JP2014193156A - Method for preparing acetic acid bacterium having defective target gene and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for preparing an acetic acid bacterium having a defective target gene without introducing foreign genes.SOLUTION: In a method for preparing an acetic acid bacterium having a defective target gene by self-cloning, an endogenous pyrimidine synthesis enzyme (orotic acid phosphoribosyltransferase (pyrE) gene or orotidine 5'-phosphate decarboxylase (pyrF)) gene is used as a selection marker, the target gene is destroyed by double crossover with a target-destroying DNA, and cells having defective target gene are selected by uracil-prototrophism.

Description

  The present invention relates to a method for producing acetic acid bacteria deficient in a target gene and use thereof.

  The acetic acid bacterium Gluconacetobacter europaeus (Ga. Europaeus) has high ethanol oxidation ability and acetic acid resistance, and is widely used all over the world in industrial production of vinegar. However, the metabolic engineering technology of the acetic acid bacterium has not been reported at present, and the draft genome sequence of the type strain has just been determined in recent years. By improving by gene disruption, there is a possibility that more useful acetic acid bacteria can be produced.

  Regarding gene disruption, achievements in related acetic acid bacteria such as Ga. Xylinus and Acetobacter aceti have been reported (Non-Patent Documents 1 to 4). However, in these cases, a foreign drug resistance gene is used as a selection marker, so the obtained transformant is defined as a “gene recombinant” and is a problem to be further overcome for use in actual vinegar production. There is. As a technique for avoiding this, a self-cloning method in which the gene structure of the transformant is the same as that of the parent strain is used. However, with respect to acetic acid bacteria (Ga. Europaeus), a method for directly obtaining a transformant that can be used as it is for actual vinegar production has not been reported.

Shigematsu T, 6 others, `` Cellulose production from glucose using a glucose dehydrogenase gene (gdh) -deficient mutant of Gluconacetobacter xylinus and its use for bioconversion of sweet potato pulp. '', 2005, J Biosci Bioeng., 99 (4) , Pp. 415-22 Yadav V, 5 others, `` N-acetylglucosamine 6-phosphate deacetylase (nagA) is required for N-acetyl glucosamine assimilation in Gluconacetobacter xylinus. '', PLoS One, 2011, 6 (6), e18099 Iida A, 2 others, `` Control of acetic acid fermentation by quorum sensing via N-acylhomoserine lactones in Gluconacetobacter intermedius. '', J Bacteriol., 2008, 190 (7), pp. 2546-55 Sakurai K, 4 others, "Role of the glyoxylate pathway in acetic acid production by Acetobacter aceti.", J Biosci Bioeng, 2013, 115 (1), pp. 32-6

  It is an object of the present invention to provide a method for producing an acetic acid bacterium lacking a target gene and having no foreign gene introduced therein.

  The inventors of the present invention have intensively studied to solve the above problems and have completed the present invention. Specifically, the present inventors have found that the above problem can be solved by using an endogenous pyrimidine biosynthesis gene as a selection marker, and have completed the present invention.

The present invention has been completed as a result of further studies based on such knowledge, and is described below.
Item 1.
A method for producing acetic acid bacteria lacking a target gene by self-cloning, wherein an endogenous pyrimidine biosynthesis gene is used as a selection marker.
Item 2.
Item 2. The method according to Item 1, wherein the pyrimidine biosynthesis gene is an orotate phosphoribosyltransferase (pyrE) gene or an orotidine 5′-phosphate decarboxylase (pyrF) gene.
Item 3.
Item 3. The method according to Item 1 or 2, comprising the following steps:
(1) In the DNA corresponding to the region from the upstream region to the downstream region of the target gene in the genome of the acetic acid bacterium, DNA containing at least a part of the target gene replaced with DNA containing the pyrimidine biosynthesis gene A step of introducing a DNA having a target gene-disrupting action into an acetic acid strain deficient in the pyrimidine biosynthesis gene; and (2) an index of uracil prototrophy from the acetic acid bacterium obtained in the step (1). A step of selecting a target gene-deficient strain that has caused a double crossover with the DNA having an action of destroying the target gene.
Item 4.
Item 4. The method according to Item 3, wherein the DNA having an action of destroying a target gene is circular DNA.
Item 5.
Item 4. The method according to Item 3, wherein the DNA having an action of destroying a target gene is linear DNA.
Item 6.
Item 3. The method according to Item 1 or 2, comprising the following steps:
(1) DNA corresponding to from the upstream region to the downstream region of the target gene in the genome of the acetic acid bacterium, a DNA in which at least a part of the target gene is deleted; and circular DNAs each containing the pyrimidine biosynthesis gene In a strain lacking the pyrimidine biosynthetic gene;
(2) a step of selecting a strain in which the circular DNA has been incorporated into the genome by pop-in substitution from acetic acid bacteria obtained in the step (1) using uracil prototrophy as an index; and (3) the step From the acetic acid strain selected by (2), using 5-fluoroorotic acid (5-FOA) resistance and uracil requirement as an index, at least a part of the target gene and the pyrimidine biosynthesis gene by pop-out substitution A step of selecting a target gene-deficient strain in which the contained DNA has been removed from the genome.
Item 7.
Item 7. The method according to any one of Items 3 to 6, wherein the strain lacking the pyrimidine biosynthesis gene is obtained by a method comprising the following steps:
(I) The pyrimidine biosynthesis comprising DNA corresponding to from the upstream region to the downstream region of the pyrimidine biosynthesis gene in the genome of the acetic acid bacterium, wherein at least a part of the pyrimidine biosynthesis gene is deleted. A step of introducing a DNA having a synthetic gene disrupting action into an acetic acid bacterium; and (ii) from the acetic acid bacterium obtained by the step (i), using 5-FOA resistance and uracil requirement as indices, A step of selecting the pyrimidine biosynthetic gene-deficient strain that has caused a double crossover with the DNA having a synthetic gene disrupting action.
Item 8.
Item 8. The method according to Item 7, wherein the DNA having an action of destroying a pyrimidine biosynthesis gene is a circular DNA.
Item 9.
Item 8. The method according to Item 7, wherein the DNA having an action of destroying a pyrimidine biosynthesis gene is linear DNA.
Item 10.
Item 10. An acetic acid bacterium lacking a target gene, which can be obtained by the production method according to any one of Items 1 to 9.

  By using the method of the present invention, an acetic acid bacterium lacking a target gene and having no foreign gene introduced therein can be produced.

It is drawing which shows an example of the method of this invention using pop-in / pop-out. It is drawing which shows an example of the method of deleting the pyrE gene in a genome. It is drawing which shows an example of the method of deleting the target gene (aldC). It is drawing which shows the result of an Example. It is drawing which shows the result of an Example. It is drawing which shows the result of a test example. It is drawing which shows the result of a test example. It is drawing which shows the result of a test example. It is drawing which shows an example of the method of deleting the target gene (aldC). It is drawing which shows the result of an Example.

1. Method for producing acetic acid bacteria deficient in the target gene The method for producing acetic acid bacteria deficient in the target gene of the present invention is a self-cloning method, characterized in that an endogenous pyrimidine biosynthesis gene is used as a selection marker. And

  Although acetic acid bacteria are not specifically limited, For example, Acetobacter genus or Glucon acetobacter genus etc. can be used. Of these, Gluconacetobacter europaeus and Acetobacter pasteurianus are preferable.

  Self-cloning means exchanging nucleic acids between organisms belonging to the same species.

  The target gene is not particularly limited. The length of the target gene is not particularly limited in terms of the efficiency of obtaining a defective strain.

  In the present invention, an endogenous pyrimidine biosynthesis gene is used as a selection marker. Since an endogenous gene is used as a selectable marker, an acetic acid bacterium lacking a target gene and having no foreign gene introduced therein can be produced.

  A pyrimidine biosynthesis gene refers to a group of genes involved in the biosynthesis pathway of pyrimidine bases (thymine, cytosine and uracil). This pathway consists of six enzymatic reactions that synthesize UMP (uridine monophosphate), the precursor of all pyrimidine bases. The six enzymes (and the genes encoding them) are: carbamoyl phosphate synthase (carAB gene), aspartate transcarbamoylase (pyrB gene), dihydroorotase (pyrC gene) in order from the upstream of the UMP synthesis pathway ), Dihydroorotate dehydrogenase (pyrD gene), orotate phosphoribosyltransferase (pyrE) gene, and orotidine 5′-phosphate decarboxylase (pyrF). Strains carrying the genes encoding these enzymes exhibit uracil prototrophy, but strains in which the genes encoding these enzymes are disrupted cannot biosynthesize UMP and become uracil-requiring strains.

  Among these, positive selection with 5-fluoroorotic acid (5-FOA) is possible for strains in which pyrE or pyrF is disrupted. In strains that have not undergone gene disruption, 5-FOA is first taken into the pyrimidine pathway instead of orotate, and finally taken up into RNA, so that normal RNA synthesis is inhibited. To die. On the other hand, 5-FOA is not metabolized in the pyrE disrupted strain and the pyrF disrupted strain, and the cells can survive. By utilizing this, a pyrE disrupted strain or a pyrF disrupted strain can be selected by using a medium containing 5-FOA and a sufficient amount of uracil. For this reason, as an endogenous pyrimidine biosynthesis gene used as a selection marker in the present invention, pyrE or pyrF is preferable. If pyrE or pyrF is used, a strain in which pyrE or pyrF is present in the genome can be selected using uracil prototrophy as an index. Moreover, if pyrE or pyrF is used, a strain in which pyrE or pyrF is deleted from the genome can be selected using 5-FOA resistance as an index.

  The method for producing acetic acid bacteria lacking the target gene of the present invention may be a method utilizing double crossover or a method utilizing pop-in / pop-out.

Although it does not specifically limit as a method using a double crossover, For example, the method etc. which include the following processes (1) and (2) are mentioned.
(1) In the DNA corresponding to the region from the upstream region to the downstream region of the target gene in the genome of the acetic acid bacterium, DNA containing at least a part of the target gene replaced with DNA containing the pyrimidine biosynthesis gene A step of introducing a DNA having a target gene-disrupting action into an acetic acid strain deficient in the pyrimidine biosynthesis gene; and (2) an index of uracil prototrophy from the acetic acid bacterium obtained in the step (1). A step of selecting a target gene-deficient strain that has caused a double crossover with the DNA having an action of destroying the target gene.

In the step (1), by introducing a DNA having a target gene disrupting action into an acetic acid strain lacking a pyrimidine biosynthesis gene, DNA containing the pyrimidine biosynthesis gene is introduced into the genome, The target gene can be deleted from the genome.
This is because the region containing the target gene in the genome of the acetic acid bacterium is replaced with DNA containing the pyrimidine biosynthesis gene. More specifically, this replacement occurs when the DNA having the target gene destruction action causes a double crossover with the genome. In order to cause this double crossover, the DNA having a target gene disrupting action is used in the upstream region (hereinafter sometimes referred to as “5′-UR”) and downstream region (hereinafter referred to as “3′-”). DR ”))) must be included so as to sandwich the pyrimidine biosynthesis gene. These same sequences as 5′-UR and 3′-DR are also present in the genome so as to sandwich the target gene. By causing a double crossover between these mutually identical sequences, the target gene in the genome is eventually replaced with a pyrimidine biosynthesis gene. In order to cause this double crossover, the lengths required for 5′-UR and 3′-DR can be appropriately set, but usually 200 bases or more is sufficient. The length of 5′-UR and 3′-DR is preferably 300 bases to 2,000 bases, more preferably 500 bases to 1,000 bases, in view of the target gene destruction efficiency.

  The DNA having the action of destroying the target gene is not particularly limited as long as it causes the above-described double crossover. This DNA may be circular DNA or linear DNA. The length of this DNA is not particularly limited as long as the effects of the present invention can be obtained, but in the case of circular DNA, it is usually 2 kbp to 10 kbp, and preferably 4 kbp to 8 kbp. Similarly, in the case of linear DNA, it is usually 1 kbp to 8 kbp, preferably 2 kbp to 4 kbp.

  In the case of linear DNA, more specifically, as an example, a region of 0.5k to 1.0k upstream of the gene to be destroyed (target gene), a pyrE gene (1.5k), and 0.5 downstream of the gene to be destroyed. A region having a region of ˜1.0 k (that is, a total length of 2.5 k to 3.5 k) or the like can be used.

  The method for introducing DNA into acetic acid bacteria is not particularly limited, and can be appropriately selected depending on the purpose. Although not particularly limited, for example, electroporation method, conjugation transfer method with E. coli (JP 2012-125164 A) and calcium chloride method (Okumura, H. et al .: Agric. Biol. Chem., 49, 1011 ( 1985)) and the like. Among these, the electroporation method is particularly preferable from the viewpoint of easy work.

In the above, the acetic acid strain lacking the pyrimidine biosynthesis gene is not particularly limited, but can be obtained by, for example, a method including the following steps.
(I) The pyrimidine biosynthesis containing DNA in which at least a part of the pyrimidine biosynthesis gene is deleted in DNA corresponding to the region from the upstream to the downstream of the pyrimidine biosynthesis gene in the genome of acetic acid bacteria (Ii) introducing pyrimidine biosynthesis from acetic acid bacteria obtained by the above step (i) using 5-FOA resistance and uracil requirement as indicators, Selecting the pyrimidine biosynthetic gene-deficient strain that has caused a double crossover with the DNA having a gene-disrupting action.

  In the above-described method, the mechanism of gene replacement by double crossover is the same as the mechanism of the steps (1) and (2). Accordingly, all conditions including the length of the upstream region and the downstream region of the pyrimidine biosynthetic gene each having the pyrimidine biosynthetic gene disrupting function, It can be set in the same manner as described in the steps (1) and (2).

  In the step (2), the selection using uracil prototrophy as an index is performed for the purpose of selecting a target gene-deficient strain that has caused a double crossover with the DNA having an action of destroying the target gene. As long as the object is achieved, the detailed conditions can be set as appropriate.

  For example, a target gene-disrupted strain can be selected by accumulating transformants (uracil prototrophic strain) generated at a very low frequency in a minimal medium not containing uracil. The conditions in this case are not particularly limited, but examples of the composition of the minimal medium include the following.

  Glucose 30 g / L, L-glutamate sodium monohydrate 10 g / L, dipotassium hydrogen phosphate 0.1 g / L, potassium dihydrogen phosphate 0.5 g / L, potassium chloride 0.1 g / L, calcium chloride・ Dihydrate 0.1 g / L, Magnesium sulfate heptahydrate 0.25 g / L, Iron (III) chloride 0.005 g / L, Zinc sulfate heptahydrate 0.05 g / L, Molybdenum ( IV) disodium acid dihydrate 0.0005 g / L, boric acid 0.0005 g / L, copper sulfate pentahydrate 0.0025 g / L, manganese sulfate pentahydrate 0.01 g / L, Cobalt (II) chloride 0.0005 g / L, (+)-calcium pantothenate 0.002 g / L, ethanol and acetic acid 5 ml / L

Of the methods for producing acetic acid bacteria deficient in the target gene of the present invention, the method using pop-in / pop-out is not particularly limited. For example, the following steps (1) and (2) are performed. The method of including is mentioned.
(1) DNA corresponding to from the upstream region to the downstream region of the target gene in the genome of the acetic acid bacterium, a DNA in which at least a part of the target gene is deleted; and circular DNAs each containing the pyrimidine biosynthesis gene In a strain lacking the pyrimidine biosynthetic gene;
(2) a step of selecting a strain in which the circular DNA has been incorporated into the genome by pop-in substitution from acetic acid bacteria obtained in the step (1) using uracil prototrophy as an index; and (3) the step From the acetic acid strain selected by (2), DNA containing at least a part of the target gene and the pyrimidine biosynthesis gene is dropped from the genome by pop-out substitution using 5-FOA resistance and uracil requirement as an index. Selecting the target gene-deficient strain.

  An example of a method using pop-in / pop-out is shown in FIG.

  The circular DNA used in the step (1) is a DNA corresponding to the region from the upstream region (5′-UR) to the downstream region (3′-DR) of the target gene in the genome of the acetic acid bacterium. Contains partially defective DNA. The circular DNA further contains a pyrimidine biosynthesis gene.

  In the subsequent step (2), by selecting uracil prototrophy as an index, the 5′-UR or 3′-DR portion of the genome (5′-UR portion in FIG. 1) is replaced by pop-in substitution. A strain in which the full length of the circular DNA is incorporated into the genome can be selected.

  Furthermore, in step (3), by selecting 5-FOA resistance and uracil requirement as an index, DNA containing at least a part of the target gene and the pyrimidine biosynthesis gene by pop-out substitution is extracted from the genome. The missing target gene-deficient strain can be selected.

  The description for 5'-UR and 3'-DR is the same as the description for the sequence used for double crossover.

  The description of the gene introduction method, the selection method using uracil prototrophy as an index, and the selection method using 5-FOA resistance and uracil requirement as an index are the same as the description of the method using double crossover. .

  The advantage of the method using pop-in / pop-out is that the gene-disrupted strain finally obtained is used to target another target gene and repeat the steps (1) to (3), thereby separately. The gene can be deleted sequentially.

  Hereinafter, the present invention will be described in more detail with reference to Examples and Test Examples, but the present invention is not limited to these Examples.

1. Example 1: Generation of an aldC-deficient strain using a circular target gene disruption donor DNA 1.1 Genetic manipulation General genetic manipulation has been reported (Green MR, Sambrook JF. 2012. Molecular cloning: a laboratory manual, 4th ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). For cloning of DNA fragments, Escherichia coli DH5α strain was used, and transformants were selected by culturing in LB medium supplemented with 50 μg / ml ampicillin. Plasmid Midi Kit (Qiagen) was used for extraction of plasmid DNA. The primers used in the construction of the gene disruption vector described below are based on the draft genome data of Ga. Europaeus LMG18890 ^T strain (Andres-Barrao, C. et al .: J. Bacteriol., 193, 2670 (2011)). Designed. As the DNA polymerase, KOD plus (Toyobo) or Pfu-X (Greiner) was used. Restriction enzymes and other nucleic acid modifying enzymes were purchased from Takara Bio Inc. and Nippon Gene. For Southern blot analysis, DIG High Prime DNA Labeling and Detection Starter Kit I (Roche) was used. For DNA sequencing, BigDye Terminator Cycle Sequencing kit, ver. 3.1 and 3130 Genetic Analyzer (both Applied Biosystems) were used.

1.2 Preparation of electrocompetent cells 100 μl of frozen Ga. Europaeus cells isolated from vinegar fermented liquid containing 1.6% (wt / v) ethanol and 1.0% (v / v) cellulase (Sigma-Ardrich) Inoculate 5 ml YPD (glucose 30 g / l, yeast extract, 5 g / l, polypeptone 2 g / l) or YPDU (YPD supplemented with 60 μg / ml uracil), 30 ° C, reciprocal shaking 150 rpm For 16 hours (preculture). The preculture was inoculated into 30 ml YPD or YPDU containing 1.6% ethanol and 1.0% cellulase so that OD660 was 0.03, and cultured until the mid-log phase (OD660 = 0.4). The cells were collected and thoroughly washed with sterilized ultrapure water and 10% (v / v) glycerol, and then the cells were suspended in 10% glycerol of 1/100 volume of the culture solution to obtain an electrocompetent cell.

1.3 Construction of gene disruption vector
After extracting the genomic DNA of KGMA0119 strain (wild strain), using this as a template, the upstream and downstream 1.0 kb regions of the pyrE ORF were respectively EU-F (5'-G GAATTC GATCGCCATCCACGACGAAT-3 '(SEQ ID NO: 1). ; Underline, EcoRI recognition site) -E5'-R (5'- TTCAGCGCCAGTGCTTCTTC GGAGCCTGTTGAAAGTCCAG-3 '(SEQ ID NO: 2); Underline, pyrE ORF downstream region 5'-end homologous region) and E3'-F (5'- CTGGACTTTCAACAGGCTCC GAAGAAGCACTGGCGCTGAA-3 '(SEQ ID NO: 3); Underline, pyrE ORF Homologous region with 3' end of upstream region) -ED-R (5'-CG GGATCC AGCCCGGAAAACATTCAGCA-3 '(SEQ ID NO: 4); Underline, BamHI recognition site PCR amplification was carried out using the primer pair. Using both the obtained DNA fragments as templates, PCR amplification with EU-F and ED-R was performed to prepare a DNA fragment lacking the pyrE ORF. The DNA fragment was digested with a restriction enzyme and cloned into the corresponding position of pUC19 to obtain a pyrE disruption vector (pUC19-ΔpyrE). Similarly, a 2.9 kb region including aldC ORF, its upstream 1.0 kb, and downstream 1.0 kb was converted into aldC-F (5'-A GAATTC GATCACGCTCGAAACCCTGT-3 '(SEQ ID NO: 5); underline, EcoRI recognition site) and aldC -R (5'-AA ATCGAT CGATATCCCCCACCAGTTCA-3 '(SEQ ID NO: 6); ClaI recognition site) PCR amplification was performed, and the resulting DNA fragment was subjected to restriction enzyme treatment and then cloned into the corresponding position of pBR322. . Using the obtained plasmid DNA as a template, using aldC-i1 (5'-ATTCACGAAGCCATTCGCGTGGCTG-3 '(SEQ ID NO: 7)) and aldC-i2 (5'-GATTGCCCGAGAATGGTGAAGCAGG-3' (SEQ ID NO: 8)) primers PCR was performed to produce a linear DNA fragment from which the aldC ORF was deleted. At the same time, a 1.5 kb DNA fragment containing the pyrE ORF and its putative promoter region was converted into EP-F2 (5'-CTGCCATATCCCGTGTTCGT-3 '(SEQ ID NO: 9)) and E-R4 (5'- phosphorylated at the 5' end. PCR amplification was performed using TCGCCATAGGGAAAGACTGC-3 ′ (SEQ ID NO: 10)), and this fragment was ligated with the aforementioned aldC OFR deletion fragment to prepare an aldC disruption vector (pBR322-ΔaldC :: pyrE).

1.4 Isolation of gene disruption strain 1.4.1
After mixing pUC19-ΔpyrE and KGMA0119 strain electrocompetent cells in an ice-cooled 0.1 cm cuvette, an electric pulse of 25 kv / cm, 200 Ω, 25 μF was given by a gene transfer device ECM630 (BTX) and the same by electroporation. Strains were transformed. Immediately afterwards, ice-cold 1 ml YPD liquid medium was added and cultured with shaking at 30 ° C. for 16 hours. The culture solution is applied to a minimal agar medium (composition mentioned above) containing 0.2% (wt / v) 5-FOA and 60 μg / ml uracil, and cultured at 30 ° C for 2 to 3 days. 5-FOA resistance and uracil requirement A strain showing was selected. The genotype of the strain showing the same phenotype was analyzed by PCR, DNA sequencing, and Southern blot analysis, and one of the strains with the deletion of the pyrE gene was designated as KGMA0704 strain (ΔpyrE). Performed (FIG. 2).

  By the method described above, the aldC disruption vector pBR322-ΔaldC :: pyrE was introduced into the KGMA0704 strain by electroporation. Immediately after the electric pulse was applied, ice-cold 1 ml YPD liquid medium was added and cultured with shaking at 30 ° C. for 3 hours. The cells are collected, washed with physiological saline (0.85% (wt / v) NaCl), inoculated into 5 ml uracil-free minimal medium, and further cultured at 30 ° C for 96 to 120 hours. The prototrophic strain was enriched and cultured. Subsequently, the culture solution was appropriately diluted, applied to a minimal agar medium without uracil, and cultured at 30 ° C. for 2 to 3 days. The genotype of the obtained uracil prototrophic strain was analyzed by PCR, DNA sequencing and Southern blot analysis, and one of the strains in which substitution with pyrE was observed at the aldC locus was identified as KGMA4004 strain (ΔpyrE, ΔaldC :: pyrE) (FIG. 3) and was subjected to an acetoin productivity test.

1.4.2
In constructing a gene disruption system using pyrE as a selection marker, we estimated the pyrimidine biosynthesis pathway of Ga. europaeus using draft genome data of type strains. As a result, it was suggested that the acetic acid bacteria have the same metabolic pathway as other microorganisms. Therefore, by using the method described above, the KGMA0119 strain (wild strain) was tested and an attempt was made to produce a pyrE-deficient strain using 5-FOA resistance and uracil requirement as indices. As a result, a plurality of candidate strains were obtained. One of them was used as a KGMA0704 strain, and was used for the subsequent analysis. First, when the KGMA0704 strain was cultured in a minimal medium with or without uracil, growth was observed only in the presence of uracil (FIG. 4), and the uracil requirement of the same strain was confirmed from this result. In addition, the genotype of the same strain was changed to PCR (template, genomic DNA) using the primers EP-F3 (5′-ATCCCCACCAGCATGTTCAC-3 ′ (SEQ ID NO: 11)) and E-R4 (FIG. 2), and the pyrE probe. They were identified by Southern blot analysis using (FIG. 2).
As a result, in both analyses, a signal of a low molecular weight was detected in the KGMA0704 strain compared to the wild strain (FIG. 5), indicating that the pyrE gene was deleted in the genome of the KGMA0704 strain.
This fact was further confirmed by sequencing of the obtained PCR product. These results suggested that the pyrE gene deleted in KGMA0704 strain is involved in pyrimidine biosynthesis in Ga. Europaeus, and that it is possible to construct a gene disruption system using this gene as a selection marker. Based on this, KGMA0704 strain (ΔpyrE) was used for the subsequent gene disruption experiments.

1.4.3
Generally, α-acetolactic acid decarboxylase is one of acetoin biosynthetic genes, and the biosynthetic system in microorganisms converts excessive amounts of lactic acid or pyruvate into acetoin, which is a neutral compound. It suppresses the acidification of the environment and stores it as a carbon source for use during carbon depletion (Huang, M. et al .: J. Bacteriol., 181, 3837 (1999)). It has been known for a long time that acetic acid bacteria also accumulate acetoin when cultured in a medium containing lactic acid (Ley, J. De: J. Gen. Microbiol., 21: 352 (1959)). On the other hand, acetoin is widely known as one of unpleasant odors in vinegar, beer, sake, etc., and controlling the amount of accumulation is one of the important issues in product design. Furthermore, it is suggested from the draft genome data of the type strain that Ga. Europaeus also retains an acetoin biosynthesis gene group including aldC. Based on these findings, we attempted to destroy this gene by replacing the putative aldC gene in Ga. Europaeus with the pyrE gene for the purpose of producing non-acetoin-producing bacteria. Specifically, the aldC disruption vector was introduced into the KGMA0704 strain, and selection was performed using uracil prototrophy as an index. As a result, a plurality of candidate strains were obtained. One of them was designated as KGMA4004 strain, and the genotype of the strain was identified by the same method as described above. In the PCR, aldC-F2 (5'-CCTGAACCTTCATTTCAATGGTGCG-3 '(SEQ ID NO: 12)) and aldC-R2 (5'-GTCCATGCTCTGGTGCGTAAGCTTC-3' (SEQ ID NO: 13)) were used as primers (Fig. 3), genome. DNA was used as a template. Further, the aldC probe (FIG. 3) was used for Southern blot analysis. As a result, in both analyzes, a signal of a polymer was detected in the KGMA4004 strain than in the wild strain (FIG. 5), and substitution with pyrE at the aldC locus was shown. Similar results were confirmed from DNA sequencing. Based on these, the KGMA4004 strain was used as an aldC-deficient strain (ΔpyrE, ΔaldC :: pyrE) and subjected to the acetoin productivity test described below.

2. Test Example: Evaluation of the obtained aldC-deficient strain (KGMA4004 strain) (acetoin productivity test) 2.1.
Inoculate 100 μl of frozen cells of KGMA0119 and KGMA4004 strains into 5 ml YPD liquid medium containing 0.4% (wt / v) ethanol and 0.5% (wt / v) acetic acid, and 30 hours at 30 ° C with reciprocating shaking at 150 rpm for 16 hours. Cultured (preculture). The preculture is inoculated into 30 ml YPD or minimal medium containing 0.4% ethanol, 0.5% acetic acid, and 0.3% (wt / v) L-sodium lactate so that OD660 = 0.03. Cultured with shaking. The culture supernatant was collected over time, and the volatile components in the supernatant were quantified by gas chromatography (GC-14A, Shimadzu). The column was a Shinwa Kako packed column (PEG20M 10%, SHINCARBON A 60/80, 2.1m × 3.2mm), and the temperature rising program was 80 ° C for 3 minutes, 10 ° C / minute for 12 minutes, and 200 ° C for 5 minutes. went.

2.2
The KGMA4004 strain obtained as described above was cultured in a rich medium (YPD) containing L-sodium lactate or a minimal medium, and its acetoin productivity was analyzed. As a result, the acetoin accumulation amount of the KGMA4004 strain was remarkably reduced in both media compared to the wild strain (FIGS. 6 to 8). From these results, it was demonstrated that gene disruption using pyrE as a selection marker in Ga. Europaeus is possible. At the same time, the aldC gene deleted in the KGMA4004 strain is involved in acetoin biosynthesis, and it was shown that non-acetoin-producing bacteria can be produced by disruption of this gene.

3. Example 2: Gene disruption using linear target gene disruption donor DNA 3.1 Preparation of linear target gene disruption donor DNA A linear target gene disruption donor DNA was prepared according to the following procedure. . In other words, Akasaka N, Sakoda H, Hidese R, Ishii Y, Fujiwara S. 2013.An efficient method using Gluconacetobacter europaeus to reduce an unfavorable flavor compound, acetoin, in rice vinegar production.Appl.Environ.Microbiol.doi : 10.1128 / AEM.02397-13.) Using the circular gene disruption vectors pUC19-ΔpyrE and pBR322-ΔaldC :: pyrE prepared as templates in the former, EU-F-ED-R for the former, and aldC-F-aldC- for the latter PCR amplification was performed using an R primer pair (FIG. 9). DpnI was added to the PCR reaction solution and incubated at 37 ° C. for 1 hour to completely digest the circular DNA used as the template. In FIG. 9, the upper and lower arrows indicate the primers used for construction and genotyping analysis, respectively. “Cs” stands for citrate synthase, “gr” stands for glutamate racemase, “h” stands for hypothetical protein, and “als” stands for α-acetolactate synthase.

  Thereafter, the obtained PCR products were separated by electrophoresis using 0.7% agarose gel (1 × TAE) and purified by NucleoSpin Gel and PCR Cleanup Kit (Takara Bio). The resulting PCR product was further purified by ethanol precipitation and concentrated. These were subjected to subsequent gene disruption experiments. The base sequence of the linear DNA disruption donor DNA obtained here is the sequence that Ga. Europaeus originally holds in the chromosome.

3.2 Identification of gene disruption and genotype of Ga. Europaeus The linear gene disruption donor DNA obtained in the previous section was introduced by electroporation according to the previous report (Akasaka, 2013). The selection and isolation were all based on the previous report (Akasaka, 2013). The genotype of the obtained target gene disruption strain was identified by PCR using the candidate strain chromosomal DNA as a template. EP-F3-E-R4 and aldC-F2-aldC-R2 primer pairs were used for amplification of the pyrE and aldC loci, respectively. One of the pyrE and aldC disrupted strains obtained by these procedures was designated as KGMA6722 strain (ΔpyrE) and KGMA4809 strain (ΔpyrE, ΔaldC :: pyrE), respectively.

3.3 Isolation of target gene disruption strain by introduction of linear DNA By the methods described in 3.1 and 3.2 above, linear pyrE and aldC disruption donor DNAs were prepared, and each of them was used as a KGMA0119 strain ( wild-type) and KGMA0704 strain (ΔpyrE). As a result of selection, in both trials, a plurality of candidate strains that were considered to have the target gene destroyed were obtained. From these candidate strains, KGMA6722 strain and KGMA4809 strain were selected, chromosomal DNA was extracted from both strains, and the genotype was identified by PCR using the DNA as a template. As a result, a low molecular signal was detected from the pyrE locus of the KGMA6722 strain as compared to the wild strain (FIG. 10A). Similarly, a higher molecular signal was detected from the aldC locus of the KGMA4809 strain than the wild strain and the parent strain KGMA0704 (FIG. 10B). These results are in good agreement with the prediction shown in FIG. Furthermore, as a result of sequence analysis of the obtained DNA fragments, it was confirmed that the target gene was indeed destroyed in both strains. From these results, it was demonstrated that the gene disruption of Ga. Europaeus can also be achieved by introducing linear DNA obtained by chemical synthesis such as PCR. The above clearly states that the gene disruption of Ga. Europaeus can be performed without using other organisms such as E. coli (no cloning work using E. coli is required when constructing a gene disruption vector). The technique shown is considered to be a very effective means for breeding food-producing bacteria.

  Subsequently, the transformation efficiency when circular DNA (pUC19-ΔpyrE) and linear DNA (ΔpyrE) were used in constructing a pyrE-disrupted strain was verified. That is, the number of pyrE-deficient strains per unit amount of introduced DNA was 8.6 CFU / pmol DNA for circular DNA and 9.0 CFU / pmol DNA for linear DNA, and there was no significant difference between the two. Similar results have been reported in the hyperthermophilic archaeon Thermococcus kodakarensis (Sato T, Fukui T, Atomi H, Imanaka T. 2003.Targeted gene disruption by homologous recombination in the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1. J. Bacteriol. 185: 210-220.), DNA having a homologous region of sufficient length necessary for recombination is considered to be capable of gene disruption regardless of circular or linear.

Claims (10)

A method for producing acetic acid bacteria lacking a target gene by self-cloning, wherein an endogenous pyrimidine biosynthesis gene is used as a selection marker. The method according to claim 1, wherein the pyrimidine biosynthesis gene is an orotate phosphoribosyltransferase (pyrE) gene or an orotidine 5'-phosphate decarboxylase (pyrF) gene. The method according to claim 1 or 2, comprising the following steps:
(1) In the DNA corresponding to the region from the upstream region to the downstream region of the target gene in the genome of the acetic acid bacterium, DNA containing at least a part of the target gene replaced with DNA containing the pyrimidine biosynthesis gene A step of introducing a DNA having a target gene-disrupting action into an acetic acid strain deficient in the pyrimidine biosynthesis gene; and (2) an index of uracil prototrophy from the acetic acid bacterium obtained in the step (1). A step of selecting a target gene-deficient strain that has caused a double crossover with the DNA having an action of destroying the target gene. The method according to claim 3, wherein the DNA having an action of destroying a target gene is circular DNA. The method according to claim 3, wherein the DNA having an action of destroying a target gene is linear DNA. The method according to claim 1 or 2, comprising the following steps:
(1) DNA corresponding to from the upstream region to the downstream region of the target gene in the genome of the acetic acid bacterium, a DNA in which at least a part of the target gene is deleted; and circular DNAs each containing the pyrimidine biosynthesis gene In a strain lacking the pyrimidine biosynthetic gene;
(2) a step of selecting a strain in which the circular DNA has been incorporated into the genome by pop-in substitution from acetic acid bacteria obtained in the step (1) using uracil prototrophy as an index; and (3) the step From the acetic acid strain selected by (2), using 5-fluoroorotic acid (5-FOA) resistance and uracil requirement as an index, at least a part of the target gene and the pyrimidine biosynthesis gene by pop-out substitution A step of selecting a target gene-deficient strain in which the contained DNA has been removed from the genome. The method according to any one of claims 3 to 6, wherein the strain lacking a pyrimidine biosynthesis gene is obtained by a method comprising the following steps:
(I) The pyrimidine biosynthesis comprising DNA corresponding to from the upstream region to the downstream region of the pyrimidine biosynthesis gene in the genome of the acetic acid bacterium, wherein at least a part of the pyrimidine biosynthesis gene is deleted. A step of introducing a DNA having a synthetic gene disrupting action into an acetic acid bacterium; and (ii) from the acetic acid bacterium obtained by the step (i), using 5-FOA resistance and uracil requirement as indices, A step of selecting the pyrimidine biosynthetic gene-deficient strain that has caused a double crossover with the DNA having a synthetic gene disrupting action. The method according to claim 7, wherein the DNA having an action of destroying a pyrimidine biosynthesis gene is a circular DNA. The method according to claim 7, wherein the DNA having an action of disrupting a pyrimidine biosynthesis gene is a linear DNA. An acetic acid bacterium deficient in a target gene, which can be obtained by the production method according to claim 1.

Images