truncated SCN5A exon 28 transcripts, each subject of the first population has a plurality of data values that are subjects known to have an ICD that has shocked. Let me receive it,
(Ii) fitting a plurality of data values to a first Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the first Gaussian distribution;
(Iv) The first threshold ratio _RT is set to μ−Xσ (where X is a number between 0.7 and 4.0).

In exemplary embodiments, R _T = μ−Xσ, where X is a number between 0.7 and 1.0, a number between 2.0 and 4.0, or 2.326 to 4.0. It is a number between. In an exemplary aspect, the system includes machine-readable instructions that, when executed by a processor, cause the processor to receive R _S as an input and compare R _S to R _T. In an exemplary aspect, machine-readable instructions, when executed by a processor, cause the processor to present an output that indicates the relationship between R _S and R _T.

In an alternative or additional aspect, the system of the present invention, when executed by a processor,
(I) each data value of the second plurality of data values is a second plurality of data values that is a ratio determined from a biological sample obtained from a target of the second population, wherein the ratio is from the target The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C). Each subject in the second population has an ICD that has never shocked, as compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in a biological sample Receive a second plurality of data values that are known subjects,
(Ii) fitting the second plurality of data values to a second Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the second Gaussian distribution;
(Iv) The second threshold ratio R _T2 is set to μ + Xσ (where X is a number between 0.7 and 4.0).
Contains machine-readable instructions.

In an exemplary embodiment, R _T2 = μ + Xσ, and X is a number between 0.7 and 1.0, or a number between 2.0 and 4.0, or between 2.326 and 4.0. Is a number.

In an alternative or additional aspect, the system of the present invention, when executed by a processor,
(I) each of the third plurality of data values is a third plurality of data values that is a ratio determined from a biological sample obtained from a second population of objects, wherein the ratio is from the object The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C). Each subject of the third population has (I) ICD, compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in the biological sample; II) not known to have heart disease, (III) have normal left ventricular function, (IV) have no diastolic dysfunction, or (V) have known combinations thereof Thereby receive a third plurality of data values are,
(Ii) fitting a third plurality of data values to a third Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the third Gaussian distribution;
(Iv) The third threshold ratio R _T3 is set to μ + 4.0σ.
Contains machine-readable instructions.

With respect to any of these systems, in some aspects, when executed by a processor, the system maximizes the area under the curve of the first Gaussian distribution and causes the processor to maximize the area under the curve of the second Gaussian distribution. Includes a machine readable instruction that causes a _combined threshold ratio _{RT combination} to be set in that

A computer readable storage medium storing machine readable instructions executable by a processor is also provided herein. In an exemplary embodiment, the instructions are
(I) instructions for causing a processor to receive a plurality of data values, wherein each data value is a ratio determined from a biological sample obtained from a first population of objects, and the ratio is obtained from the object The level of truncated SCN5A exon 28 transcript in the biological sample is determined by (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C) the biological sample. Each subject of the first population is known to have an ICD that has shocked as compared to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts The instruction that is the subject of
(Ii) instructions for causing the processor to fit a plurality of data values to a first Gaussian distribution;
(Ii) instructions for causing the processor to determine the mean value μ and the standard deviation σ of the first Gaussian distribution;
(Iii) an instruction for causing the processor to set the first threshold ratio R _T to μ−Xσ (where X is a number between 0.7 and 4.0);
including.

In an exemplary embodiment, R _T = μ−Xσ, and X is a number between 0.7 and 1.0, or between 2.0 and 4.0, or between 2.326 and 4.0. is there. In an exemplary aspect, a computer-readable storage medium includes instructions for causing a processor to receive R _s as an input and to compare R _s with R _T. In an exemplary aspect, a computer readable storage medium includes instructions for causing a processor to present an output indicating a relationship between R _s and R _T.

In alternative or additional embodiments, the computer-readable storage medium of the present invention resides in a processor,
(I) each data value of the second plurality of data values is a second plurality of data values that is a ratio determined from a biological sample obtained from a target of the second population, wherein the ratio is from the target The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C). Each subject in the second population has an ICD that has never shocked, as compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in a biological sample Accepts multiple data values that are known subjects,
(Ii) fitting the second plurality of data values to a second Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the second Gaussian distribution;
(Iv) The second threshold ratio R _T2 is set to μ + Xσ (where X is a number between 0.7 and 4.0).
Including instructions for.

In an exemplary embodiment, R _T = μ−Xσ, and X is a number between 0.7 and 1.0, or between 2.0 and 4.0, or between 2.326 and 4.0. is there.

In alternative or additional embodiments, the computer-readable storage medium is on a processor,
(I) each of the third plurality of data values is a third plurality of data values that is a ratio determined from a biological sample obtained from a second population of objects, wherein the ratio is from the object The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C). Each subject of the third population has (I) ICD, compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in the biological sample; II) not known to have heart disease, (III) have normal left ventricular function, (IV) have no diastolic dysfunction, or (V) have known combinations thereof Thereby receive a plurality of data values are,
(Ii) fitting a third plurality of data values to a third Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the third Gaussian distribution;
(Iv) The third threshold ratio R _T3 is set to μ + 4.0σ.
Including instructions for.

The computer readable storage medium, in an exemplary embodiment, causes the processor to combine threshold ratio R at a point where the area under the curve of the first Gaussian distribution is maximized and the area under the curve of the second Gaussian distribution is minimized. Instructions for setting the _{T combination} are included.

Further provided herein is a method implemented by a processor in a computer. In an exemplary embodiment, the method comprises
(I) a step of receiving a plurality of data values, wherein each data value is a ratio determined from a biological sample obtained from a subject of the first population, and the ratio is a cutting type of the biological sample obtained from the subject The level of SCN5A exon 28 transcript is expressed as (A) the level of full length SCN5A exon 28 transcript of the biological sample or (B) the level of total SCN5A exon 28 transcript of the biological sample or (C) the full length SCN5A exon of the biological sample. Each subject of the first population is a subject known to have an ICD that has shocked, as compared to the level of 28 transcripts and the level of one or more truncated SCN5A exon 28 transcripts, Steps,
(Ii) fitting a plurality of data values to a first Gaussian distribution;
(Ii) determining a mean value μ and a standard deviation σ of the first Gaussian distribution;
(Iii) setting the first threshold ratio _RT to μ-Xσ (where X is a number between 0.7 and 4.0);
Includes steps.

In an exemplary embodiment, R _T = μ−Xσ, and X is a number between 0.7 and 1.0, or between 2.0 and 4.0, or between 2.326 and 4.0. is there. In an exemplary aspect, the method includes receiving R _s as an input and comparing R _s to R _T. In an exemplary aspect, the method includes presenting an output that indicates a relationship between R _s and R _T.

In an alternative or exemplary embodiment, the method comprises
(I) each data value of the second plurality of data values is a second plurality of data values that is a ratio determined from a biological sample obtained from a target of the second population, wherein the ratio is from the target The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C). Each subject in the second population has an ICD that has never shocked, as compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in a biological sample Receiving a second plurality of data values for which is a known object;
(Ii) fitting the second plurality of data values to a second Gaussian distribution;
(Iii) determining a mean value μ and a standard deviation σ of a second Gaussian distribution;
(Iv) setting the second threshold ratio R _T2 to μ + Xσ (where X is a number between 0.7 and 4.0);
Includes steps.

In an exemplary embodiment, R _T = μ−Xσ, and X is a number between 0.7 and 1.0, or between 2.0 and 4.0, or between 2.326 and 4.0. is there.

In an alternative or exemplary embodiment, the method comprises
(I) each of the third plurality of data values is a third plurality of data values that is a ratio determined from a biological sample obtained from a second population of objects, wherein the ratio is from the object The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C). Each subject of the third population has (I) ICD, compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in the biological sample; II) not known to have heart disease, (III) have normal left ventricular function, (IV) have no diastolic dysfunction, or (V) have known combinations thereof Receiving a third plurality of data values are,
(Ii) fitting a third plurality of data values to a third Gaussian distribution;
(Iii) determining a mean value μ and a standard deviation σ of a third Gaussian distribution;
(Iv) setting the third threshold ratio R _T3 to μ + 4.0σ;
Includes steps.

In an exemplary aspect, the method sets a _combined threshold ratio R _{T combination in} that the area under the curve of the first Gaussian distribution is maximized and the area under the curve of the second Gaussian distribution is minimized. Includes steps.

  In alternative embodiments of the systems, media and methods described in this section, the present invention provides a system, media, and system wherein each subject of the first population is a subject known to have heart failure or arrhythmia. A method is further provided. In an exemplary aspect, the system, medium or method further includes instructions related to receiving a third plurality of data values, wherein each data value of the third plurality of data values is from a third group of subjects. A ratio determined from the resulting biological sample, wherein each subject of the third population has (I) no ICD, (II) no heart disease, eg, heart failure or arrhythmia, (III) normal A subject known to have left ventricular function, (IV) no diastolic dysfunction, or (V) a combination thereof.

Kits, eg, diagnostic kits that can be used in the diagnosis or determination of risk are provided herein in light of the methods described herein. In an exemplary embodiment, the kit includes (a) an E28C binding agent and / or E28D binding agent, (b) a WT SCN5A binding agent and / or an E28A-S binding agent and instructions for use. In an exemplary embodiment, the kit further comprises a binding agent for all SCN5A exon 28 transcripts: WT, E28A-S, E28B, E28C and E28D.

In additional or alternative embodiments, the kit comprises (I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a first population of subjects, wherein the ratio is The level of truncated SCN5A exon 28 transcript is determined by: (i) the level of full length SCN5A exon 28 transcript in the biological sample or (ii) the level of total SCN5A exon 28 transcript in the biological sample or (iii) the full length of the biological sample. In subjects known to have each subject in the first population have an ICD that has shocked as compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts A plurality of data values, (II) a Gaussian distribution of the plurality of data values, (IV) a mean value and standard deviation of the Gaussian distribution or (V) The mean value of the Gaussian distribution of the number of data values and includes a computer readable storage medium storing a threshold ratio R _T based on the standard deviation. In an exemplary embodiment, the kit includes access to a computer readable storage medium. In an exemplary embodiment, the kit includes access to any one or more of (I)-(V).

In additional or alternative embodiments, the kit comprises: (I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a first population of subjects, wherein the ratio is The level of truncated SCN5A exon 28 transcript is determined by: (i) the level of full length SCN5A exon 28 transcript in the biological sample or (ii) the level of total SCN5A exon 28 transcript in the biological sample or (iii) the full length of the biological sample. In subjects where each subject of the first population is known to have an ICD that has never shocked, as compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts A plurality of data values, (II) a Gaussian distribution of the plurality of data values, (IV) a mean value and standard deviation of the Gaussian distribution or (V) The mean value of the Gaussian distribution of the number of data values and includes a computer readable storage medium storing a threshold ratio R _T based on the standard deviation. In an exemplary embodiment, the kit includes access to a computer readable storage medium. In an exemplary embodiment, the kit includes access to any one or more of (I)-(V).

In additional or alternative embodiments, the kit comprises: (I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a first population of subjects, wherein the ratio is The level of truncated SCN5A exon 28 transcript is determined by: (i) the level of full length SCN5A exon 28 transcript in the biological sample or (ii) the level of total SCN5A exon 28 transcript in the biological sample or (iii) the full length of the biological sample. Compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts, each subject of the first population has (I) no ICD, (II) in heart disease No known (III) with normal left ventricular function, (IV) no diastolic dysfunction, or (V) a combination of these (II) Gaussian distribution of multiple data values, (IV) Average value and standard deviation of Gaussian distribution, or (V) Threshold ratio based on average value and standard deviation of Gaussian distribution of multiple data values A computer-readable storage medium storing _RT is included. In an exemplary embodiment, the kit includes access to any one or more of (I)-(V).

In additional or alternative embodiments, the kit comprises (I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a first population of subjects, wherein the ratio is The level of truncated SCN5A exon 28 transcript is determined by: (i) the level of full length SCN5A exon 28 transcript in the biological sample or (ii) the level of total SCN5A exon 28 transcript in the biological sample or (iii) the full length of the biological sample. A plurality of data wherein each subject of the first population is a subject known to be at heart risk or at risk thereof compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts Value, (II) Gaussian distribution of multiple data values, (IV) mean and standard deviation of Gaussian distribution or (V) multiple data The mean value of the Gaussian distribution and including a computer readable storage medium storing a threshold ratio R _T based on the standard deviation. In an exemplary embodiment, the kit includes access to a computer readable storage medium. In an exemplary embodiment, the kit includes access to any one or more of (I)-(V).

In additional or alternative embodiments, the kit comprises (I) a plurality of data values, each data value being a ratio determined from a biological sample obtained from a first population of subjects, wherein the ratio is The level of truncated SCN5A exon 28 transcript is determined by: (i) the level of full length SCN5A exon 28 transcript in the biological sample or (ii) the level of total SCN5A exon 28 transcript in the biological sample or (iii) the full length of the biological sample. A plurality of data wherein each subject of the first population is a subject known to be at or at risk of arrhythmia as compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts Value, (II) Gaussian distribution of multiple data values, (IV) mean and standard deviation of Gaussian distribution or (V) multiple data The mean value of the Gaussian distribution and including a computer readable storage medium storing a threshold ratio R _T based on the standard deviation. In an exemplary embodiment, the kit includes access to a computer readable storage medium. In an exemplary embodiment, the kit includes access to any one or more of (I)-(V).

  In an exemplary embodiment, the kit comprises an hLuc7a binding agent, an RBM25 binding agent, a PERK binding agent and / or a chaperone protein binding agent, eg, a CHOP binding agent, a calnexin binding agent.

  As used herein, the term “binder” refers to any compound that specifically binds to a marker of interest (hLuc7A, RBM25, PERK, CHOP, calnexin, etc.).

  With respect to the foregoing, the binding agent in some embodiments is an antibody, antigen-binding fragment, aptamer, protein or peptide substrate, or nucleic acid probe. Such binders are known in the art. In some embodiments, the kit includes a collection of binding agents, eg, a collection of antibodies, each binding agent that specifically binds to a gene or nucleic acid encoding a marker. In some embodiments, the collection of nucleic acid probes is formatted into an array on a solid support, eg, a gene chip. In some embodiments, the kit includes a collection of antibodies that specifically bind to the marker. In some embodiments, the kit comprises a multi-well microtiter plate, wherein each well contains an antibody having a specificity specific for the antibody in the other well. In some embodiments, the kit includes a collection of substrates that specifically react with the marker. In some embodiments, the kit comprises a multi-well microtiter plate, wherein each well contains a substrate that has a unique specificity for the substrate of the other well.

  In some embodiments, the kit further comprises instructions for use. In some embodiments, the instructions are provided as paper copy instructions, electronic copy instructions, eg, a compact disc, flash drive, or other electronic media. In some embodiments, instructions are provided to provide guidance to Internet sites where users can access the instructions.

  In some embodiments, the kit further comprises a unit for collecting a biological sample of interest, eg, any of the samples described herein. In some embodiments, the unit for collecting samples is a vial, beaker, tube, microtiter plate, petri dish or the like.

  The following examples are included solely to illustrate the present invention or to provide background information related to the present invention. The following examples are in no way intended to limit the scope of the invention.

Example 1
This example demonstrates the detection of N-terminal and C-terminal mRNA splicing variants of human SCN5A, as shown in US Patent Application Publication No. 2007/0212723.

  The first human SCN5A cDNA (reported by Sheng et al. (DNA and Cell Biology 13: 9-23 (1994)); see also Zhang et al., Gene Expression 8: 85-103 (1999)) ( Accession No. M77235) is 8.5-9.0 kb with a 5 ′ end extending 150 bp upstream of the ATG codon and having a 3293 UTR of 2293 bp, which consists of a polyadenylation signal sequence and a polyA region. None of these were contained. The mouse scn5a gene has complex 5 ′ and 3 ′ UTRs, and 5 ′ and 3 ′ UTR splice variants are developmentally regulated (Shang, LL & Dudley, SC, Jr, J. Biol. Chem. 280: 933-940 (2005)). Therefore, Applicants sought to evaluate whether the previously reported human UTR sequences represent the full range of cDNA isoforms. The RACE procedure was used for analysis of the 5 'and 3' mRNA ends upstream of the start codon and downstream of the stop codon, respectively. PCR amplification of the cDNA resulted in several distinct bands in gel electrophoresis. Subsequent nested PCR amplification resulted in three bands (380 bp, 200 bp and 100 bp) in both fetal heart RNA and adult heart RNA (FIG. 5). The sequence of these bands indicated that all three bands were SCN5A gene specific. A comparison between the 5'RACE-PCR product and the genomic sequence shows that, from the reported data, there are two different exon 1 isoforms, one of which is 160 bp, 16.0 kb upstream of exon 2 It was shown that it is positioned. The new isoform was 85 bp, which was 12.3 kb away from exon 2. Another new splicing exon 1 is found in exon 2, which means that there is no exon 1 splice. RNA was transcribed directly from exon 2, but TSS was 13 bp shorter compared to normal exon 2. From the RACE procedure, Applicants were unable to obtain the exon 1 isoform reported previously (Shang, LJ & Dudley, SC, Biophysical Journal 86, 424A (2004)). A total of 3 exon 1 splice variants were suggested. Multiple TSSs were present in all splicing isoforms. Applicants named these untranslated cDNA fragments exon 1A (160 bp), exon 1B (85 bp) and exon 2B (313 bp), respectively. Exon 1A, identified by primer extension and RNase protection, has been previously reported in humans and rats in lengths ranging from 97 to 176 bp (Yang et al., Cardiovascular Research 61: 56-65 (2004)). All isoforms of SCN5A 5'UTR are summarized in FIGS. 1 and 3 and sequences are depicted in FIGS. 2 and 4.

  Analysis of the 3'UTR showed evidence of splice variants in fetal and adult hearts. By RACE-PCR using GSP3 'and oligo dT primers, Applicants identified six alternative 3'UTRs (Figure 6). Comparison of the genomic and cDNA sequences showed that the 3'UTR has 6 different poly A splicing variants. One of them has a long 2295 bp after the stop codon and was not found in Genebank, but is consistent with the published mouse scn5a cDNA (Accession No. AJ271477). In addition, there was a second short variant of 824 bp corresponding to human scn5a cDNA 5'UTR (Accession No. M77235). These two isoforms have exon 28 with the same splice called E28A. In the 3'UTR, three exon 28 splice variants, E28B (27 bp), E28C (39 bp) and E28D (114 bp) were detected. The sequences of E28B, E28C, and E28D are designated as Genbank accession numbers EF092922, EF092923, and EF092294, respectively, and are herein designated as SEQ ID NOs: 636 to 638, respectively. E28B is fetal specific, E28D is adult specific, while E28C was expressed in both fetus and human heart. Compared to the full-length E28A variant, all three variants were shorter, resulting in an immature cleaved Na + channel protein lacking a segment from domain IV, S3 or S4 at the C-terminus (George et al., Cytogenet Cell Genet 68: 67-70 (1995)). An overview of 3′UTR findings is shown in FIG. The sequence of all isoforms of SCN5A 3'UTR was preformatted in FIG.

  The method used in this example is as follows.

  Human heart tissue from fetuses and adults was homogenized and total RNA was isolated using the RNeasy Mini kit according to manufacturer's instructions (Qiagen, Valencia, CA). The 5 'and 3' ends of human SCN5A mRNA were characterized by the GeneRacer kit (Invitrogen, Carlsbad, CA) using the RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE). That is: mu. g total RNA was treated with calf intestinal phosphatase to remove truncated mRNA and non-mRNA form of 5 'phosphate in total RNA. The 5 'cap structure was removed from the intact full-length mRNA using tobacco acid pyrophosphatase, and GeneRacer RNA Oligo was added to the 5' end of the mRNA using T4 RNA ligase. SuperScript II reverse transcriptase using reverse gene specific primer GSP5 ′ (5′CATCTTCCGGTTCAGTGCCACCCA3 ′ (SEQ ID NO: 640)) and GeneRacer oligo dT primer complementary to exon 3 of the human SCN5A gene at the 5 ′ and 3 ′ ends, respectively. First strand cDNA was synthesized by To amplify the 5 'end fragment10. mu. 10. Using M GSP5 'and GeneRacer 5' primers and complementary to exon 27 of human SCN5A to obtain the 3 'end. mu. 5 'and 3' end PCR reactions were performed with Platinum Pfx DNA polymerase using M forward GSP3 '(5'GCTGCCCTGCGCCCACTACTACTTC3' (SEQ ID NO: 641)) and GeneRacer oligo dT primer. Additional PCR reactions with nested primers were performed. The nested PCR product was cloned into the pCRII-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced to confirm that the RACE-PCR product was derived from human SCN5A cDNA.

  Primary DNA sequence analysis was performed with Vector NTI 7 software (Informax, Frederick, MD). The sequence was aligned with human genomic DNA and cDNA sequences in the Genebank database to identify the transcription start site (TSS) and 3 'polyadenylylation sites.

(Example 2)
As shown in one or more of Shang et al., Circulation Research 101: 1146-1154 (2007) and US Patent Application Publication No. 2007/0212723, this example shows that human heart failure is a cardiac sodium channel Data suggesting association with aberrant C-terminal splicing variants in

Detection of three novel human SCN5A C-terminal mRNA splicing variants Two SCN5A mRNA variants with different polyA tail lengths that do not alter the coding sequence have been previously reported from the mouse heart (Gellens et al., 1992). Proc. Natl. Acad. Sci. USA 89: 554-558; and Shang, LL, and Dudley, SC, Jr., 2005, J. Biol. Chem. 280: 933-940). Using RACE-PCR, Applicants found a similar sodium channel mRNA isoform in the human heart (FIG. 6). In addition to these bands, nested _RT- PCR revealed shorter bands in both fetal and adult human hearts. Sequence analysis of the bands revealed three new mRNA splice variants, as described above, which were exons E28B (27 bp), E28C (39 bp) and E28D (114 bp) (Genbank accession numbers EF092922, EF092934 and EF092294, respectively) and Named. Alternative splicing to produce these novel exons is summarized in FIG. Compared to the full-length E28A isoform, all three new isoforms are predicted to yield shorter, immature cleaved sodium channel proteins that lack a segment from domain IV, S3, or S4 at the C-terminus. It was.

The relative abundance of SCN5A isoforms is developmentally controlled. The Na _v 1.5 splice variant at the C-terminus is known to vary in development. Thus, Applicants investigated whether Applicants' new 3 ′ isoforms behaved similarly. Quantitative real-time _RT- PCR shows that the relative abundance of each isoform is 41.6% (p <0.001), 5.1-fold for the E28A, E27B, E28C and E28D, respectively, from fetus to adult heart (P <0.01), 1.1-fold (p <0.01) and 4.8-fold (p <0.001) increase (FIG. 9A). FIG. 9B shows that as a percentage of total transcript, E28A was most abundant in both fetal and adult hearts. E28B was the least in the fetal heart but most increased with development and 1.7. + −. Changed 0.2 times. As a percentage of total mRNA, the alternative splice variants E28B and E28D increased significantly, full-length E28A decreased, and E28C abundance remained unchanged in development.

Heart failure increased 2 of the sodium channel C-terminal splice variants 12 patients (Table 1) whose heart was removed in a heart transplant for HF, and 3 known to have no heart disease The presence of splice variants was compared between ventricles obtained from control patients.

Real-time _RT- PCR results showed that the relative mRNA abundance of the E28A full-length isoform was reduced by 24.7% in HF patients compared with controls (p <0.001). However, two of the truncated isoforms were increased in HF patients compared to controls (FIG. 10A). E28C and E28D mRNA abundances were increased 14.2 times (p <0.001) and 3.8 times (p <0.001), respectively, compared to controls with HF patients (FIG. 10A). On the other hand, the smallest isoform, E28B, decreased by 73.8% (p <0.01) in HF patients. As a percentage of total transcript abundance, E28A and B ranged from 87.5% (. +-. 5.1) and 2.4% (. +-. 0.4) in controls to 45. There was a significant decrease to 1% (. +-. 4.5) and 0.5% (. +-. 0.2). E28C and D variants range from 3.9% (. +-. 0.6) and 6.2% (. +-. 4.6) in controls to 34.3% (. +-. 0.3) in HF patients. .1) and 20.2% (. + − 3.3) (FIG. 10A). The total percentage of short isoform variants went from 12.5% (. +-. 5.1) of total SCN5A mRNA in control subjects to 54.9% (. +-. 4.5) in HF patients. .

  Because channel expression heterogeneity is thought to contribute to arrhythmic risk, relative RNA abundance of SCN5A isoforms in the left ventricle (LV, FIG. 10B) and right ventricle (RV, FIG. 10C) in control and HF patients Compared. When normalized to total SCN5A mRNA, E28A abundance was reduced in both LV and RV. The pattern of changes in the cleaving variant was increased in E28C and E28D and was similar in both ventricles. The percentage of truncated mRNA was higher in LV compared to RV (p = 0.0003).

Cleaved isoforms reduce sodium channel function. The three novel SCN5A splice variants identified were predicted to yield immature cleaved non-functional sodium channels. Applicants examined this idea by creating a gene-targeted mouse model with a nonsense mutation in exon 28 (1652stop, FIG. 7). Appropriate homologous recombination in embryonic stem cells was confirmed by sequencing, restriction site analysis and Southern blotting (see supplementary material). Embryonic stem (ES) cells were successfully injected into blastocysts to create chimeric animals. However, when trying to breed these animals, the mutation was embryonic lethal. However, undifferentiated mouse ES cells in which SCN5A ^1652stop is heterozygous had normal growth characteristics and could differentiate into spontaneously beating cardiomyocytes (CM).

In order to assess the electrophysiological effects of the presence of cleavage, ES cells with heterozygous mutations were differentiated into CM in vitro and electrophysiologically tested. The currents and action potentials (AP) of each CM isolated enzymatically on day 19 were compared. The sodium channel current-voltage relationship for contracting CM isolated from wild type and embryonic bodies from individual ES cell lines is shown in FIG. 5A. Compared to WT CM (76.4. +-. 9.5 pA / pF to 10.6. +-. 0.9 pA / pF; FIG. 5B), peak I _Na is 86 in differentiated CM containing cleavage. Reduced by 1% (. +-. 5.2, n = 8, p = 0.0002). The action potential of spontaneously beating CM recorded in current clamp mode is 2.9. + −. From 0.4 beats (bps) to 1.3 bps. + −. A significant slowing of the pulsation frequency was shown to 0.1 (p = 0.02, n = 11). The action potential is 4.1. + −. 0.3 mV / ms to 1.4. + −. Significant decrease in the maximum rate of AP increase to 0.1 mV / ms (p <0.01, n = 11) and 76. compared to wild type (WT). + −. 1.4 mV to 52. + −. Also shown was an amplitude drop to 0.6 mV (p. Ltoreq. 0.01, n = 11) (FIGS. 12C and D). These changes are consistent with reduced sodium channel function.

  The syncytium properties of CM containing truncation mutations were tested by dissecting a portion of the CM from the embryoid body and placing it on top of a planar multi-electrode array (MEA) (Caspi and Gepstein, 2004, Potential applications Ann. NY Acad. Sci., 1015: 285-298; and Kehat et al., 2002, High-resolution electrophysiological assessment of human embryonic stem cell-derived cardiomyocytes: a novel in vitro model for the study of conduction., Circ. Res. 91: 659-661). The characteristics of the bipolar extracellular electrograms of WT and mutant ES cells were compared. It is known that the time of initial decay of bipolar field potential (FP), minimum FP amplitude and conduction velocity reflect sodium channel activity. Consistent with the physiologically significant reduction in sodium current resulting from truncated mRNA, the MEA record of CM with a truncation mutation is −1126. + −. 314. mu. From V (n = 6), -332. + −. 174. mu. The minimum FP decreased by 70.5% (p <0.05) to V (n = 7) (FIGS. 13A and B). Increased FP is observed in 22. WT and mutant respectively. + −. 4 ms (n = 6) to 32. + −. It slowed 45.5% (p <0.05) to 2 ms (n = 7) (FIGS. 13A and C). The conduction velocity is 5.3. + −. From 1.2 cm / s (n = 6), 1.9. + −. It decreased by 64.2% (p = 0.03) to 0.4 cm / s (n = 7) (FIG. 13D).

  The method used in this example is as follows.

Detection of human SCN5A 3′UTR isoforms by RACE-PCR Human total RNA from normal fetal and adult whole hearts was purchased from Clontech (Mountain View, CA). The 3 ′ end of human SCN5A mRNA was characterized with the GeneRacer kit (Invitrogen, Carlsbad, Calif.) using the RNA ligase-mediated rapid amplification (RLM-RACE) of the cDNA end. That is, 1 μg of total RNA was used to synthesize first strand cDNA with SuperScript II reverse transcriptase using GeneRacer oligo dT primer at the 3 ′ end. 9. Complementary to exon 26 of human SCN5A gene mu. A 3 ′ end PCR reaction with Platinum Pfx DNA polymerase using M forward gene specific primer (GSP) HE26F (5′CATCCCCGGGCCCCTGAACAAGTA3 ′ (SEQ ID NO: 642)) and GeneRacer 3 ′ primer to amplify the 3 ′ end fragment. went. An additional PCR reaction with a nested GSP primer HE27F (5′CTGCGCCACTACTACTTACCACACA3 ′ (SEQ ID NO: 643)) corresponding to exon 27 of the human SCN5A gene and a nested GeneRacer 3 ′ primer was performed. Nested PCR products were cloned into pCR4-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced. The resulting sequence was compared to that of SCN5A using Vector NTI 7 software (Invitrogen).

Isolation and culture of lymphoblasts From peripheral blood mononuclear cells of volunteers with normal cardiac function referred to the cardiac catheterization laboratory of the Atlanta Veterans Administration Medical Center (AVAMC) A human lymphoblast cell line was generated. Procedures and consent forms were approved by the Emory Institutional Review Board and the AVAMC Research & Development Committee. In order to elicit an immortalized lymphoblast cell line, peripheral blood was fractionated by Ficoll Hipack centrifugation, and mononuclear cells were infected with Epstein-Barr virus (EBV) B95-8. After EBV transformation, 10% heat-inactivated fetal calf serum, 2 mM L-glutamine, in RPMI-1640 medium supplemented with 100 U / mL penicillin and 100 mg / mL streptomycin, Celsius 37 degrees, 5% CO _2, the high-humidity Lymphoblasts were cultured in an atmosphere. The medium was changed twice a week. Cell number and viability were assessed by trypan blue staining and fluorescence microscopy. Approximately 5.0 × 10 ⁷ lymphoblasts were collected by centrifugation and RNA was isolated using TRIzol reagent (Invitrogen) as described in the manufacturer's manual.

Real-time SYBR Green PCR quantification of SCN5A transcript isoforms Heart removed during heart transplantation at Emory University Hospital under protocol approved by Emory Institutional Review Board Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Normal adult ventricular and skeletal muscle total RNA was purchased from Ambion (Austin, TX) and Clontech, respectively. To determine the abundance of different cardiac mRNAs carrying variant exon 28 (E28) isoforms, both normal and patient left and right ventricular total RNA was converted to iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Was used for the synthesis of cDNA by reverse transcription according to the manufacturer's instructions. The first strand cDNA was used as a template for subsequent PCR. Each PCR reaction solution is 25. mu. In a total reaction volume of L, 12.5. mu. L QuantiTect SYBR Green PCR kit master mix (Qiagen, Valencia, CA) and 200 nM primer pairs. The reverse primers for exon 28 variants were HSCN5AE28A / R (5′GGAAGAGCGTCCGGGGAGAAGAAGTA3 ′ (SEQ ID NO: 21), E28A and 28D), HSCN5AE28B / R (5′ATGCACCATGAGAAGATCTCCTGC3 ′ (SEQ ID NO: 644E) 'TCTTGGCACTTGATGTTCGTCCCTTC3' (SEQ ID NO: 645), E28C) and HSCN5AE28D / R (5'TCATGAGGGCAAAGAGCAGCGT3 '(SEQ ID NO: 646), E28A only). The forward primer, HE27F, was unchanged in each case. The reaction yielded 124 bp, 170 bp and 143 bp and 211 bp PCR products, respectively. Amplification with primers HE27F and HSCN5AE28D / R produced a full-length isoform, E28A. Amplification with HE27F and HSCN5AE28A / R produced a product composed of isoforms E28A and E28D. The amount of E28D was calculated by subtracting the products of these two reactions. All amplifications were performed in triplicate and consisted of 40 cycles of 30 seconds 94 ° C., 30 seconds 65 ° C. and 1 minute 72 ° C. in a BioRed thermocycler iCycler (Hercules, Calif.). PCR products were analyzed by electrophoresis on a 1.5% agarose gel. When performing a quantitative comparison, beta-actin was used as an internal reference.

Preparation of a truncated Scn5a mouse model By PCR amplification using the primer RHI28F / R (11) corresponding to the known mouse SCN5A exon 28 sequence (40), a 4.0 kb fragment of 129Sv / J mouse genomic DNA was mouse ES cell genome Cloned from the library. A single PCR positive clone was used to subclone the 4.0 kb HindIII genomic fragment into the scn5a cleavage targeting vector pBSK. SCN5A ^1652stop was constructed. A PGK-neomycin cassette, floxed between two loxPs, was inserted into the AatII site (FIG. S2). Adenosine (A) was deleted at this codon. This deletion results in a _{frameshift of} the 1652 codon that previously encoded methionine to a stop codon (TGA; NCBI ACCESSION NP-- ₉₃₂₁₇₃ ; FIG. 7), which causes immature sodium channel cleavage. It was foreseen. The 5 ′ and 3 ′ arms of the targeting vector separated by the neomycin resistance cassette were 1,767 and 2,214 bp, respectively, maintaining a 942 bp homologous fragment on the 5 ′ side of the mutation (FIG. S2). ). 20. mu. After electroporating g KpnI linearized targeting constructs into mouse embryonic stem cells (R1), the targeted clones were screened and primers P1 / neoR at the 5 ′ and 3 ′ ends (P1: 5′GCTGCCCTGCGCCCACTATTACTTC3 '(SEQ ID NO: 647)); -Primers P3 / P4 (P3: 5'CAGAG) using the cassette (FIGS. 21B and 22A) and before and after the mutation site CCATGTATAGTTGATTTC3 '(SEQ ID NO: 651); P4: 5'GCTGTTGGCAAAGGTCTG3' (SEQ ID NO: 652)) (identified by PCR using 21, and 22E). PCR results were confirmed using Southern blotting of 5 ′ and 3 ′ ends with external probes A and B (FIGS. 21, 22B and 22C). The neomycin cassette flanked by two loxPs was excised by expressing the transfected Cre recombinase in a correctly targeted clone, confirmed by PCR with neoorF / R (FIG. 21D). Heterozygosity was confirmed by P3-P4 PCR product with or without BspHI digestion (FIG. 21E). Experimental studies were performed in ES cell lines that successfully targeted one allele of the sodium channel.

In vitro differentiation of ES cells into cardiomyocytes R1 mouse ES cells with or without mutations were used with high glucose Dulbecco's modified Eagle's medium (DMEM, GibcoBRL, Life Technologies Inc., Rockville, Md.) Containing supplements. Maintain in an undifferentiated state and as previously described (Zhang, YM, Shang, L., Hartzell, C., Narlow, M., Cribbs, L., and Dudley, SC, Jr., 2003, Characterization and regulation of T-type Ca ²⁺ channels in embryonic stem cell-derived cardiomyocytes., Am. J. Physiol Heart Circ. Physiol 285: H2770-H2779). For the patch clamp experiment, the part of the pulsating CM from the 19-day-old embryoid body was mechanically dissected, and one CM was obtained by enzymatic digestion of the dissected part (Shang et al., 2006, Analysis of arrhythmic potential of embryonic stem cell-derived cardiomyocytes, Methods Mol. Biol. 330: 221-231). For the MEA experiment, the portion of the CM that beats from the 17-day-old embryoid body was mechanically dissected, placed on top of the MEA, and cultured for an additional 2 days before recording.

Recording of sodium current of ES-derived cardiomyocytes Patch clamp experiments were performed 1-5 days after cell isolation. In the test, cardiomyocytes with uniform contraction and beat rate were used. A patch pipette was pulled to a resistance of 2-5M omega. A solution comprising NaCl (140), KCl (5.4), CaCl ₂ (1.8), MgCl ₂ (1), HEPES (10) and glucose (10) (unit: mM) (pH 7.4 with NaOH). The current fixation experiment was conducted. The intracellular solution contained KCl (120), MgCl ₂ (1), MGATP (3), HEPES (10) and EGTA (10) (unit: mM) (pH 7.2 with KOH). For voltage fixation experiments, a glass pipette was charged with a solution of CsCl (60), Cesium aspartate (80), EGTA (11), HEPES (10) and Na ₂ ATP (5) (unit: mM). PH 7.2) was charged with CsOH. Bath (bath bath) solution, NaCl (30), N- methyl -D- glucamine _{(NMDG) Cl (100),} CsCl (5), CaCl 2 (2), MgCl 2 (1.2), HEPES (10) And glucose (5) (unit: mM) (pH 7.4 with HCl). Patch clamp data was collected with an Axopatch 200B amplifier and pCLAMP software (Axon Instruments). Data was digitized at 10 kHz and filtered at 1 kHz for analysis. The experiment was performed at 37 ° C.

Functional assessment of truncated variants by multi-electrode array recording Extracellular recording of ES cell-derived WT and truncated syncytium CM was performed using the MEA data acquisition system (Multi Channel System, Reutlingen, Germany). The MEA consists of a matrix of 60 titanium nitride-coated gold electrodes (30 μm diameter) in an 8 × 8 layout grid with an interelectrode distance of 200 μm. An MEA was inserted in the amplifier system. Simultaneous recording of bipolar extracellular FP of all electrodes was performed at 37 ° C. at a sampling frequency of 10 kHz. One electrode at the boundary of the array was grounded and used as a reference electrode. MATLAB (Mathworks, Natick, Mass.) As previously described by Jiao et al. (2006, A possible mechanism of halocarbon-induced cardiac sensitization arrhythmias., J. Mol. Cell Cardiol. 41: 698-705). The data was analyzed offline with a customized toolbox programmed for. To measure conduction velocity (CV), Applicants calculated the activation time at each point using a threshold-crossing algorithm to form an isochron map. A range of three non-colinear points with uniform parallel isochrons was chosen to calculate the CV in two orthogonal directions (eg, vx and vy). The final CV was calculated as v = ((1 / vx) ² + (1 / vy) ² ) ^−1/2 .

Statistical evaluation All data are averages. + −. S. E. Shown as M. Statistical analysis of mean values was performed using independent t-test with post-hoc correction for multiple comparisons or one-way ANOVA. A p value <0.05 was considered statistically significant.

  Finally, although control subjects were younger than HF patients, Applicants were unable to find evidence of changes in splice variants with age (FIG. 20).

  In conclusion, Applicants demonstrate that there are several alternative truncated forms of SCN5A mRNA in the human heart. During HF, these alternative spliced mRNA isoforms are likely to reduce sodium current to a level that can contribute to arrhythmic risk, either alone or in combination with other triggers.

(Example 3)
This example is shown in US Patent Application Publication No. 2007/0212723 and Shang et al., Am J Physiol Cell Physiol 294: C372-C379, one or more of the cardiac SCN5A sodium channel by angiotensin II. Data is provided that demonstrates NFκB-dependent transcriptional control.

Ang II and H ₂ O ₂ dose range determination in H9c2 cells (Dose Ranging)
To determine reasonable concentrations of these drugs in future experiments, rat H9c2 cardiomyocytes were treated with increasing concentrations of AngII and H ₂ O ₂ to determine dose-dependent cell viability. H9c2 cardiomyocytes were resistant to a wide range of AngII concentrations from 1 to 500 nM in serum-free medium (FIG. 14A). On the other hand, higher doses of H ₂ O ₂ induced cell death starting at a concentration of 50 μM (FIG. 14B). Thus, Applicants limited further experiments to 20 μM H ₂ O ₂ , a concentration that does not show a statistically significant increase in cell death over the time course of Applicants' experiments. A 48 hour exposure was used to allow sufficient time for the transcriptional effect on Na ⁺ current.

AngII down-regulated Scn5a mRNA abundance H9c2 cells treated with 100 nM AngII for 48 hours were 47.3% (. +-5.3.3%, n = 7, P <0.01 in scn5a mRNA abundance. ) Showed a decrease (FIG. 15A). Because H9c2 cells are generally responsive only to high doses of Ang II (Tran et al. (1995) Biochim. Biophys. Acta 1259, 283-290; and Laufs et al. (2002) Cardiovasc. 53, 911-920), the experiment was repeated with acutely isolated rat neonatal cells and a more physiological concentration of Ang II. In neonatal cardiomyocytes, 48 hours exposure to 2 nM AngII resulted in a 49.0% (. +-5.2%, n = 10, P <0.01) decrease in scn5a mRNA abundance in neonatal cardiomyocytes. This result suggests that isolated myocytes have higher sensitivity and the effect is not limited to the H9c2 system (FIG. 15B).

AngII both cardiac Na ⁺ channel mRNA and current by H ₂ O ₂ was downregulated _may be to activate the NADPH oxidase to produce superoxide which is disproportionated (dismutate) to H 2 _{O 2} Since it is known, Applicants examined whether H ₂ O ₂ reproduces Ang II results. Exposure of H9c2 cells to ₂₀ μmol / L H ₂ O ₂ for 48 hours similarly reduced Na ⁺ channel mRNA (46.9%. + − 3.6%, n = 9, p <0.01; FIG. 15A). In isolated neonatal rat myocytes, a similar response was seen at 48 hours to reduced concentrations of H ₂ O ₂ , consistent with its increased sensitivity to Ang II (40 nM; 45.4%. +-. 7.5%, n = 9, p <0.01; FIG. 15B). In both types of muscle cells, AngII-mediated down-regulation of Na + channel mRNA can be prevented by pretreatment of the cells with catalase, indicating that AngII acts through H ₂ O ₂ production. Consistent with the idea. FIG. 16 shows that 48 h of 20 μmol / L H ₂ O ₂ exposure resulted in a 46.0% (. + −. 2.9%) decrease in Na ⁺ current, which is commensurate with a decrease in mRNA abundance (control n). = 7, treatment group n = 9, P = 0.01).

Evidence for NF-κB regulation of cardiac Na ⁺ channels NF-κB is a known redox sensitive transcription factor (Zhou et al. (2001) Free Radic. Biol. Med. 31, 1405-1416). ). Applicants have previously shown that the promoter region of the cardiac Na + channel contains one NF-κB consensus binding sequence (Shang, LL & Dudley, SC, Jr. (2005) J. Am. Biol. Chem. 280, 933-940). Thus, Applicants investigated whether NF-κB may be involved in AngII or H ₂ O ₂ mediated Na ⁺ channel transcriptional regulation. To test this idea, Applicants constructed a mutant form of the scn5a promoter, APS3-NF-κBm, with a modified NF-κB binding site (FIG. 17A). Promoter-reporter constructs containing an intact NF-κB binding site showed reduced activity in response to AngII or H ₂ O ₂ (FIG. 17B). When comparing cardiomyocytes transfected with the APS3 construct with and without AngII or H ₂ O ₂ exposure, the scn5a Na + channel promoter activity was 33.0% (. + −. 2.6%, n, respectively) in H9c2 cells. = 4, P <0.001) and 42.3% (. +-. 4.5%, n = 4, P <0.001) were suppressed. On the other hand, constructs with mutated NF-κB binding sites did not show a significant change in activity in the presence of AngII or H ₂ O ₂ .

To confirm that NF-Kappa B is associated with the scn5a promoter in response to AngII or H ₂ O ₂ exposure, Applicants have performed an electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assay. used. A 35 bp fragment of the scn5a promoter having an NF-κB site was used as a probe (FIG. 18A). NF-κB binding activity was increased in the presence of AngII or H ₂ O ₂ treatment. NF-κB B binding was blocked by the NF-κB inhibitor caffeic acid phenethyl ester (Natarajan et al. (1996) Proc. Natl. Acad. Sci. USA 93, 9090-9095; Watabe et al. (2004). Year) J. Biol. Chem. 279, 6017-6026). The ChIP assay showed that complete p50-p65 NF-κB heterodimer was generated in the cardiac Na ⁺ channel promoter in response to AngII or H ₂ O ₂ treatment (FIG. 18B).

Overexpression of the NF-κB subunit in H9c2 cells confirmed the need for the p50 subunit in Na ⁺ channel downregulation. Quantitative real-time _RT- PCR results show that the relative scn5a mRNA abundance is 77.3% (. +-7.3, n = 4) and p50 alone or a combination of p50 and p65, respectively, and A decrease of 88.6% (. +-4.8, n = 4) was shown. However, there was no significant change in Na ⁺ channel mRNA due to the presence of p65 overexpression alone (FIG. 19).

  In this example, the following method was used.

Cell Culture and Cell Viability Assay Rat embryonic cardiomyocyte cell line, H9c2 (ATCC cat # CRL-1446) or acutely isolated neonatal rat heart cardiomyocytes were used. Rat neonatal ventricular cells from the 3 day old Sprague-Dawley rat (Charles River Laboratories, Wilmington, Mass.) Using the kit according to the manufacturer's instructions (Worthington Biochemical Corp., Lakewood, NJ). Was isolated. Cells cultured in Dulbecco's Modified Eagle Medium (DMEM; ATCC, Manassas, VA) supplemented with 10% fetal calf serum (ATCC) under standard tissue culture conditions at 37 ° C. until 70-80% confluence were obtained. Exposure to AngII (Sigma, St. Louis, MO) or H ₂ O ₂ (Sigma) for 48 hours in total in serum-free culture medium (SFM) to replicate three times in well plates. The experiment was repeated three times. After dissociation with 0.125% trypsin-EDTA, 20 μL of 0.4% trypan blue (Sigma, St. Louis, MO) was added to each well to perform a trypan blue exclusion viability assay. The use of rats complies with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, revised 1996) published by the National Institutes of Health.

Quantification of scn5a transcripts by quantitative real-time _RT- PCR assay Quantitative real-time _RT- PCR was used to determine the abundance of cardiac sodium channel (scn5a) mRNA under various conditions. Using an RNeasy Mini Kit (Qiagen, Valencia, Calif.), Total RNA was isolated from untreated and treated cardiomyocytes with the addition of RNase-free DNase I. 3. iScript reverse transcriptase (Bio-Rad, Hercules, CA), 1 pg total RNA and mu. Reverse transcription was performed with L 5 × iScript reaction mix at 42 ° C. for 30 minutes according to the manufacturer's instructions. First strand cDNA was used (as) with Green Supermix (Bio-Rad) and 2.5 μM primer pair in a total reaction volume of 25 μL. The forward primer, rtPCRscn5aF (5′GAAGAAGCTGGGCTCCAAGA3 ′ (SEQ ID NO: 653)) recognized a sequence derived from exon 26. The reverse primer, rtPCRscn5aR (5′CATCGAAGGCCTGCTTGGTC3 ′ (SEQ ID NO: 654)) was complementary to exon 27 of the scn5a cDNA. The reaction yielded a 101 bp PCR product. All amplifications were performed in triplicate and consisted of 40 cycles of 30 seconds 95 ° C., 30 seconds 60 ° C. and 30 seconds 72 ° C. in a BioRad thermal cycler iccycler (Hercules, Calif.). PCR products were analyzed by the relative standard curve method. When performing a quantitative comparison, β-actin was used as a reference.

Electrophysiological determination of Na + current H9c2 cells were trypsinized and plated on treated plastic coverslips 3 hours before the start of the patch clamp experiment. H9c2 cells were treated with or without H ₂ O ₂ as indicated. A glass pipette was pulled in a Sutter Model P-97 horizontal puller to a resistance of 0.5-1.5 MΩ. A glass pipette was filled with pH 7.2 with a solution of CsCl (60), cesium aspartate (80), sodium EGTA (11), HEPES (10), Na ₂ ATP (5) (unit: mM), CsOH. The bath solution, Na (30), N- methyl -D- glutamate chloride _{(glutamate chloride) (100),} CsCl (5), CaCl 2 (2), MgCl 2 (1.2), HEPES (10), glucose (5) (unit: mM), adjusted to pH 7.4 with NaOH. Once the seal was established, a small amount of suction was applied to obtain a whole cell configuration. A peak current obtained at −10 mV from a holding potential of −100 mV was used for comparison. Cells were examined at 25 ° C. Data was sampled at 10 kHz and then filtered at 5 kHz for analysis. The current was recorded and analyzed with an Axopatch 200B amplifier, Axon Digidata 1230A A / D converter and pClamp software (Molecular Devices Corporation, Sunnyvale, Calif.).

Promoter-reporter construct and transient transfection The scn5a promoter region has been previously defined (Shang, LL & Dudley, SC, Jr. (2005) J. Biol. Chem. 280, 933-940). . For these experiments, a new promoter construct containing an NF-κB consensus binding site was used to examine the effect of treatment on scn5a transcription. This construct, pGL3-APS3, consisted of a 937 bp fragment starting from exon 1C and up to +32 base pairs relative to the start codon located in exon 2 of the mouse scn5a gene.

H9c2 cardiomyocytes are plated in each well of a 24-well plate to a density of 2.5 × 10 ⁴ cells in a final volume of 1 mL culture medium, allowed to attach overnight, until 70% -80% confluence Increased. Promoter-reporter construct (0.3 μg) and plasmid containing the herpes simplex virus thymidine kinase (HSV-TK) promoter driving expression of synthetic Renilla luciferase (phRL-TK; Promega, Madison, Calif.) (0.013 μg) Was transfected with 0.9 μL Fugene 6 chemical transfection reagent (Roche, Indianapolis, Ind.) According to the manufacturer's instructions. Serum-free DMEM culture medium with or without AngII or H ₂ O ₂ was changed every 24 hours. After culturing for 48 hours, the cells were treated with passive lysis buffer (Promega, Madison, Calif.) And the 100 μl of dual luciferase reporter assay system (Promega, Madison, Calif.). mu. L luciferase assay substrate and 100. mu. Cell extracts were collected for analysis of firefly and Renilla luciferase activities using L Stop & Glo reagent. Luminescence was quantified in a Veritas microplate luminometer using Veritas version 1.4.0 software (Tuener Biosystems, Sunnyvale, CA). The transfection efficiency of the reporter construct was verified by comparison with Renilla luciferase activity. The phRL-TK vector was engineered to remove most of the potential transcription factor binding sites, thus minimizing any modulation of Renilla luciferase expression due to experimental conditions. The luciferase activity of all promoter-constructs was normalized to the co-transfected pGL3-basic promoterless control. Four separate transfection sessions were analyzed, and in each session transfections were performed in triplicate. Three double luciferase readings were taken per transfection experiment.

Site-directed mutagenesis of the NF-κB binding site Using the QuikChange II XL site-directed mutagenesis kit, according to the manufacturer's instructions (Stratagene, La Jolla, Calif.), Disruption of the NF-kappa B binding site. went. That is, for PCR, 10 ng of pGL3-APS3 was used as a template, and the listed nucleotide primers were used to mutate the pGL3-APS3 NF-κB binding site (bold is wild type, underlined is mutant). . NFκB-mutCF: 5′GGTGCTGCACTCAGGCCCATCCCTATGAGATCTCC3 ′ (SEQ ID NO: 655) and NFκB-mutCR: 5′GAGGATCTCATAGGATGGCCCTGAGTGGCAGCACC3 ′ (SEQ ID NO: 656). After digestion with DpnI, 2 μL of PCR product was used to transform XL10-Gold competent cells. Valid clones were identified by sequencing.

Electrophoretic mobility shift assay (EMSA / gel shift)
H9c2 cells were treated with AngII or H ₂ O ₂ for 48 hours after or 24 hours after plating with or without CAPE (caffeic acid phenethyl ester, NF-κB inhibitor, 10 μM). Approximately 5 × 10 ⁶ cells were scraped for nuclear protein extraction with a nuclear extraction kit (Activemotif, Carlsbad, Calif.). NF-κB consensus binding sequence derived from the scn5a promoter (bold) (5′GGTGCTGCACTCAGGGGATCCCTATGAGATCTCTC3 ′ (SEQ ID NO: 657)) and NF-κB mutant sequence (5′GGTGCTGCACTCAGGCCCATCCCTATGAGATCTCC3 ′) (SEQ ID NO: 6) Nucleotides were used as probes for assays of nuclear extract binding activity. Protein-DNA complexes were detected using biotin end-labeled double stranded DNA probes prepared by annealing complementary oligonucleotides. Oligonucleotides were labeled in a reaction using terminal deoxynucleotide transferase and biotin-N4-CTP (Pierce, Rockford, Ill.) According to the biotin 3 ′ end DNA labeling kit manual. The binding reaction was performed using the LightShift kit (Pierce). That is, 30 μg of nuclear extract and binding buffer were incubated on ice for 5 minutes in a volume of 20 μL, then labeled probe (20 fmol) was added and the reaction was allowed to proceed for an additional 25 minutes. After electrophoresis, the DNA-protein complex was transferred to a nylon membrane and detected using chemiluminescence. TNF-α activated H9c2 cell nuclear extract (5 μg) was used as a positive control. The reaction products were separated on a 6% retarded gel. Specificity was confirmed by the addition of a 200-fold excess of unlabeled probe.

Chromatin immunoprecipitation (ChIP) assay Formaldehyde crosslinking and chromatin immunoprecipitation were performed as described in the manufacturer's manual (ChIP-IT ™ kit, Activemotif). That is, proteins were cross-linked with chromatin using 1% formaldehyde in H9c2 cells with or without treatment. The cells were then sonicated in lysis buffer and lysate aliquots were used for PCR reactions. The remaining lysate was clarified with protein G beads. Half of the clarified lysate was incubated with p50 or p65 antibody, while the other half was used as a negative control without antibody. After releasing the crosslinking, the immune complex was digested with proteinase K and the DNA was purified. DNA was analyzed by PCR using PicoMax polymerase (Stratagene, La Jolla, Calif.) And primers specific for the APS3 promoter region.

The stable H9c2 cell line overexpressed NF-κB subunits p50 and p65, and H9c2 cells were expressed as expression vectors carrying the human NF-kappa B subunit p50 and / or p65 (Lindholm et al. (2003) J. Hypertens. .21, 1563-1574) and co-transfected with the pDsRed expressing N1 vector (Clontech, Mountain View, Calif.) Carrying the red fluorescent protein as a marker for 400. mu. Selected by g / mL Geneticin (Invitrogen). At this point, more than 90% of cells showed red fluorescence. Transfection was confirmed by _RT- PCR using human p50 or p65 specific primers. Na + channel expression was assayed using SYBR quantitative real-time _RT- PCR.

Statistical evaluation All data are average values. + −. S. E. Shown as M. Statistical analysis of the mean values was performed using student paired or unpaired t-tests. ANOVA was used to compare the variance between multiple means. A p value <0.05 is considered statistically significant.

Example 4
The following description relates to the data provided herein.

Heart failure increases two of the Na + channel C-terminal splice variants The presence of splice variants was compared between explanted ventricles and control patients without known heart disease. _RT- PCR results showed that the relative mRNA abundance of the E28A full-length variant was reduced by 24.7% in HF patients compared to controls (p <0.001). E28C and E28D mRNA abundances were increased 14.2 times (p <0.001) and 3.8 times (p <0.001), respectively, compared to controls with HF patients. As a percentage of total SCN5A transcript, E28A and B ranged from 87.5% (± 5.1) and 2.4% (± 0.4) in controls to 45.1% (± 4.5) in HF patients. ) And 0.5% (± 0.2). E28C and D variants range from 3.9% (± 0.6) and 6.2% (± 4.6) in controls to 34.3% (± 3.1) and 20.2% in HF patients ( It increased to ± 3.3). The total percentage of short variants went from 12.5% (± 5.1) of total SCN5A mRNA in control subjects to 54.9% (± 4.5) in HF patients. Similar amounts of truncated channel variants are known to be responsible for Brugada syndrome (Chen et al., Nature 392: 293-296 (1998); Makiyama et al., J Am Coll Cardiol 46: 2100 2106 (2005); Priori et al., Circulation 105: 1342-1347 (2002); Schulze-Bahr et al., Hum Mutat 21: 651-652 (2003); Smiths et al., J Am Coll Cardiol 40 Volume: 350-356 (2002)). The pattern of truncation variant changes was similar in both ventricles, with E28C and E28D increasing. Corresponding to the RNA effect, Western analysis of human control and heart failure tissues revealed 62.8% (± 9.7, n = 3, p <0.01) protein reduction in HF compared to normal heart I made it. No band that could correspond to the truncated variant was observed in normal and failing hearts.

Cleaved variants reduce Na + channel protein and current Variant cDNA was expressed in a human embryonic kidney (HEK) -SCN5A cell line that stably expresses the full-length E28A channel. E28D expression reduced E28A variant mRNA abundance. When the vector encoding E28D was used in increasing proportions, the full-length transcript mRNA abundance was progressively reduced. Both E28C and E28D variants do not generate current when transfected into HEK cells alone, and both variants when transfected into a HEK-SCN5A cell line that stably expresses a full-length Na + channel, Na + current was reduced. The presence of the C or D variant is 54.6% (± 8.5, p <0.01, n = 14) and 56.0% (± 8. 9, p <0.01, n = 10). The decrease in current was dependent on the ratio of variant to full length vector used. Fluorescence micrographs of HEK cells transfected with the Na + channel C-terminally labeled variant demonstrated a marked decrease in the amount of C or D variant Na + channel protein when compared to an equal amount of full-length E28A variant.

Physiological significance of SCN5A cleavage variants The physiological significance of cleavage in SCN5A exon 28 was examined by creating a gene-targeted mouse model with a nonsense mutation in exon 28 between cleavages due to C and D variants. This mutation was embryonic lethal. Undifferentiated mouse embryonic stem cells in which SCN5A1652stop is heterozygous have normal growth characteristics and were able to differentiate into spontaneously beating cardiomyocytes (CM). Peak I _Na is reduced by 86.1% (± 5.2, n = 8, p = 0.0002) in the differentiated CM containing the cleavage compared to the WT CM, and the dominant of the cleavage in the wild-type channel A negative effect was shown. The action potential recorded in the current-clamping mode from the spontaneously beating CM is a significant slowing of the pulsation frequency (p = 0.02, n = 11) and activity in the truncation mutation compared to the wild type. There was a significant decrease in the maximum rate of potential increase (p <0.01, n = 11) and a decrease in amplitude (00.01, n = 11). These changes are consistent with Na + channel dysfunction (Smits et al., J Mol Cell Cardiol 38: 969-981 (2005); Tan et al. Nature 409: 1043-1047 (2001); Lei et al. J Physiol 567: 387-400 (2005)). The syncytium properties of these CMs were tested using a multielectrode array (MEA) (Caspi et al., Ann NY Acad Sci 1015: 285-298 (2004); Kehat et al., Circ Res 91: 659-661 ( 2002)). Consistent with the physiologically significant reduction in Na + current resulting from the truncated mRNA, the MEA recording of the CM with the truncation mutation showed a conduction rate of 64.2% (p <0.03) compared to the wild type. ) Showed a reduction (Halbach et al., Cell Physiol Biochem 13: 271-284 (2003)).

(Example 5)
This example is splicing as shown in one or both of Gao et al., Circulation, Volume 124 (No. 10): 1124-31 (published online on August 22, 2011) and International Publication No. 2010/129964. Demonstrate that factors hLuc7A and RBM25 are associated with aberrant splicing of SCN5A.

  The next paragraph describes the method used in Examples 5 and 6.

Cell culture Jurkat T cell clone E6.1 (ATCC, Manassas, VA) was cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum, 4 mM glutamine, 75 units / mL streptomycin and 100 units / mL penicillin. .

  Human embryonic stem (ES) cells were maintained in mouse embryonic fibroblasts (MEF) as previously described. 14. Cardiomyocytes were differentiated from WA09 (H9) ES cells using a directed differentiation approach in defined media for efficient heart development. After 30 days of differentiation, human embryonic stem cell-derived cardiomyocytes (hESC-CM) were used in this study.

Real-time PCR quantification Total RNA was isolated from cultured cells and human ventricular tissue using RNeasy Mini Kit and RNeasy Lipid Tissue Mini Kit (Qiagen, Valencia, CA), respectively. Human heart tissue was obtained from a tissue bank maintained at the Advocate Christ Cardiac Surgery Clinical Research Center.

Transfection and infection assay Fugene 6 reagent from Roche (Madison, Wis.) Was used in the transfection assay according to the manufacturer's instructions. LUC7L3 and RBM25 small inhibitory RNA (siRNA) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Human pGIPZ lentivirus small hairpin RNAmir particles were purchased from Open Biosystems (Huntsville, AL). Human cardiomyocytes were placed in 24-well plates at a density of 200,000 / well. RBM25 small hairpin RNA (shRNA; 5 μL per well, based on pre-titer results) pre-incubated with polybrene (Sigma, Milwaukee, Wis.) At a final concentration of 8 μg / mL for 1 hour. Noted. The scrambled shRNA group followed the same protocol. After 5 hours, the medium was replaced with normal culture medium. Infection and RBM25 knockdown rates were assessed on days 2 and 3 by confocal microscopy (Carl Zeiss GmbH, Oberkochen, Germany) and qPCR, respectively. Homo sapiens LUC73 and RBM25 green fluorescent protein (GFP) tagged open reading frame clones were purchased from ORIGENE (Rockville, Md.). The transfection assay followed the manufacturer's instructions.

Electrophysiology hESC-CM was trypsinized (2.5%, Invitrogen) for 10 minutes and plated the day before the experiment on a 35 mm glass bottom culture dish (MatTek, Ashland, Mass.) At a cell density of 40,000 cells / dish. . Na + channel current was measured by using the whole cell patch clamp technique at room temperature in a voltage clamp configuration. To measure Na + channel current, pipettes (3-4 MΩ) were added to CsCl (80), cesium aspartic acid (80), EGTA (11), MgCl ₂ (1), CaCl ₂ (1), HEPES (10) and A pipette solution containing Na ₂ ATP (5) (unit: mmol / L) (adjusted to pH 7.4 with CsOH) was charged. The bath solution was NaCl (130), CsCl (5), CaCl ₂ (2), MgCl ₂ (1.2), HEPES (10) and glucose (5) (unit: mmol / L) (pH 7.4 with CsOH). Adjustment). 15. The holding potential was −100 mV. A voltage step protocol ranging from −80 to +70 mV with a 10 mV step was applied to establish the presence of Na + channel current. The peak current density was used to plot a current-voltage (IV) curve. Nifedipine (10 μM, Sigma) was added to the bath solution to block L-type Ca + channel current.

Gel Mobility Shift Assay An RNA gel mobility shift assay was performed using the LightShift Chemiluminescent RNA Electrophoretic Mobility Shift Assay (EMSA) kit (Pierce, Appleton, Wis.). In summary, Invitrogen synthesized biotinylated wild-type (CAGCAGGCGGGCAGCGGCCU) and mutant (CAGCAGGUUAGAGGGCGCCU) RNA substrates. Binding of biotinylated RNA to RBM25 was achieved by incubation of 0.2 nmol / L RNA and variable amounts of protein in 20 μL binding buffer for 30 minutes at 4 ° C. For competition assays, various fold levels of molar excess of unlabeled competitor RNA were added to the preincubated reaction mixture. Samples were fractionated on native 5% polyacrylamide gels and transferred to Hybond-N + nylon membranes (Pierce, Appleton, Wis.). Biotin-labeled RNA was detected using streptavidin horseradish peroxidase conjugate and a chemiluminescent substrate. 12.

Western Blot Assay A Mini-PROTEAN® Tetra electrophoresis system from BioRad (Hercules, CA) was used for Western blot analysis. Anti-RBM25 antibody was provided by Dr. Shu-Ching Huang (Dana-Farber Cancer Institute). Anti-LUC7L3 antibody was purchased from Millipore (Billerica, Mass.). Anti-GFP was purchased from ORIGENE (Rockville, MD).

Statistical data are presented as mean ± standard error of the mean (SEM). Mean values were compared using independent student t-test or one-way analysis of variance (ANOVA). A probability value P <0.05 was considered statistically significant.

Clinical specimens Microarray test samples consisted of end-stage cardiomyopathy hearts (n = 10) and non-failing control hearts (n = 6). 1. End-stage cardiomyopathy heart samples were obtained upon left ventricular assist device (LVAD) installation or heart transplantation. Subjects with end-stage cardiomyopathy showed severe reduction in ejection fraction, left ventricular dilation, increased pulmonary artery and wedge pressure, and decreased cardiac index. The control subjects were younger (median age 42 years, quartile range 24-50 years) and were mainly male.

Data Analysis Method Genes significantly differentially expressed from human (GEO accession: GSE1869) 1 heart failure tissue-derived gene expression data were identified and compared using the GeneShifter gene expression microarray data analysis system. Data was uploaded to GeneShifter using the Affymetrix probe ID usage option Batch Upload. No data points were missing from either file. The z-score was used as a measure of the significance of the observed gene compared to the normal distribution. A z-score is considered significant if> 2 or <-2, which implies that the gene was significantly over-represented or under-represented. Statistically significant genetic changes were identified using an independent student t test, p-value <0.05 and 5% Benjamini and Hochberg false discovery rate (FDR) correction. These settings are the same as those used by Kittleson et al. 1. A range of fold change cut-off was used. For functional analysis, a gene ontology (GO) report was prepared according to the method of Doniger et al. 2. Genes associated with RNA splicing were found under the biological process GO term “GO: 0008380 RNA splicing”. Up-regulated splicing factors are listed in Table 1. No significant down-regulation of splicing factors was observed. Hierarchical clustering of these genes across samples was performed using an average correlation approach by Bioconductor (Fred Hutchinson Cancer Research Center). The heat map (FIG. 1) represents the relationship between genes and samples, green represents downregulation of genes relative to the average expression value of each gene, and red represents upregulation.

Alteration of mRNA profiles of splicing factors in human HF tissue mRNA microarray analysis was used to identify and compare splicing factors in both normal and human HF tissues. Of the 181 known human splicing factors analyzed, 17 were upregulated in HF. These splicing factors were grouped according to known virulence regulators such as hypoxia, inflammation, wall tension or hormonal factors involved in HF (Table 1).

Upregulation of RBM25 and LUC7L3 in human HF tissue The cis element of the splicing factor RBM25, CGGGCA, was found near the splicing sites of SCN5A variants E28C and E28D. Since RBM25 requires the activity of LUC7L3 in splicing control, both RBM25 and LUC7L3 were further evaluated for their role in SCN5A mRNA splicing control. Of the other 45 up-regulated splicing factors, none are known to bind based on known cis-element sequences, nor do they have the exemplary binding sequences present in SCN5A.

  qPCR confirmed up-regulation of splicing factors RBM25 and LUC7L3 in human HF tissue. Compared to normal human heart tissue, the results showed that the relative abundance of RBM25 and LUC7L3 increased 1.1-fold and 0.6-fold in HF tissue, respectively (P <0.05, FIG. 23A). Full-length SCN5A mRNA was reduced 0.6-fold in HF tissue (P <0.05, FIG. 23A), a result similar to our previous report. 8. The knowledge of mRNA correlated with protein expression by Western blot. A representative Western blot is shown in FIG. 23B. Compared to the control group (mixture of 4 normal human heart tissue samples), Western blot quantification showed that RBM25 increased 0.5-0.6 fold in HF tissue samples 1-4, respectively ( P <0.05, 3 replicates per sample). The gel density of LUC7L3 increased 0.6-0.7 fold in the same HF tissue sample (P <0.05, 3 replicates per sample).

RBM25 is related to SCN5A and interacts with CGGGCA Gel mobility shift assay showed that RMB25 bound to the exemplary sequence in SCN5A exon 28, CGGGCA (FIG. 24). A scan of the entire SCN5A RNA sequence revealed only a single binding site for RBM25 at the position where the SCN5A splicing variant was detected (FIG. 2A). In FIGS. 2B-D, binding of RBM25 to biotinylated wild type (CAGCAGGCGGGCAGCGGCCU) RNA was observed. This result explained that RBM25 binding is specific for the sequence CGGGCA. RBM25 bound to the wild type SCN5A sequence in a concentration dependent manner (FIG. 24B). For competition assays, various fold levels of molar excess of unlabeled competitor RNA were added to the preincubated reaction mixture (FIG. 2D). Specificity was confirmed by lacking binding to the mutated exemplary binding sequence (FIG. 24C) and showing that the unlabeled probe cannot compete with the labeled probe for RBM25 binding (FIG. 24D).

(Example 6)
This example is described in Ang, as shown in one or both of Gao et al., Circulation, Volume 124 (No. 10): 1124-31 (published online on August 22, 2011) and WO 2010/129964. -Il demonstrates that hypoxia and hypoxia control RBM25, hLuc7A and SCN5A mRNA splicing.

AngII and hypoxia controlled SCN5A mRNA splicing along with RBM25, LUC7L3 expression AngII and hypoxia are common virulence factors in HF and potential upstream stimuli responsible for changes in mRNA splicing factors in microarray analysis (Table 1). SCN5A mRNA is known to be transcribed in skeletal muscle and leukocytes. Applicants have reported that leukocytes have an mRNA splicing pattern similar to that of the heart. Moreover, circulating leukocytes from HF patients showed a 4-fold increase in AngII type 1 receptor (data not shown). Therefore, Jurkat cells, an immortalized lineage of T lymphocytes that markedly express SCN5A, were selected as an initial model for testing the SCN5A regulatory mechanism.

Jurkat cells were divided into three experimental groups: untreated control, hypoxic treatment (1% O ₂ ) and Ang II treatment (200 nmol / L). At four time points (30 minutes, 24 hours, 48 hours and 72 hours), cells were collected from each experimental group and total mRNA was extracted. The expression of RBM25 and LUC7L3 was examined by qPCR, and the results at 48 hours are shown in FIG. 25A. HIF-1α was used as an indicator of cellular hypoxic stress. Under hypoxic conditions, RBM25 and LUC7L3 expression in Jurkat cells increased 2.4-fold and 4.9-fold, respectively (P <0.05). Under AngII treatment conditions, RBM25 and LUC7L3 expression in Jurkat cells increased 2.1-fold and 1.9-fold, respectively (P <0.05). Expression of RBM25 and LUC7L3 by Western blot at 3 time points (12 hours, 24 hours and 48 hours) in the hypoxia treatment group and at 4 time points (24 hours, 48 hours, 72 hours and 96 hours) in the AngII treatment group Was analyzed. Western blot quantification showed that RBM25 increased 1.9, 2.0 and 1.5-fold in the hypoxia-treated group at 12 hours, 24 hours and 48 hours, respectively, and 24 for the AngII-treated group, respectively. It showed a 2.1, 2.1, 1.9 and 2.0 fold increase at time, 48 hours, 72 hours and 96 hours (P <0.05). The LUC7L3 gel density increased 2.4, 2.4 and 2.7 times in the hypoxia treated group at 12 hours, 24 hours and 48 hours, respectively, and 24 hours in the Ang II treated group, respectively. There was a 2.6, 2.5, 2.8 and 2.8-fold increase at 48, 72 and 96 hours (P <0.05). A representative Western blot and quantification (based on 3 replicates for each group) is shown in FIG. 25B.

  In order to correlate SCN5A variants with RBM25 and LUC7L3 abundance, the effects of hypoxia and AngII on SCN5A variants E28C and E28D in Jurkat cells were also tested. Expression of the full-length SCN5A transcript at 48 hours and SCN5A variants E28C and E28D is shown in FIG. 25C. Hypoxia increased the expression of SCN5A variants E28C and E28D by 3.7-fold and 6.4-fold, respectively (P <0.05), while the expression of full-length SCN5A transcript was decreased by 0.7-fold. (P <0.05). AngII increased the expression of SCN5A variants E28C and E28D by 2.9-fold and 4.3-fold, respectively (P <0.05), whereas the expression of full-length SCN5A transcript (transcipt) was 0.8-fold. Decreased (P <0.05).

  These two splicing factor siRNAs were found to partially block hypoxia or AngII-induced SCN5A variants E28C and E28D at 48 hours (FIGS. 25D-E). A partial effect in reducing aberrant splicing is that siRNA knockdown efficiencies are 60 ± 5% and 70 ± 5% as estimated by qPCR for RBM25 and LUC7L3, respectively, and 63 ± 7% and 69 ± 6% for Western blots. There may be a cause.

  Down-regulation of two splicing factors in Jurkat cells reduced SCN5A variants E28C and E28D, but overexpression of RBM25 and LUC7L3 increased E28C and E28D and decreased full-length SCN5A mRNA abundance. Expression of the full-length SCN5A transcript at 48 hours and SCN5A variants E28C and E28D is shown in FIG. 25F. Overexpression of RBM25 increased the expression of SCN5A variants E28C and E28D by 1.6-fold and 2.5-fold, respectively (P <0.05), whereas full-length SCN5A transcript expression was 0.6-fold Decreased (P <0.05). Overexpression of LUC7L3 increased the expression of SCN5A variants E28C and E28D by 1.1-fold and 1.9-fold, respectively (P <0.05), whereas full-length SCN5A transcript expression was 0.7-fold Decreased (P <0.05).

Effect of Ang II on Na ⁺ channel in hESC-CM The effect of Ang II on cardiac Na + channel in hESC-CM was investigated. On day 30 of differentiation, hESC-CM was plated on 24-well culture plates. Cells were divided into three experimental groups: AngII treatment (200 nmol / L), AngII treatment (200 nmol / L) and pGIPZ lentivirus RBM25 shRNAmir pre-infection and AngII treatment (200 nmol / L) and scrambled shRNA pre-infection. It was. Ang II (200 nmol / L) treatment was performed on day 3 of infection in all experimental groups. When cells were preinfected with RBM25 shRNA, the expression of full-length SCN5A transcripts increased 0.4-fold, while the expression of SCN5A variants E28C and E28D decreased 0.4-fold and 0.5-fold, respectively ( P <0.05). In each experimental group, qPCR measurement was performed 24 hours after AngII treatment and normalized by β-actin. However, no changes were observed when cells were preinfected with scrambled shRNA. The results showed that AngII-mediated SCN5A downregulation was dependent on the splicing factor RBM25 (FIG. 26A). When evaluated by the ratio of GFP-positive cells (pGIPZ lentivirus-infected cells) to total cells, the infection rate was 90 ± 6%. As assessed by both qPCR and Western blot, the RBM25 knockdown efficiency was 70 ± 5% (FIG. 26B).

Abnormal Na ⁺ channel mRNA processing altered the Na ⁺ channel current. The Na + current in hESC-CM was measured by whole cell voltage clamp technique to examine what the changes in Na + channel mRNA processing meant. Since no suitable animal model has been validated, hESC-CM was used for the most mimic clinical condition. Cells were divided into 4 experimental groups: control, AngII treatment (200 nmol / L), AngII treatment (200 nmol / L) and pre-infection with RBM25 shRNA and AngII treatment (200 nmol / L) and pre-infection with scrambled shRNA. Assuming that RBM25 controls pre-mRNA alternative splicing by recruiting LUC7L3, the 12-function loss form of RBM25 by lentiviral shRNA was used exclusively to suppress abnormal channel splicing. The macroscopic Na + channel current in each experimental group was measured. The results of the first three experimental groups 24 hours after Ang II treatment are shown in FIG. There was a significant difference in peak currents between control and AngII treated cells at membrane potentials ranging from -40 to +30 mV (P <0.05). When cells were preinfected with RBM25 shRNA prior to AngII treatment, no effect of AngII on peak current was observed. By comparing to cells pre-infected with scrambled shRNA, which had no effect on the IV relationship compared to Ang II alone, the non-specific effects of lentivirus were excluded (data not shown). The results showed that Ang II was able to down-regulate Na + channel current in hESC-CM, and this down-regulation was dependent on the splicing factor RBM25.

(Example 7)
This example demonstrates that the SCN5A variant activates endoplasmic reticulum stress response (UPR) as shown in WO2010 / 129964.

Previously, Applicants have shown that SCN5A splicing variants have a dominant negative effect on Na ⁺ current (Shang et al., Circ. Res. 101: 1146-1154 (2007)). Since the Na ⁺ channel is encoded by a single mRNA, it is not clear how the truncated form could have a dominant negative effect in full-length channel production. The following example investigated whether a truncated SCN5A variant activated the endoplasmic reticulum stress response (UPR) pathway.

Hypoxia and AngII were used to increase abnormal SCN5A splicing. Expression was measured PERK and sXBP1 by R _T -PCR. PERK expression was 18.6 ± 0.8 fold (p <0.05) and 14.2 ± 0.6 fold (p <0.05) at 48 hours under hypoxic and AngII treatment conditions, respectively. ) But upregulation of sXBP1 expression was not observed. To test whether such upregulation of one arm of the UPR is mediated by SCN5A mRNA variants, exogenous E28C and E28D were introduced. Jurkat cells were divided into four experimental groups: normal control, empty vector control, variant E28C overexpressing cells and variant E28D overexpressing cells. In each group, PERK expression was measured by _RT- PCR at 48 hours. The results show that when variant E28C or E28D is overexpressed, PERK expression is 6.3 ± 0.4 (p <0.05) and 7.9 ± 0.5 (p <0.05). Showed an increase. The upregulation of PERK in Jurkat cells was further confirmed by Western blot. Compared to the control group, Western blot analysis showed that the density of PERK increased by 437.9 ± 11.2% and 383.2 ± 10.7% under hypoxic and AngII treated conditions, respectively (p < 0.05), increased 262.6 ± 9.6% and 359.5 ± 10.1% in cells overexpressing variant E28C or E28D, respectively (p <0.05). Furthermore, siRNA against PERK partially reversed the downregulation of full-length SCN5A expression after hypoxia or AngII treatment. siRNA knockdown efficiency is 50% or more.

(Example 8)
This example demonstrates the role of the PERK-mediated endoplasmic reticulum stress response pathway in the control of cardiac sodium channels in human heart failure, as previously described.

  Endoplasmic reticulum stress response (UPR) is a series of interrelated events that occur when the endoplasmic reticulum (ER) experiences hypersecretory load, accumulates misfiled proteins, or is subjected to other pathological conditions. Signal transduction pathway. UPR acts to attenuate overall protein synthesis, induces expression of ER chaperone proteins and enhances degradation of misfiled proteins. In a published study, Applicants have found that mRNA failure EHF, where heart failure (HF) increases the alternative splicing of the SCN5A gene (encoding cardiac sodium channel) and encodes a truncated, non-functional sodium channel. And produced E28D. The presence of these variants results in a dominant negative down-regulation of wild-type SCN5A mRNA and sodium current to a degree sufficient to become arrthmogenic. Applicants examined whether PERK-mediated UPR contributes to a dominant negative effect on Na + current when a truncated sodium channel mRNA variant is present in HF.

  The expression correlation varies between PERK, major human embryonic stem cell-derived cardiomyocytes (hESC-CM). Hypoxia and Ang II were used as inducers of aberrant splicing because they have been shown to mediate some of the pathological consequences of HF. hESC-CM was divided into 6 experimental groups: normoxia, 1% O2 hypoxia treatment, 100 nmol / L AngII treatment, E28C overexpression, E28D overexpression and empty vector control. To overexpress the truncated protein, E28C and E28D constructs were transduced.

  The expression of the major UPR components (PERK, calnexin, CHOP) was increased in HF tissue and cardiac Na + channels were down-regulated. In hESC-CM, induction of SCN5A variants E28C and E28D by AngII or hypoxia was able to induce major UPR components (PERK, calnexin, CHOP) along with the expression of exogenous variants. Finally, PERK downregualtion prevented loss of full-length SCN5A mRNA abundance due to these stimuli.

  The SCN5A variant was able to induce the expression of the major UPR components and to induce the down-regulation of PERK-mediated Na + channed. The results indicate that UPR contributes to down-regulation of Na + channels in human HF.

Example 9
Applicants reported that SCN5A, the gene encoding the α-subunit of the cardiac Na + channel, has two mRNA alternative splicing variants that are upregulated in human heart failure (HF). These splicing variants do not form functional channels, and their presence reduces the conduction velocity between cardiomyocytes. Thus, abnormal Na + channel splicing can contribute to arrhythmic risk in HF. Further studies showed that the splicing factors RBM25 and hLuc7A lead to aberrant mRNA processing. Applicants' data also indicate that immortalized B cells express cardiac Na + channel variants in the same manner as cardiac tissue and can serve as a surrogate for abnormal cardiac splicing.

Applicants examined whether leukocyte (WBC) Na + channel mRNA splicing fluctuated with or without HF.
Methods: 180 adult patients were recruited into the study, 45 of which were controls without HF (ejection fraction (EF)> 60%) and 135 with HF (EF <35%) . Patients with congenital heart disease, infections and inflammatory conditions were excluded. Total RNA was extracted from WBC. The mRNA abundance of SCN5A, SCN5A variants and splicing factors RBM25 and hLuc7a was determined by real-time PCR.
Results: The ratio of WBC SCN5A variant E28C or E28D to full-length SCN5A transcript was increased in HF patients compared to the control group. Mean ploidy induction was 5.0 ± 2.7 and 7.0 ± 3.5 for SCN5A variants E28C and E28D, respectively (p <0.05). These changes were greater than those observed in cardiac tissue. RBC25 and hLuc7a WBC mRNA abundance was also increased in HF. The average increases in RBM25 and hLuc7A were 67.0 ± 7.8% and 73.0 ± 9.3%, respectively (p <0.05). These changes were similar to the heart tissue previously reported by the applicants. Conclusion: There is a distinct pattern of pathogenic splicing factor increase and aberrant Na + channel splicing in circulating WBC of HF patients, indicating that WBC mRNA splicing can be affected by the same process that occurs in the heart, WBC mRNA splicing Suggested that it may serve as a surrogate for arrhythmic risk related to Na + channel downregulation in the heart.

(Example 10)
This example provides a description of a human clinical trial known as SOCS-HEFT (Sodium Channel Splicing in Heart Failure Trial, NCT01185585), an ongoing clinical trial.

  Applicants have found that (1) patients with reduced left ventricular ejection fraction have an increased abundance of a truncated mRNA splice variant of the SCN5A gene, which is associated with sodium channel dysfunction and sudden cardiac death. Patients with implantable cardiac defibrillation devices (ICDs) who are a precursor to increased risk and have experienced shock therapy compared to patients with similar congestive heart failure who have never experienced shock therapy Thus, it was assumed that the abundance of a truncated mRNA splice variant of the SCN5A gene increases.

  In order to test these hypotheses, Applicants initiated a SOCS-HEFT trial essentially as follows.

  The specific goals and objectives of this study were: (i) SCN5A mRNA splice variants in patients with baseline ejection fraction below 35% who are chronic heart failure (CHF) versus normal controls in similar age groups And (ii) comparing the abundance of SCN5A mRNA splice variants in patients with ICD devices and in patients who have not experienced ICD shock therapy. The amount of white cell Na + channel splice variant in patients with or without heart failure correlates with ejection fraction and that the amount of leukocyte Na + channel splice variant in patients with ICD in place is a reasonable ICD. The test was designed to correlate with the number of shocks.

  Study participants were mainly adult patients with acquired heart failure (not a secondary to congenital heart disease) with or without an ICD device for any cause. Patients with normal left ventricular function and no evidence of diastolic dysfunction as assessed by echocardiography were also included as control patients in this study. These patients are not heart disease and do not have an ICD device.

The following eligibility criteria were used when selecting study participants:
1. All patients must be over 18 years of age.
2. Patients with reduced left ventricular function (ie, patients with heart failure) must have acquired heart failure and ejection fraction less than 35% as demonstrated by either methodology over the last two years.
3. Control population patients should not have heart failure symptoms, diastolic dysfunction, and left ventricular systolic dysfunction demonstrated by any methodology within one year of study enrollment.
4. Patients with ICD in place for more than 1 year and evidence of ICD events.
5. Patients who have ICDs in place for more than one year and have no evidence of ICD events.
6). All patients must be able to give informed consent.

The following criteria for disqualification were used in excluding study participants.
1. Patients under 18 years old.
2. History of congenital heart disease caused by left ventricular dysfunction.
3. Control patients with left ventricular systolic function deficiency or diastolic dysfunction.
4). Control or test group patients with a history of congenital electrophysiological disorders such as long QT syndrome or Brugada disease are not included.
5. Control or test group patients in need of antiarrhythmic drugs other than Vaughn-Williams class II and IV drugs.
6). Control patients with a history of serious illnesses that can impair cardiac function within 12 months of study entry. Such conditions include myocardial infarction, hospitalized treatment with the heart, cardiac arrhythmia, infection or cancer.
7). ICD patients with other terminal or chronic inflammatory diseases.
8). Patients with chronic infections or acute or chronic inflammatory diseases receiving immunosuppressive medications that may alter leukocyte mRNA expression.
9. Patients with any disease expected to die within 18 months of enrollment.
10. Patients with leukocyte cachexia or cancer.
11. Currently, illegal drugs are used.
12 Informed consent cannot be given.

The following pre-registration assessments were conducted for candidates participating in the study.
1. Medical history and physical examination.
2. Records of current pharmacotherapy including, but not limited to, angiotensin converting enzyme inhibitors (ACE inhibitors), statins, antiarrhythmic drugs and angiotensin receptor blockers (ARB).
3. Patients with an ICD device collate that device and review for the presence of shock.

  The duration of participation was determined as follows. A single blood draw was required at enrollment and the level of SCN5A mRNA splice variant was analyzed. The patient's medical records related to heart-specific information, such as ICD verification records, ECG, and echo test results, were retrospectively examined from the date of registration. This study did not require changes in care standards. All study participants were subjected to phlebotomy at enrollment. There were no monitoring parameters in this study. The patient was able to discontinue the study at any time.

  The grade assessment was as follows. Demographics and past medical history data were recorded at the initial assessment. This information included age, race, gender, body mass index, blood pressure, New York Heart Association class, history of myocardial infarction and hypertension, diabetes status, tobacco and alcohol consumption, presence and type of pacemaker device. The age at the time of heart failure diagnosis was recorded. In addition, a review of previous heart tests was recorded. The types of examinations reviewed included electrocardiograms, tomographic echocardiograms, coronary angiograms, and cardiac nucleus test results. To assess the level of SCN5A mRNA splice variant, a blood sample from each study participant was taken. Since Applicants have recently shown that AngII and hypoxia are upstream signals of aberrant SCN5A mRNA splicing, Applicants have identified angiotensin converting enzyme (ACE) levels and activities, angiotensin II (AngII) and low Note also the oxygen-inducible factor (HIF-1α) mRNA.

  Sample collection and processing in this test were performed as follows. Approximately 15 ml of blood was collected from a UIC or JBVAMC study participant who gave informed consent for phlebotomy and study participation. Samples were immediately delivered by test staff for processing within 2 hours of collection. mRNA levels were measured and a portion of the processed sample was stored in the same laboratory -80 ° F freezer for up to 7 years. JBVAMC or other facilities did not store or process the samples.

The statistical considerations for the test are as follows. The relationship of Na ⁺ channel mRNA variant abundance was compared in subjects with and without heart failure and subjects with and without ICD events. The primary endpoint was a comparison of mRNA variant abundance. Dependent variables included heart failure and shock count. The number of patients required for the goal of this study was determined by examining the variance of the test, the expected mean difference and the covariates required for analysis in the regression analysis. Previously, Applicants have shown that the lowest sensitivity measure is a 24% reduction in E28A abundance. If we assume that the same percentage reduction occurs in goals 1 and 2, we need about 45 patients in each group to have 90% power to detect this difference, and the assay Assume a 10% loss rate due to technical errors in. Thus, the applicants required a total of 180 patients for the clinical trial, 45 heart failure, 45 controls, 45 evented ICD patients and 45 non-event patients.

Baseline data were expressed as the mean ± SD of continuous variables and the frequency of categorical variables. Differences in baseline characteristics between groups are examined by using Fisher Direct and Mann-Whitney tests for categorical and continuous variables, respectively. Since the number of recorded ICD events is a function of observation time, Poisson regression was used to model any relationship. In this model, the number of observed ICD events is assumed to be distributed according to the Poisson distribution. That is, the probability that a certain number of events have occurred in a given period is a function of the event rate multiplied by the observation period. To estimate the effect of mRNA variants on event incidence, the event rate was assumed to be a linear logarithm with respect to the target predictor. Solving this equation gives a ratio that compares the event rate in subjects with and without ICD events. Multiple representations of mRNA variant abundance were considered, such as the relative abundance of each variant, the abundance of individual variants as a function of total Na ⁺ channel mRNA, and the ratio of cleaved to full length Na ⁺ channel mRNA. Regression coefficients were estimated for the relationship between the dependent variable, the ICD event, and the independent variable as the log of the ratio estimate. Statistical significance was determined by using a likelihood ratio test. A p value of 0.05 or less was interpreted as statistically significant. Results were reported as the risk ratio and its associated 95% confidence interval. In order to select variables to be included in this model, Applicants conservatively examined variables with different distributions between the two groups at p <0.20. The possibility of multicolinearity was evaluated. Linear and nonlinear terms were studied. The normality of the variable distribution was tested by normal probability plot and Shapiro-Wilk test. Regression is quite resistant to infringement in this regard, but the transformation was investigated as appropriate. The equidispersity was evaluated by plotting residue versus predicted value. Model discrimination was evaluated by the overall C index and verified by the bootstrap method.

  Safety monitoring and assessment of this study are as follows. This is a cross-sectional cohort comparative trial with minimal risk to the patient. There was no data safety monitoring committee. All data was collected in compliance with current laws and regulations. Data was stored in an access location managed in a de-identified manner. Applicants do not anticipate any complications from blood sample acquisition, mRNA variant analysis or statistical implementation. Nevertheless, the main limitation for this trial is its retrospective nature. Nevertheless, the data will be useful in the design of future prospective trials.

  The following references were considered in this example.

(Example 11)
This example demonstrates that leukocyte (WBC) SCN5A alternative splicing correlates with cardiac SCN5A splicing.

  Based on data from SOCS-HEFT, Applicants established that WBC and left ventricular SCN5A splicing variant abundance is highly correlated. Using the left ventricular assist device core sample and the blood sample obtained simultaneously, Applicants have shown that there is a significant degree of correlation between normalized variant levels in the heart and blood (Figure 29). . These data suggest that variant blood tests are likely to reflect changes in the heart.

(Example 12)
This example demonstrates that an increase in WBC splicing variants predicts a reasonable ICD discharge.

  Based on data from the SOCS-HEFT trial, Applicants were able to show that both variants E28C and E28D were increased in the blood of ICD patients compared to controls. In addition, variant levels are considerably higher in patients with a reasonable ICD discharge due to ventricular tachycardia or fibrillation within a period of 12 months prior to sample acquisition, and overlap in the distribution of variant abundance between groups Was hardly seen (FIG. 30). The current study enrollment is 28 controls, 34 ICD patients without discharge and 15 patients with reasonable discharge (reasonable substitute for sudden death). The outcome of trials is already statistically significant for the use of SCN5A variants to predict the risk of shock in patients with retrospective and small numbers but with ICD.

  Moreover, using a cut-off of 4.0 for E28C or 2.8 for E28D, the sensitivity and specificity for predicting shock risk is 100% and 85%, respectively, and the area under the curve (AUC) is , E28C is 0.96 ± 0.03, and E28D is 0.95 ± 0.03 (p <0.001, FIG. 30). This result implies that the proposed blood test has the highest AUC of any test available for predicting sudden death.

  The following description shows how calculations are made based on the Gaussian distribution curve of FIG.

  In probability theory, a Gaussian distribution is a continuous probability distribution with a bell-shaped probability density function known as a Gaussian function.

(In the formula, parameter μ is an average value or an expected value (peak position), and σ is a standard deviation.)

  The distribution of E28C / SCN5a (SCN5a splice variant E28C to SCN5a abundance ratio) and E28D / SCN5a (SCN5a splice variant E28D to SCN5a abundance ratio) in control and ICD patients (with or without shock) follows a Gaussian distribution. The control Gaussian distribution has a smaller mean and smaller standard deviation, corresponding to a very narrow bell-shaped probability distribution. The Gaussian distribution of ICD patients without shock has a larger mean and larger standard deviation, corresponding to a wider bell-like probability distribution. The Gaussian distribution of shocked ICD patients has the largest mean and largest standard deviation, corresponding to the widest bell-shaped probability distribution furthest from the ordinate.

Usually, the abundance of SCN5a and its splice variants E28C and E28D in ICD patients is calibrated by some algorithm prior to calculation of VC / SCN5a and VD / SCN5a. An example is shown below. First, for β-actin, SCN5a and its splice variants E28C and E28D, the abundance difference ΔCt between the ICD patient and the control is calculated. Secondly, ΔΔCt _SCN5a = ΔCt _SCN5a -ΔCt _β-actin , ΔΔCt _E28C = ΔCt _E28C -ΔCt _β-actin and ΔΔCt _E28D = ΔCt _E28D -ΔCt _β-actin are calculated. Next, we obtain the calibrated abundance of SCN5a and its splice variants E28C and E28D in ICD patients by the following formula: 2 to the minus ΔΔCt _SCN5a , minus ΔΔCt _E28C and minus ΔΔCt _E28D , respectively. Finally, using the values of VC / SCN5a (calibrated variant E28C abundance, ratio of calibrated SCN5a abundance) and VD / SCN5a (calibrated variant E28D abundance, ratio of calibrated SCN5a abundance) To fit the Gaussian distribution in ICD patients.

  To fit the Gaussian distribution, the raw values of VC / SCN 5a and VD / SCN 5a can be binned to maximize the variance of the distribution of values in each bottle. For example, if VC / SCN 5a or VD / SCN 5a is greater than or equal to 5.5 and less than 6.5, all relevant values can be grouped into the same bottle center value 6.0 having a bottle width of 1.0. The Gaussian fit results depend to some extent on the value of the bottle width.

  The fitting of the Gaussian distribution can be performed by software such as GraphPad Prism. The frequency distribution is specified to be plotted as an XY plot where the frequency is the Y value and the VC / SCN5a or VD / SCN5a bottle center is the X value. When using the software GraphPad Prism, the analytical function is clicked after the XY value is input. Subsequently, non-linear regression, a Gaussian family of equations and a Gaussian model are selected, and then a Gaussian frequency distribution is created.

  A VC / SCN5a value of 4.1 and a VD / SCN5a value of 2.6 can be chosen as criteria for predicting the likelihood that an ICD patient may have a shock. According to existing clinical data, 99% of shocked ICD patients have VC / SCN5a values greater than 4.1 and VD / SCN5a values greater than 2.6, whereas 8% of shockless ICD patients account for 4 A VC / SCN5a value greater than .1 and 16% of shockless ICD patients have a VD / SCN5a value greater than 2.6. 96% of shocked ICD patients have VC / SCN5a values greater than 4.7 and VD / SCN5a values greater than 3.5, whereas 3% of shockless ICD patients have VC / SCV values greater than 4.7. It has an SCN5a value and a VD / SCN5a value greater than 3.5.

  The resulting values of VC / SCN5a and VD / SCN5a are then compared to the cutoff value chosen as a criterion for predicting the likelihood that an ICD patient may have a shock. The cutoff value can be specified to have a negative predictive value around 99%.

  Based on the Gaussian distribution table, the data value of 99% is larger than the criterion value calculated by the following formula: μ−2.33σ (where μ is an average value or an expected value (peak position)) And σ is the standard deviation).

  The average value μ can be calculated by the following equation.

(Where N is the total number of data values, and each data value is denoted by x _i (i = 1,..., N).)

  The standard deviation σ can be calculated by the following equation.

  According to existing clinical data, the Gaussian distribution of shocked ICD patients has a mean value μ of 7.2 for VC / SCN5a and a standard deviation σ of 1.3, and a mean value of 6.4 for VD / SCN5a With a standard deviation σ of μ and 1.6. Therefore, μ−2.33σ = 4.1 for VC / SCN5a and μ−2.33σ = 2.6 for VD / SCN5a. Since a VC / SCN5a value of 4.1 and a VD / SCN5a value of 2.6 are chosen as criteria, 99% of shocked ICD patients can be identified as positive, ie their VC / SCN5a > 4.1 and VD / SCN5a> 2.6. If only a VC / SCN5a value of 4.1 is chosen as the criterion, the corresponding sensitivity and specificity are 91.7% and 91.1%, respectively. The corresponding positive and negative predictive values are 92.5% and 98.9%, respectively. When only a VD / SCN5a value of 2.6 is chosen as the criterion, the corresponding sensitivity and specificity are 85.3% and 83.2%, respectively, and the corresponding positive and negative predictive values are 86. 1% and 98.8%.

  Next, formulas for calculating sensitivity, specificity, positive predictive value, and negative predictive value are described.

Sensitivity = TP / (TP + FP + FN)
Specificity = TN / (TN + FP + FN)
Positive predictive value = TP / (TP + FP)
Negative predictive value = TN / (TN + FN)
(Where TP indicates true positive, TN indicates true negative, FP indicates false positive, and FN indicates false negative.) For example, when a threshold is determined, TN is cut Data values in the off-left no shock group. FN is a data value in the ICD shock group on the left of the cutoff. TP and FP are the cutoff right shock group and the no shock group, respectively.

(Example 13)
This example demonstrates that WBC splicing variants are increased in HF patients.

  In the same SOCS-HEFT trial, Applicants were able to show that both variants were increased in the blood of HF patients compared to controls (Figure 30). The current clinical trial registration is 42 men and 14 women. This result suggests that WBC SCN5A mRNA splicing varies in response to HF, and since HF is associated with arrhythmic risk, it is reasonable to believe that WBC mRNA variants can predict sudden death risk.

(Example 14)
This example shows a cross-sectional, cohort study comparing patients with and without ICD therapy for ventricular arrhythmias.

  Each patient in this study will have an ICD. Potential subjects will come from thousands of patient cohorts following three institutions of the University of Illinois at Chicago teaching hospital. Patients with ICD therapy screened for malignant ventricular tachycardia (ie, ICD events) will have WBC Na + channel mRNA splice variant abundance with the same number of subjects without ICD events selected from the same database and randomly selected. You are asked to provide additional blood samples for analysis. These abundances are then correlated with the presence of ICD events after correction of the covariates described below. Eligibility criteria include (1) being over 18 years of age and (2) deploying an ICD for over a year so that retrospective risk can be assessed over a reasonable period of time. Ineligibility criteria are listed in the Human Subjects section, which includes chronic infections that are receiving congenital heart disease, a history of congenital arrhythmic disorders, immunosuppressive medications that can alter leukocyte mRNA expression Including leukocyte cachexia or cancer patients. All enrolled patients submit written consent.

  Data will be collected from subject interviews and review of hospitals and clinic charts. The demographic data obtained include age, race, body mass index, New York Heart Association (NYHA) functional class and previous myocardial infarction, hypertension, diabetes history, smoking or alcohol consumption. In addition, any medications received at registration and the date and method of EF determination are recorded.

One blood collection is performed at the time of registration. Total RNA is isolated acutely from WBC, and various forms of Na + channel splice variants are analyzed using real-time _RT- PCR. Total RNA is used to synthesize cDNA by reverse transcription using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA) according to the manufacturer's instructions. All amplifications were performed in duplicate and consisted of 40 cycles of 30 seconds 94 ° C., 30 seconds 65 ° C. and 1 minute 72 ° C. in a BioRad thermal cycler iCycler (Hercules, Calif.). PCR products are analyzed by electrophoresis on a 1.5% agarose gel. When making quantitative comparisons, beta-actin and GAPDH are used as internal references.

  The minimal change in mRNA isoform abundance noted above between HF and control patients was a 25% reduced full length transcript. Using this minimum change as the basis for power analysis, the registration of 37 subjects in each group uses 90% power to detect this difference using a two-tailed alpha level of 0.05. Will bring. Based on this, and because it is necessary to obtain sufficient targets for correction of the covariates, the applicants register 50 subjects in each group.

  Applicants predict that an abnormal SCN5A splicing pattern is associated with an ICD event. The relationship between Na + channel mRNA variant abundance and pattern is compared in subjects with and without ICD events. As described above, various mRNA isoform levels are expressed as relative mRNA abundance and percent of total Na4 channel mRNA. Baseline data is expressed as the mean ± SD of continuous variables and the frequency of categorical variables. Differences in baseline characteristics between groups are examined by using Fisher direct and Mann-Whitney tests for categorical and continuous variables, respectively. Since the number of recorded ICD events is a function of observation time, Poisson regression is used to model any relationship. In this model, the number of observed ICD events is assumed to be distributed according to the Poisson distribution. That is, the probability that a certain number of events have occurred in a given period is a function of the event rate multiplied by the observation period. In order to estimate the effect of mRNA variants on event incidence, it is assumed that the event rate is a linear logarithm with respect to the predictor of interest. Solving this equation gives a ratio that compares the event rate in subjects with and without ICD events. Multiple representations of mRNA variant abundance are considered, such as the relative abundance of each variant, the abundance of individual variants as a function of total Na + channel mRNA, and the ratio of cleaved to full length Na + channel mRNA. A regression coefficient is estimated for the relationship between the dependent variable, the ICD event, and the independent variable as the logarithm of the ratio estimate. Statistical significance is determined by using a likelihood ratio test. A p value of 0.05 or less is interpreted as statistically significant. Results are reported as the risk ratio and its associated 95% confidence interval. In order to select the variables included in this model, Applicants conservatively consider variables with different distributions between the two groups at p <0.20. The possibility of multiple colinearity is evaluated. Linear and nonlinear terms are considered. The normality of the variable distribution is tested by a normal probability plot and a Shapiro-Wilk test. Regression is quite resistant to infringement in this regard, but transformations are investigated as appropriate. Equal dispersibility is assessed by a plot of residue versus predicted value. Model discrimination is evaluated by the overall C index and verified by the bootstrap method. Data analysis was conducted in the UIC Center for Clinical Translational Science (UIC Center for Clinical Translational), recently funded by the National Center for Research Resources, NIH, and Award Number UL 1RR029879, which maintains a biostatistics core. Science).

  Applicants have recently developed a statins for the prevention of Atrial fibrillation trial (StoP-AF, NCT00252967) (56) by interim GRADE analysis 55 or the Applicants. It does not predict any complications from obtaining blood samples, analyzing mRNA variants or performing statistics, similar to those used in. However, although Applicants have shown that Ang II and hypoxia affect splice variant abundance, one potential complicating factor is Na + channel splicing, apart from that associated with HF. There may be other conditions that affect it. Sample size should be large enough for statistical correction of other factors, and identification of such factors can lead to risk mitigation strategies. For example, splicing can be affected by cardiomyopathy type, race, gender or EF and will be investigated. Applicants' preliminary data indicate that age does not affect variant abundance in F-IF patients (data not shown). Moreover, even if this retrospective trial is positive, it is recognized that a prospective, multicenter trial is required to firmly establish the usefulness of Na + channel variants in the prediction of ICD events.

(Example 15)
This example shows a test to identify patients who are safe to administer antiarrhythmic drugs.

  Patients with ICD and taking antiarrhythmic drugs are enrolled in this study. This protects the patient from any adverse arrhythmogenic events of the drug. The level of sodium channel variant, sodium channel splicing factor and / or endoplasmic reticulum stress response (UPR) is assessed prior to the initiation of an antiarrhythmic drug regimen. In the case of ventricular arrhythmia safety and efficacy or onset / relapse of atrial arrhythmia, the patient is monitored for its reasonable shock risk after initiating the drug. The use of these drugs in atrial arrhythmias is more common and represents a larger market.

  Proportional hazard regression, median time to arrhythmia estimation and proportional endpoint-free are used to analyze the difference in time to associated arrhythmia. Cox proportional hazard regression is used to affect performance including age, gender, body mass index, blood pressure, NYHA classification, hypertension, smoking, previous CV count, LA size, estimated LV ejection fraction and LV wall thickness After adjusting for possible variables, the hazard ratio of the test endpoint is derived. In the analysis, the time to onset of the associated arrhythmia is a dependent variable, with baseline marker levels, demographics and clinical variables functioning as independent variables. This approach tests whether treatment outcome is predicted by marker level. Modeling takes into account that statins, ACE inhibitors / ARBs, nitrates and other drugs can affect our markers by including dummy indicator variables for these treatments. Model discrimination is assessed by the overall C index, verified by the bootstrap method, and adapted by examining the relationship between recurrent arrhythmias foreseen and observed over a range of events foreseen. Proportional hazard assumptions are checked in a variety of ways (examination of log-log plots, Schoenfeld residue tests, inclusion of terms representing time-dependent interactions between each independent variable and time). Results are reported as hazard ratios and their associated 95% confidence intervals. The significance of this hazard ratio is tested by a likelihood ratio test. If the hypothesis is true, the therapy should reduce the hazard ratio of AF or AFlut recurrence and reduce markers of oxidative stress. The secondary endpoint of intervention ability to reduce oxidative stress on day 30 is analyzed by paired t-test and multiple regression techniques to adjust the covariates.

The overall, adjusted R ² is interpreted as a measure of goodness of fit. Because of the null hypothesis that the coefficient of the independent variable in question is equal to zero, we use a model refined using a stepwise backward procedure, excluding variables above the value of p = 0.05. Assumptions in the analysis, such as the linearity of the term, examine the scatter plot of the independent variable with respect to the residue study and the dependent variable. If non-linearity is detected, attempt variable transformation or non-linear model fitting and evaluate terms for its model improvement. The normality of the variable distribution is tested by a normal probability plot and a Shapiro-Wilk test. Regression is quite resistant to infringement in this regard, but transformations are investigated as appropriate. Equal dispersibility is assessed by a plot of residue versus predicted value. If the assumption appears to be violated, Applicants will consider non-parametric methods (eg, the Kruskall-Wallis test).

  All references, including publications, patent applications, and patents cited herein are hereby individually and specifically shown as if each reference was incorporated by reference. Are incorporated by reference to the same extent as if they were written in their entirety.

  The use of the terms “a” and “an” and “the” and similar directives in the context of describing the present invention (especially in the context of the following claims) Unless otherwise indicated, or unless clearly contradicted by context, this should be interpreted as covering both the singular and plural. The terms “including”, “having”, “including” and “containing” unless otherwise indicated are open-ended terms (ie, including but not limited to “etc.”). Meaning).

  The description of a range of values herein serves only as a shorthand way to individually point to each distinct value and each endpoint that falls within the range, unless otherwise stated herein. For purposes of illustration, each distinct value and endpoint is incorporated herein as if it were individually described herein.

  All methods described herein may be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. it can. The use of any and all specific examples or exemplary languages (e.g., "etc.") provided herein is solely for the purpose of fully illuminating the present invention and, unless stated otherwise, No limitation is imposed on the scope of the invention. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

  Preferred embodiments of this invention are described herein, such as the best mode known to the inventors for carrying out the invention. Those skilled in the art will appreciate variations of the preferred embodiments upon reading the foregoing description. The inventors anticipate that those skilled in the art will make appropriate use of such variants, and that the inventors will implement the invention in a manner other than that specifically described herein. Contemplate. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described components in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context. Is done.

Claims (147)

A method for determining a subject's need for ICD, comprising:
The level of truncated SCN5A exon 28 transcript in a biological sample obtained from the subject,
(I) the level of full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of total SCN5A exon 28 transcript in the biological sample or (iii) the level of full-length SCN5A exon 28 transcript in the biological sample and Determining the ratio R _S to be compared to the level of one or more truncated SCN5A exon 28 transcripts. The method of claim 1, wherein the subject requires ICD if R _S is greater than or equal to a threshold ratio R _{T. RT} represents the level of truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject,
(I) the level of full length SCN5A exon 28 transcript of the biological sample obtained from the control subject or (ii) the level of total SCN5A exon 28 transcript of the biological sample obtained from the control subject or (iii) the control A ratio relative to the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcript of said biological sample obtained from a subject;
The control subject is
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
3. The method of claim 2, wherein the method is a subject known to be (iv) free of diastolic dysfunction or (v) a combination thereof. R _T = μ + 4.0σ,
Where μ = is the average value of a Gaussian distribution of a set of data values,
Each data value in the set represents the level of truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject,
(I) the level of full length SCN5A exon 28 transcript of the biological sample obtained from the control subject or (ii) the level of total SCN5A exon 28 transcript of the biological sample obtained from the control subject or (iii) the control Representing the level of the full-length SCN5A exon 28 transcript of the biological sample obtained from the subject and the ratio compared to the level of one or more truncated SCN5A exon 28 transcripts;
The control subject is
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
The method of claim 2, wherein (iv) is an object known not to have diastolic dysfunction, or (v) a combination thereof, and σ is a standard deviation of a Gaussian distribution of the data values. _RT represents the level of truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject,
(I) the level of full length SCN5A exon 28 transcript of the biological sample obtained from the control subject or (ii) the level of total SCN5A exon 28 transcript of the biological sample obtained from the control subject or (iii) the control A ratio relative to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of the biological sample obtained from the subject, wherein the control subject shocks the control subject The method of claim 2, wherein the subject is known to have an unequal ICD. R _T = μ + Xσ, where μ = is the mean value of a Gaussian distribution of a set of data values, each data value of the set being a truncated SCN5A exon 28 transcript of a biological sample obtained from a control subject Product level,
(I) the level of full length SCN5A exon 28 transcript of the biological sample obtained from the control subject or (ii) the level of total SCN5A exon 28 transcript of the biological sample obtained from the control subject or (iii) the control The level of full-length SCN5A exon 28 transcript of the biological sample obtained from the subject and the ratio compared to the level of one or more truncated SCN5A exon 28 transcripts, wherein the control subject shocks the control subject 3. An object known to have a rare ICD, σ is the standard deviation of a Gaussian distribution of the data values, and X is a number between 0.7 and 4.0. The method described in 1. R _T = μ−Xσ, where μ = is the average value of a Gaussian distribution of a set of data values, each data value of the set represents a ratio, and the control object is the control object Is a subject known to have an ICD that has never shocked, and the control subject is a subject known to have an ICD that has shocked the control subject, and σ is the The method of claim 2, wherein the standard deviation is a Gaussian distribution of data values, and X is a number between 0.7 and 4.0.   The method of claim 7, wherein X is a number between about 0.7 and about 1.0.   The method of claim 7, wherein X is a number between about 2.0 and about 4.0.   The method of claim 9, wherein X is a number between about 2.326 and about 4.0. (A) when _RS is determined, obtained from said subject (i) the level of truncated SCN5A exon 28 transcript of said biological sample or (ii) the level of full-length SCN5A exon 28 transcript of said biological sample or (Iii) the level of total SCN5A exon 28 transcript in the biological sample is normalized to the level of housekeeping genes in the biological sample obtained from the subject;
(B) when _RT is determined, obtained from said subject (i) the level of truncated SCN5A exon 28 transcript of said biological sample or (ii) the level of full-length SCN5A exon 28 transcript of said biological sample or (Iii) the level of total SCN5A exon 28 transcript in the biological sample is normalized to the level of housekeeping gene in the biological sample obtained from the control subject, or (C) (A) and (B) And the method according to any one of the preceding claims.   The method according to claim 11, wherein the housekeeping gene is glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin. R _S is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Or R _S is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
A method according to any one of the preceding claims. When R _T = μ + Xσ, the ratio of the biological sample obtained from the control subject =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([ICt patient (−) full length SCN5A exon 28 transcript Ct of shock] − [control sample full length SCN5A exon 28 transcript Ct])
ΔCt _{truncation type} = ([Ct of ICD patient (−) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (−) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (−) shock” is a biological sample obtained from a subject known to have an ICD that has never shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Alternatively, if R _T = μ + Xσ, the ratio of the biological sample obtained from the control subject =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in ICD patients (-) shock]-[Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (−) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (−) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (−) shock” is a biological sample obtained from a subject known to have an ICD that has never shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
14. A method according to any one of claims 6 and 11-13. When R _T = μ−Xσ, the ratio of the biological sample obtained from the control subject is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of ICD patient (+) shock] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (+) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (+) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (+) shock” is a biological sample obtained from a subject known to have an ICD that has shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Alternatively, if R _T = μ−Xσ, the ratio of the biological sample obtained from the control subject is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in ICD patient (+) shock]-[Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (+) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (+) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (+) shock” is a biological sample obtained from a subject known to have an ICD that has shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
The method according to any one of claims 7 to 13. 16. A method according to any one of claims 13-15, wherein each mRNA level is determined by real time polymerase chain reaction ( _RT- PCR).   Any one of the preceding claims, wherein the level of the truncated SCN5A exon 28 transcript is the level of SCN5A exon 28 splice variant C (E28C) or the level of SCN5A exon 28 splice variant D (E28D). The method described in 1.   18. The method of claim 17, wherein the level of truncated SCN5A exon 28 transcript is a level of E28C and E28D.   The level of the truncated SCN5A exon 28 transcript is compared to (i) the level of WT SCN5A exon 28 transcript, (ii) the level of E28A-S or (iii) a combination of (i) and (ii). A method according to any one of the preceding claims.   The method of any preceding claim, wherein the level of the truncated SCN5A exon 28 transcript is compared to all levels of WT SCN5A exon 28 transcript, E28A-S, E28B, E28C and E28D. The method described. The level of the truncated SCN5A exon 28 transcript is compared to the levels of (A) and (B);
(A) is one of (i) a level of WT SCN5A exon 28 transcript, (ii) a level of E28A-S or (iii) a combination of (i) and (ii);
(B) is one or more of E28B, E28C and E28D.
A method according to any one of the preceding claims.   21. The method of claim 19 or 20, wherein the truncated SCN5A exon 28 transcript is E28C. R _S = R _E28C =

Where
Calibration abundance of ^{E28C transcript} = 2- ^{ΔΔCtE28C transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{E28C transcript} = ΔCt _{E28C transcript} -ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _E28C = ([Ct of E28C transcript of target sample] − [Ct of E28C transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Or R _E28C =

Where
Calibration abundance of ^{E28C transcript} = 2- ^{ΔΔCtE28C transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{E28C transcript} = ΔCt _{E28C transcript} -ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _E28C = ([Ct of E28C transcript of target sample] − [Ct of E28C transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
The method of claim 22.   The method according to claim 19 or 21, wherein the truncated SCN5A exon 28 transcript is E28D. R _S = R _E28D =

Where
Calibration abundance of ^{E28D transcript} = 2- ^{ΔΔCtE28D transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{E28D transcript} = ΔCt _{E28D transcript} -ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _E28D = ([Ct of E28D transcript of target sample] − [Ct of E28D transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Or R _E28D =

Where
Calibration abundance of ^{E28D transcript} = 2- ^{ΔΔCtE28D transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{E28D transcript} = ΔCt _{E28D transcript} -ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _E28D = ([Ct of E28D transcript of target sample] − [Ct of E28D transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
25. A method according to claim 24. Determining a first R _S and a second R _S , wherein the first R _S compares the level of E28C with the level of total SCN5A exon 28 transcript, and the second R S 26. The method of any one of claims 22-25, wherein _S compares the level of E28D with the level of total SCN5A exon 28 transcript. 27. The method of claim 26, wherein the first R _S is RE28C and the second R _S is E28D. A method for determining a subject's need for an implantable defibrillator (ICD) comprising:
(A) the level of a truncated SCN5A exon 28 transcript of the biological sample of interest, (i) the level of full-length SCN5A exon 28 transcript of the biological sample or (ii) the total SCN5A exon 28 transcript of the biological sample Determining the ratio R _s , or (iii) comparing the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of said biological sample;
(B) comparing R _S determined in (A) with a threshold ratio R _T , wherein R _T is determined by the system according to any one of claims 97 to 108;
Including a method. 30. The method of claim 28, wherein the subject requires ICD if Rs is greater than or equal to _RT . A method of determining a subject's risk for sudden visceral death (SCD) comprising:
The level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample. Or (iii) determining a ratio R _s that is compared to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in the biological sample. 31. The method of claim 30, wherein the subject is at risk for SCD if Rs is greater than or equal to a threshold ratio _RT . A method for determining a subject's need for antiarrhythmic therapy comprising:
The level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample. Or (iii) determining a ratio R _s that is compared to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in the biological sample. 35. The method of claim 32, wherein the subject requires antiarrhythmic therapy if Rs is greater than or equal to a threshold ratio _RT .   34. The method of claim 32 or 33, wherein the antiarrhythmic agent is a Singh Vaghan Williams class IA, IB, IC or III antiarrhythmic agent.   34. The method of claim 32 or 33, wherein the Singh Vaghan Williams class IA antiarrhythmic agent is quinidine, procainamide or disopyramide.   34. The method of claim 32 or 33, wherein the Singh Vaghan Williams class IB antiarrhythmic agent is lidocaine, phenytoin, mexiletine or tocainide.   34. The method of claim 32 or 33, wherein the Singh Vaughan Williams class IC antiarrhythmic agent is flecainide, propafenone, moricidin or encainide.   34. The method of claim 32 or 33, wherein the Singh Vaghan Williams class III antiarrhythmic agent is dronedarone, amiodarone, or ibutilide.   34. The method of claim 32 or 33, wherein the antiarrhythmic agent is NAD + or mitoTEMPO. A method for reducing the risk of sudden cardiac death (SCD) in a subject comprising:
(A) comparing the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject to the level of (i) the full-length SCN5A exon 28 transcript or (ii) the level of the entire SCN5A exon 28 transcript; Determining a ratio Rs;
(B) if Rs is increased compared to the threshold ratio _RT , implanting ICD in the subject;
A method comprising the steps of: _RT represents the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample obtained from the control subject, or (ii) Level of total SCN5A exon 28 transcript of the biological sample obtained from a control subject or (iii) level of full length SCN5A exon 28 transcript of the biological sample obtained from the control subject and one or more truncated SCN5A exon 28 Ratio compared to transcript level, wherein the control subject is (i) not having ICD, (ii) not heart disease, (iii) having normal left ventricular function, (iv) dilated function Claims 31 and 33 to 33, which are subjects that are known to be free or (v) a combination thereof. 41. The method according to any one of 40. R _T = μ + 4.0σ, where μ = is the mean of a Gaussian distribution of a set of data values, each data value of the set being a truncated SCN5A exon of a biological sample obtained from a control subject 28 transcript levels of (i) the full-length SCN5A exon 28 transcript of the biological sample obtained from the control subject or (ii) the total SCN5A exon 28 transcript of the biological sample obtained from the control subject. Level or (iii) the ratio of the biological sample obtained from the control subject to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcript, the control subject comprising: (I) have no ICD, (ii) not have heart disease, (iii) have normal left ventricular function, (iv 41. Any one of claims 31 and 33-40, wherein the subject is known not to have diastolic dysfunction, or (v) a combination thereof, and σ is the standard deviation of the Gaussian distribution of the data values. The method described in 1. _RT represents the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a control subject, (i) the level of a full-length SCN5A exon 28 transcript in the biological sample obtained from the control subject, or (ii) Level of total SCN5A exon 28 transcript of the biological sample obtained from a control subject or (iii) level of full length SCN5A exon 28 transcript of the biological sample obtained from the control subject and one or more truncated SCN5A exon 28 41. A ratio as compared to the level of transcript, wherein the control subject is a subject known to have an ICD that has not shocked the control subject. The method described in 1. R _T = μ + Xσ, where μ = is the mean value of a Gaussian distribution of a set of data values, each data value of the set being a truncated SCN5A exon 28 transcript of a biological sample obtained from a control subject The level of product is either (i) the level of full-length SCN5A exon 28 transcript of the biological sample obtained from the control subject or (ii) the level of total SCN5A exon 28 transcript of the biological sample obtained from the control subject or (Iii) represents the level of full-length SCN5A exon 28 transcript of the biological sample obtained from the control subject and the ratio compared to the level of one or more truncated SCN5A exon 28 transcript, wherein the control subject comprises the control The subject is known to have an ICD that has not shocked the subject, and σ is the gauss of the data value. 41. A method according to any one of claims 31 and 33 to 40, wherein the standard deviation of the us distribution and X is a number between 0.7 and 4.0. R _T = μ−Xσ, where μ = is the average value of a Gaussian distribution of a set of data values, each data value of the set represents a ratio, and the control object is the control object Is a subject known to have an ICD that has never shocked, and the control subject is a subject known to have an ICD that has shocked the control subject, and σ is the 41. A method according to any one of claims 31 and 33 to 40, wherein the standard deviation of the Gaussian distribution of data values and X is a number between 0.7 and 4.0.   46. The method of claim 45, wherein X is a number between about 0.7 and about 1.0.   46. The method of claim 45, wherein X is a number between about 2.0 and about 4.0.   48. The method of claim 47, wherein X is a number between about 2.326 and about 4.0. (A) when _RS is determined, obtained from said subject (i) the level of truncated SCN5A exon 28 transcript of said biological sample or (ii) the level of full-length SCN5A exon 28 transcript of said biological sample or (Iii) the level of total SCN5A exon 28 transcript in the biological sample is normalized to the level of housekeeping genes in the biological sample obtained from the subject;
(B) when _RT is determined, obtained from said subject (i) the level of truncated SCN5A exon 28 transcript of said biological sample or (ii) the level of full-length SCN5A exon 28 transcript of said biological sample or (Iii) the level of total SCN5A exon 28 transcript in the biological sample is normalized to the level of housekeeping gene in the biological sample obtained from the control subject, or (C) (A) and (B) Both
49. A method according to any one of claims 30 to 48.   50. The method of claim 49, wherein the housekeeping gene is glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin. R _S is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Or R _S is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _{cleavage type} = ([Ct of the cleaved SCN5A exon 28 transcript of the target sample] − [Ct of the cleaved SCN5A exon 28 transcript of the control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
51. A method according to any one of claims 28-50. When R _T = μ + Xσ, the ratio of the biological sample obtained from the control subject =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([ICt patient (−) full length SCN5A exon 28 transcript Ct of shock] − [control sample full length SCN5A exon 28 transcript Ct])
ΔCt _{truncation type} = ([Ct of ICD patient (−) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (−) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (−) shock” is a biological sample obtained from a subject known to have an ICD that has never shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Alternatively, if R _T = μ + Xσ, the ratio of the biological sample obtained from the control subject =

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in ICD patients (-) shock]-[Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (−) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (−) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (−) shock” is a biological sample obtained from a subject known to have an ICD that has never shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
52. The method according to any one of claims 44 and 49-51. When R _T = μ−Xσ, the ratio of the biological sample obtained from the control subject is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of ICD patient (+) shock] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (+) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (+) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (+) shock” is a biological sample obtained from a subject known to have an ICD that has shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Alternatively, if R _T = μ−Xσ, the ratio of the biological sample obtained from the control subject is

Where
Calibration abundance of ^{truncated SCN5A exon 28 transcript} = 2- ^{ΔΔCt truncated SCN5A exon 28 transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{truncated SCN5A exon 28 transcript} = ΔCt _truncated −ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts in ICD patient (+) shock]-[Ct of all SCN5A exon 28 transcripts in control sample])
ΔCt _{truncation type} = ([Ct of ICD patient (+) shock truncation SCN5A exon 28 transcript] − [Ct of truncation SCN5A exon 28 transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of ICD patient (+) shock] − [Ct of housekeeping gene of control sample])
An “ICD patient (+) shock” is a biological sample obtained from a subject known to have an ICD that has shocked,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
52. A method according to any one of claims 45 to 51. 54. The method of any one of claims 28-53, wherein each level is determined by real-time polymerase chain reaction ( _RT- PCR).   55. The method of any one of claims 28 to 54, wherein the level of the truncated SCN5A exon 28 transcript is a level of SCN5A exon 28 splice variant C (E28C) or a level of SCN5A exon 28 splice variant D (E28D). The method described.   56. The method of claim 55, wherein the level of truncated SCN5A exon 28 transcript is a level of E28C and E28D.   The level of the truncated SCN5A exon 28 transcript is compared to (i) the level of WT SCN5A exon 28 transcript, (ii) the level of E28A-S or (iii) a combination of (i) and (ii) 57. A method according to any one of claims 28 to 56.   57. The level of any of the truncated SCN5A exon 28 transcripts is compared to all levels of WT SCN5A exon 28 transcripts, E28A-S, E28B, E28C and E28D. the method of. The level of the truncated SCN5A exon 28 transcript is compared to the levels of (A) and (B);
(A) is one of (i) a level of WT SCN5A exon 28 transcript, (ii) a level of E28A-S or a combination of (iii) (i) and (ii);
(B) is one or more of E28B, E28C and E28D.
57. A method according to any one of claims 28 to 56.   59. The method of claim 57 or 58, wherein the truncated SCN5A exon 28 transcript is E28C. R _S = R _E28C =

Where
Calibration abundance of ^{E28C transcript} = 2- ^{ΔΔCtE28C transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{E28C transcript} = ΔCt _{E28C transcript} -ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _E28C = ([Ct of E28C transcript of target sample] − [Ct of E28C transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Or R _E28C =

Where
Calibration abundance of ^{E28C transcript} = 2- ^{ΔΔCtE28C transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{E28C transcript} = ΔCt _{E28C transcript} -ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _E28C = ([Ct of E28C transcript of target sample] − [Ct of E28C transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
61. The method of claim 60.   59. The method of claim 57 or 58, wherein the truncated SCN5A exon 28 transcript is E28D. R _S = R _E28D =

Where
Calibration abundance of ^{E28D transcript} = 2- ^{ΔΔCtE28D transcript}
Calibration abundance of ^{full length SCN5A exon 28 transcript} = 2- ^{ΔΔCt full length SCN5A exon 28 transcript}
ΔΔCt _{full length SCN5A exon 28 transcript} = ΔCt _{full length} −ΔCt _{housekeeping gene}
ΔΔCt _{E28D transcript} = ΔCt _{E28D transcript} -ΔCt _{housekeeping gene}
ΔCt _{full length} = ([Ct of full length SCN5A exon 28 transcript of subject sample] − [Ct of full length SCN5A exon 28 transcript of control sample])
ΔCt _E28D = ([Ct of E28D transcript of target sample] − [Ct of E28D transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Full length” refers to WT SCN5A exon 28 transcript or E28A-S transcript or both WT SCN5A exon 28 transcript and E28A-S transcript.
Or R _E28D =

Where
Calibration abundance of ^{E28D transcript} = 2- ^{ΔΔCtE28D transcript}
Calibration abundance of ^{total SCN5A exon 28 transcript} = 2- ^{ΔΔCt total SCN5A exon 28 transcript}
ΔΔCt _{total SCN5A exon 28 transcript} = ΔCt _{total SCN5A exon 28 transcript} -ΔCt _{housekeeping gene}
ΔΔCt _{E28D transcript} = ΔCt _{E28D transcript} -ΔCt _{housekeeping gene}
ΔCt _{total SCN5A exon 28 transcript} = ([Ct of all SCN5A exon 28 transcripts of subject sample] − [Ct of all SCN5A exon 28 transcripts of control sample])
ΔCt _E28D = ([Ct of E28D transcript of target sample] − [Ct of E28D transcript of control sample])
ΔCt _{housekeeping gene} = ([Ct of housekeeping gene of target sample] − [Ct of housekeeping gene of control sample])
"Target sample" is a biological sample obtained from the target,
The “control sample”
(I) has no ICD,
(Ii) not heart disease,
(Iii) has normal left ventricular function,
(Iv) a biological sample obtained from a control subject known not to have diastolic dysfunction, or (v) a combination thereof,
“Total SCN5A exon 28 transcript” refers to all of WT, E28A-S, E28B, E28C and E28D.
64. The method of claim 62. Determining a first R _S and a second R _S , wherein the first R _S compares the level of E28C with the level of total SCN5A exon 28 transcript, and the second R _S R _S is, comparing the level of E28D and the level of total SCN5A exon 28 transcript a method according to any one of claims 28 to 63. 65. The method of claim 64, wherein the first R _S is RE28C and the second R _S is E28D. A method for determining a subject's risk for arrhythmia, comprising:
The level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample. Or (iii) determining a ratio Rs that is compared to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in the biological sample. 68. The method of claim 66, wherein the subject is at risk for arrhythmia if Rs is greater than or equal to a threshold ratio _RT .   68. The method of claim 66 or 67, wherein the arrhythmia is an atrial arrhythmia, optionally atrial fibrillation. A method for determining a subject's risk for heart failure, comprising:
The level of a truncated SCN5A exon 28 transcript in a biological sample obtained from a subject is expressed as (i) the level of a full-length SCN5A exon 28 transcript in the biological sample or (ii) the level of the total SCN5A exon 28 transcript in the biological sample. Or (iii) determining a ratio Rs that is compared to the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in the biological sample. 70. The method of claim 69, wherein the subject is at risk for heart failure if R _s is greater than or equal to a threshold ratio _RT .   Measuring (i) the level of full-length SCN5A exon 28 transcript, (ii) the level of truncated SCN5A exon 28 or (iii) the level of total SCN5A exon 28 transcript of a biological sample obtained from said subject, A method according to any one of the preceding claims.   72. The method of claim 71, wherein said measuring comprises performing a polymerase chain reaction, optionally real time PCR. (A) measuring (i) the level of full-length SCN5A exon 28 transcript, (ii) the level of truncated SCN5A exon 28 or (iii) the level of total SCN5A exon 28 transcript of a biological sample obtained from said subject When,
(B) obtaining from said subject's medical record (i) the level of full-length SCN5A exon 28 transcript, (ii) the level of truncated SCN5A exon 28 or (iii) the level of total SCN5A exon 28 transcript;
73. The method of claim 71 or 72, comprising:   The method according to any one of the preceding claims, comprising the step of giving the subject an antiarrhythmic therapy.   75. The method of claim 74, comprising implanting the ICD in a subject that has been determined to need to be implanted.   76. The method of claim 74 or 75, comprising administering an antiarrhythmic agent to the subject.   77. The method of claim 76, wherein the antiarrhythmic agent is a sodium channel blocker. Any one of the preceding claims, comprising: (i) obtaining a biological sample from the subject every 6-12 months; and (ii) determining the R _{S of} each obtained biological sample. The method described in 1.   The method according to any one of the preceding claims, comprising the step of determining the level of SCN5A splicing factor or UPR protein or chaperone protein in said sample.   80. The method of claim 79, comprising determining the level of hLuc7A, RBM25 or PERK.   80. The method of claim 79, wherein the chaperone protein is CHOP or calnexin.   The method according to any one of the preceding claims, wherein the biological sample comprises white blood cells, heart cells or muscle cells from the subject.   84. The method of claim 82, wherein the biological sample is blood from the subject.   The method of any one of the preceding claims, wherein the subject suffers from a chronic left ventricular ejection fraction of less than 50% or about 50%.   85. The method of claim 84, wherein the subject suffers from a chronic left ventricular ejection fraction of less than 40% or about 40%.   86. The method of claim 85, wherein the subject suffers from a chronic left ventricular ejection fraction of less than 35% or about 35%.   The subject suffers from (i) non-ischemic dilated cardiomyopathy or ischemic heart disease at least 40 days after myocardial infarction; (ii) chronically receiving medical therapy but with NYHA functional class II or III A method according to any one of the preceding claims which is classified as a subject or is (iii) (i) and (ii) both.   The method of any one of the preceding claims, wherein the subject has structural heart disease.   84. The method of any one of claims 30-44 and 46-83, wherein the subject has an ICD.   The method of any one of the preceding claims, wherein the subject has been diagnosed with HF. A kit,
(A) an E28C binder and / or an E28D binder,
(B) A kit comprising a WT SCN5A binding agent and / or an E28A-S binding agent, and instructions for use.   92. The kit of claim 91 further comprising a binding agent for all SCN5A exon 28 transcripts: WT, E28A-S, E28B, E28C and E28D.   93. The kit according to claim 91 or 92, wherein the binding agent is a nucleic acid. A kit,
(I) each data value is a plurality of data values that are ratios determined from a biological sample obtained from a subject of the first population, wherein said ratio is the level of truncated SCN5A exon 28 transcript ( i) the level of full-length SCN5A exon 28 transcript of the biological sample or (ii) the level of total SCN5A exon 28 transcript of the biological sample or (iii) the level of full-length SCN5A exon 28 transcript of the biological sample and 1 Or a plurality of data values, wherein each subject of said first population is a subject known to have a shocked ICD as compared to the level of a plurality of truncated SCN5A exon 28 transcripts,
(II) a Gaussian distribution of the plurality of data values;
(IV) Average value and standard deviation of the Gaussian distribution or (V) Threshold ratio R _T based on the average value and standard deviation of the Gaussian distribution of the plurality of data values
Or a computer-readable storage medium storing the above or a kit including access to any one or more of (I) to (V). A kit,
(I) each data value is a plurality of data values that are ratios determined from a biological sample obtained from a subject of the first population, wherein said ratio is the level of truncated SCN5A exon 28 transcript ( i) level of full-length SCN5A exon 28 transcript in the biological sample or (ii) level of total SCN5A exon 28 transcript in the biological sample or (iii) level of full-length SCN5A exon 28 transcript in the biological sample and 1 Or a plurality of data values, wherein each subject of said first population is a subject known to have an ICD that has never shocked, as compared to the level of a plurality of truncated SCN5A exon 28 transcripts,
(II) a Gaussian distribution of the plurality of data values;
(IV) an average value and standard deviation of the Gaussian distribution or (V) a threshold ratio R _T based on the average value and the standard deviation of the Gaussian distribution of the plurality of data values
Or a computer-readable storage medium storing the above or a kit including access to any one or more of (I) to (V). A kit,
(I) each data value is a plurality of data values that are ratios determined from a biological sample obtained from a subject of the first population, wherein said ratio is the level of truncated SCN5A exon 28 transcript ( i) the level of full-length SCN5A exon 28 transcript of the biological sample or (ii) the level of total SCN5A exon 28 transcript of the biological sample or (iii) the level of full-length SCN5A exon 28 transcript of the biological sample and 1 Or compared to the levels of multiple truncated SCN5A exon 28 transcripts, each subject of the first population has (I) no ICD, (II) no heart disease, (III) normal left A plurality of data values having a ventricular function, (IV) no diastolic dysfunction, or (V) a subject known to be a combination of these,
(II) a Gaussian distribution of the plurality of data values;
(IV) an average value and standard deviation of the Gaussian distribution or (V) a threshold ratio R _T based on the average value and the standard deviation of the Gaussian distribution of the plurality of data values
Or a computer-readable storage medium storing the above or a kit including access to any one or more of (I) to (V). A system,
A processor;
A memory device coupled to the processor, the memory device being executed by the processor;
(I) Each data value is a plurality of data values that are ratios determined from a biological sample obtained from a subject of the first population, wherein the ratio is a truncated SCN5A exon 28 of the biological sample obtained from the subject. Transcript levels can be expressed as (A) full-length SCN5A exon 28 transcript level of the biological sample or (B) total SCN5A exon 28 transcript level of the biological sample or (C) full-length SCN5A exon of the biological sample. Each subject of said first population is known to have an ICD that has shocked, compared to the level of 28 transcripts and the level of one or more truncated SCN5A exon 28 transcripts Accept multiple data values,
(Ii) fitting the plurality of data values to a first Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the first Gaussian distribution;
(Iv) Let the first threshold ratio _RT be set to μ−Xσ, where X is a number between 0.7 and 4.0,
A memory device for storing machine-readable instructions;
Including system. 98. The system of claim 97, wherein _RT = [mu] -X [sigma] and X is a number between 0.7 and 1.0. 98. The system of claim 97, wherein _RT = [mu] -X [sigma] and X is a number between 2.0 and 4.0. 100. The system of claim 99, wherein R _T = μ−Xσ, and X is a number between 2.326 and 4.0. 101. The system of any one of claims 97-100, comprising machine-readable instructions that when executed by the processor cause the processor to receive Rs as an input and compare Rs to _RT . 102. The system of claim 101, comprising machine readable instructions that, when executed by the processor, cause the processor to present an output indicating a relationship between Rs and _RT . When executed by the processor, the processor
(I) each of the second plurality of data values is a second plurality of data values that is a ratio determined from a biological sample obtained from a second population of objects, wherein the ratio is the object The level of the truncated SCN5A exon 28 transcript of the biological sample obtained from (A) the level of the full-length SCN5A exon 28 transcript of the biological sample or (B) the level of the total SCN5A exon 28 transcript of the biological sample or (C) comparing the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of the biological sample, each subject of the second population was shocked Receiving a second plurality of data values that are known to have no ICD;
(Ii) fitting the second plurality of data values to a second Gaussian distribution;
(Iii) determining the mean value μ and the standard deviation σ of the second Gaussian distribution;
(Iv) The second threshold ratio R _T2 is set to μ + Xσ, where X is a number between 0.7 and 4.0,
103. A system according to any one of claims 97 to 102, comprising machine readable instructions. 104. The system of claim 103, wherein R _T2 = μ + Xσ, and X is a number between 0.7 and 1.0. 104. The system of claim 103, wherein R _T2 = μ + Xσ, and X is a number between 2.0 and 4.0. 106. The system of claim 105, wherein R _T2 = μ + Xσ, and X is a number between 2.326 and 4.0. When executed by the processor, the processor
(I) a third plurality of data values, wherein each data value of the third plurality of data values is a ratio determined from a biological sample obtained from a target of the second population, wherein the ratio is the target The level of the truncated SCN5A exon 28 transcript of the biological sample obtained from (A) the level of the full-length SCN5A exon 28 transcript of the biological sample or (B) the level of the total SCN5A exon 28 transcript of the biological sample or (C) comparing the level of full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcript, each subject of the third population has (I) ICD Not (II) not heart disease, (III) have normal left ventricular function, (IV) no diastolic dysfunction, or (V) combinations thereof There it was does not receive a third plurality of data values is a known object,
(Ii) fitting the third plurality of data values to a third Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the third Gaussian distribution;
(Iv) The third threshold ratio R _T3 is set to μ + 4.0σ.
107. A system according to any one of claims 97 to 106, comprising machine readable instructions. When executed by the processor, the processor is configured to maximize the area under the curve of the first Gaussian distribution and minimize the area under the curve of the second Gaussian distribution. 108. A system according to any one of claims 103 to 107, comprising machine readable instructions for setting a _{T combination} . A system,
A processor;
A memory device coupled to the processor, the memory device being executed by the processor;
(I) Each data value of a plurality of data values is a plurality of data values that are ratios determined from a biological sample obtained from a target of a group, and the ratio is a truncated SCN5A of the biological sample obtained from the target The level of exon 28 transcript is expressed as (A) the full-length SCN5A exon 28 transcript level of the biological sample or (B) the level of the total SCN5A exon 28 transcript of the biological sample or (C) the full length of the biological sample. A plurality of subjects in which each subject of the population is known to have an ICD that has never shocked as compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts Receive the data value of
(Ii) fitting the plurality of data values to a Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the Gaussian distribution;
(Iv) Let the threshold ratio R _T2 be set to μ + Xσ, where X is a number between 0.7 and 4.0,
A memory device for storing machine-readable instructions;
Including system. 110. The system of claim 109, wherein R _T2 = μ + Xσ, and X is a number between 0.7 and 1.0. 110. The system of claim 109, wherein R _T2 = μ + Xσ, and X is a number between 2.0 and 4.0. 112. The system of claim 111, wherein R _T2 = μ + Xσ, and X is a number between 2.326 and 4.0. A system,
When executed by a processor, the processor
(I) Each data value of a plurality of data values is a plurality of data values that are ratios determined from a biological sample obtained from a target of a group, and the ratio is a truncated SCN5A of the biological sample obtained from the target The level of exon 28 transcript is expressed as (A) the full-length SCN5A exon 28 transcript level of the biological sample or (B) the level of the total SCN5A exon 28 transcript of the biological sample or (C) the full length of the biological sample. Each subject of the population compared to the level of SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts, (I) not having ICD, (II) not having heart disease, In subjects known to have (III) normal left ventricular function, (IV) no diastolic dysfunction, or (V) a combination thereof A plurality of data values not receive that,
(Ii) fitting the plurality of data values to a Gaussian distribution;
(Iii) determining the mean value μ and standard deviation σ of the Gaussian distribution;
(Iv) The threshold ratio R _T3 is set to μ + 4.0σ.
A system containing machine-readable instructions. A computer readable storage medium storing machine readable instructions executable by a processor,
(I) instructions for causing the processor to receive a plurality of data values, each data value being a ratio determined from a biological sample obtained from a first population of subjects, wherein the ratio is from the subject The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or ( C) Each subject of the first population has shocked as compared to the level of full-length SCN5A exon 28 transcript in the biological sample and the level of one or more truncated SCN5A exon 28 transcripts An instruction that is a subject known to have an ICD;
(Ii) instructions for adapting the plurality of data values to a first Gaussian distribution to the processor;
(Ii) instructions for causing the processor to determine an average value μ and a standard deviation σ of the first Gaussian distribution;
(Iii) An instruction for causing the processor to set the first threshold ratio _RT to μ−Xσ, wherein X is a number between 0.7 and 4.0. When,
A computer-readable storage medium including: 115. The computer readable storage medium of claim 114, wherein _RT = [mu] -X [sigma] and X is a number between 0.7 and 1.0. 115. The computer readable storage medium of claim 114, wherein _RT = [mu] -X [sigma] and X is a number between 2.0 and 4.0. 117. The computer readable storage medium of claim 116, wherein _RT = [mu] -X [sigma] and X is a number between 2.326 and 4.0. The processor to receive R _s as input, the R _s includes instructions for comparing the R _T, computer-readable storage medium according to any one of claims 114 to 117. To the processor, including instructions for presenting an output indicating the relationship between the R _s and R _T, computer-readable storage medium of claim 118. In the processor,
(I) each of the second plurality of data values is a second plurality of data values that is a ratio determined from a biological sample obtained from a second population of objects, wherein the ratio is the object The level of the truncated SCN5A exon 28 transcript of the biological sample obtained from (A) the level of the full-length SCN5A exon 28 transcript of the biological sample or (B) the level of the total SCN5A exon 28 transcript of the biological sample or (C) comparing the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of the biological sample, each subject of the second population was shocked Receiving a second plurality of data values that are known to have no ICD;
(Ii) fitting the second plurality of data values to a second Gaussian distribution;
(Iii) determining the mean value μ and the standard deviation σ of the second Gaussian distribution;
(Iv) The second threshold ratio R _T2 is set to μ + Xσ, where X is a number between 0.7 and 4.0,
120. The computer readable storage medium of any one of claims 114 to 119, comprising instructions for: 121. The computer readable storage medium of claim 120, wherein R _T2 = μ + Xσ, and X is a number between 0.7 and 1.0. 121. The computer readable storage medium of claim 120, wherein R _T2 = μ + Xσ, and X is a number between 2.0 and 4.0. 123. The computer readable storage medium of claim 122, wherein R _T2 = μ + Xσ, and X is a number between 2.326 and 4.0. In the processor,
(I) a third plurality of data values, wherein each data value of the third plurality of data values is a ratio determined from a biological sample obtained from a subject of the second population, wherein the ratio is from the subject The level of truncated SCN5A exon 28 transcript in the resulting biological sample is expressed as (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or ( C) comparing the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcript of said biological sample, each subject of said third population has (I) ICD Not (II) not heart disease, (III) have normal left ventricular function, (IV) no diastolic dysfunction, or (V) in these combinations Rukoto not have received a third plurality of data values is a known object,
(Ii) fitting the third plurality of data values to a third Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the third Gaussian distribution;
The computer-readable storage medium according to any one of claims 114 to 123, comprising: (iv) an instruction for setting the third threshold ratio R _T3 to μ + 4.0σ. Instruction for causing the processor to set a _combined threshold ratio _{RT combination in} that the area under the curve of the first Gaussian distribution is maximized and the area under the curve of the second Gaussian distribution is minimized. 125. A computer readable storage medium according to any one of claims 120 to 124, comprising: A computer readable storage medium storing machine readable instructions executable by a processor,
(I) instructions for causing the processor to receive a plurality of data values, wherein each data value of the plurality of data values is a ratio determined from a biological sample obtained from a population subject; , The level of the truncated SCN5A exon 28 transcript in the biological sample obtained from the subject, (A) the level of the full-length SCN5A exon 28 transcript in the biological sample or (B) the total SCN5A exon 28 transcript in the biological sample. Each subject of the population has not been shocked as compared to the level or (C) the level of full-length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts in the biological sample An instruction that is a subject known to have an ICD;
(Ii) instructions for adapting the plurality of data values to a Gaussian distribution to the processor;
(Iii) instructions for causing the processor to determine an average value μ and a standard deviation σ of the Gaussian distribution;
(Iv) an instruction for causing the processor to set the threshold ratio R _T2 to μ + Xσ, wherein X is a number between 0.7 and 4.0;
A computer-readable storage medium including: 127. The computer readable storage medium of claim 126, wherein R _T2 = μ + Xσ and X is a number between 0.7 and 1.0. 127. The computer readable storage medium of claim 126, wherein R _T2 = μ + Xσ, and X is a number between 2.0 and 4.0. 129. The computer readable storage medium of claim 128, wherein R _T2 = μ + Xσ, and X is a number between 2.326 and 4.0. A computer readable storage medium storing machine readable instructions executable by a processor,
(I) instructions for causing the processor to receive a plurality of data values, wherein each data value of the plurality of data values is a ratio determined from a biological sample obtained from a population subject; , The level of the truncated SCN5A exon 28 transcript in the biological sample obtained from the subject, (A) the level of the full-length SCN5A exon 28 transcript in the biological sample or (B) the total SCN5A exon 28 transcript in the biological sample. Each subject of the population has (I) ICD as compared to the level or (C) the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in the biological sample Not (II) not heart disease, (III) have normal left ventricular function, (IV) no diastolic dysfunction, or ( ) Is a known object that is a combination thereof, and instructions,
(Ii) instructions for adapting the plurality of data values to a Gaussian distribution to the processor;
(Iii) instructions for causing the processor to determine an average value μ and a standard deviation σ of the Gaussian distribution;
(Iv) an instruction for causing the processor to set the threshold ratio R _T3 to μ + 4.0σ;
A computer-readable storage medium including: A method implemented by a processor in a computer comprising:
(I) a step of receiving a plurality of data values, wherein each data value is a ratio determined from a biological sample obtained from a target of the first population, and the ratio is a cutting type of the biological sample obtained from the target The level of SCN5A exon 28 transcript is determined by: (A) the level of full-length SCN5A exon 28 transcript of the biological sample or (B) the level of total SCN5A exon 28 transcript of the biological sample; It is known that each subject of the first population has an ICD that has shocked as compared to the level of the long SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts The target step, and
(Ii) fitting the plurality of data values to a first Gaussian distribution;
(Ii) determining an average value μ and a standard deviation σ of the first Gaussian distribution;
(Iii) setting the first threshold ratio _RT to μ−Xσ, wherein X is a number between 0.7 and 4.0;
Including a method. 132. The method of claim 131, wherein _RT = [mu] -X [sigma] and X is a number between 0.7 and 1.0. 132. The method of claim 131, wherein _RT = [mu] -X [sigma] and X is a number between 2.0 and 4.0. 134. The method of claim 133, wherein R _T = μ-Xσ, and X is a number between 2.326 and 4.0. It receives _{R s} as input, comprising the step of comparing the _{R s} and _{R T,} the method according to any one of claims 131-134. 138. The method of claim 135, comprising presenting an output indicating a relationship between R _s and R _T. (I) receiving a second plurality of data values, wherein each data value of the second plurality of data values is a ratio determined from a biological sample obtained from a second population of subjects; The ratio is the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (A) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (B) the total SCN5A exon 28 in the biological sample. Each subject of the second population is compared to the level of transcript or (C) the level of full length SCN5A exon 28 transcript and the level of one or more truncated SCN5A exon 28 transcripts of the biological sample. A step known to have an ICD that has not been given
(Ii) fitting the second plurality of data values to a second Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the second Gaussian distribution;
(Iv) setting the second threshold ratio R _T2 to μ + Xσ, where X is a number between 0.7 and 4.0;
The method according to any one of claims 131 to 136, comprising: 138. The method of claim 137, wherein R _T2 = μ + Xσ, and X is a number between 0.7 and 1.0. 138. The method of claim 137, wherein R _T2 = μ + Xσ, and X is a number between 2.0 and 4.0. 140. The method of claim 139, wherein R _T2 = μ + Xσ and X is a number between 2.326 and 4.0. (I) receiving a third plurality of data values, wherein each data value of the third plurality of data values is a ratio determined from a biological sample obtained from a second population of subjects; The ratio is the level of a truncated SCN5A exon 28 transcript in a biological sample obtained from the subject, (A) the level of a full-length SCN5A exon 28 transcript in the biological sample, or (B) the total SCN5A exon 28 in the biological sample. Each subject of the third population is compared to the level of transcript or (C) the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in the biological sample, I) no ICD, (II) no heart disease, (III) normal left ventricular function, (IV) no diastolic dysfunction, or Is a known object that V) a combination thereof, a step,
(Ii) fitting the third plurality of data values to a third Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the third Gaussian distribution;
(Iv) setting the third threshold ratio R _T3 to μ + 4.0σ;
141. The method according to any one of claims 131 to 140, comprising: 137. Setting the _combined threshold ratio _{RT combination} to the point where the area under the curve of the first Gaussian distribution is maximized and the area under the curve of the second Gaussian distribution is minimized. 141. The method according to any one of. A method implemented by a processor in a computer comprising:
(I) a step of receiving a plurality of data values, wherein each data value of the plurality of data values is a ratio determined from a biological sample obtained from a target of a group, and the ratio is a living body obtained from the target The level of truncated SCN5A exon 28 transcript in the sample is determined by: (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C) Each subject of the population is known to have an ICD that has not been shocked as compared to the level of full-length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in a biological sample The steps that are the subject of
(Ii) fitting the plurality of data values to a Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the Gaussian distribution;
(Iv) setting the threshold ratio R _T2 to μ + Xσ, wherein X is a number between 0.7 and 4.0;
Including a method. 135. The method of claim 134, wherein R _T2 = μ + Xσ, and X is a number between 0.7 and 1.0. 135. The method of claim 134, wherein R _T2 = μ + Xσ, and X is a number between 2.0 and 4.0. 145. The method of claim 145, wherein R _T2 = μ + Xσ, and X is a number between 2.326 and 4.0. A method implemented by a processor in a computer comprising:
(I) a step of receiving a plurality of data values, wherein each data value of the plurality of data values is a ratio determined from a biological sample obtained from a target of a group, and the ratio is a living body obtained from the target The level of truncated SCN5A exon 28 transcript in the sample is determined by: (A) the level of full-length SCN5A exon 28 transcript in the biological sample or (B) the level of total SCN5A exon 28 transcript in the biological sample or (C) Each subject of said population has (I) no ICD as compared to the level of full length SCN5A exon 28 transcript and one or more truncated SCN5A exon 28 transcripts in a biological sample, (II) Not heart disease, (III) with normal left ventricular function, (IV) no diastolic dysfunction, or (V) combinations thereof Is a known object that there, the steps,
(Ii) fitting the plurality of data values to a Gaussian distribution;
(Iii) determining an average value μ and a standard deviation σ of the Gaussian distribution;
(Iv) setting the threshold ratio R _T3 to μ + 4.0σ;
Including a method.