JP2014230515A - Novel transposon transferase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a system capable of introducing a gene and/or its expression control base sequence with high efficiency even if base sequences of DNAs of them have huge sizes, and capable of reconstituting a genotype by removing the introduced gene and/or expression control base sequence when the introduced gene becomes unnecessary.SOLUTION: There are provided: (a) a nucleic acid comprising a specific base sequence or a partial sequence thereof; (b) a nucleic acid that hybridizes with a nucleic acid comprising a base sequence complementary to the specific base sequence under a stringent condition, and includes a base sequence which codes a protein having Albatross transposon transfer activity; (c) a nucleic acid comprising a base sequence which includes a base sequence coding a protein having Albatross transposon activity, and which has an identity of 80% or more to the specific base sequence; a novel transposon transferase including any one of the nucleic acids; a gene transfer reagent using the novel transposon transferase; and a gene transfer kit.

Description

  The present invention relates to a novel gene transfer removal method and a transposon transferase, a gene transfer reagent and a gene transfer kit used therefor.

  The expression of many genes is controlled by a transcriptional regulatory region that extends over 100 kb. In order to introduce a foreign gene into the genome and to express it in a tissue-specific manner, a large genomic region including the transcriptional regulatory region is required. It is necessary to introduce. Several gene transfer systems have been developed so far.

  First, there is an introduction system using a so-called episomal vector virus using Epstein Barr virus or herpes virus. This system has a problem that only a transient expression can be reproduced because the transgene is not integrated into the host genome. Furthermore, in addition to the retrovirus and lentiviral vectors being able to introduce only genes of 10 kb or less, there is a problem that the risk of canceration due to high-frequency introduction is high. In addition, there is a system in which a gene is directly injected into a cell nucleus. Although the system is excellent in operability, there is a problem that introduction efficiency is low. There is also an introduction system using a BAC clone. In this system, a gene having a sequence of 300 kb or more can be incorporated, but there is a problem that introduction efficiency is low. Furthermore, even when a gene is integrated, a plurality of clones are incorporated and form concatamers arranged in tandem, which causes a problem of being susceptible to silencing by the host.

  The system using a DNA transposon utilizes the principle that a transposon transferase recognizes a transposon recognition sequence and cleaves the recognition sequence. Specifically, a transposon transfer mechanism is constructed by preparing a construct incorporating a transposon recognition sequence at both ends of a gene intended to be introduced and introducing it into a cell together with a construct expressing a transposon transferase gene. In this system, the gene is introduced into the host genome. The system has the advantages that the introduction efficiency is higher than that of the conventional system, the construction is easy to construct, and the transgene can be stably expressed. So far, DNA transposons such as Sleeping Beauty, Tol2, and piggyBac have been used in the system.

  Here, Sleeping Beauty transposon is a transposon artificially created by modifying its base sequence from a transposon that has lost its activity remaining as a trace in the salmon genome. It is said that there is a low risk of (Non-Patent Document 1). However, when the size of the gene to be incorporated is 1.7 kb or more, there is a problem that the incorporation rate is reduced by 30% every time the size is increased by 1 kb, and the introduction efficiency is extremely reduced as the introduction sequence is increased. Tol2 transposon has been cloned from the medaka genome (Non-patent Document 2), and it is known that a gene having a size of about 10 kb can be introduced. However, gene transfer using the Tol2 transposon has a problem that base insertion or deletion called a footprint occurs when the introduced sequence is excised from the genome by the same mechanism. The piggyBac transposon is a natural transposon derived from Trichoplusia ni (Non-patent Document 3), and has the advantage that no mutation remains when removing the introduced sequence, but the maximum size that can be introduced without impairing uptake efficiency. The length was 9.7 kb, and there was a problem that efficiency was lowered when a large-sized gene or regulatory sequence was incorporated.

Ivics Z, Hackett PB, Plasterk RH, Izsvak Z. Cell. 1997 Nov 14; 91 (4): 501-10. Kawakami K et al., Dev. Cell, 7, 133-144 (2004) Ding S, Wu X, Li G, Han M, Zhuang Y, Xu T. Cell. 2005 Aug 12; 122 (3): 473-83 Suster M. L. et al., Nat. Protocols, 6, 1998-2021 (2011) Rostovskaya M. et al., Nucleic Acid Res. October; 40 (19) (2012)

  Thus, the gene is controlled by a transcriptional regulatory region extending over 100 kb. In order to introduce a foreign gene into the genome and to express it in a tissue-specific manner, a large genomic region including the transcriptional regulatory region is required. When it was necessary to introduce the gene, the conventional gene introduction system could not incorporate such a large-sized gene or control sequence efficiently and with high accuracy, and thus the function analysis of the gene was limited. There was a problem. Therefore, a gene introduction system that can introduce a gene with high efficiency even with a large DNA sequence has been desired.

  Here, a BAC clone incorporating a sequence in which the transposon recognition sequence is arranged in the opposite direction (inside-out state) is prepared and introduced into a cell together with a construct expressing a transferase, and the transposon transfer mechanism is determined. A technique for introducing into a cultured cell using this method is known, and it has been confirmed that a relatively large gene or the like can be incorporated (Non-Patent Documents 4 and 5). However, the transposon has a problem that it is almost impossible to remove the introduced sequence. The reason is as follows. That is, it was known that transposon transfer generally increases in efficiency as the distance between recognition sequences at both ends decreases. Here, the reason why it was possible to introduce a large-sized DNA fragment even when a conventional transposon was used was that the transposon recognition sequence was placed in the reverse direction (as in the inside-out state) as described above. If circular DNA was used, it was thought that the distance between recognition sequences could be shortened while sandwiching a large target introduction sequence. This is because the transferase can be cut out even if the recognition sequence is in the reverse direction. However, after the gene has been introduced, the construct becomes linear, which in turn increases the distance between the transposon recognition sequences and, consequently, the efficiency of the excision reaction.

  Therefore, an object of the present invention is to provide a gene introduction / removal system that can introduce and remove genes with a high efficiency even with a DNA sequence of a huge size.

  While analyzing the novel medaka DNA transposon Albatross, the present inventors have unexpectedly exceeded the total length of the DNA transposon of about 150 kb, and the total length of the DNA transposon reported so far is several kb. We found that it was much larger than that. Furthermore, it has been confirmed that the DNA transposon Albatross has been transferred on the medaka genome, and has actually been found to have the following transfer activity. That is, a large DNA sequence of Albatross can be introduced; a large sequence can also be removed; and the specificity to the transposon recognition sequence is high, and the introduced target sequence can be removed without leaving a mutation. . As a result, this Albatross was used to construct a gene introduction / removal system capable of gene introduction and gene removal with a high efficiency even with a DNA sequence of a huge size exceeding 100 kb.

That is, the present invention is as follows.
(1) The nucleic acid according to any one of the following (a) to (h).
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 or a partial sequence thereof (b) hybridizing with a nucleic acid comprising a base sequence complementary to the base sequence comprising SEQ ID NO: 1 under stringent conditions; A nucleic acid comprising a base sequence encoding a protein having an Albatross transposon transfer activity (c) comprising a base sequence consisting of 80% or more of the base sequence consisting of SEQ ID NO: 1 and encoding a protein having an Albatross transposon transfer activity (D) a nucleic acid containing a nucleotide sequence encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 or a partial sequence thereof (e) one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2 Consisting of an amino acid sequence deleted, substituted, or added, and the transposition activity of Albatross transposon (F) a nucleic acid comprising a base sequence encoding a protein having the amino acid sequence (f) comprising an amino acid sequence having 80% or more identity with the amino acid sequence consisting of SEQ ID NO: 2 and comprising a base sequence encoding a protein having Albatross transposon transfer activity Nucleic acid (g) A protein that hybridizes under stringent conditions with a nucleic acid consisting of a base sequence complementary to the base sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 2, and has an Albatross transposon transfer activity (2) A protein according to any one of the following (a) to (c):
(A) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in SEQ ID NO: 2, and having translocation activity of Albatross transposon (C) A protein comprising an amino acid sequence having an identity of 80% or more with the amino acid sequence consisting of SEQ ID NO: 2 and having an activity of transposing transposon (3) A recombinant vector comprising the nucleic acid according to (1).
(4) A transformant transformed with the recombinant vector according to (3).
(5) A transposon transferase obtained by culturing the transformant according to (4).
(6) A gene introduction reagent comprising the transposon transferase and the transposon recognition sequence according to (5).
(7) The quantitative ratio of the expression vector in which the transposon transferase described in (5) is operably linked to the target sequence and the construct incorporating the transposon recognition sequence that recognizes the transposon transferase described in (5) is 29: 1. The gene introduction reagent according to (6), which is ˜1: 29.
(8) A gene introduction kit comprising the gene introduction reagent according to (6) or (7).

  If the gene transfer system of the present invention is used, even a DNA sequence having a huge size exceeding 100 kb can be transferred with high efficiency. As a result, a large genomic region including a transcriptional regulatory region is introduced for a foreign gene that is controlled by a transcriptional regulatory region of 100 kb or more, which is impossible with a conventional gene transfer system, and expressed in a time-specific and tissue-specific manner. Can be made. Therefore, there is an advantage that the function analysis can be advanced for the first time by the system of the present invention even for a gene whose function has been unknown.

  Furthermore, the gene introduction and removal method of the present invention has an advantage that the introduced sequence can be removed from the genome by expressing the same transposon transferase as that used at the time of gene introduction in the gene introduction body. Although there is a risk that the activity of the transgene itself may cause abnormalities in the function of the living body or change the activity of the gene near the insertion site, the gene transfer method using the transposon of the present invention is necessary. It is very useful in that a gene can be introduced at any time and removed whenever it is no longer needed.

  Furthermore, the transposon transferase of the present invention has high specificity with the transposon recognition sequence, and can remove the introduced target sequence without leaving a mutation. Therefore, there is an advantage that cell introduction and removal with higher accuracy can be realized.

  Since a vector in which the transposon transferase system of the present invention is combined with another transposon transferase system can be prepared, there is an advantage that a plurality of cells can be introduced with one cell introduction system.

  The cell introduction / removal technique of the present invention has an advantage that it can contribute particularly to the development of regenerative medicine. For example, when iPS cells are established, a plurality of undifferentiated induction genes (Oct3 / 4, Sox2, Klf4, c-Myc) are introduced, but since these genes are at risk of causing canceration, When it is actually applied to humans, it must be removed. However, by using the above method of the present invention, it is possible to establish stem cells by gene transfer, thereby regenerating tissues / organs, and then remove unnecessary transgenes and restore genotypes. Become.

  Furthermore, the gene transfer system of the present invention only requires both transferase and Albatross end sequences, is easy to construct, and has high utility value as a simple and simple gene transfer tool.

It is a figure which shows the outline | summary of the gene introduction method of this invention. It is a figure which shows the outline | summary of the gene introduction method of this invention. In the gene introduction method of this invention, it is a figure which shows that the plasmid integrated in the indicator plasmid was cut out. It is a figure which shows the outline | summary of the system of the gene transfer removal method of this invention.

  The present invention relates to a novel transposon transferase, a gene introduction reagent and a gene introduction kit using the same, and a gene introduction method. The present invention will be described below.

(1) Summary of the present invention The present invention relates to a method for gene transfer using a transposon transferase and a transposon recognition sequence recognized by the enzyme. The outline of the present invention will be described below.

  A transposon is cleaved and cut out by the action of a transposon transferase, and is moved to another position on a chromosome, as it is called a moving DNA. Here, the transposon transferase recognizes a sequence called an inverted repeat sequence (also called a transposon recognition sequence) located at both ends of the transposon and moves the transposon. Therefore, a foreign gene sequence is inserted between the transposon recognition sequences at both ends. When the is inserted, the foreign gene sequence can also move with the transposon. Based on this principle, the following gene transfer system has been developed. That is, a transposon in which a target gene is inserted between the transposon recognition sequences at both ends is prepared, introduced into a cell, and transposon transferase is allowed to act to transfer the target gene to the host genome (chromosome). By moving the target gene, the target gene is incorporated into the host genome (FIG. 1).

The present invention pays attention to the giant transposon Albatross from medaka, which is a fish inhabiting East Asia and has been used for genetic research of vertebrates. Albatross transposon is a transposon found in the medaka (Oryzias latipes) genome and belongs to the piggyBac family. The size of this Albatross transposon is 150 kb or more, which is an extremely large transposon compared to the reported transposon size of several kb. It has been known that there are several mutants caused by transposition of Albatross transposon to another region on the chromosome. Therefore, the present inventors focused on the transfer activity of the Albatross transposon and examined whether or not the transfer activity was maintained, and found that the transfer activity was maintained. Furthermore, the present inventors have completed the Albatross transposon gene introduction system by discovering a transposon transferase that acts specifically on the Albatross transposon, that is, acts on the Albatross transposon recognition sequence. Thus, the present invention is a novel gene transfer system that applies the transposon gene transfer system. The transposon gene introduction system of the present invention can efficiently introduce a DNA sequence having a size of more than 100 kb and cut it out later. Furthermore, the transposon transferase of the present invention is highly useful as a gene introduction / removal system having a high sequence recognition specificity and an excellent characteristic that an unnecessary mutant is not produced. Hereinafter, the gene introduction (removal) method of the present invention will be described.
(2) Nucleic acid encoding the transposon transferase of the present invention The Albatross transposon transferase of the present invention (hereinafter sometimes referred to as “the transposon transferase of the present invention”) is derived from medaka (Oryzias latipes) and has a size of 2499b. is there. Specifically, the 1st to 6th bases indicate a Kozak sequence, the 7th to 2460th bases are sequences encoding a transposon transferase, the 2461st to 2478th bases indicate a linker sequence, The 2479th to 2496th bases indicate a nuclear translocation signal sequence, and the 2497th to 2499th bases indicate a stop codon. The 1394-1489th base is an intron. This base sequence is shown in SEQ ID NO: 1.

  The nucleic acid encoding the transposon transferase of the present invention includes not only single-stranded and double-stranded DNAs but also RNA complements thereof, and those that are naturally derived may be artificially prepared. Also good. Examples of DNA include genomic DNA, cDNA corresponding to the genomic DNA, chemically synthesized DNA, DNA amplified by PCR, a combination thereof, and a hybrid of DNA and RNA. It is not limited.

  Preferred embodiments of the nucleic acid of the present invention include: (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 or a partial sequence thereof; (b) a nucleic acid comprising a base sequence complementary to the base sequence comprising SEQ ID NO: 1. A nucleic acid that hybridizes under stringent conditions and includes a base sequence encoding a protein having an transposson transfer activity; (c) consists of a base sequence that is 80% or more identical to the base sequence consisting of SEQ ID NO: 1 And a nucleic acid comprising a base sequence encoding a protein having Albatross transposon transfer activity; (d) a nucleic acid comprising a base sequence encoding a protein comprising the amino acid sequence represented by SEQ ID NO: 2 or a partial sequence thereof; (e) a sequence An amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown by No. 2 A nucleic acid comprising a base sequence encoding a protein having an Albatross transposon transfer activity; (f) an amino acid sequence having 80% or more identity with the amino acid sequence consisting of SEQ ID NO: 2 and an Albatross transposon transfer activity (G) a nucleic acid comprising a nucleotide sequence complementary to the nucleotide sequence encoding the protein comprising the amino acid sequence represented by SEQ ID NO: 2 and hybridizing under stringent conditions Examples thereof include a nucleic acid containing a base sequence that encodes a protein that is soybean and has an Albatross transposon transfer activity.

  In order to obtain the above base sequence, it is also possible to search for a base sequence encoding a protein having high identity with a protein having a known transposon transfer activity from the base sequence data of an organism having transposon transfer activity or genomic DNA. it can. A known method can be used for the EST analysis. Examples of the organism having Albatross transposon transfer activity include fish, and preferred examples include, but are not limited to, medaka.

  As a result of homology analysis of the base sequence of the Albatross transposon transferase of the present invention using BLASTX to the amino acid sequence registered in GenBank, it showed homology with the piggyBac type transferase gene homolog. The highest identity is the putative protein piggyBac transposable element-derived protein 4-like derived from Takifugu rubripes. The identity of the CDS of the base sequence derived from the protein and the CDS of the Albatross transposon transferase of the present invention and the amino acid sequence The identity was 65.4% and 47.0%, respectively, when calculated with clustalW. In addition, for the putative protein piggyBac transposase derived from Trichoplusia ni, the identity of the CDS of the base sequence derived from the protein and the CDS of the Albatross transposon transferase of the present invention and the identity of the amino acid sequence were determined by clustalW, respectively, 45.9%, It was 27.8%.

  The present invention also includes the nucleotide sequence represented by SEQ ID NO: 1 (sometimes referred to as “the nucleotide sequence of the present invention”) (a), and the amino acid sequence represented by SEQ ID NO: 2 (“the amino acid sequence of the present invention”). The following nucleic acids having a function equivalent to that of the nucleic acid containing the base sequence (d) encoding the protein consisting of “Having an equivalent function” means that the protein encoded by the base sequence of the present invention and the protein comprising the amino acid sequence of the present invention have Albatross transposon transfer activity. Although the Albatross transposon transfer activity can be measured using a known method, for example, the Excision assay described in Example 3 of the present specification can be mentioned.

(B) a nucleic acid that hybridizes under stringent conditions with a nucleic acid consisting of a base sequence complementary to the base sequence consisting of SEQ ID NO: 1 and which comprises the base sequence encoding the protein having the activity of the present invention The nucleic acid of the invention includes a base sequence that hybridizes with a nucleic acid comprising a base sequence complementary to the base sequence comprising SEQ ID NO: 1 under stringent conditions and encodes the protein having the activity of the present invention. . SEQ ID NO: 1 and Albatross transposon transfer activity are as described above.

  The above nucleotide sequence is prepared by preparing a probe using an appropriate fragment by a method known to those skilled in the art, and using this probe by a known hybridization method such as colony hybridization, plaque hybridization, Southern blotting, etc. And a genomic library.

  For details on the hybridization procedure, see Molecular Cloning, A Laboratory Manual 3rd ed. (Cold Spring Harbor Press (2001); Section 6-7 in particular), Current Protocols in Molecular Biology (John Wiley & Sons ( 1987-1997); especially Sections 6.3-6.4), “DNA Cloning 1: Core Techniques, A Practical Approach 2nd ed.” (Oxford University (1995); Section 2.10) for hybridization conditions. Can do.

  The strength of the hybridization condition is mainly determined by the hybridization condition, more preferably, the hybridization condition and the washing condition. As used herein, “stringent conditions” include moderately or highly stringent conditions.

  Specifically, moderately stringent conditions include, for example, hybridization conditions such as 1 × SSC to 6 × SSC, 42 ° C. to 55 ° C., more preferably 1 × SSC to 3 × SSC, 45 C. to 50.degree. C., most preferably 2.times.SSC, 50.degree. When the hybridization solution contains, for example, about 50% formamide, a temperature 5 to 15 ° C. lower than the above temperature is adopted. Examples of the washing conditions include 0.5 × SSC to 6 × SSC, 40 ° C. to 60 ° C. In general, 0.05% to 0.2%, preferably about 0.1% SDS may be added during hybridization and washing.

  Highly stringent (high stringent) conditions include hybridization and / or washing at higher temperatures and / or lower salt concentrations than moderately stringent conditions. For example, as hybridization conditions, 0.1 × SSC to 2 × SSC, 55 ° C. to 65 ° C., more preferably 0.1 × SSC to 1 × SSC, 60 ° C. to 65 ° C., most preferably , 0.2 × SSC, 63 ° C. Washing conditions include 0.2 × SSC to 2 × SSC, 50 ° C. to 68 ° C., more preferably 0.2 × SSC, 60 to 65 ° C.

  In particular, as hybridization conditions used in the present invention, for example, prehybridization is performed in 5 × SSC, 1% SDS, 50 mM Tris-HCl (pH 7.5) and 50% formamide at 42 ° C., and then the probe is used. And overnight at 42 ° C. to allow hybridization, followed by washing in 0.2 × SSC, 0.1% SDS at 65 ° C. for 20 minutes three times. It is not limited.

  In addition, a commercially available hybridization kit that does not use a radioactive substance for the probe can also be used. Specific examples include hybridization using a DIG nucleic acid detection kit (Roche Diagnostics), ECL direct labeling & detection system (Amersham).

  The nucleic acid included in the present invention preferably hybridizes with a nucleic acid consisting of a base sequence complementary to the base sequence consisting of SEQ ID NO: 1 under conditions of 2 × SSC and 50 ° C., and has an Albatross transposon transfer activity. And a nucleic acid containing a base sequence encoding a protein having

(C) a nucleic acid comprising a base sequence having 80% or more identity with the base sequence consisting of SEQ ID NO: 1 and comprising a base sequence encoding a protein having the above activity of the present invention, a base sequence contained in the nucleic acid of the present invention Encodes a protein having at least 80% identity to the nucleic acid sequence shown in SEQ ID NO: 1 and having the above activity of the present invention.

  Preferably, it is at least 80%, more preferably 85%, even more preferably 90% (for example, 92% or more, even more preferably 95% or more, and even 97%) with respect to the base sequence shown in SEQ ID NO: 1. 98% or 99%), and a base sequence encoding a protein having the above activity of the present invention.

  The percent identity between two nucleic acid sequences can be determined by visual inspection or mathematical calculation, but is preferably determined by comparing the sequence information of the two nucleic acids using a computer program. As a sequence comparison computer program, for example, the BLASTN program (Altschul et al. (Altschul et al. 1990) J. Mol. Biol. 215: 403-10): Version 2.2.7 or WU-BLAST 2.0 algorithm. Standard default parameter settings for WU-BLAST 2.0 can be those described at the following Internet site: http://blast.wustl.edu.

(E) a nucleic acid comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and comprising a base sequence encoding the protein having the above activity of the present invention The nucleic acid of the present invention comprises an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2, and a base sequence encoding a protein having the above activity of the present invention including.

In particular,
(i) One or a plurality of amino acid sequences shown in SEQ ID NO: 2 (preferably one or several (for example, 1 to 400, 1 to 200, 1 to 100, 1 to 50, 1 to 30, 1-25, 1-20, 1-15, more preferably 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1)) Amino acid sequence;
(ii) one or a plurality of amino acid sequences shown in SEQ ID NO: 2 (preferably one or several (for example, 1 to 400, 1 to 200, 1 to 100, 1 to 50, 1 to 30) , 1-25, 1-20, 1-15, more preferably 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1)) amino acids are other amino acids A substituted amino acid sequence;
(iii) 1 or more (preferably 1 or several (for example, 1 to 400, 1 to 200, 1 to 100, 1 to 50, 1 to 30) amino acid sequences shown in SEQ ID NO: 2 1-25, 1-20, 1-15, more preferably 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1)) other amino acids added Amino acid sequence; or
(iv) an amino acid sequence obtained by combining the above (i) to (iii);
And a base sequence encoding a protein having the above activity of the present invention.

  Of the above, the substitution is preferably a conservative substitution. A conservative substitution is the replacement of a particular amino acid residue with a residue having similar physicochemical characteristics, but any substitution that does not substantially change the structural characteristics of the original sequence. For example, any substitution may be made so long as the substituted amino acid does not destroy the helix present in the original sequence or other types of secondary structures characterizing the original sequence.

  Conservative substitution is generally introduced by biological system synthesis or chemical peptide synthesis, but preferably by chemical peptide synthesis. In this case, the non-natural amino acid residue may be included in the substituent, and the reversed type or the same region in which the non-substituted region is reversed in the peptidomimetic or amino acid sequence is reversed. Inverted types are also included.

In the following, amino acid residues are classified and exemplified for each substitutable residue, but the substitutable amino acid residues are not limited to those described below.
Group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminobutanoic acid, methionine, O-methylserine, t-butylglycine, t-butylalanine and cyclohexylalanine Group B: aspartic acid, glutamic acid, isoaspartic acid, Isoglutamic acid, 2-aminoadipic acid and 2-aminosuberic acid group C: asparagine and glutamine group D: lysine, arginine, ornithine, 2,4-diaminobutanoic acid and 2,3-diaminopropionic acid group E: proline, 3 -Hydroxyproline and 4-hydroxyproline group F: serine, threonine and homoserine Group G: phenylalanine and tyrosine In the case of non-conservative substitution, one member of the above types is exchanged with another type of member. Can In this case, however, it is preferable to consider the hydropathic index of amino acids (hydropathic amino acid index) in order to retain the biological function of the protein of the present invention (Kyte et al., J. Mol. Biol., 157). : 105-131 (1982). In the case of non-conservative substitution, amino acid substitution can be performed based on hydrophilicity. In the present specification and drawings, bases and amino acids and their abbreviations follow IUPAC-IUB Commission on Biochemical Nomenclature or, for example, Immunology--A Synthesis (2nd edition, supervised by ES Golub and DR Gren, Sinauer Associates, Massachusetts). Based on abbreviations commonly used in the industry, such as those described in Sunderland (1991)). In addition, when there is an optical isomer with respect to an amino acid, L form is shown unless otherwise specified.

  Stereoisomers of the above amino acids such as D-amino acids, unnatural amino acids such as α, α-disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids also constitute the protein of the present invention. Can be an element.

  The protein notation used herein is based on standard usage and notation commonly used in the art, the left direction is the amino terminal direction, and the right direction is the carboxy terminal direction. Similarly, unless otherwise specified, generally the left end of single-stranded polynucleotide sequences is the 5 'end, and the left direction of double-stranded polynucleotide sequences is the 5' direction.

  One skilled in the art can design and generate suitable variants of the proteins described herein using techniques known in the art. For example, in a protein molecule that can change its structure without damaging the biological activity of the protein of the present invention by targeting a region that is considered to be less important for the biological activity of the protein of the present invention. Appropriate regions can be identified. It is also possible to identify molecular residues and regions that are conserved among similar proteins. In addition, conservative amino acid substitutions are introduced into regions believed to be important for the biological activity or structure of the protein of the invention without compromising biological activity and without adversely affecting the polypeptide structure of the protein. You can also

  In particular, in the Albatross transposon transferase of the present invention, there exists a “DDD motif” which is a conserved motif. This motif is an essential motif for the Albatross transposon transferase and is conserved in the amino acid sequence, and includes the DDD motif which is the 319th to 688th amino acid residues. Therefore, the mutant of the present invention may be any mutant as long as the conserved motif is preserved and the activity of the present invention is not impaired.

  A person skilled in the art identifies residues of peptides that are important for the biological activity or structure of the protein of the invention and are similar to the peptides of the proteins, and compares the amino acid residues of the two peptides, So-called structure-function studies can be performed to predict which residues of a protein similar to the protein of the invention are amino acid residues corresponding to amino acid residues important for biological activity or structure. . Furthermore, by selecting a chemically similar amino acid substitution of the amino acid residue predicted in this way, a mutant that retains the biological activity of the protein of the present invention can also be selected. Those skilled in the art can also analyze the three-dimensional structure and amino acid sequence of the mutant of this protein. Furthermore, the alignment of amino acid residues with respect to the three-dimensional structure of a protein can be predicted from the obtained analysis results. Amino acid residues predicted to be on the protein surface may be involved in important interactions with other molecules, but those skilled in the art will be able to do this based on the analysis results described above. Mutants can be made that do not change the amino acid residues predicted to be on the surface of various proteins. Furthermore, those skilled in the art can also produce mutants that substitute only one amino acid residue among the amino acid residues constituting the protein of the present invention. Such mutants can be screened by known assay methods and information on individual mutants can be collected. When the biological activity of the mutant in which a specific amino acid residue is substituted is reduced as compared with the biological activity of the protein of the present invention, such biological activity is not exhibited. Or the usefulness of the individual amino acid residues constituting the protein of the present invention can be evaluated by comparing cases that cause inappropriate activities that inhibit the biological activity of the protein. it can. Moreover, those skilled in the art can easily make amino acid substitutions undesired as a variant of the protein of the present invention, alone or in combination with other mutations, based on information collected from such routine experiments. Can be analyzed.

As described above, a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted, or added in the amino acid sequence represented by SEQ ID NO: 2 is “Molecular Cloning, A Laboratory Manual 3rd ed.” (Cold Spring Harbor Press (2001)), Current Protocols in Molecular Biology (John Wiley & Sons (1987-1997), Kunkel (1985) Proc. Natl. Acad. Sci. USA 82: 488-92, Kunkel (1988) Method 85: 2763-6 etc., and can be prepared according to the method such as site-directed mutagenesis etc. The production of such mutants with mutations such as deletion, substitution or addition of amino acids is possible. For example, a mutation introduction kit using site-directed mutagenesis by a known method such as Kunkel method or Gapped duplex method, such as QuikChange ^™ Site-Directed Mutagenesis Kit (Stratagene), GeneTailor ^™ Site-Directed Mutagenesis System Manufactured by emissions Ltd.), TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc .: Takara Bio Inc.) and the like can be carried out using.

  In addition to the site-directed mutagenesis described above, a gene can be mutated as a method for introducing deletion, substitution, or addition of one or more amino acids into the amino acid sequence of a protein while retaining its activity. And a method of ligation after selective cleavage of a gene to remove, substitute or add selected nucleotides.

  The base sequence contained in the nucleic acid of the present invention preferably consists of an amino acid sequence in which 1 to 200 amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2, and has an activity of transfecting an Albatross transposon. It is the base sequence which codes the protein which has. The number of amino acid mutations or modifications in the protein of the present invention, or the site of mutation or modification is not limited as long as the activity of the present invention is maintained. The method for measuring the activity of the present invention is as described above.

(F) a nucleic acid comprising an amino acid sequence having 80% or more identity with the amino acid sequence consisting of SEQ ID NO: 2 and comprising a base sequence encoding a protein having the above activity of the present invention. And a base sequence encoding the protein having the above activity of the present invention. The protein encoded by the nucleic acid of the present invention may be an Albatross transposon transferase or a protein having the same amino acid sequence as the Albatross transposon transferase as long as it has a function equivalent to that of the protein having the activity of the present invention.

  Specifically, it is 80% or more, preferably 85% or more, more preferably 90%, still more preferably 95% or more, still more preferably 97% (for example, 98%, Furthermore, amino acid sequences having 99%) or more identity are exemplified. The nucleic acid of the present invention preferably encodes a protein consisting of an amino acid sequence having 95% or more identity with the amino acid sequence consisting of SEQ ID NO: 2, and includes a base sequence encoding a protein having the above activity of the present invention. It is a nucleic acid. More preferably, it is a nucleic acid that encodes a protein consisting of an amino acid sequence having an identity of 98% or more with the amino acid sequence consisting of SEQ ID NO: 2, and comprising a base sequence encoding the protein having the above activity of the present invention.

  The percent identity between two amino acid sequences can be determined by visual inspection and mathematical calculation. The percent identity can also be determined using a computer program. Examples of such computer programs include BLAST, FASTA (Altschul et al., J. Mol. Biol., 215: 403-410 (1990)), ClustalW, and the like. In particular, various conditions (parameters) for identity search by the BLAST program are those described in Altschul et al. (Nucl. Acids. Res., 25, p.3389-3402, 1997), and the National Center for Biotechnology Information (NCBI) ) And DNA Data Bank of Japan (DDBJ) website (BLAST Manual, Altschul et al. NCB / NLM / NIH Bethesda, MD 20894; Altschul et al.). Genetic information processing software GENETYX Ver. 7 (Genetics), DINASIS Pro (Hitachi Software), Vector NTI (Infomax), etc. can also be used for determination.

  A specific alignment scheme that juxtaposes multiple amino acid sequences can also show a match of a specific short region of the sequence, so even if there is no significant relationship between the full length sequences of the sequences used, In such a region, a region having a very high specific sequence identity can also be detected. In addition, the BLAST algorithm can use the BLOSUM62 amino acid scoring matrix, but the following can be used as selection parameters: (A) Segments of query sequence with low composition complexity (Wootton and Federhen's Determined by the SEG program (Computers and Chemistry, 1993); Wootton and Federhen, 1996 “Analysis of compositionally biased regions in sequence databases” Methods Enzymol., 266: 544-71 Including a filter for masking segments (determined by the XNU program of Claverie and States (Computers and Chemistry, 1993)) and (B) the database consisting of short-periodic internal repeats (see) A statistical significance threshold for reporting fits to the sequence, Is the expected probability of a match found by chance, according to a statistical model of E-score (Karlin and Altschul, 1990); this fit if the statistical significance difference due to a fit is greater than the E-score threshold Is not reported.

(G) a protein that hybridizes under stringent conditions with a nucleic acid comprising a base sequence complementary to a base sequence encoding a protein comprising the amino acid sequence represented by SEQ ID NO: 2 and having the above-described activity of the present invention The nucleic acid of the present invention hybridizes under stringent conditions with a nucleic acid consisting of a base sequence complementary to the base sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 2 And it is a nucleic acid containing the base sequence which codes the protein which has the said activity of this invention.

  The protein consisting of the amino acid sequence shown in SEQ ID NO: 2 and the hybridization conditions are as described above. The nucleic acid of the present invention hybridizes under stringent conditions with a nucleic acid comprising a base sequence complementary to a base sequence encoding a protein comprising the amino acid sequence represented by SEQ ID NO: 2, and Examples thereof include nucleic acids containing a base sequence encoding a protein having activity.

Further, the nucleic acid of the present invention comprises a base sequence in which one or more bases are deleted, substituted or added in the base sequence consisting of SEQ ID NO: 1, and encodes the protein having the above activity of the present invention. Nucleic acids containing the base sequence are also included. In particular,
(i) One or more (preferably one or several (for example, 1 to 1500, 1 to 1000, 1 to 500, 1 to 300, 1 to 1) of the nucleotide sequence shown in SEQ ID NO: 1 250, 1-200, 1-150, 1-100, 1-50, 1-30, 1-25, 1-20, 1-15, more preferably 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1)) base sequence deleted,
(ii) One or a plurality (preferably one or several (for example, 1 to 1500, 1 to 1000, 1 to 500, 1 to 300, 1 to 250) of the nucleotide sequence shown in SEQ ID NO: 1 Pieces, 1 to 200 pieces, 1 to 150 pieces, 1 to 100 pieces, 1 to 50 pieces, 1 to 30 pieces, 1 to 25 pieces, 1 to 20 pieces, 1 to 15 pieces, more preferably 10, 9, 8 , 7, 6, 5, 4, 3, 2, or 1))) in which a base is substituted with another base,
(iii) One or more (preferably one or several (for example, 1-1500, 1-1000, 1-500, 1-300, 1-250) in the base sequence shown in SEQ ID NO: 1 1 to 200, 1 to 150, 1 to 100, 1 to 50, 1 to 30, 1 to 25, 1 to 20, 1 to 15, more preferably 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1)) a base sequence to which another base is added, or
(iv) A nucleic acid having a base sequence obtained by combining the above (i) to (iii) and including a base sequence encoding the protein having the above activity of the present invention can also be used.

A preferred embodiment of the nucleic acid of the present invention includes any of the nucleic acids described below.
-(A) a nucleic acid comprising the base sequence shown in SEQ ID NO: 1 or a partial sequence thereof
-(D) a nucleic acid comprising a base sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or a partial sequence thereof (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 and (d) represented by SEQ ID NO: 2 The nucleic acid containing the base sequence encoding the protein consisting of the amino acid sequence is as described above. The partial sequence of the above sequence includes ORF, CDS, a region having biological activity, a region used as a primer as described below, and a region that can be used as a probe. Alternatively, an artificially produced one may be used.

  The nucleic acid of the present invention includes the following nucleic acid: 1) a base sequence encoding a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 A nucleic acid comprising: a nucleic acid that hybridizes under stringent conditions with a nucleic acid comprising a base sequence complementary to the base sequence comprising SEQ ID NO: 1; from a base sequence having at least 80% identity to the base sequence comprising SEQ ID NO: 1 A nucleic acid comprising a base sequence encoding a protein comprising: a nucleic acid comprising a base sequence encoding a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence comprising SEQ ID NO: 2; comprising the amino acid sequence represented by SEQ ID NO: 2 A nucleic acid consisting of a base sequence complementary to the base sequence encoding the protein and high under stringent conditions A nucleic acid to be lysed, and 2) any of the following (a) to (e): 1) the nucleic acid according to 1): (a) the amino acid sequence represented by SEQ ID NO: 2 lacks 1 to 200 amino acids A nucleic acid comprising a base sequence encoding a protein comprising a lost, substituted or added amino acid sequence; (b) a nucleic acid comprising a base sequence complementary to the base sequence comprising SEQ ID NO: 1 and 2 × SSC at 50 ° C. A nucleic acid that hybridizes underneath; (c) a nucleic acid comprising a base sequence consisting of a base sequence consisting of 90% or more of the base sequence consisting of SEQ ID NO: 1; and (d) 90% identical to an amino acid sequence consisting of SEQ ID NO: 2. % A nucleic acid comprising a base sequence encoding a protein consisting of at least an amino acid sequence; (e) a base complementary to the base sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 Nucleic acid that hybridizes under conditions of nucleic acid and 2 × SSC, 50 ℃ consisting column; also included.

(3) Transposon transferase protein of the present invention The protein of the present invention includes a protein (a) consisting of the amino acid sequence represented by SEQ ID NO: 2 and a protein having a function equivalent to that of the protein, and is naturally derived. Alternatively, it may be artificially produced. The protein consisting of the amino acid sequence represented by SEQ ID NO: 2 is as described above. The “protein having an equivalent function” means a protein having “the above activity of the present invention” as described in the section “Nucleic acid encoding the transposon transferase of the present invention” above.

In the present invention, examples of the protein having the same function as the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 include the proteins described in the following (b) or (c).
(B) an amino acid sequence in which one or a plurality of amino acids are deleted, substituted or added in SEQ ID NO: 2, and the protein having the above activity of the present invention (c) an amino acid sequence consisting of SEQ ID NO: 2 A protein having the amino acid sequence of 80% or more and having the above activity of the present invention, among which the amino acid sequence in which one or more amino acids are deleted, substituted or added in SEQ ID NO: 2, or SEQ ID NO: The amino acid sequence having an identity of 80% or more with the amino acid sequence consisting of 2 is as described above in the section “Nucleic acid encoding the transposon transferase of the present invention”.

  The protein of the present invention may be artificially prepared. In that case, chemical synthesis such as Fmoc method (fluorenylmethyloxycarbonyl method), tBoc method (t-butyloxycarbonyl method), etc. It can also be manufactured by the law. Chemical synthesis using peptide synthesizers such as Advanced Chemtech, PerkinElmer, Pharmacia, Protein Technology Instruments, Syntheselvega, Perceptive, Shimadzu, etc. You can also.

The protein of the present invention also includes the following proteins.
1) a protein comprising an amino acid sequence in which one or more amino acids are deleted, substituted or added in SEQ ID NO: 2 or a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence comprising SEQ ID NO: 2; (A) a protein comprising an amino acid sequence in which 1 to 200 amino acids have been deleted, substituted or added in SEQ ID NO: 2; (b) an amino acid sequence having 90% or more identity with the amino acid sequence comprising SEQ ID NO: 2 (4) Cloning of the nucleic acid of the present invention The nucleic acid of the transposon transferase of the present invention can be cloned, for example, by screening from a cDNA library using an appropriate probe. Moreover, it can clone by amplifying by PCR reaction using a suitable primer, and ligating to a suitable vector. Furthermore, it can be subcloned into another vector.

For example, pBlue-Script (trademark) SK (+) (Stratagene), pGEM-T (Promega), pAmp (TM: Gibco-BRL), p-Direct (Clontech), pCR2.1-TOPO (Invitrogene), etc. Plasmid vectors, viral vectors, artificial chromosome vectors and cosmid vectors can be used. In the case of amplification by PCR reaction, any part of the base sequence shown in SEQ ID NO: 1 or the like can be used as a primer.
Upstream primer: 5′-GGAATTCCGCCCACCATGAACAAAGGCCGCAAAAAACAC-3 ′ (SEQ ID NO: 5)
Downstream primer: 5′-GTCGACCTAAAACCTACCGCTTCTTCTTACACCACCACCACCACCACCCTGGGACGCGCTCTGT-3 ′ (SEQ ID NO: 6)
Etc. can be used respectively. Then, a PCR reaction is carried out by allowing the above-mentioned primers and heat-resistant DNA polymerase to act on the genomic sequence. The above method can be easily carried out by those skilled in the art according to “Molecular Cloning, A Laboratory Manual 3rd ed.” (Cold Spring Harbor Press (2001)), etc., but the conditions for the PCR reaction of the present invention are as follows. For example, the following conditions can be mentioned.
Denaturation temperature: 95-100 ° C
Annealing temperature: 40-60 ° C
Elongation temperature: 60-75 ° C.
Number of cycles above: about 5 Denaturation temperature: 95-100 ° C
Elongation temperature: 60-75 ° C
A known method can be used to purify the PCR product obtained from about 20 to 30 cycles described above. For example, a method using a kit such as Wizard SV Gel and PCR clean-UP System (Promega), GENECLEAN (Funakoshi), QIAquick PCR purification Kits (QIAGEN), ExoSAP-IT (GE Healthcare Bioscience), DEAE-cellulose filter paper There are a method of using a dialysis tube and the like. When using an agarose gel, perform agarose gel electrophoresis, cut out the base sequence fragment from the agarose gel, Wizard SV Gel and PCR clean-UP System (Promega), GENECLEAN (Funakoshi), QIAquick Gel extraction Kits (QIAGEN) It can be purified by freeze & squeeze method.

  The base sequence of the cloned nucleic acid can be determined using a sequencer such as BigDye terminator v3.1 (Applied Biosystems).

(5) Construction of vector for transposon transferase expression of the present invention and preparation of transformant The present invention is also a recombinant vector containing a nucleic acid encoding the transposon transferase of the present invention (hereinafter also referred to as “helper plasmid”). Provide). The present invention further provides a transformant transformed with the above recombinant vector.

  Such recombinant vectors and transformants can be obtained as follows. That is, a plasmid having a nucleic acid encoding the transposon transferase of the present invention is digested with a restriction enzyme. Examples of restriction enzymes used include, but are not limited to, EcoRI, KpnI, BamHI, and SalI. The ends may be smoothed by treating with T4 polymerase. The digested base sequence fragment is purified by agarose gel electrophoresis. A transposon transferase expression vector can be obtained by incorporating this nucleotide sequence fragment into an expression vector using a known method. This expression vector is introduced into a host to produce a transformant and used for expression of the target protein.

  In this case, the expression vector and the host are not particularly limited as long as the target protein can be expressed. Examples of the host include fungi, bacteria, plants, animals, and their cells. Examples of bacteria include Escherichia coli and Bacillus subtilis. Further, as fungi, filamentous fungi, S. pneumoniae. and yeasts such as cerevisiae (Saccharomyces cerevisiae). Furthermore, examples of plants include oil plants such as rapeseed, soybean, cotton, safflower and flax.

  The host preferably has a structure in which the nucleic acid of the present invention can replicate autonomously in the host or can be inserted on the chromosome of the bacterium. At the same time, a structure including a promoter and a terminator is preferable. When using Escherichia coli as a host, examples of expression vectors include BAC clones, Pharmacia pGEX, and pUC18. As the promoter, for example, a promoter derived from Escherichia coli, phage or the like, such as trp promoter, lac promoter, PL promoter, PR promoter or the like is used. As a method for introducing a recombinant vector into bacteria, for example, an electroporation method or a calcium chloride method can be used.

  Examples of the method for introducing the recombinant vector include an electroporation method, a spheroplast method, a particle delivery method, and direct microinjection of DNA into the nucleus. When an auxotrophic host strain is used, a transformed strain can be obtained by selecting a strain that grows on a selective medium lacking the nutrient. When a drug resistance marker gene is used for transformation, cell colonies exhibiting drug resistance can be obtained by culturing in a selective medium containing the drug.

(6) Method for producing transposon transferase of the present invention The present invention provides a method for producing a transposon transferase from the transformant. That is, it is a method for producing a transposon transferase from a culture obtained by culturing the transformant. Specifically, it can be produced by the following method. However, the production method is not limited to this method, and can be carried out using other generally known methods.

The culture medium used for culturing organisms expressing transposon transferase has a suitable pH and osmotic pressure, and contains nutrients necessary for the growth of each host, trace components, and biological materials such as serum and antibiotics. Any culture solution can be used as long as it is a solution (medium). For example, when HEK293T cells are used as organisms expressing transposon transferase, DMEM (Gibco) can be used as the medium. The culture conditions may be any conditions as long as they are suitable for the growth of the host and are suitable for keeping the produced enzyme stable. Specifically, anaerobic degree, culture time, temperature, humidity, static Individual conditions such as stationary culture or shaking culture can be adjusted. The culture method may be culture under the same conditions (one-stage culture), or so-called two-stage culture or three-stage culture using two or more different culture conditions, but in the case of mass culture, the culture efficiency is good. Two-stage culture is preferred. For example, when HEK293T cells are used as organisms expressing transposon transferase and DMEM (Gibco) is used as the medium, the cells can be cultured under conditions of 5% CO ₂ and 37 ° C.
(7) Gene Transfer Reagent of the Present Invention When cells are introduced using the transposon transferase of the present invention, a transposon recognition sequence is used in combination with the various transposon transferases described above. And in addition to these, it can be set as a composition combining with another solvent and solute. For example, distilled water, pH buffer reagent, salt, protein, surfactant and the like can be combined.

  The transposon transferase of the present invention may be in the form of a helper plasmid incorporated into an appropriate vector (FIG. 2). The helper plasmid can be prepared, for example, by the method described in Example 1 below.

The transposon recognition sequence relating to the present invention will be described below. Albatross transposon recognition sequences for the present invention are shown in SEQ ID NOs: 3 and 4. Specifically, the Albatross transposon recognition sequence includes an Albatross left side recognition sequence (SEQ ID NO: 3) and a right side recognition sequence (SEQ ID NO: 4). Here, in SEQ ID NO: 3, the 1-110th base is a sequence portion that recognizes the outside of the transposon left side, and the 111th to 508th bases are a sequence portion that recognizes the inside of the transposon left side. Among these, the recognition sequence necessary for transfer of the Albatross transposon is the 111th to 128th bases of SEQ ID NO: 3. In SEQ ID NO: 4, the 1-586th base is a sequence portion that recognizes the inside of the transposon right side, and the 587th to 682nd bases are a sequence portion that recognizes the outside of the transposon right side. Among these, the recognition sequence necessary for the transfer of the Albatross transposon is the 569th to 586th base of SEQ ID NO: 4. The transposon recognition sequence itself can be obtained by a known method described in “(2) Nucleic acid encoding the transposon transferase of the present invention”. In the gene introduction reagent according to the present invention, the transposon recognition sequence may be in the state of a construct (indicator plasmid) containing the transposon recognition sequence (FIG. 2). The indicator plasmid has a structure in which a desired target sequence used for gene introduction is incorporated between the left recognition sequence and the right recognition sequence. The indicator plasmid can be prepared using a known method, and for example, can be prepared by the method described in Example 2 below. Specifically, first, a PCR reaction is performed on the purified transposon left recognition sequence and right recognition sequence, for example, using the following primers.
Left forward primer: CATTGATGAATGAGACGGCTTTGATTTGGA (SEQ ID NO: 11)
Right reverse primer: TGTACTCATTGAACTTTGGATGGTCACACA (SEQ ID NO: 12)

PCR condition denaturation temperature: 95-100 ° C
Annealing temperature: 40-60 ° C
Elongation temperature: 60-75 ° C.
Number of cycles above: about 5 Denaturation temperature: 95-100 ° C
Elongation temperature: 60-75 ° C
About 20 to 30 cycles above

The obtained amplification product is purified by a known method, and an indicator plasmid can be obtained by ligation and transformation by a known method.

The gene introduction reagent of the present invention may contain a reaction reagent. A reaction reagent is a reagent having a label detectable by an appropriate chemical or physical detection means. As a labeling agent used in a measurement method using such a labeling substance, for example, a fluorescent substance, an enzyme, a radioisotope, a luminescent substance and the like are used. An ELISA method using an enzyme for labeling is widely used. As fluorescent substances, fluorescamine, fluorescein isothiocyanate, etc. As enzymes, peroxidase, alkaline phosphatase, malate dehydrase, α-glucosidase, α-galactosidase, etc. As radioisotopes, ¹²⁵ I, ¹³¹ I, ³ Examples of luminescent substances such as H and ¹⁴ C include luciferin, lucigenin, luminol, and luminol derivatives.

Further, the reaction medium includes a buffer solution that gives optimum conditions for the reaction or is useful for stabilizing the reaction product, a stabilizer for the reactant, and the like.
(8) Cell transfer kit of the present invention When performing cell transfer using the transposon transferase of the present invention, special conditions, operations, etc. are not required. It is carried out according to the usual conditions and operations in each method, and a suitable measurement system can be constructed by adding some modifications if necessary.

For this purpose, the most convenient and efficient measurement can be performed by making the gene introduction reagent of the present invention into a kit. By making a kit, quantitative analysis can be performed efficiently in a normal laboratory or laboratory without the need for special analytical instruments, skilled operations, and advanced knowledge. The configuration and form of the assay kit are not particularly limited, and the content thereof is not limited as long as the predetermined purpose can be achieved. In general, a candidate substance sample is composed of instructions for interpreting the results obtained by performing screening, reaction reagents, reaction medium in which the reaction is performed, and a substrate that provides a place for the assay. . Furthermore, if desired, a verification sample for use as a comparison reference or for creating a calibration curve, a detector, and the like may be included. Examples of the detection confirmation means for gene introduction according to the present invention include those capable of detecting the above-mentioned label such as a spectroscope, a radiation detector, and a light scattering detector.
(9) Cell introduction method of the present invention The method for gene transfer using the above-described transposon transferase of the present invention comprises the following: (a) one or more containing the transposon transferase according to claim 5 A step of producing one or more expression vectors operatively linked to a transposon transferase; (b) one or more comprising the transposon transferase of claim 5 at both ends of one or more target sequences; A step of preparing a construct by incorporating one or more transposon recognition sequences recognized by the transposon transferase of (c); (c) introducing the expression vector of one of the expression vectors and the construct into a cell; Cleaving DNA by causing the transposon recognition sequence to recognize; and (d) cleaving A step of integrating the DNA into the host genome. Here, the steps (a) and (b) are as described above. As for steps (a) and (b), the expression vector of step (a) and the construct of step (b) may be prepared by the time of step (c), and both steps may be performed simultaneously. Either of these may be done first.

  (B) For the step of incorporating a transposon recognition sequence at both ends of the target sequence, any base (genomic) sequence including a sequence of any size can be used as the target sequence. That is, in addition to single-stranded and double-stranded DNA, and its RNA complement, it may be naturally derived or artificially produced. Examples of DNA include genomic DNA, cDNA corresponding to the genomic DNA, chemically synthesized DNA, DNA amplified by PCR, a combination thereof, and a hybrid of DNA and RNA. It is not limited. Furthermore, the gene introduction method of the present invention has an advantage that even a DNA sequence of a huge size exceeding 100 kb can be introduced.

  Methods for incorporating a transposon recognition sequence at both ends of the target sequence are as described in “(4) Cloning of nucleic acid of the present invention”, “(5) Construction of vector for expression of transposon transferase of the present invention and preparation of transformant”, etc. Any known method as described can be used. For example, it can be obtained by treating a target sequence amplified and purified by a known method with a restriction enzyme, and performing a known ligation reaction with a construct containing a transposon recognition sequence treated with the restriction enzyme in the same manner. Specific examples include, but are not limited to, a construct production method using PCR, a construct production method using in fusion, and a construct production method using BAC. The construction method using PCR is a method in which each amplified target sequence and a sequence containing a transposon recognition sequence are ligated using a PCR reaction and then ligated to a vector, and used when the introduced sequence is short. The construct preparation method using in fusion is a method in which a linearized vector obtained by amplifying an amplified target sequence and a sequence containing a transposon recognition sequence with a PCR primer to which a sequence complementary to the terminal bases of the vector to be incorporated is added. This method is used when the introduced sequence is short. Alternatively, it may be designed to have sequences that are adjacent to the left and right transposon recognition sequences but are complementary to each other. The construction method using the target sequence BAC can introduce a long sequence exceeding 100 kb.

  Step (c) The step of introducing the construct into which the expression vector and the target sequence are incorporated into a cell, causing the transposon transferase to be recognized by the transposon recognition sequence and cleaving the DNA, is performed by using the expression vector (helper plasmid). ) And a construct (indicator plasmid) incorporating the target sequence is introduced into the cell by a known method. The cells that can be used here are not particularly limited as long as they can express the intended transposon transfer activity of the present invention, and examples thereof include animal cells, fungi, bacteria, plants, animals, and their cells. . Examples of animal cells include HEK, particularly HEK293T, CHO, HL-60, HeLa, MDCK, NIH3T3, PC12, S2, Sf9, Vero, and the like. Examples of bacteria include Escherichia coli and Bacillus subtilis. Examples of fungi include filamentous fungi and yeasts such as S. cerevisiae. Furthermore, examples of plants include oil plants such as rapeseed, soybean, cotton, safflower and flax. Furthermore, the helper plasmid and indicator plasmid of the present invention are preferably capable of autonomous replication in cells or have a structure that can be inserted into the chromosome of the bacterium. At the same time, a structure including a promoter and a terminator is preferable. When animal-derived cells are used as the cells, promoters such as CMV and SV40 are used as the promoter, for example. As a method for introducing a recombinant vector into a cell, for example, a commercially available kit such as PEI-MAX (final: 8ug / ml, PSI), electroporation method, calcium chloride method, spheroplast method, particle delivery method And direct microinjection of DNA into the nucleus. When an auxotrophic host strain is used, a transformed strain can be obtained by selecting a strain that grows on a selective medium lacking the nutrient. When a drug resistance marker gene is used for transformation, cell colonies exhibiting drug resistance can be obtained by culturing in a selective medium containing the drug.

  Furthermore, the helper plasmid of the present invention, that is, the expression vector operably linked to the transposon transferase of the present invention, and the indicator plasmid, that is, the target sequence and the transposon recognition sequence that recognizes the transposon transferase of the present invention are incorporated. The construct may be used in any quantitative ratio, but preferably the helper plasmid: indicator plasmid is 100: 1, 80: 1, 75: 1, 50: 1, 40: 1, 30: 1, 29: 1, 25 : 1, 20: 1, 15: 1, 12.5: 1, 10: 1, 9: 1, 8: 1, 7: 1, 6: 1, 5: 1, 4.5: 1, 4: 1, 3.5: 1 , 3: 1, 2.5: 1, 2: 1, 1.5: 1, 1: 1, 1: 1.5, 1: 2, 1: 2.5, 1: 3, 1: 3.5, 1: 4, 1: 4.5, 1 : 5, 1: 6, 1: 7, 1: 8, 1: 9, 1:10, 1: 12.5, 1:15, 1:20, 1:25, 1:29, 1:30, 1:40 1:50, 1:75, 1:80, 1: 100, more preferably 29: 1, 25: 1, 20: 1, 15: 1, 12.5: 1, 10: 1, 9: 1 8: 1, 7: 1, 6: 1, 5: 1, 4.5: 1, 4: 1, 3.5: 1, 3: 1, 2.5: 1 , 2: 1, 1.5: 1, 1: 1, 1: 1.5, 1: 2, 1: 2.5, 1: 3, 1: 3.5, 1: 4, 1: 4.5, 1: 5, 1: 6, 1 : 7, 1: 8, 1: 9, 1:10, 1: 12.5, 1:15, 1:20, 1:25, 1:29.

  As described above, when the helper plasmid and the indicator plasmid containing the target sequence are recognized by adding the helper plasmid and the indicator plasmid to the cells in an appropriate amount ratio and culturing the cells, the above “(1) As described in “Summary of the Invention”, the transposon transferase of the present invention recognizes the left recognition sequence and the right recognition sequence and cleaves the relevant portion. Thereby, the target sequence of interest is cut out and incorporated into the host genome, thereby completing gene introduction of the target sequence.

According to the gene introduction method using the helper plasmid and the indicator plasmid of the present invention, since only one clone is incorporated into the host clone, it is advantageous in that it does not receive silencing. Furthermore, the transposon transferase of the present invention accurately recognizes the transposon recognition sequence. That is, the present invention is an excellent gene introduction method as a method capable of accurately reproducing the function of a target sequence when the cut out target sequence is introduced into the host genome.
(10) Cell introduction / removal method of the present invention Furthermore, using the principle of the gene transfer method of the present invention, the target sequence from the host genome containing the transposon recognition sequence and the target sequence can be obtained using the transposon transferase of the present invention. It can also be cut out (removed). When a host genome having a transposon recognition sequence and a target sequence and the transposon transferase of the present invention are introduced into a cell, the transposon transferase recognizes the transposon recognition sequence, whereby DNA is cleaved at the recognition sequence. Here, the desired target is contained in the DNA cut and cut. Thus, the method of the present invention can remove DNA containing the target sequence from the host genome. In this case, since the transposon transferase of the present invention accurately recognizes the transposon recognition sequence, an excess base is not cut off at the time of cleavage, and an excess base is not left uncut. The method of the present invention is preferable in that a desired target sequence can be accurately cut out.

  The host genome containing the transposon recognition sequence and the target sequence of the above method may be prepared by the method described in the above “(9) Cell transfer method of the present invention”. In this case, the transposon transferase is introduced into the cell into which the DNA has been incorporated in the host genome generated in the steps (a) to (d) described below: (e) in the step (d). Cleaving the DNA by causing the enzyme to recognize a transposon recognition sequence and removing the DNA containing the target sequence from the host genome; and (f) ligating the host genome from which the DNA has been removed. Thus, the desired DNA can be removed from the host genome. The step (e) is the same as the step of introducing the construct into which the expression vector and the target sequence are incorporated in the step (c) into a cell, causing the transposon transferase to be recognized by the transposon recognition sequence and cleaving the DNA. And may be performed by the method described in step (c). Step (f) is performed subsequent to step (e) by a catalytic reaction of transferase.

  The above gene introduction method and removal (cutout) method can be used in combination with one or more other transposon transferases and their recognition sequence sets in the set of transposon transferases and their recognition sequences of the present invention ( FIG. 4). That is, in the above method, after steps (e) and (f) are performed on one transposon transferase, steps (e) and (f) are further performed on one or more other transposon transferases. By repeatedly performing one or more, gene introduction and removal of a plurality of target sequences can be more effectively performed in a desired order. That is, in the present invention, an indicator plasmid in which a plurality of recognition sequences each recognizing a plurality of transposon transferases is preliminarily incorporated can be prepared, and a helper plasmid containing each of the transposon transferases can be allowed to act in order. Thereby, more complicated gene introduction and removal thereof can be realized. According to the present invention, an undifferentiation-inducing gene (Oct3 / 4, Sox2, Klf4, c-Myc) that is at risk of causing canceration is introduced, particularly when iPS cells are established, and then stem cells are established to establish tissues and organs. After the regeneration, it is possible to restore the genotype by removing the gene. Thus, the gene transfer removal method of the present invention has an advantage that it can be applied in the field of regenerative medicine.

  EXAMPLES Next, although an Example demonstrates this invention, this invention is not limited by these Examples, Various modifications are included.

Example 1
The purpose of this example is to amplify the base sequence of the transposon transferase of the present invention.
The genomic sequence of the transposon transferase used is shown in SEQ ID NO: 1. Among the nucleotide sequences described in SEQ ID NO: 1, the 1st to 6th bases indicate the Kozak sequence, the 7th to 2460th bases are sequences encoding a transposon transferase, and the 2461st to 2478th bases. Indicates a linker sequence, the 2479th to 2496th bases indicate a nuclear translocation signal sequence, and the 2497th to 2499th bases indicate a stop codon.

The genomic sequence of this transposon transferase was amplified by the following method. First, BAC library created according to the method described in Construction of a BAC library derived from the inbred Hd-rR strain of the teleost fish, Oryzias latipes.Matsuda, M. et al., Genes Genet. Syst. (2011). BAC clones (Md-series, 13I17) containing the full length of Albatross were screened and the transferase sequence was amplified by PCR. PrimeSTAR GXL polymerase (TaKaRa) was used for amplification.
Primers used for amplification are as follows.
Forward primer: EcoRI-Kozak-Alba-F
GGAATTCCGCCACCATGAACAAAGGCCGCAAAAGAAC (SEQ ID NO: 5)

Reverse primer: Alba-R-TPase + NLS + SalI
GTCGACCTAAACCTTACGCTTCTTCTTACCACCACCACCACCACCCTGGGACGCGTCTGT
(SEQ ID NO: 6)

The PCR reaction conditions used for amplification are as follows.
1. 98 ° C 60 seconds 2. 98 ° C 10 seconds 3. 55 ° C 15 seconds 4. 68 ° C 2 minutes 30 seconds (2 to 4 5 cycles)
5. 98 ° C for 10 seconds 6. 68 ° C for 2 minutes 30 seconds
7. 4 ℃ ∞
Thereafter, the amplified PCR product was electrophoresed, and the amplified product was purified using Wizard SV Gel and PCR clean-UP System (Promega). The purified amplification product was ligated to Blunt II TOPO (invitrogen), transformed into DH5a E. coli strain, and streaked on a kanamycin plate. The obtained colonies were collected and cultured at 37 ° C. overnight in 2 ml LB supplemented with kanamycin (50 ug / ml). Plasmids were purified from the cultured colonies using QIAGEN Mini prep (QIAGEN). The obtained plasmid was subjected to enzyme treatment for 3 hours using restriction enzymes EcoRI (ToYoBo) and SalI (TaKaRa). At the same time, for pCSf107mT vector (Secreted Frizzled-related proteins enhance the diffusion of Wnt ligands and expand their signaling range.Mii, Y. et al., Development (2009)), EcoRI (ToYoBo), XhoI (TaKaRa) and Enzyme treatment was performed for 3 hours using CIAP (TaKaRa). The enzyme-treated plasmid and vector were each electrophoresed and purified using Wizard SV Gel and PCR clean-UP System (Promega). The purified plasmid and vector were ligated at 16 ° C. for 1 hour using Ligation high v2 (ToYoBo). The ligated plasmid vector was transformed into DH5a E. coli strain and streaked on an ampicillin plate. Thereafter, colonies were collected and cultured overnight at 37 ° C. in 100 ml LB supplemented with ampicillin (50 ug / ml). The cultured plasmid was purified using Nucleobond extra midi kit (TaKaRa). As a result, a vector containing the base sequence of transposon transferase was amplified. The obtained plasmid was used as a helper plasmid.
(Example 2)
The purpose of this example is to amplify the left-side recognition sequence and the right-side recognition sequence of Albatross to produce an indicator plasmid.
The amplification of Albatross left side recognition sequence (SEQ ID NO: 3) and right side recognition sequence (SEQ ID NO: 4) was carried out by the following method. First, BAC library created according to the method described in Construction of a BAC library derived from the inbred Hd-rR strain of the teleost fish, Oryzias latipes.Matsuda, M. et al., Genes Genet. Syst. (2011). BAC clones (Md-series, 13I17) containing the full length of Albatross were screened and the transferase sequence was amplified by PCR. PrimeSTAR GXL polymerase (TaKaRa) was used for amplification.
Primers used for amplification are as follows.

<Primer for transposon left recognition sequence>
Alba-indi-left-F: CATTGATGAATGAGACGGCTTTGATTTGGA (SEQ ID NO: 7)
Alba-indi-left-R: CCTTTCACTGGGAGGGTTATATAAATACGGAGGTC (SEQ ID NO: 8)

<Primer for transposon right recognition sequence>
Alba-indi-right-F: CCCTCCCAGTGAAAGGGAACCGGTAAAGCGAGAC (SEQ ID NO: 9)
Alba-indi-right-R: TGTACTCATTGAACTTTGGATGGTCACACA (SEQ ID NO: 10)

The PCR reaction conditions used for amplification are as follows.
<PCR reaction conditions for transposon left recognition sequence>
1. 98 ℃ 60 seconds 2. 98 ℃ 10 seconds 3. 68 ℃ 60 seconds (2 to 3 30 cycles)
4. 4 ℃ ∞

<PCR reaction conditions for transposon right recognition sequence>
1. 98 ° C 60 seconds 2. 98 ° C 10 seconds 3. 68 ° C 1 minute 30 seconds (2 to 3 30 cycles)
4. 4 ℃ ∞

Thereafter, the amplified PCR product was electrophoresed, and the amplified product was purified using Wizard SV Gel and PCR clean-UP System (Promega).

  Next, an equal amount of the purified amplification product is added to the PCR reaction solution, and PCR amplification is performed using the following primers. PrimeSTAR GXL polymerase (TaKaRa) was used for amplification.

Alba-indi-left-F: CATTGATGAATGAGACGGCTTTGATTTGGA (SEQ ID NO: 11)
Alba-indi-right-R: TGTACTCATTGAACTTTGGATGGTCACACA (SEQ ID NO: 12)

The PCR reaction conditions used for amplification are as follows.
1. 98 ° C 60 seconds 2. 98 ° C 10 seconds 3.54 ° C 15 seconds 4. 68 ° C 2 minutes 00 seconds (2 to 4 5 cycles)
5. 98 ° C 10 seconds 6.68 ° C 2 minutes 00 seconds (5 to 6 25 cycles)
7. 4 ℃ ∞

Thereafter, the amplified PCR product was electrophoresed, and the amplified product was purified using Wizard SV Gel and PCR clean-UP System (Promega). The purified amplification product was ligated to Blunt II TOPO (invitrogen), transformed into DH5a E. coli strain, and streaked on a kanamycin plate. The obtained colonies were collected and cultured overnight at 37 ° C. in 2 ml LB supplemented with kanamycin (50 ug / ml). The cultured plasmid was purified using Nucleobond extra midi kit (TaKaRa). Thus, an indicator indicator plasmid containing the left recognition sequence and the right recognition sequence of Albatross was obtained.
Example 3
The purpose of this example is to confirm the activity of the transposon transferase of the present invention by an exclusion assay.

In this example, HEK293T cells or HeLa cells were used. The cells were seeded in a 6 cm dish, and the medium was prepared by culturing using DMEM (Gibco) under conditions of 5% CO ₂ and 37 ° C. The cells were passaged to a 6 cm dish (final 10% confluency) and cultured overnight. The next day, the 20% confluency cells were washed with PBS. The cells were simultaneously transfected with the helper plasmid and the indicator plasmid prepared in Examples 1 and 2. At this time, PEI-MAX (final: 8 μg / ml, PSI) was used. The quantitative ratio of the helper plasmid and indicator plasmid used for cotransfection is as follows.

The solutions prepared in the above five types were incubated for 3 hours and then replaced with 4 ml of DMEM. Thereafter, the cells were cultured until they became confluent (3 days). From the cells thus prepared, a plasmid was extracted according to the method described in Selective Extraction of Polyoma DNA from Infected Mouse Cell Cultures. Hirt, B., J. Nol. Biol. (1967). Specifically, the cells were washed with PBS, 1 ml of 0.6% SDS, 0.01M EDTA solution (pH 8.0) was added to the cells, and shaken for 20 minutes. When the cells were lysed, the cell solution was collected in a 1.5 ml tube. 5M NaCl was added to the tube to a final concentration of 1M, and the tube was left at 4 ° C. overnight. Thereafter, the mixture was centrifuged at 17000 × g, 4 ° C., 30 minutes, and the supernatant was collected in a 2 ml tube. To the recovered liquid, 90% of the isopropanol was added, followed by further centrifugation at 17000 × g, 4 ° C. for 15 minutes. After discarding the supernatant after centrifugation, 1 ml of 70% ethanol was added. Thereafter, centrifugation was further performed under the conditions of 17000 × g, room temperature, and 5 minutes. The supernatant after centrifugation was discarded, and the one dried for 5 minutes was dissolved in 200 ul TE (pH 8.0).

  The plasmid purified above was used as a template. The sequence after excision was amplified by PCR reaction using the following primers. ExTaq (TaKaRa) was used for amplification.

Alba-indi-left-F: CATTGATGAATGAGACGGCTTTGATTTGGA (SEQ ID NO: 13)
Alba-indi-right-R: TGTACTCATTGAACTTTGGATGGTCACACA (SEQ ID NO: 14)

PCR amplification conditions are as follows.
<I. excision product amplification conditions>
1. 94 ° C 2 minutes 00 seconds 2. 94 ° C 15 seconds 3. 68 ° C 10 seconds 4. 72 ° C 15 seconds (2 to 4 50 cycles)
5. 72 ℃ 5 minutes 00 seconds 6.4 ℃ ∞

<II. Positive control amplification conditions>
1. 94 ° C 2 minutes 0 seconds 2. 94 ° C 15 seconds 3. 68 ° C 10 seconds 4. 72 ° C 2 minutes 00 seconds (30 cycles of 2-4)
5. 72 ℃ 5 minutes 00 seconds 6.4 ℃ ∞

The amplification product was electrophoresed and purified using the Wizard SV Gel and PCR clean-UP System (Promega). The purified amplification product was ligated to TOPO TA cloning kit (invitrogen), transformed into DH5a, and streaked on an ampicillin plate. Colonies were picked and cultured overnight at 37 ° C. in 2 ml ampicillin-added LB (50 ug / ml). Thereafter, the plasmid was purified using QIAGEN Mini prep kit (QIAGEN). Sequencing was performed using the purified plasmid (BigDye terminator v3.1, Applied Biosystems).

  As a result, it was confirmed that the plasmid incorporated in the indicator plasmid was excised with high precision at any ratio of the helper plasmid and the indicator plasmid used for cotransfection (FIG. 3).

As mentioned above, the invention made by the present inventor has been specifically described based on the embodiment. However, the invention is not limited to the embodiment, and various modifications can be made without departing from the scope of the invention. Needless to say.

  The transposon transferase of the present invention provides a system that can introduce a gene with high efficiency even with a DNA sequence of a huge size exceeding 100 kb. As a result, a large genomic region including a transcriptional regulatory region is introduced for a foreign gene that is controlled by a transcriptional regulatory region of 100 kb or more, which is impossible with a conventional gene transfer system, and expressed in a time-specific and tissue-specific manner. Can be made. Furthermore, when the introduced sequence is no longer necessary, it can be removed from the genome by the same method. Therefore, there is an industrial applicability that a gene whose function has not been known can be advanced for the first time by the system of the present invention.

  The cell introduction and removal technique of the present invention is an important technique particularly in the development of regenerative medicine. For example, when iPS cells are established, a plurality of undifferentiated induction genes (Oct3 / 4, Sox2, Klf4, c-Myc) are introduced, but since these genes are at risk of causing canceration, When it is actually applied to humans, it must be removed. However, by using the above method of the present invention, it is possible to establish stem cells by gene transfer, thereby regenerating tissues / organs, and then remove unnecessary transgenes and restore genotypes. Become. Therefore, the present invention has industrial applicability that it can contribute to the development of regenerative medicine.

Sequence number 5: Primer sequence number 6: Primer sequence number 7: Primer sequence number 8: Primer sequence number 9: Primer sequence number 10: Primer sequence number 11: Primer sequence number 12: Primer sequence number 13: Primer sequence number 14: Primer

Claims (8)

The nucleic acid according to any one of the following (a) to (g).
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 or a partial sequence thereof (b) hybridizing with a nucleic acid comprising a base sequence complementary to the base sequence comprising SEQ ID NO: 1 under stringent conditions; A nucleic acid comprising a base sequence encoding a protein having an Albatross transposon transfer activity (c) comprising a base sequence consisting of 80% or more of the base sequence consisting of SEQ ID NO: 1 and encoding a protein having an Albatross transposon transfer activity (D) a nucleic acid containing a nucleotide sequence encoding a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 or a partial sequence thereof (e) one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2 Consisting of an amino acid sequence deleted, substituted, or added, and the transposition activity of Albatross transposon (F) a nucleic acid comprising a base sequence encoding a protein having the amino acid sequence (f) comprising an amino acid sequence having 80% or more identity with the amino acid sequence consisting of SEQ ID NO: 2 and comprising a base sequence encoding a protein having Albatross transposon transfer activity Nucleic acid (g) A protein that hybridizes under stringent conditions with a nucleic acid consisting of a base sequence complementary to the base sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID NO: 2, and has an Albatross transposon transfer activity Nucleic acid containing a nucleotide sequence encoding The protein according to any one of the following (a) to (c).
(A) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (b) a protein consisting of an amino acid sequence in which one or more amino acids are deleted, substituted or added in SEQ ID NO: 2, and having translocation activity of Albatross transposon (C) a protein comprising an amino acid sequence having 80% or more identity with the amino acid sequence consisting of SEQ ID NO: 2 and having an activity of transposing transposons of Albatross   A recombinant vector containing the nucleic acid according to claim 1.   A transformant transformed with the recombinant vector according to claim 3.   A transposon transferase obtained by culturing the transformant according to claim 4.   A gene transfer reagent comprising the transposon transferase of claim 5 and a transposon recognition sequence.   The quantity ratio between the expression vector operably linked to the transposon transferase of claim 5 and the construct incorporating the target sequence and the transposon recognition sequence recognizing the transposon transferase of claim 5 is 29: 1 to 1: The gene introduction reagent according to claim 6, which is 29.   A gene transfer kit comprising the gene transfer reagent according to claim 6.