JP2013146251A - Modified lipase, production method thereof, and reaction using the enzyme - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a modified lipase having excellent carbamating activity or transesterification activity, and to provide a production method of a carbamate compound or a transesterification product, using the modified lipase.SOLUTION: There are provided a modified lipase which exhibits higher carbamating activity or transesterification activity than a wild type lipase exhibiting a specific amino acid sequence, and is obtained by substituting a leucine of the 278th position of the specific amino acid sequence with another amino acid residue, a mutant thereof having further substitution, deletion, insertion, addition or inversion of one or several amino acids, and a production method of a carbamate compound or a transesterification product, using those. There is also provided a production method of a carbamate compound, using a known modified lipase.

Description

  The present invention relates to a novel modified lipase, a method for producing the same, and various reactions using the enzyme. More specifically, the present invention relates to a modified lipase having an excellent carbamation activity or transesterification activity. Furthermore, the present invention relates to a method for producing a carbamate compound or a transesterification product using the modified lipase.

  The present invention also relates to a method for producing a carbamate compound using a known modified lipase.

  Conventionally, a method of obtaining a carbamate compound using lipase as a catalyst (carbamation) is, for example, a carbamate compound obtained by reaction of 3 ′, 5′-diaminonucleoside (aliphatic amine compound) with a diethyl carbonate compound in the presence of lipase. Is known (Non-patent Document 1).

  However, the number of lipases with respect to the substrate is large, the reaction takes a long time, the yield of the product is low, and the carbamate compound production method using lipase is not an industrially satisfactory production method. From these points, a lipase having excellent carbamate activity has been demanded.

  On the other hand, studies have been conducted to improve the activity and stability by modifying the amino acid sequence of lipase (Non-patent Documents 2 and 3). However, there is no known lipase with improved carbamation activity due to amino acid sequence modification.

  Moreover, although patent document 1 describes the increase in acrylate activity by the amino acid sequence modification of lipase (CALB), it describes that the single substitution of the 104th tryptophan to phenylalanine produces a decrease in activity.

  Non-Patent Document 4 describes the increase in lipase activity by modifying the amino acid sequence at three positions including 278 of lipase (CALB), but does not describe the activity of the single substitution product at 278. In addition, the carbamate activity of the variant is not disclosed.

  Conventionally, transesterification using lipase as a catalyst is carried out by transesterification between a free hydroxyl group of an alkyl alcohol using lipase (CALB) and a fatty acid vinyl alcohol ester such as vinyl methacrylate as described in Non-Patent Document 5. Is disclosed. However, the lipase (CALB) to be used requires 10% by weight based on the substrate, and a lipase with higher transesterification activity has been demanded.

WO2009 / 080676 A1

J. et al. Org. Chem. 2004 Volume 69 p. 1748-1751 ChemBioChem 2010 Volume 11 p. 789-795 J. et al. Amer. Chem. Soc. 2005, 127, p. 13466-13467 Biotechnol. Prog. 2011, Vol. 27, p. 47-53 ACS Symposium Series 1043 Green Polymer Chemistry 2010 p. 417-424

  An object of the present invention is to provide a modified lipase having excellent carbamate-forming activity or transesterification activity, and a method for producing a carbamate compound or transesterification product using the modified lipase.

  Another object of the present invention is to provide a method for producing a carbamate compound using a known modified lipase.

  The present inventors selected CALB as a lipase, produced a mutant of CALB, and aimed to reduce the cost required for producing a carbamate compound by improving carbamate activity. As a result of extensive studies, the inventors succeeded in producing a mutant CALB having a higher carbamate activity or transesterification activity than the wild type. The present inventors have also found that known modified CALB has high carbamation activity. That is, the present invention provides the following inventions.

(1) Modified lipase in which glutamine at position 193 in SEQ ID NO: 1 is substituted with another amino acid residue, or a variant thereof having substitution, deletion, insertion, addition or inversion of one or more amino acids A modified lipase or a variant thereof, which exhibits higher carbamate activity or transesterification activity than the wild type lipase shown in SEQ ID NO: 1. That is, a single modified lipase having SEQ ID NO: 1 of Q193X (where X represents any amino acid other than glutamine) or a variant thereof.

(2) The modified lipase according to (1), wherein glutamine at position 193 is substituted with glutamic acid or aspartic acid, or further, one or several amino acid substitutions, deletions, insertions, additions or inversions, A variant thereof exhibiting the same carbamation activity and transesterification activity as modified lipase. That is, a single modified lipase having SEQ ID NO: 1 of Q193E or Q193D or a variant thereof.

(3) Furthermore, tryptophan at position 104 is substituted with phenylalanine, the modified lipase according to (1) or (2), or further substitution, deletion, insertion, addition or inversion of one or several amino acids. And variants thereof having the same carbamation activity and transesterification activity as the modified lipase. That is, a double modified lipase having SEQ ID NO: 1 of [Q193X, Q193E or Q193D] + W104F or a variant thereof.

(4) In addition, leucine at position 278 is substituted with arginine or lysine, the modified lipase according to (1) or (2), or further substitution, deletion, insertion, addition or reverse of one or several amino acids And mutants thereof having the same carbamation activity and transesterification activity as the modified lipase. That is, the double modified lipase of SEQ ID NO: 1 having [Q193X, Q193E or Q193D] + [L278K or L278R] or a variant thereof.

(5) Further, the modified lipase according to (3), wherein leucine at position 278 is substituted with arginine or lysine, or further, substitution, deletion, insertion, addition or inversion of one or several amino acids These mutants exhibiting the same carbamation activity and transesterification activity as the modified lipase. That is, the triple modified lipase of SEQ ID NO: 1 having [Q193X, Q193E or Q193D] + W104F + [L278K or L278R] or a variant thereof.

(6) Furthermore, the modified lipase according to (5), wherein alanine at position 283 is substituted with valine, or further, substitution, deletion, insertion, addition or inversion of one or several amino acids, Those variants that show the same carbamate and transesterification activity as the modified lipase. That is, the quadruple modified lipase of SEQ ID NO: 1 having [Q193X, Q193E or Q193D] + W104F + [L278K or L278R] + A283V or a variant thereof.

(7) DNA encoding the modified lipase or mutant thereof according to any one of (1) to (6).

(8) A transformed microorganism comprising the DNA according to (7).

(9) A modified lipase or a mutant thereof characterized by culturing the transformed microorganism according to (8) in a medium and accumulating the modified lipase or a mutant thereof in the medium and / or the microorganism. Production method.

(10) Modified lipase or variant thereof according to any one of (1) to (6) or modified lipase obtained by the method according to (9) or a variant thereof immobilized on a carrier Type lipase or a variant thereof.

(11) Carbamation of the modified lipase or variant thereof according to any one of (1) to (6) and (10) or the modified lipase or variant thereof obtained by the method according to (9) Use in reaction or transesterification.

(12) The use according to (11), wherein the carbamate reaction comprises reacting a carbonate compound and an amine compound to produce a carbamate compound.

(13) The use according to (11), wherein the transesterification reaction is one in which an ester compound and an alcohol compound are reacted to produce a transesterification product.

(14) In the presence of the modified lipase or variant thereof according to any one of (1) to (6) and (10) or the modified lipase obtained by the method according to (9) or a variant thereof A method for producing a carbamate compound, comprising reacting a dialkyl carbonate compound and an amine compound as a substrate.

(15) In the presence of the modified lipase according to any one of (1) to (6) and (10) or a variant thereof or the modified lipase obtained by the method according to (9) or a variant thereof A method for producing a transesterification product, comprising reacting an alkyl alcohol compound and a fatty acid vinyl alcohol ester compound as a substrate.

(16) The method for producing a carbamate compound according to (14), wherein the dialkyl carbonate compound is a dimethyl carbonate compound.

(17) A modified lipase in which tryptophan at position 104 of SEQ ID NO: 1 is substituted with phenylalanine, or further having one or several amino acid substitutions, deletions, insertions, additions or inversions, and the modified lipase Use of the variant exhibiting the same carbamate activity in a carbamate reaction.

(18) The use according to (17), wherein the carbamate reaction comprises reacting a carbonate compound and an amine compound to produce a carbamate compound.

(19) A modified lipase in which tryptophan at position 104 of SEQ ID NO: 1 is substituted with phenylalanine, or a substitution, deletion, insertion, addition or inversion of one or several amino acids, and the modified lipase A method for producing a carbamate compound, comprising reacting a dialkyl carbonate compound and an amine compound as a substrate in the presence of a mutant exhibiting the same carbamate activity.

(20) The method for producing a carbamate compound according to (19), wherein the dialkyl carbonate compound is a dimethyl carbonate compound.

(21) A modified lipase obtained by substituting leucine at position 278 of SEQ ID NO: 1 with another amino acid residue, or a variant thereof having substitution, deletion, insertion, addition or inversion of one or more amino acids A modified lipase or a variant thereof, which exhibits higher carbamate activity and transesterification activity than the wild type lipase shown in SEQ ID NO: 1. That is, the modified lipase of SEQ ID NO: 1 having L278X (where X represents any amino acid other than glutamine) or a variant thereof.

(22) The modified lipase according to (21), wherein leucine at position 278 is substituted with arginine or lysine, or further, substitution, deletion, insertion, addition or inversion of one or several amino acids, and the modification A variant thereof exhibiting the same carbamate and transesterification activity as type lipase. That is, the modified lipase of SEQ ID NO: 1 having L278K or L278R or a variant thereof.

(23) The modified lipase according to (21) or (22), wherein glutamine at position 193 is substituted with glutamic acid or aspartic acid, or further substitution, deletion, insertion, addition or addition of one or several amino acids Those variants having an inversion and exhibiting the same carbamate and transesterification activity as the modified lipase. That is, the modified lipase of SEQ ID NO: 1 having [Q193E or Q193D] + [L278K or L278R] or a variant thereof.

(24) A DNA encoding the modified lipase or a mutant thereof according to any one of (21) to (23).

(25) A transformed microorganism comprising the DNA according to (24).

(26) A modified lipase or a mutant thereof, wherein the transformed microorganism according to (25) is cultured in a medium, and the modified lipase or a mutant thereof is accumulated in the medium and / or the microorganism. Production method.

(27) The modified lipase or variant thereof according to any one of (21) to (23) or the modified lipase obtained by the method according to (26) or the variant thereof immobilized on a carrier Lipase or a variant thereof.

(28) Carbamation of the modified lipase or variant thereof according to any one of (21) to (23) and (27) or the modified lipase or variant thereof obtained by the method of (26) Use in reaction or transesterification.

(29) The use according to (28), wherein the carbamate reaction comprises reacting a carbonate compound and an amine compound to produce a carbamate compound.

(30) The use according to (28), wherein the transesterification reaction is one in which an ester compound and an alcohol compound are reacted to produce a transesterification product.

(31) In the presence of the modified lipase according to any one of (21) to (23) and (27) or a variant thereof or the modified lipase obtained by the method according to (26) or a variant thereof A method for producing a carbamate compound, comprising reacting a dialkyl carbonate compound and an amine compound as a substrate.

(32) In the presence of the modified lipase according to any one of (21) to (23) and (27) or a variant thereof or the modified lipase obtained by the method according to (26) or a variant thereof A method for producing a transesterification product, comprising reacting an alkyl alcohol compound and a fatty acid vinyl alcohol ester compound as a substrate.

(33) The method for producing a carbamate compound according to (31), wherein the dialkyl carbonate compound is a dimethyl carbonate compound.

  The modified lipase of the present invention or a variant thereof exhibits a carbamation activity or transesterification activity superior to that of a wild type lipase.

The expression vector pYES2CT (pYES2CT / SUC2sig / mCALB) containing the mature wild type CalB gene linked to the signal sequence of SUC2 is shown. The ester compound decomposition | disassembly activity of the transformed yeast which holds pYES2CT / SUC2sig / mCALB vector is shown. “-CALB” indicates a transformed yeast (control) carrying the pYES2CT / SUC2sig vector without the CalB gene. “+ CALB” indicates a transformed yeast carrying the pYES2CT / SUC2sig / mCALB vector having the CalB gene. The carbamate compound synthesis activity from dimethyl carbonate (DMC) and n-hexylamine using W104F, Q193E, W104F / Q193E modified lipase is shown. (A) shows GC chromatography of the reaction liquid after 8 hours using W104F / Q193E modified lipase. IS indicates an internal standard. (B) shows the yield (%) of methylhexyl carbamate. w. t. , W104F, Q193E and W104F / Q193E represent wild type lipase, W104F modified lipase, Q193E modified lipase and W104F / Q193E modified lipase, respectively. The carbamate compound synthesis activity from dimethyl carbonate (DMC) and 1,3-bisaminomethylcyclohexane (1,3BAC) using W104F, Q193E, W104F / Q193E modified lipase is shown. The carbamate compound synthesis activity from dimethyl carbonate (DMC) and 1,12- diaminododecane (DMD) using W104F, Q193E, W104F / Q193E modified lipase is shown. The carbamate compound synthesis activity from dimethyl carbonate (DMC) and xylylenediamine (XDA) using W104F, Q193E, W104F / Q193E modified lipase is shown. Dimethyl carbonate (DMC) and n-hexyl using W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R, L278R, L278K, Q193D, A283V modified lipase It shows carbamate compound synthesis activity.

  The lipase of the present invention means a lipase originating from Candida antarctica (CALB, Genebank ACCESSION No. P41365). CALB of the present invention preferably means mature CALB, and its amino acid sequence is shown in SEQ ID NO: 1. Hereinafter, the lipase having the amino acid sequence of SEQ ID NO: 1 is referred to as wild-type lipase.

  The modified lipase of the present invention is a single modified lipase (hereinafter referred to as 193) wherein glutamine at position 193 in SEQ ID NO: 1 is substituted with another amino acid residue and exhibits higher carbamate activity or transesterification activity than wild type lipase. It is referred to as a modified lipase. Alternatively, a single modified lipase in which tryptophan at position 104 is substituted with phenylalanine (W104F) (hereinafter, W104F modified lipase (SEQ ID NO: 3)) may be included.

  Preferably, a single modified lipase in which the glutamine at position 193 is substituted with glutamic acid or aspartic acid (Q193E or Q193D) (hereinafter referred to as Q193E modified lipase (SEQ ID NO: 2) or Q193D modified lipase (SEQ ID NO: 19)) Called).

  More preferably, a double modified lipase (hereinafter referred to as Q193E / W104F modified lipase (SEQ ID NO: 4)) wherein glutamine at position 193 is substituted with glutamic acid or aspartic acid and tryptophan at position 104 is substituted with phenylalanine. Q193D / W104F modified lipase (referred to as SEQ ID NO: 20).

  The modified lipase of the present invention shows a single modified lipase (hereinafter referred to as 278) in which leucine at position 278 in SEQ ID NO: 1 is substituted with another amino acid residue, which exhibits higher carbamate activity and transesterification activity than wild type lipase. It is referred to as a modified lipase.

  Preferably, the leucine at position 278 is replaced with arginine or lysine (L278R or L278K) as a single modified lipase (hereinafter referred to as L278R modified lipase (SEQ ID NO: 21) or L278K modified lipase (SEQ ID NO: 22)). ).

  More preferably, a double modified lipase (hereinafter referred to as Q193E / L278K modified lipase (SEQ ID NO: 23) in which glutamine at position 193 is substituted with glutamic acid or aspartic acid, and leucine at position 278 is substituted with arginine or lysine. ), Q193E / L278R modified lipase (SEQ ID NO: 24), Q193D / L278K modified lipase (SEQ ID NO: 25) or Q193D / L278R modified lipase (SEQ ID NO: 26)).

  More preferably, the triple-modified lipase (hereinafter referred to as Q193E / Q) in which glutamine at position 193 is substituted with glutamic acid or aspartic acid, tryptophan at position 104 is substituted with phenylalanine, and leucine at position 278 is substituted with arginine or lysine. W104F / L278K modified lipase (SEQ ID NO: 27), Q193E / W104F / L278R modified lipase (SEQ ID NO: 28), Q193D / W104F / L278K modified lipase (SEQ ID NO: 29) or Q193D / W104F / L278R modified lipase (sequence) No. 30)).

  More preferably, glutamine at position 193 is substituted with glutamic acid or aspartic acid, tryptophan at position 104 is substituted with phenylalanine, leucine at position 278 is substituted with arginine or lysine, and alanine at position 283 is substituted with valine. Quadruple modified lipase (hereinafter referred to as Q193E / W104F / L278K / A283V modified lipase (SEQ ID NO: 31), Q193E / W104F / L278R / A283V modified lipase (SEQ ID NO: 32), Q193D / W104F / L278K / A283V modified) Lipase (SEQ ID NO: 33) or Q193D / W104F / L278R / A283V modified lipase (SEQ ID NO: 34)).

  The modified lipase of the present invention has an amino acid sequence in which amino acid substitution is performed at the 193-position, 104-position, 278-position and / or 283-position, and the 193-position, 104-position, 278-position and An amino acid mutation may be further included at a position other than position 283. Therefore, the present invention has the same function when compared with the modified lipase having the amino acid substitution at positions 193, 104, 278 and / or 283, but the positions 193, 104, 278 are the same. Also provided are variants that differ in part in amino acid sequence from modified lipases having an amino acid substitution at position 283 and / or.

  A difference in amino acid sequence in part means that, typically, a mutation occurs in the amino acid sequence due to deletion, substitution, addition, insertion, inversion, or a combination of one to several amino acids constituting the amino acid sequence. It means that

  Therefore, the present invention includes substitution of one or several amino acids, deletion, insertion, addition or inversion in addition to substitution of glutamine at position 193 with other amino acid residues, and is the same as 193 modified lipase Including variants thereof exhibiting carbamate and transesterification activities.

  Further, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions in addition to the W104F substitution, and exhibits the same carbamation activity and transesterification activity as the W104F modified lipase. Including variants.

  Further, the present invention further includes Q193E substitution, and further includes substitution, deletion, insertion, addition or inversion of one or several amino acids, and exhibits the same carbamation activity and transesterification activity as Q193E modified lipase. Including variants.

  In addition to Q193D substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and mutants thereof exhibiting the same carbamate activity and transesterification activity as Q193D modified lipase including.

  In addition to the Q193E / W104F substitution, the present invention further includes substitution, deletion, insertion, addition or inversion of one or several amino acids, and the same carbamate activity and transesterification as the Q193E / W104F modified lipase Also included are variants thereof that exhibit activity.

  The present invention further includes substitution, deletion, insertion, addition or inversion of one or several amino acids in addition to the Q193D / W104F substitution, and has the same carbamation activity and transesterification activity as the Q193D / W104F modified lipase. The mutants shown are also included.

  In addition to the Q193E / L278K substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and has the same carbamation activity and transesterification activity as the Q193E / L278K modified lipase. The mutants shown are also included.

  In addition to the Q193E / L278R substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and has the same carbamation activity and transesterification activity as the Q193E / L278R modified lipase. The mutants shown are also included.

  In addition to the Q193D / L278K substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and has the same carbamate and transesterification activities as the Q193D / L278K modified lipase. The mutants shown are also included.

  In addition to the Q193D / L278R substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and has the same carbamation activity and transesterification activity as the Q193D / L278R modified lipase. The mutants shown are also included.

  In addition to the Q193E / W104F / L278K substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and the same carbamation activity as Q193E / W104F / L278K modified lipase and Also included are variants thereof that exhibit transesterification activity.

  In addition to the Q193E / W104F / L278R substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and has the same carbamation activity as Q193E / W104F / L278R modified lipase and Also included are variants thereof that exhibit transesterification activity.

  In addition to the Q193D / W104F / L278K substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and the same carbamation activity as Q193D / W104F / L278K modified lipase and Also included are variants thereof that exhibit transesterification activity.

  In addition to the Q193D / W104F / L278R substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and has the same carbamation activity as Q193D / W104F / L278R modified lipase and Also included are variants thereof that exhibit transesterification activity.

  In addition to the Q193E / W104F / L278K / A283V substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and is the same as the Q193E / W104F / L278K / A283V modified lipase Also included are variants thereof that exhibit carbamate and transesterification activities.

  In addition to the Q193E / W104F / L278R / A283V substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and is the same as the Q193E / W104F / L278R / A283V modified lipase Also included are variants thereof that exhibit carbamate and transesterification activities.

  In addition to the Q193D / W104F / L278K / A283V substitution, the present invention further includes substitution, deletion, insertion, addition or inversion of one or several amino acids, and is the same as the Q193D / W104F / L278K / A283V modified lipase Also included are variants thereof that exhibit carbamate and transesterification activities.

  In addition to the Q193D / W104F / L278R / A283V substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and is the same as the Q193D / W104F / L278R / A283V modified lipase Also included are variants thereof that exhibit carbamate and transesterification activities.

  The present invention includes the same carbamation as 278 modified lipase, including substitution of leucine at position 278 to other amino acid residues, and further substitution, deletion, insertion, addition or inversion of one or several amino acids. And variants thereof exhibiting activity and transesterification activity.

  The present invention includes the same carbamation as 278 modified lipase, including substitution of leucine at position 278 to other amino acid residues, and further substitution, deletion, insertion, addition or inversion of one or several amino acids. And variants thereof exhibiting activity and transesterification activity.

  In addition to L278R substitution, the present invention further includes one or several amino acid substitutions, deletions, insertions, additions or inversions, and mutants thereof exhibiting the same carbamate activity and transesterification activity as L278R modified lipase including.

  In addition to L278K substitution, the present invention further comprises one or several amino acid substitutions, deletions, insertions, additions or inversions, and mutants thereof exhibiting the same carbamation activity and transesterification activity as L278K modified lipase including.

  Amino acid sequence differences are tolerated (preferably to the extent that they are substantially retained) as long as the properties associated with the carbamate reaction and transesterification activity are not significantly reduced. Therefore, as long as this condition is satisfied, the position where the amino acid sequence is different may not be particularly limited. Further, a difference may occur at a plurality of positions. Here, the term “plurality” refers to, for example, a number corresponding to less than about 30% of all amino acids, preferably a number corresponding to less than about 20%, and more preferably a number corresponding to less than about 10%. The number is preferably less than about 5%, and most preferably less than about 1%.

  Accordingly, a protein partially differing in amino acid sequence may be, for example, about 70% or more, preferably about 80% or more, more preferably about 90% or more, and even more preferably about 95%, with any of the amino acid sequences of the modified lipase. % Or more, most preferably about 99% or more homologous protein having amino acid sequence identity. Amino acid sequence identity may be calculated with default values using BLAST well known to those skilled in the art. BLAST is published on the website (for example, http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&BLAST_PROGRAMS=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&BLAST_SPEC=blast2seq&LINK_LOC=blasttab&LAST_PAGE=blastn&seq=blastn&BLAST_INIT)

  The above homologous proteins can preferably be obtained by making conservative amino acid substitutions at amino acid residues that are not involved in carbamate reaction and transesterification activity. As used herein, the term “conservative amino acid substitution” refers to substitution of an amino acid residue with an amino acid residue having a side chain having similar properties. Depending on the side chain of the amino acid residue, a basic side chain (eg, lysine, arginine, histidine), an acidic side chain (eg, aspartic acid, glutamic acid), an uncharged polar side chain (eg, asparagine, glutamine, serine, threonine, tyrosine, cysteine) ), Non-polar side chains (eg glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (eg threonine, valine, isoleucine), aromatic side chains (eg tyrosine, phenylalanine, Like tryptophan), it is classified into several families. A conservative amino acid substitution is preferably a substitution between amino acid residues within the same family.

  Therefore, the mutant of 193 modified lipase has about 70% or more amino acid sequence identity with 193 modified lipase, and exhibits the same carbamate activity and transesterification activity as 193 modified lipase. Good.

  In addition, the variant of W104F modified lipase may have about 70% or more amino acid sequence identity with W104F modified lipase and exhibit a carbamate activity equivalent to that of W104F modified lipase.

  Further, the mutant of the Q193E modified lipase has about 70% or more amino acid sequence identity with the Q193E modified lipase, and exhibits the same carbamate activity and transesterification activity as the Q193E modified lipase. Good.

  The mutant of the Q193D modified lipase may have about 70% or more amino acid sequence identity with the Q193D modified lipase and exhibit a carbamateization activity and transesterification activity equivalent to those of the Q193D modified lipase.

  Further, the mutant of Q193E / W104F modified lipase has about 70% or more amino acid sequence identity with Q193E / W104F modified lipase, and has the same carbamate activity and transesterification activity as Q193E / W104F modified lipase. It may be shown.

  The variant of the Q193D / W104F modified lipase has about 70% or more amino acid sequence identity with the Q193D / W104F modified lipase, and exhibits the same carbamate activity and transesterification activity as the Q193D / W104F modified lipase. It may be.

  A variant of the Q193E / L278K modified lipase has approximately 70% or more amino acid sequence identity with the Q193E / L278K modified lipase, and exhibits carbamate and transesterification activities equivalent to those of the Q193E / L278K modified lipase. It may be.

  A variant of the Q193D / L278K modified lipase has about 70% or more amino acid sequence identity with the Q193D / L278K modified lipase, and exhibits the same carbamate activity and transesterification activity as the Q193D / L278K modified lipase It may be.

  A variant of the Q193E / L278R modified lipase has approximately 70% or more amino acid sequence identity with the Q193E / L278R modified lipase, and exhibits carbamate and transesterification activities equivalent to those of the Q193E / L278R modified lipase. It may be.

  A variant of the Q193D / L278R modified lipase has about 70% or more amino acid sequence identity with the Q193D / L278R modified lipase, and exhibits the same carbamate activity and transesterification activity as the Q193D / L278R modified lipase It may be.

  A variant of the Q193E / W104F / L278K modified lipase has about 70% or more amino acid sequence identity with the Q193E / W104F / L278K modified lipase, and has a carbamate activity equivalent to that of the Q193E / W104F / L278K modified lipase and It may exhibit transesterification activity.

  A variant of the Q193D / W104F / L278K modified lipase has about 70% or more amino acid sequence identity with the Q193D / W104F / L278K modified lipase, and has a carbamate activity equivalent to that of the Q193D / W104F / L278K modified lipase and It may exhibit transesterification activity.

  A variant of the Q193E / W104F / L278R modified lipase has about 70% or more amino acid sequence identity with the Q193E / W104F / L278R modified lipase, and has a carbamate activity equivalent to that of the Q193E / W104F / L278R modified lipase and It may exhibit transesterification activity.

  A variant of the Q193D / W104F / L278R modified lipase has about 70% or more amino acid sequence identity with the Q193D / W104F / L278R modified lipase, and has a carbamate activity equivalent to that of the Q193D / W104F / L278R modified lipase and It may exhibit transesterification activity.

  The mutant of the Q193E / W104F / L278K / A283V modified lipase has about 70% or more amino acid sequence identity with the Q193E / W104F / L278K / A283V modified lipase, and the Q193E / W104F / L278K / A283V modified lipase It may exhibit equivalent carbamate activity and transesterification activity.

  The mutant of the Q193D / W104F / L278K / A283V modified lipase has about 70% or more amino acid sequence identity with the Q193D / W104F / L278K / A283V modified lipase, and the Q193D / W104F / L278K / A283V modified lipase It may exhibit equivalent carbamate activity and transesterification activity.

  The mutant of the Q193E / W104F / L278R / A283V modified lipase has about 70% or more amino acid sequence identity with the Q193E / W104F / L278R / A283V modified lipase, and the Q193E / W104F / L278R / A283V modified lipase It may exhibit equivalent carbamate activity and transesterification activity.

  The mutant of the Q193D / W104F / L278R / A283V modified lipase has about 70% or more amino acid sequence identity with the Q193D / W104F / L278R / A283V modified lipase, and the Q193D / W104F / L278R / A283V modified lipase It may exhibit equivalent carbamate-forming activity.

  The mutant of the 278 modified lipase may have about 70% or more amino acid sequence identity with the 278 modified lipase and exhibit the same carbamate activity and transesterification activity as the 278 modified lipase.

  The mutant of the L278R modified lipase may have about 70% or more amino acid sequence identity with the L278R modified lipase, and exhibit a carbamateization activity and transesterification activity equivalent to those of the L278R modified lipase.

  The mutant of the L278K modified lipase may have about 70% or more amino acid sequence identity with the L278K modified lipase, and may exhibit the same carbamate activity and transesterification activity as the L278K modified lipase.

  The DNA encoding the modified lipase or a variant thereof means a DNA having a nucleic acid sequence encoding the amino acid sequence of the modified lipase or a variant thereof, and the nucleic acid sequence is based on the genetic code well known to those skilled in the art. Can be determined from

  Since one or more codons can encode the same amino acid (codon degeneracy), one or more nucleic acid sequences can encode one amino acid sequence. Therefore, the DNA encoding the modified lipase or a variant thereof is not limited as long as it is a nucleic acid sequence encoding the modified lipase or a variant thereof.

  Examples of the nucleic acid sequence encoding the amino acid sequence of Q193E modified lipase (SEQ ID NO: 2) or Q193D modified lipase (SEQ ID NO: 19) include the sequence of SEQ ID NO: 14 or 35. Examples of the nucleic acid sequence encoding the amino acid sequence of W104F modified lipase (SEQ ID NO: 3) include the sequence of SEQ ID NO: 17.

  Examples of the nucleic acid sequence encoding the amino acid sequence of Q193E / W104F modified lipase (SEQ ID NO: 4) or Q193D / W104F modified lipase (SEQ ID NO: 20) include the sequence of SEQ ID NO: 18 or 36.

  Amino acid sequence of Q193E / L278R modified lipase (SEQ ID NO: 23), Q193E / L278K modified lipase (SEQ ID NO: 24), Q193D / L278R modified lipase (SEQ ID NO: 25) or Q193D / L278K modified lipase (SEQ ID NO: 26) Examples of the nucleic acid sequence that encodes the sequence of SEQ ID NO: 39, 40, 41, or 42.

  Q193E / W104F / L278R modified lipase (SEQ ID NO: 27), Q193E / W104F / L278K modified lipase (SEQ ID NO: 28), Q193D / W104F / L278R modified lipase (SEQ ID NO: 29) or Q193D / W104F / L278K modified lipase As for the nucleic acid sequence which codes the amino acid sequence of (sequence number 30), the sequence of sequence number 43, 44, 45 or 46 is mentioned, for example.

  Q193E / W104F / L278R / A283V modified lipase (SEQ ID NO: 31), Q193E / W104F / L278K / A283V modified lipase (SEQ ID NO: 32), Q193D / W104F / L278R / A283V modified lipase (SEQ ID NO: 33) or Q193D / As for the nucleic acid sequence which codes the amino acid sequence of W104F / L278K / A283V modified lipase (sequence number 34), the sequence of sequence number 47, 48, 49 or 50 is mentioned, for example.

  Examples of the nucleic acid sequence encoding the amino acid sequence of L278R modified lipase (SEQ ID NO: 21) or L278K modified lipase (SEQ ID NO: 22) include the sequence of SEQ ID NO: 37 or 38.

  The mutant of the modified lipase may be one that hybridizes with the modified lipase gene and exhibits the same carbamate activity and transesterification activity as the modified lipase.

  Hybridization preferably means hybridization under stringent conditions. Particularly preferably: Hybridization buffer: 2 × SSC; 10 × Denhardt solution (Ficoll 400 + PEG + BSA; ratio = 1: 1: 1); 0.1% SDS; 5 mM EDTA; 50 mM Na 2 HPO 4; 250 μg / ml herring sperm DNA; 50 μg / ml tRNA; or 25 M sodium phosphate buffer pH 7.2; 1 mM EDTA; 7% SDS), hybridization temperature: T = 65-68 ° C., wash buffer: 0.1 × SSC; 0.1% SDS, Washing temperature: means hybridization under conditions of T = 65 to 68 ° C.

  A transformed microorganism containing a DNA encoding a modified lipase or a mutant thereof refers to a transformed microorganism that introduces a DNA encoding a modified lipase or a mutant thereof into the microorganism to produce the modified lipase or a mutant thereof. Means transformed microorganisms. The DNA encoding the modified lipase or a variant thereof may be present in the microorganism as a plasmid or may be integrated into the chromosome.

  The microorganism is not limited, and examples thereof include bacteria, yeast, and filamentous fungi. Preferably, Escherichia, Corynebacterium, Bacillus, lactic acid bacteria (Lactobacillus, Bifidobacterium), yeast (Saccharomyces, Pichia, Schizosaccharomyces, Kluyveromyces, Hansenula, Yarrowia), filamentous fungi (Aspergillus, etc.) It is done. Among these, Escherichia coli, yeast (Saccharomyces, Pichia, Schizosaccharomyces, Kluyveromyces, Hansenula, Yarrowia) and filamentous fungi (Aspergillus) are more preferable. These microorganisms are available from the market.

  The DNA encoding the modified lipase or variant thereof transformed into a microorganism is preferably in a vector. Examples of the vector include a phage and a plasmid, and a plasmid is preferable. The plasmid is more preferably an expression plasmid having a promoter for expression, a start codon, a stop codon, a polyadenylation signal sequence, a multicloning site, a replication origin, a selection marker, and the like.

  Examples of the plasmid derived from E. coli include pBR322, pBR325, pUC18, and pUC118. Examples of yeast-derived plasmids include pSH19, pSH15, pYES2, and examples of filamentous fungus-derived plasmids include pAUR316. These plasmids are commercially available.

  It is preferable that the DNA encoding the modified lipase to be transformed into a microorganism or a variant thereof is operably linked to a promoter that enables expression in the microorganism.

  The promoter is not limited as long as it expresses a linked modified lipase or a mutant thereof in a microorganism. When the microorganism is E. coli, trp promoter, lac promoter, rec A promoter, λPL promoter, lpp promoter, T7 promoter, etc.When the microorganism is yeast, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, The GAL1 promoter and the like are preferable. When the microorganism is a filamentous fungus, a glucoamylase gene promoter, an α-amylase gene promoter, an alcohol dehydrogenase I gene promoter, and the like are preferable.

  Operatively linked to a promoter means that the modified lipase or variant thereof is linked downstream of the promoter so as to produce the modified lipase or variant thereof under the control of the promoter.

  Transformation of microorganisms can be performed according to methods known in the art. For example, there are an electroporation method and a method of introducing DNA into a microorganism used as a competent cell by a calcium method.

  Production of the modified lipase of the present invention or a variant thereof is preferably carried out by culturing the transformant in a medium and accumulating the modified lipase in the medium and / or in the transformant.

  The medium for culturing the transformant is not particularly limited as long as the microorganism grows, and can be cultured according to a method known in the art. For example, a culture solution containing sugars such as glucose and sucrose as a carbon source, inorganic nitrogen sources such as ammonium salts and nitrates, organic nitrogen sources such as yeast extract, and various inorganic salts and vitamins, etc. In addition, an inducer (such as IPTG) or a selective agent (such as antibiotics such as ampicillin, chloramphenicol, carbenicillin) may be included. The culture conditions (temperature, time, shaking, aerobic or anaerobic) are not particularly limited as long as microorganisms grow.

  When the modified lipase or a variant thereof is secreted into the medium, the DNA encoding the modified lipase or a variant thereof may be linked to a signal sequence for secretion. As the signal sequence, for example, a signal sequence such as alkaline phosphatase or invertase can be used. Further, it may be linked to a tag sequence for facilitating purification, for example, a histidine tag sequence, a flag tag sequence or the like. Further, a cleavage sequence such as an endopeptidase recognition sequence may be linked between the tag sequence, signal sequence and modified lipase or a variant thereof.

  The modified lipase produced by the transformant or a variant thereof is preferably purified from the culture medium and / or the culture transformant. For purification from the culture medium and / or culture transformant, for example, chromatography (gel filtration chromatography, affinity chromatography, ion exchange chromatography, hydrophobic chromatography, etc.) is used in accordance with conventional protein purification methods. Can be done.

  The modified lipase or variant thereof of the present invention is preferably an immobilized modified lipase or variant thereof bound to an insoluble carrier.

For the carrier binding method (physical adsorption method, ionic bond method, covalent bond method, biochemical specific bond method), for example, polysaccharides (cellulose, agarose, etc.), inorganic substances (porous glass, metal, etc.) Oxides) and synthetic polymers (polyacrylamide compounds, polystyrene resins, ion exchange resins, etc.). For cross-linking methods, for _{example, OHC- (CH 2) 3 -CHO} ( _{glutaraldehyde), O = N = C- (} CH 2) 3 -C = N = O and the like. Examples of the inclusion method include polysaccharides (alginic acid, carrageenan, etc.), polyacrylamide compounds, ENT, PU, and nylon.

  Immobilization of the modified lipase or variant thereof to the carrier can be performed according to conventional immobilization methods for proteins.

  Experimental techniques used in the present invention, such as microorganisms, recombinant DNA, mutant production, PCR, expression, culture, purification, and immobilization, are well known to those skilled in the art, and general textbooks (for example, MOLECULAR CLONING: A LABORATORY MANUAL, second edition (Sambrook et al., 1989) Cold Spring Harbor Laboratory Press; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FM Ausubel et al., Eds., 1987 and annual updates); PCR PROTOCOLS: A GUIDE TO METHODS AND APPLICATIONS ( Innis et al., 1990, Academic Press, San Diego, CA); PCR: THE POLYMERASE CHAIN REACTION (Mullis et al., Eds., 1994); MANUAL OF INDUSTRIAL MICROBIOLOGY AND BIOTECHNOLOGY, Second Edition (AL Demain, et al. , eds. 1999); and BIOTECHNOLOGY: A TEXTBOOK OF INDUSTRIAL MICROBIOLOGY, (Thomas D. Brock) Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass, etc.).

  The use of the modified lipase of the present invention or a variant thereof in the carbamate reaction or transesterification reaction means that the carbamation reaction or the transesterification reaction is performed by the modified lipase of the present invention or a variant thereof. The modified lipase or variant thereof is preferably immobilized.

The carbamate reaction is represented by the following reaction formula (A):

(In the formula, R represents a hydrogen atom or a hydrocarbon group which may have a substituent)
As shown in the above, it means a reaction in which a carbamate bond is formed between an amine compound and a carbonate compound.

  The amine compound is not particularly limited as long as it synthesizes a carbamate compound by reacting with a carbonate compound. In the present invention, a monoamine compound or a diamine compound is preferably used. An aliphatic monoamine compound or an aliphatic diamine compound is more preferably used. An aliphatic amine means a compound in which a hydrogen atom of a linear hydrocarbon is substituted with an amino group, -NH2.

The monoamine compound has the general formula (I):

(Wherein R ¹ may have a substituent, C _1-20 linear or branched alkyl group, C _2-20 linear or branched alkenyl group, C _2-20 linear or branched) A chain alkynyl group, a C _4-24 cycloalkylalkyl group, a C _7-21 aralkyl group, or a C _3-20 cycloalkyl group, and n is 0 or 1)
Is preferably used.

The C _1-20 linear or branched alkyl group which may have a substituent in R ¹ is a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, or an n-hexyl group. Group, n-heptyl group, n-octyl group, n-nonyl group, n-decyl group, n-undecyl group, n-dodecyl group, isopropyl group, isobutyl group, t-butyl group and the like. A C _1-12 linear or branched alkyl group is preferred, and a methyl group, ethyl group, n-propyl group, n-butyl group, n-hexyl group, n-dodecyl group, isopropyl group or t-butyl group is more preferred. .

In R ^1, which may have a substituent C _{2 to 20} linear or branched alkenyl group, include allyl, 1-propenyl, 1-butenyl, 1-pentenyl group or Isopuropaniru group, is It is done. A _C2-12 linear or branched alkenyl group is preferred, and an allyl group is more preferred.

_{Examples of the} C _2-20 linear or branched alkynyl group which may have a substituent in R ¹ include an ethynyl group, a propargyl group, a butenyl group, or a 1-methyl-2-propynyl group. A _C2-12 linear or branched alkynyl group is preferable, and an ethynyl group or a propargyl group is more preferable.

The C _3-20 cycloalkyl group which may have a substituent in R ¹ is a monocyclic or polycyclic alicyclic hydrocarbon group which may be substituted with a C _1-4 linear alkyl group. A cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a bicyclo [2.2.1] heptyl group, a methylcyclohexyl group, a dimethylcyclohexyl group, or an ethylcyclohexyl group. A C _3-12 cycloalkyl group is preferred, and a cyclohexyl group or a bicyclo [2.2.1] heptyl group is more preferred. Here, examples of the C _1-4 straight chain alkyl group include a methyl group, an ethyl group, an n-propyl group, and an n-butyl group.

The _optionally substituted C _4-24 cycloalkylalkyl group in R ¹ is a C _1-4 linear alkyl group substituted with a C _3-20 cycloalkyl group as defined above, Examples include cyclohexylmethyl group, cyclohexylethyl group, trimethylcyclohexylmethyl group, norbornylmethyl group, and the like. C _{3 to 10 C 4 to 14} cycloalkylalkyl group is preferably a _{C 1 to 4} straight chain alkyl group substituted with a cycloalkyl group, cyclohexylmethyl group is more preferable.

_{Examples of the} C _7-21 aralkyl group that may have a substituent in R ¹ include an alkyl group substituted with a C _6-20 aryl group. The C _6-20 aryl group is a group having a monocyclic or polycyclic aromatic ring, and is a phenyl group, a naphthyl group, a biphenylyl group, or a terphenylyl group (for example, a p-terphenyl-4-yl group, m-terphenyl-3-yl group) and the like. The number of carbon atoms in the alkyl group is the number obtained by subtracting the number of carbon atoms in the aryl group from the number of carbon atoms in the aralkyl group. Therefore, examples of the C _7-21 aralkyl group include a benzyl group, a phenethyl group, a naphthylmethyl group, or an m-terphenyl-3-yl-methyl group, a C _7-13 aralkyl group is preferable, and a benzyl group is more preferable. preferable. In addition, the group mentioned as R ¹ includes various isomers.

The group mentioned as R ¹ may have a further substituent. Further substituents for R ¹ are, for example, a halogen atom (a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom); a C _1-4 alkoxy group such as a methoxy group, an ethoxy group, a propoxy group, or a butoxy group; A dialkylamino group disubstituted by a C _1-6 alkyl group such as an amino group, a diethylamino group, or a dipropylamino group; a cyano group; a nitro group; an acetyl group; and a benzene ring when R ¹ is an aralkyl group And an amino group directly bonded to.

From the above, R ¹ is preferably methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-hexyl, n-dodecyl, fluoromethyl, difluoromethyl. Group, trifluoromethyl group, cyanomethyl group, nitromethyl group, fluoroethyl group, trifluoroethyl group, trichloroethyl group, cyanoethyl group, nitroethyl group, methoxyethyl group, ethoxyethyl group, or t-butoxyethyl group C _1-12 linear or branched alkyl group, C _3-12 cycloalkyl group, C _4-14 cycloalkylalkyl group, benzyl group, fluorobenzyl group, chlorobenzyl group, bromobenzyl Group, iodobenzyl group, methoxybenzyl group, dimethoxybenzyl group, nitrobenzyl group, Nitrobenzyl group or a cyanobenzyl group; be and aminobenzyl group of substituted good C _{7 to 13} also aralkyl group; and particularly preferably, methyl group, ethyl group, n- propyl group, isopropyl Group, n-butyl group, t-butyl group, n-hexyl group, n-dodecyl group, cyclohexyl group, cyclohexylmethyl group, or benzyl group.

  From the above, the monoamine compound represented by the general formula (I) is particularly preferably an n-hexylamine compound, an n-dodecylamine compound, a cyclohexylmethylamine compound, or a benzylamine compound.

The diamine compound has the general formula (II):

(Wherein, ^{R 3} may have a _{substituent, C 1 to 20} straight or branched chain alkylene _{group, C 1 to 4} linear alkylene _{-C 3 to 20} cycloalkylene _{-C 1 to 4} straight Chain alkylene group, C _1-4 straight chain alkylene-C _6-20 arylene-C _1-4 straight chain alkylene group, C _3-20 cycloalkylene group, or C _1-4 straight chain alkylene-C _3-20 cycloalkylene And m and p are each independently 0 or 1)
Is preferably used.

The C _1-20 linear or branched alkylene group which may have a substituent in R ³ is a methylene group, an ethylene group, an n-propylene group, an n-butylene group, an n-pentylene group, or n-to. A linear alkylene group such as a xylene group, n-heptylene group, n-octylene group, n-nonylene group, n-decylene group, or n-dodecylene group; or 2-methylpropylene group, 2-methylhexylene group, tetra Examples include branched chain alkylene groups such as methylethylene group. A _C1-20 linear alkylene group is preferred, and a methylene group, ethylene group, propylene group, butylene group, pentylene group, hexylene group, heptylene group, octylene group, nonylene group, decylene group, or dodecylene group is more preferred.

The C _3-20 cycloalkylene group which may have a substituent in R ³ is a monocyclic or polycyclic hydrocarbon group, and may be substituted with a C _1-4 linear alkyl group. Examples include a cyclopropylene group, a cyclobutylene group, a cyclopentylene group, a cyclohexylene group, or a bicyclo [2.2.1] heptane-2,6-diyl group. A C _3-12 cycloalkylene group is preferred, and a cyclohexylene group or a bicyclo [2.2.1] heptane-2,6-diyl group is more preferred.

In R ^3, _{C 1 to 4} straight chain alkylene group which may have a substituent _{C 1 to 4} linear alkylene _{-C 3 to 20} cycloalkylene _{-C 1 to 4} straight chain alkylene group, a methylene group, Examples include an ethylene group, a propylene group, or a butylene group. C _1-4 straight chain alkylene-C _3-20 cycloalkylene-C _1-4 straight chain alkylene group is methylene-cyclopentylene-methylene group, ethylene-cyclopentylene-ethylene group, or methylene-cyclohexylene- A methylene group etc. are mentioned. C _{1 to 4} linear alkylene _{-C 3 to 12} cyclohexylene _{-C 1 to 4} straight-chain alkylene group is preferred, methylene - cyclohexylene - methylene group is more preferable.

The _optionally substituted C _1-4 linear alkylene-C _3-20 cycloalkylene group in R ³ is substituted with a C _1-4 linear alkylene-C _1-4 linear alkyl group. Preferred is a C _3-12 cycloalkylene group, and more preferred is a methylene-trimethylcyclohexylene group.

In R ^3, which may have a substituent _{C 1 to 4} linear alkylene _{-C having 6 to 20} arylene _{-C 1 to 4} straight chain alkylene _{group, C 1 to 4} linear alkylene - phenylene _{-C. 1 to A 4-} linear alkylene group is preferred, and a xylylene group is more preferred. These groups include various isomers.

The hydrocarbon group for R ³ may have a further substituent. Examples of the further substituent in R ³ include the same group as the substituent of the hydrocarbon group in R ¹ . In addition, when R ³ is a C _1-4 linear alkylene-C _6-20 arylene-C _1-4 linear alkylene group, the substituent in R ³ is directly bonded to the aromatic carbon atom of the arylene group. A primary amino group may be mentioned.

From the above, ^{R 3} is preferably a _{C 1 to 20} straight or branched chain alkylene _{group, C 1 to 4} linear alkylene _{-C 3 to 20} cycloalkylene _{-C 1 to 4} straight chain alkylene _{group, C 1 to 4} straight A chain alkylene-C _6-20 arylene-C _1-4 linear alkylene group, a C _3-20 cycloalkylene group, or a C _1-4 linear alkylene-C _3-20 cycloalkylene group; more preferably C _1-12 linear alkylene group, _C1-4 linear alkylene- _C3-12 cycloalkylene- _C1-4 linear alkylene group, _C1-4 linear alkylene-phenylene- _C1-4 linear alkylene group , be a _{C 3 to 12} cycloalkylene group, or a _{C 1 to 4 C 3 to 12} cycloalkylene group substituted with a straight-chain alkylene _{-C 1 to 4} straight chain alkyl group; particularly preferably methylene , Ethylene group, propylene group, butylene group, pentylene group, hexylene group, heptylene group, octylene group, nonylene group, decylene group, dodecylene group, cyclohexylene group, methylene-trimethylcyclohexylene group, cyclohexylenedimethylene group, or xylylene It is a group.

  The diamine compound of the present invention is preferably a compound from which a biscarbamate compound as a diisocyanate raw material can be obtained. In the present invention, 1,6-hexamethylenediamine compound, 1,12-dodecamethylenediamine compound, isophoronediamine compound, 1,3-bis (aminomethylcyclohexane), 1,4-bis (aminomethylcyclohexane), 4, 4′-methylenebis (cyclohexaneamine compound), 2,5-bis (aminomethyl) bicyclo [2,2,1] heptane, 2,6-bis (aminomethyl) bicyclo [2,2,1] heptane, 1, More preferably, it is at least one selected from the group consisting of 3-bis (aminomethyl) benzene and 1,4-bis (aminomethyl) benzene.

The carbonate compound of the present invention has the general formula (III):

(In the formula, R ² represents a hydrocarbon group which may have a substituent, and R ² may independently form a ring.)
Is preferably used.

In the general formula (III), examples of the monovalent hydrocarbon group which may have a substituent of R ² include the same groups as those defined for R ¹ defined in the general formula (I). The hydrocarbon group for R ² is preferably a C _1-20 such as a methyl group, an ethyl group, an n-propyl group, an i-propyl group, or an n-butyl group, preferably a C _1-6 linear or branched chain. An alkyl group, and a particularly preferred group is a methyl group or an ethyl group.

The hydrocarbon group for R ² may have a further substituent. Further substituents include, for example, a halogen atom (a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom); a C _1-4 alkoxy group such as a methoxyl group, an ethoxyl group, a propoxyl group, or a butoxyl group; a dimethylamino group, Examples thereof include a dialkylamino group disubstituted with a C _1-4 alkyl group such as a diethylamino group or a dipropylamino group; a cyano group; or a nitro group.

  From the above, the carbonate compound represented by the general formula (III) is preferably a dimethyl carbonate compound or a diethyl carbonate compound.

  The reaction of the present invention can be carried out using an organic solvent or without a solvent. The organic solvent is not particularly limited as long as it is a solvent that can dissolve the amine compound and the carbonate compound and does not inactivate the modified lipase or a mutant thereof, but is not limited to saturated cyclic hydrocarbons, unsaturated cyclic hydrocarbons, and acyclic ethers. Or a mixed solvent thereof is preferred.

Solvents of saturated cyclic hydrocarbons include C _5-10 unsubstituted cycloalkanes such as cyclopentane, cyclohexane, cycloheptane, or isopropylcyclohexane; C _5-10 cyclo substituted with a halogen such as chlorocyclopentane or chlorocyclohexane. Examples include alkanes. C _5-10 unsubstituted cycloalkanes are preferable, and cyclohexane is more preferable.

Examples of the solvent for unsaturated cyclic hydrocarbons include aromatic hydrocarbons such as benzene, toluene, xylene or mesitylene; C _5-10 cycloalkenes such as cyclopentene or cyclohexene. Aromatic hydrocarbons are preferable, and toluene or xylene is more preferable.

Acyclic ethers are aliphatic ethers such as C _2-8 dialkyl ethers such as diethyl ether, t-butyl methyl ether, or diisopropyl ether; C _5-18 cycloalkyl alkyl ethers such as cyclopentyl methyl ether or cyclopentyl ethyl ether. _C7-18 aromatic ethers such as _benzylphenyl ether, benzylmethyl ether, alkylphenyl ether, diphenyl ether, di (p-tolyl) ether, or dibenzyl ether. Preferred are aliphatic ethers or aromatic ethers, and more preferred are diisopropyl ether or anisole. These organic solvents may be used alone or in combination of two or more.

  The amount of the organic solvent used is preferably 1 to 200 mL, more preferably 1 to 50 mL, and particularly preferably 1 to 20 mL with respect to 1 g of the monoamine compound or diamine compound.

  As shown in the following reaction formulas (B) and (C), the carbamate reaction of the present invention can be performed, for example, by a monoamine compound or diamine compound, a carbonate compound, an organic solvent, and a modified lipase or a mutant thereof (preferably an immobilization). Modified lipase or a mutant thereof) are mixed and reacted with stirring. Alternatively, it is carried out by a continuous flow method or the like in which an organic solvent containing a monoamine compound or a diamine compound and a carbonate compound is passed through a column packed with an immobilized modified lipase or a variant thereof.

When the reaction is performed in a continuous flow mode, the concentration of the monoamine compound or diamine compound in the reaction solution is preferably 10 to 50% by mass with respect to the total mass of the reaction system. Moreover, the liquid flow rate of the reaction liquid is preferably 0.5 to 400 mm / min, and more preferably 1 to 200 mm / min. The liquid flow rate (mm / min) is the cross-sectional area of the packed bed (mm ² ) by the amount of liquid fed per minute (mm ³ / min) (or also called the liquid feed rate (10 ⁻³ mL / min)). The value expressed by the quotient divided by. When the pressure inside the packed column increases by increasing the liquid flow rate, it becomes difficult to pass the liquid and an enzyme packed column with high pressure resistance is required. Therefore, it is preferable that the liquid passage speed is 400 mm / min or less. Further, from the viewpoint of productivity, it is preferable that the liquid flow rate is 1 mm / min or more. Since the expression activity of the immobilized enzyme changes depending on the flow rate, the reaction can be performed according to the desired production capacity and manufacturing cost by selecting the optimal flow rate and determining the reaction conditions. it can. The flow time of the reaction solution in the reaction vessel can be in the range of 30 seconds to 6 hours.

Reaction formula (B):

(Wherein R ¹ , R ² , m and n are as defined above.)

Reaction formula (C):

(In the formula, R ² , R ³ , m, n, and p are as defined above.)

  The temperature in the reaction of the present invention is not particularly limited as long as the modified lipase or a mutant thereof is not inactivated, but preferably 30 ° C. to 120 ° C. in order to obtain a desired carbamate compound with good yield. ° C to 90 ° C is more preferable, and 65 ° C to 90 ° C is particularly preferable. In addition, the reaction pressure in the batch reaction is not particularly limited, but it is preferably performed under normal pressure or reduced pressure. The reaction time in the batch reaction is not particularly limited, but is preferably 0.5 hours to 120 hours, and more preferably 0.5 hours to 72 hours.

  The reaction of the present invention is preferably carried out in a range that does not inactivate according to the characteristics of each modified lipase or mutant thereof used.

  The present invention is advantageous in that the reaction is generally heterogeneous, the catalyst can be reused and the post-treatment is simple. That is, the product can be obtained by removing the catalyst by filtration at the end of the reaction and concentrating the obtained filtrate. The product can also be obtained by crystallization operation from the obtained filtrate.

  The production apparatus used for the reaction of the present invention is not particularly limited, and examples thereof include general production apparatuses such as a reaction vessel and a heating (cooling) apparatus. A device in which the modified lipase of the present invention or a variant thereof is immobilized on a carrier and is housed in a reaction vessel as a fixed bed is preferable. Therefore, the reaction of the present invention is preferably a reaction including a step of passing a monoamine compound or diamine compound and a carbonate compound through the reaction vessel.

Furthermore, the general formula (IV) obtained by the production method of the present invention:

(In the formula, R ¹ , R ² and n are as defined above.)
Or a monocarbamate compound represented by the general formula (V):

(Wherein R ² , R ³ , m and p are as defined above.)
The biscarbamate compound represented by can be further purified by general methods such as distillation, liquid separation, extraction, crystallization, recrystallization and column chromatography.

The transesterification reaction is represented by the following reaction formula (D):

(Wherein R ⁴ , R ⁵ and R ⁶ each have a substituent, a C _1-20 linear or branched alkyl group, a C _2-20 linear or branched alkenyl group, C _2-20 linear or branched alkynyl group, C _4-24 cycloalkylalkyl group, C _7-21 aralkyl group, or C _3-20 cycloalkyl group.
As shown by, when the alcohol compound and the ester compound are reacted, the main chain portion is interchanged.

  The transesterification product means an alcohol compound and an ester compound after the reaction in which the main chain portion is exchanged with that before the reaction. Preferably, it means an ester compound after the reaction in which the main chain portion is exchanged before the reaction.

The alcohol compound has the general formula (VI):

(Wherein R ⁴ may have a substituent, C _1-20 linear or branched alkyl group, C _2-20 linear or branched alkenyl group, C _2-20 linear or branched) A chain alkynyl group, a C _4-24 cycloalkylalkyl group, a C _7-21 aralkyl group, or a C _3-20 cycloalkyl group)
Is preferably used.

The C _1-20 linear or branched alkyl group which may have a substituent in R ⁴ is a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, or an n-hexyl group. Group, n-heptyl group, n-octyl group, n-nonyl group, n-decyl group, n-undecyl group, n-dodecyl group, isopropyl group, isobutyl group, t-butyl group and the like. A C _1-12 linear or branched alkyl group is preferred, and a methyl group, ethyl group, n-propyl group, n-butyl group, n-hexyl group, n-dodecyl group, isopropyl group or t-butyl group is more preferred. .

Examples of the C _2-20 linear or branched alkenyl group which may have a substituent in R ⁴ include an allyl group, a 1-propenyl group, a 1-butenyl group, a 1-pentenyl group, and an isopropanyl group. It is done. A _C2-12 linear or branched alkenyl group is preferred, and an allyl group is more preferred.

_{Examples of the} C _2-20 linear or branched alkynyl group which may have a substituent in R ⁴ include an ethynyl group, a propargyl group, a butenyl group, or a 1-methyl-2-propynyl group. A _C2-12 linear or branched alkynyl group is preferable, and an ethynyl group or a propargyl group is more preferable.

The C _3-20 cycloalkyl group which may have a substituent in R ⁴ is a monocyclic or polycyclic alicyclic hydrocarbon group which may be substituted with a C _1-4 linear alkyl group. A cyclopropyl group, a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, a bicyclo [2.2.1] heptyl group, a methylcyclohexyl group, a dimethylcyclohexyl group, or an ethylcyclohexyl group. A C _3-12 cycloalkyl group is preferred, and a cyclohexyl group or a bicyclo [2.2.1] heptyl group is more preferred. Here, examples of the C _1-4 straight chain alkyl group include a methyl group, an ethyl group, an n-propyl group, and an n-butyl group.

The _optionally substituted C _4-24 cycloalkylalkyl group in R ⁴ is a C _1-4 linear alkyl group substituted with a C _3-20 cycloalkyl group as defined above, Examples include cyclohexylmethyl group, cyclohexylethyl group, trimethylcyclohexylmethyl group, norbornylmethyl group, and the like. C _{3 to 10 C 4 to 14} cycloalkylalkyl group is preferably a _{C 1 to 4} straight chain alkyl group substituted with a cycloalkyl group, cyclohexylmethyl group is more preferable.

_{Examples of the} C _7-21 aralkyl group which may have a substituent in R ⁴ include an alkyl group substituted with a C _6-20 aryl group. The C _6-20 aryl group is a group having a monocyclic or polycyclic aromatic ring, and is a phenyl group, a naphthyl group, a biphenylyl group, or a terphenylyl group (for example, a p-terphenyl-4-yl group, m-terphenyl-3-yl group) and the like. The number of carbon atoms in the alkyl group is the number obtained by subtracting the number of carbon atoms in the aryl group from the number of carbon atoms in the aralkyl group. Therefore, examples of the C _7-21 aralkyl group include a benzyl group, a phenethyl group, a naphthylmethyl group, or an m-terphenyl-3-yl-methyl group, a C _7-13 aralkyl group is preferable, and a benzyl group is more preferable. preferable. In addition, the group mentioned as R ⁴ includes various isomers.

The group mentioned as R ⁴ may have a further substituent. Further substituents for R ⁴ include, for example, a halogen atom (a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom); a C _1-4 alkoxy group such as a methoxy group, an ethoxy group, a propoxy group, or a butoxy group; A dialkylamino group disubstituted by a C _1-6 alkyl group such as an amino group, a diethylamino group, or a dipropylamino group; a cyano group; a nitro group; an acetyl group; and a benzene ring when R ⁴ is an aralkyl group And an amino group directly bonded to.
From the above, R ⁴ is preferably methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-hexyl, n-dodecyl, fluoromethyl, difluoromethyl. Group, trifluoromethyl group, cyanomethyl group, nitromethyl group, fluoroethyl group, trifluoroethyl group, trichloroethyl group, cyanoethyl group, nitroethyl group, methoxyethyl group, ethoxyethyl group, or t-butoxyethyl group C _1-12 linear or branched alkyl group, C _3-12 cycloalkyl group, C _4-14 cycloalkylalkyl group, benzyl group, fluorobenzyl group, chlorobenzyl group, bromobenzyl Group, iodobenzyl group, methoxybenzyl group, dimethoxybenzyl group, nitrobenzyl group, Nitrobenzyl group or a cyanobenzyl group; be and aminobenzyl group of substituted good C _{7 to 13} also aralkyl group; and particularly preferably, methyl group, ethyl group, n- propyl group, isopropyl Group, n-butyl group, t-butyl group, n-hexyl group, n-dodecyl group, cyclohexyl group, cyclohexylmethyl group, or benzyl group.

The ester compound has the general formula (VII):

In the general formula (VII), examples of the monovalent hydrocarbon group which may have a substituent of R ⁶ include the same groups as R ¹ defined in the general formula (I).

Preferably, the hydrocarbon group for R ⁶ is preferably C _1-20 such as methyl, ethyl, n-propyl, i-propyl, vinyl, or n-butyl, preferably C _{1- It is a 6} linear or branched alkyl group, and a particularly preferred group is a methyl group, an ethyl group or a vinyl group.

The hydrocarbon group for R ⁶ may have a further substituent. Further substituents include, for example, a halogen atom (a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom); a C _1-4 alkoxy group such as a methoxyl group, an ethoxyl group, a propoxyl group, or a butoxyl group; a dimethylamino group, Examples thereof include a dialkylamino group disubstituted with a C _1-4 alkyl group such as a diethylamino group or a dipropylamino group; a cyano group; or a nitro group.

In the general formula (VII), examples of the monovalent hydrocarbon group which may have a substituent of R ⁵ include the same groups as those defined for R ¹ defined in the general formula (I).

Preferably, the hydrocarbon group for R ⁵ is preferably C _1-20 such as methyl group, ethyl group, n-propyl group, i-propyl group, vinyl group, or n-butyl group, preferably C _{1-1. It is a 6} linear or branched alkyl group, and a particularly preferred group is a methyl group, an ethyl group or a vinyl group.

The hydrocarbon group for R ⁵ may have a further substituent. Further substituents include, for example, a halogen atom (a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom); a C _1-4 alkoxy group such as a methoxyl group, an ethoxyl group, a propoxyl group, or a butoxyl group; a dimethylamino group, Examples thereof include a dialkylamino group disubstituted with a C _1-4 alkyl group such as a diethylamino group or a dipropylamino group; a cyano group; or a nitro group.

  From the above, examples of the ester compound represented by the general formula (VII) include acrylate alkenyl esters such as vinyl acrylate and isopropenyl acrylate, methacrylic acid alkenyl esters such as vinyl methacrylate and isopropenyl methacrylate, and the like. It is done. Of these, vinyl acrylate and vinyl methacrylate are preferred.

  The reaction of the present invention can be carried out using an organic solvent or without a solvent. The organic solvent is not particularly limited as long as it can dissolve an alcohol compound and an ester compound and does not deactivate the modified lipase or a mutant thereof. However, the organic solvent is not limited to saturated cyclic hydrocarbons, unsaturated cyclic hydrocarbons, and acyclic ethers. Or a mixed solvent thereof is preferred.

Solvents of saturated cyclic hydrocarbons include C _5-10 unsubstituted cycloalkanes such as cyclopentane, cyclohexane, cycloheptane, or isopropylcyclohexane; C _5-10 cyclo substituted with a halogen such as chlorocyclopentane or chlorocyclohexane. Examples include alkanes. C _5-10 unsubstituted cycloalkanes are preferable, and cyclohexane is more preferable.

Examples of the solvent for unsaturated cyclic hydrocarbons include aromatic hydrocarbons such as benzene, toluene, xylene or mesitylene; C _5-10 cycloalkenes such as cyclopentene or cyclohexene. Aromatic hydrocarbons are preferable, and toluene or xylene is more preferable.

Acyclic ethers are aliphatic ethers such as C _2-8 dialkyl ethers such as diethyl ether, t-butyl methyl ether, or diisopropyl ether; C _5-18 cycloalkyl alkyl ethers such as cyclopentyl methyl ether or cyclopentyl ethyl ether. _C7-18 aromatic ethers such as _benzylphenyl ether, benzylmethyl ether, alkylphenyl ether, diphenyl ether, di (p-tolyl) ether, or dibenzyl ether. Preferred are aliphatic ethers or aromatic ethers, and more preferred are diisopropyl ether or anisole. These organic solvents may be used alone or in combination of two or more.

  The amount of the organic solvent used is preferably 1 to 200 mL, more preferably 1 to 50 mL, and particularly preferably 1 to 20 mL with respect to 1 g of the alcohol compound.

  In the transesterification reaction of the present invention, as shown in the reaction formula (D), an alcohol compound, an ester compound, an organic solvent, and a modified lipase or a variant thereof (preferably an immobilized modified lipase or a variant thereof) are used. Mix and react with stirring. Alternatively, it is carried out by a continuous flow method or the like in which an organic solvent containing an alcohol compound and an ester compound is passed through a column packed with an immobilized modified lipase or a mutant thereof.

When the reaction is performed in a continuous flow mode, the concentration of the alcohol compound in the reaction solution is preferably 10 to 50% by mass with respect to the total mass of the reaction system. Moreover, the liquid flow rate of the reaction liquid is preferably 0.5 to 400 mm / min, and more preferably 1 to 200 mm / min. The liquid flow rate (mm / min) is the cross-sectional area of the packed bed (mm ² ) by the amount of liquid fed per minute (mm ³ / min) (or also called the liquid feed rate (10 ⁻³ mL / min)). The value expressed by the quotient divided by. When the pressure inside the packed column increases by increasing the liquid flow rate, it becomes difficult to pass the liquid and an enzyme packed column with high pressure resistance is required. Therefore, it is preferable that the liquid passage speed is 400 mm / min or less. Further, from the viewpoint of productivity, it is preferable that the liquid flow rate is 1 mm / min or more. Since the expression activity of the immobilized enzyme changes depending on the flow rate, the reaction can be performed according to the desired production capacity and manufacturing cost by selecting the optimal flow rate and determining the reaction conditions. it can. The flow time of the reaction solution in the reaction vessel can be in the range of 30 seconds to 6 hours.

  The temperature in the reaction of the present invention is not particularly limited as long as the modified lipase or a mutant thereof is not inactivated, but preferably 30 ° C. to 120 ° C. in order to obtain a desired transesterification product with good yield. 60 degreeC-90 degreeC is more preferable, and 65 degreeC-90 degreeC is especially preferable. In addition, the reaction pressure in the batch reaction is not particularly limited, but it is preferably performed under normal pressure or reduced pressure. The reaction time in the batch reaction is not particularly limited, but is preferably 0.5 hours to 120 hours, and more preferably 0.5 hours to 72 hours.

  The reaction of the present invention is preferably carried out in a range that does not inactivate according to the characteristics of each modified lipase or mutant thereof used.

  The present invention is advantageous in that the reaction is generally heterogeneous, the catalyst can be reused and the post-treatment is simple. That is, the product can be obtained by removing the catalyst by filtration at the end of the reaction and concentrating the obtained filtrate. The product can also be obtained by crystallization operation from the obtained filtrate.

  The production apparatus used for the reaction of the present invention is not particularly limited, and examples thereof include general production apparatuses such as a reaction vessel and a heating (cooling) apparatus. A device in which the modified lipase of the present invention or a variant thereof is immobilized on a carrier and is housed in a reaction vessel as a fixed bed is preferable. Therefore, the reaction of the present invention is preferably a reaction including a step of passing an alcohol compound and an ester compound through the reaction vessel.

  Furthermore, the transesterification product obtained by the production method of the present invention can be further purified by a general method such as distillation, liquid separation, extraction, crystallization, recrystallization and column chromatography.

  The monocarbamate compound, biscarbamate compound or transesterification product obtained by the production method of the present invention is produced using the modified lipase of the present invention or a variant thereof. For this reason, the possibility of mixing impurities such as metal salts or halides into the product, which can occur in the conventional methods for producing carbamate compounds or transesterification products, is extremely low, and a chemically safer product can be obtained.

  The use of the modified lipase of the present invention or a variant thereof in the carbamate reaction or transesterification reaction means that the carbamation reaction or the transesterification reaction is performed by the modified lipase of the present invention or a variant thereof. The modified lipase or variant thereof is preferably immobilized.

  Examples of the present invention will be described below, but the present invention is not limited to these examples.

Expression of Candida antarctica lipase B (wild type, SEQ ID NO: 1) by yeast
1) Amplification of a DNA fragment encoding a signal sequence (SEQ ID NO: 6) derived from yeast invertase (SUC2)
In order to clone the SUC2-derived signal sequence (the nucleic acid sequence of SEQ ID NO: 6 and the amino acid sequence of SEQ ID NO: 7) into a yeast expression vector, the following two types of primers, namely SUC2-F (SEQ ID NO: 8): 5'- gggaatattaagcttggtacc atgcttttgcaagctttccttttc -3 '(the underlined portion is a sequence homologous to the pYES2 / CT vector, the underlined portion is a nucleotide sequence encoding the N-terminal side of the SUC2 signal sequence) and SUC2-R (SEQ ID NO: 9: 5'-tgctggatatctgcagaattc tgcagatattacggcg A DNA fragment was amplified by PCR using 3 '(the underlined portion is a sequence homologous to the pYES2 / CT vector, and the underlined portion is the base sequence encoding the C-terminal side of the SUC2 signal sequence) .Saccharomyces serevisiae S288C strain Using chromosomal DNA (manufactured by Open Biosystems) as a template and heating at 94 ° C for 5 minutes using KOD Plus (manufactured by Toyobo Co., Ltd.), 30 cycles of 94 ° C for 15 seconds, 54 ° C for 30 seconds, and 68 ° C for 18 seconds Okay, primer etc. Gonucleotide was obtained from Fasmac Co., Ltd.

2) Linearization of pYES2 / CT vector with restriction enzymes
The pYES2 / CT vector (Invitrogen) was cleaved with the restriction enzyme Kpn I (Toyobo) at a position downstream of the GAL1 promoter (37 ° C., 5 hours). The cleaved DNA fragment was purified using QIAquick Gel Extraction Kit (manufactured by QIAGEN). The DNA fragment after KpnI digestion was further digested with restriction enzyme EcoR I (manufactured by Toyobo) (37 ° C., 16 hours), and the DNA fragment was purified using QIAquick Gel Extraction Kit (manufactured by QIAGEN). As a result, a linearized pYES2 / CT vector was obtained.

3) Cloning of DNA fragment encoding SUC2-derived signal sequence into vector
Add 2 μL of Cloning Enhancer attached to In-Fusion Advantage PCR Cloning Kit w / Cloning Enhancer (Clontech), which is a cloning method using homologous sequences, to 5 μL of the PCR product obtained in 1), and continue at 37 ° C. for 15 minutes. After the treatment, treatment at 80 ° C. for 15 minutes was performed to obtain a Cloning Enhancer-treated PCR product. The linearized pYES2 / CT vector obtained in 2) obtained with the Cloning Enhancer-treated PCR product was reacted according to the method attached to the kit (reaction at 37 ° C for 15 minutes followed by reaction at 50 ° C for 15 minutes) ). After the reaction, 40 μL of TE buffer solution was added for dilution, and a part (2.5 μL) of the solution was used to transform 50 μL of ECOS E. coli DH5α competent cell (Nippon Gene). The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in an LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard Plus Minipreps DNA Purification System (Promega). The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence (SEQ ID NO: 6). The resulting vector into which the SUC2-derived signal sequence has been introduced is referred to as pYES2 / CT-SUC2sig.

4) Amplification of DNA fragment encoding Candida antarctica lipase B gene (SEQ ID NO: 5)
In order to clone the DNA fragment encoding the Candida antarctica lipase B (CALB) gene (SEQ ID NO: 5) into the expression vector pYES2 / CT-SUC2sig, the following two primers, SUC2-mCALBf (SEQ ID NO: 10) : 5'-gccaaaatatctgca ctaccttccggttcggac- 3 '(the underlined portion is a sequence homologous to the nucleotide sequence encoding the C-terminal side of the SUC2 signal sequence, the underlined portion is the nucleotide sequence encoding the N-terminal side of mature CALB) and CalBterminal- r (SEQ ID NO: 11): PCR using 5'-cttaccttcgaagggccctctagactcgag tcagggggtgacgatg- 3 '(the underlined portion is a sequence homologous to pYES2 / CT-SUC2sig, and the underlined portion is a base sequence encoding the C-terminal side of mature CALB) The DNA fragment was amplified at. Using KOD Plus (manufactured by Toyobo Co., Ltd.) as a template with the CALB gene (Takara Bio Inc., a DNA having the sequence of SEQ ID NO: 5 was custom-made and the cloned plasmid was purchased) as a template. After heating at 94 ° C for 2 minutes, a cycle of 94 ° C for 15 seconds, 55 ° C for 30 seconds, and 68 ° C for 60 seconds was performed 30 times.

5) Linearization of pYES2 / CT-SUC2sig vector with restriction enzymes
The pYES2 / CT-SUC2sig vector was digested with restriction enzyme EcoR I (manufactured by Toyobo) (37 ° C., 15 hours). The cleaved DNA fragment was purified using QIAquick Gel Extraction Kit (manufactured by QIAGEN). The EcoR I cleaved DNA fragment was further cleaved with restriction enzyme Xba I (Toyobo) (37 ° C., 16 hours), and the DNA fragment was purified using QIAquick Gel Extraction Kit (QIAGEN). As a result, a linearized pYES2 / CT-SUC2sig vector was obtained.

6) Cloning of Candida antarctica lipase B gene into pYES2 / CT-SUC2sig vector
Add 2 μL of Cloning Enhancer attached to In-Fusion Advantage PCR Cloning Kit w / Cloning Enhancer (Clontech) to 5 μL of the PCR product obtained in 4), treat at 37 ° C for 15 minutes, then 80 ° C for 15 minutes. As a result, a Cloning Enhancer-treated PCR product was obtained. The resulting PCR product treated with Cloning Enhancer and the linearized pYES2 / CT-SUC2sig vector obtained in 5) were reacted according to the method attached to the kit (37 ° C, 15 minutes reaction, 50 ° C, 15 minutes) reaction). After the reaction, 40 μL of TE buffer solution was added for dilution, and a part (2.5 μL) of the solution was used to transform 50 μL of ECOS E. coli DH5α competent cell (Nippon Gene). The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in an LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard Plus Minipreps DNA Purification System (Promega). The obtained plasmid was analyzed for its nucleotide sequence and confirmed to be the target sequence (SEQ ID NO: 5). The obtained vector into which the SUC2-derived signal sequence has been introduced is referred to as pYES2CT / SUC2sig / mCALB (FIG. 1).

7) Transformation of yeast with pYES2CT / SUC2sig / mCALB vector and expression of wild-type CALB Transformation into yeast was performed using S. cerevisiae Direct Transformation Kit Wako (manufactured by Wako Pure Chemical Industries, Ltd.) according to the kit instructions. The yeast S. cerevisiae BY4742 strain (purchased from Open Biosystems, Inc.) is suspended in YPD liquid medium (1% yeast extract, 2% peptone, 2% glucose) so that OD600 = 0.01, and 1 mL is 30 ° C. The cells were cultured at 180 rpm for 27.5 hours. A transformation solution (20 μl of Sc Transformation Reagent included with the kit plus 2 μl of Carrier DNA included with the kit and 1 μg of plasmid DNA) was prepared and incubated at 42 ° C. for 2 hours. A mixture containing the pYES2CT / SUC2sig / mCALB vector and the yeast culture solution was prepared and transformed. SC-Ura agar medium (0.67% yeast nitrogen base (without amino acids), 2% glucose, 0.01% (adenine, arginine, cysteine, leucine, lysine, threonine, tryptophan), 0.005% (aspartic acid, histidine , isoleucine, methionine, phenylalanine, proline, serine, tyrosine, valine), 2% agar, pH 5.6), and cultured at 30 ° C. for 3 days to obtain transformed yeast colonies.

  The transformed yeast carrying the pYES2CT / SUC2sig / mCALB vector was inoculated into 5 mL of SC-Ura liquid medium and cultured at 30 ° C. and 200 rpm for 16 hours. The obtained preculture was added to 100 mL of YPD liquid medium for expression (1% yeast extract, 4% peptone, 2% glucose) and cultured in a 500 mL Sakaguchi flask at 20 ° C. and 130 rpm for 3 days. 2 mL of YG solution (20% yeast extract, 40% galactose) was added, and cultured as it was at 20 ° C. and 130 rpm for 3 days. After centrifuging the culture solution, the supernatant was collected, and the enzyme activity (ester compound decomposition activity) in the culture supernatant was measured by the method shown below.

  560 μL of substrate solution (50 mM Tris-HCl, 1% DMSO, 2.1 mM p-nitrophenyl butyrate, pH 7.0) was placed in the cell and preincubated at 25 ° C. for 3 minutes. Next, 140 μL of the culture supernatant was added and stirred, and the absorbance at 405 nm was measured over time with a spectrophotometer to calculate the initial reaction rate. As a result, high ester compound degradation activity was confirmed in the transformed yeast having the pYES2CT / SUC2sig / mCALB vector (FIG. 2).

8) Purification of lipase
The bacteria were inoculated into 10 mL of SC-Ura liquid medium and cultured with shaking at 30 ° C. and 180 rpm overnight (16 hours). 10 mL of the preculture was added to 500 mL of YPD medium (1% yeast extract, 4% tryptone, 2% glucose) prepared in a 2 L baffle flask, and cultured with shaking at 30 ° C. and 95 rpm for 8 hours. Expression was induced by adding 25 mL of 20% yeast extract and 25 mL of 40% galactose and culturing with shaking at 20 ° C. and 95 rpm for 3 days (about 72 hours). After collecting the culture supernatant by centrifugation (8000 g, 10 minutes), pass the culture supernatant through Butyl-TOYOPEARL 650M (manufactured by Tosoh) equilibrated with 20 mM Tris-HCl buffer (pH 7.5), and use lipase as a carrier. Adsorbed. After washing with the same buffer, the lipase was eluted with 20 mM Tris-HCl buffer (pH 7.5) containing 50% (v / v) EtOH. The eluate was passed through SuperQ-650S (manufactured by Tosoh Corporation) equilibrated with 20 mM Tris-HCl buffer (pH 7.5), and the passed solution was collected.

  Concentrate the solution containing lipase to 1.0 mL using a centrifugal ultrafiltration filter (Amicon (registered trademark) Ultra-15 Centrifugal Filter Devices, 10000 MWCO, manufactured by Millipore), and then add 20 mM Tris-HCl buffer (pH 7.5). 10 mL was added and mixed, and further concentrated to 1.0 mL. This operation was performed 3 times in total to obtain a concentrated lipase solution in which the solvent was replaced with a buffer solution. The lipase concentrate was passed through SuperQ-650S (manufactured by Tosoh) equilibrated with 20 mM Tris-HCl buffer (pH 7.5), and the passed solution was used as a purified lipase solution.

9) Preparation of lipase-immobilized enzyme Prepare 0.60 g of ion exchange resin Lewatitt VPOC 1600 (manufactured by LANXESS) as a carrier in a test tube, add 3 mL of ethanol, stir, and then remove the ethanol using a pipette. . 3 mL of distilled water was added and stirred, and then water was similarly removed. Water washing was further performed twice, and the mixture was added to 6 mL of a 1.5 mg / mL purified lipase solution (20 mM Tris-HCl buffer, pH 7.0) and stirred at 10 ° C. and 180 rpm for 19 hours. After separating the solution and the carrier, the recovered carrier was washed with 3 mL of distilled water and dried under reduced pressure for 16 hours to obtain an immobilized enzyme having a carrier weight ratio of supported enzyme amount of 3 wt%.

  Before and after the immobilization treatment, the protein concentration in the lipase solution was measured by the BCA method (reference protein BSA), and the amount of protein decreased by the immobilization treatment was divided by the weight of the obtained immobilized enzyme as the amount of protein immobilized on the carrier. This was defined as the amount of enzyme supported.

Production of Q193E modified lipase (SEQ ID NO: 2)
1) Introduction of Q193E mutation
In order to construct Q193E modified lipase, site mutation was introduced into the pYES2CT / SUC2sig / mCALB vector. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two types of primers, CalB-Q193E-F (SEQ ID NO: 12): 5′-CCT GAG GTGTCCAACTCGCCACTCGACTCATCCTAC-3 ′ (the underlined sequence corresponds to the Q193E mutation) and CalB-Q193E-R (SEQ ID NO: 13): Mutagenesis was carried out using 5′-CTGAACGATCTCGTCGGTCGC-3 ′ and pYES2CT / SUC2sig / mCALB vector as a template (after heating at 94 ° C. for 2 minutes, 10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes). 0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in an LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard Plus Minipreps DNA Purification System (Promega).

  The nucleotide sequence of the obtained plasmid was analyzed and confirmed to be the target sequence (SEQ ID NO: 14). The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-Q193E.

2) Yeast transformation, expression of Q193E modified lipase, purification and preparation of immobilized enzyme The same procedure as described in 7) to 9) of Example 1 was performed.

Production of W104F modified lipase (SEQ ID NO: 3)
1) Introduction of W104F mutation
In order to construct a W104F modified lipase, site mutation was introduced into the pYES2CT / SUC2sig / mCALB vector. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two kinds of primers, CalB-W104F-F (SEQ ID NO: 15): 5′-ACC TTT TCCCAGGGTGGTCTGGTTGCACAG-3 ′, the underlined sequence corresponds to the W104F mutation) and CalB-W104F-R (SEQ ID NO: 16): 5 Mutagenesis was carried out using '-GAGCACGGGAAGCTTGTTGTTG-3' and pYES2CT / SUC2sig / mCALB vector as a template (after heating at 94 ° C for 2 minutes, followed by 10 cycles of 98 ° C for 10 seconds and 68 ° C for 7 minutes). 0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in an LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard Plus Minipreps DNA Purification System (Promega).

  The nucleotide sequence of the obtained plasmid was analyzed and confirmed to be the target sequence (SEQ ID NO: 17). The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-W104F.

2) Yeast transformation, expression of W104F modified lipase, purification, and preparation of immobilized enzyme The same procedure as described in 7) to 9) of Example 1 was performed.

Production of W104F / Q193E modified lipase (SEQ ID NO: 4)
1) Introduction of W104F / Q193E mutation
In order to construct the W104F / Q193E modified lipase, site mutation was introduced into the pYES2CT / SUC2sig / mCALB-Q193E vector. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

  Mutation introduction reaction (94 ° C for 2 minutes) using the following two types of primers, CalB-W104F-F (SEQ ID NO: 15) and CalB-W104F-R (SEQ ID NO: 16) and the pYES2CT / SUC2sig / mCALB-Q193E vector as a template After heating, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes was performed 10 times). 0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in an LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard Plus Minipreps DNA Purification System (Promega).

  The nucleotide sequence of the obtained plasmid was analyzed and confirmed to be the target sequence (SEQ ID NO: 18). The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-W104F / Q193E.

2) Yeast transformation, expression of W104F / Q193E modified lipase, purification and preparation of immobilized enzyme The same procedure as described in 7) to 9) of Example 1 was performed.

  Using a modified lipase (W104F, Q193E, W104F / Q193E), the carbamate compound synthesis activity from a carbonate compound and n-hexylamine which is a monoamine compound was evaluated.

  In a glass container having an internal volume of about 19 ml equipped with a stirrer, temperature control and upper cooling device, 200 mg (1.97 mmol) of n-hexylamine, 0.536 g (5.95 mmol) of dimethyl carbonate, tetra After adding 20.0 mg of ethylene glycol dimethyl ether and adding toluene to a constant volume of 2.0 ml, 10.0 mg of the immobilized lipase prepared in Examples 1 to 4 (supported enzyme amount 3 wt%) was mixed, The reaction was allowed to proceed for 24 hours at 70 ° C. with stirring. During the reaction, 50 μl of the reaction solution was sampled over time, 150 μl methanol added was filtered, and 1.0 μl was subjected to gas chromatographic analysis (FIG. 3A). The reaction yield was calculated by quantifying the product amount from a standard product and a calibration curve of the internal standard ratio.

Gas chromatographic analysis conditions Column: DB-5 30m × 0.25mmID 0.25μm
Column temperature: 80 ℃ (2min) → 10 ℃ / min → 250 ℃ (2min)
INJ: 200 ° C DET: FID at 250 ° C
Carrier Gas: He, linear velocity 30cm / sec
Sprit ratio 50: 1, injection volume: 1.0μ
Retention time: Tetraethylene glycol dimethyl ether: 12.3min,
n-Hexylamine: 3.15min
n-hexyl carbamate: 8.84min

result

  As shown in Table 1 and FIG. 3B, the Q193E modified lipase improved the synthesis activity of the carbamate compound by about 1.5 times compared to the wild type lipase (reaction times 3, 6, 8 h). On the other hand, W104F modified lipase was almost as active as wild-type lipase. Surprisingly, the W104F / Q193E modified lipase improved the synthesis activity of the carbamate compound by about 2.0 times compared to the wild type lipase (reaction times 3, 6, 8 h).

  Using a modified lipase (W104F, Q193E, W104F / Q193E), the carbamate compound synthesis activity from a carbonate compound and 1,3-bisaminomethylcyclohexane (1,3-BAC) which is a diamine compound was evaluated.

  In a glass container having an internal volume of about 19 ml equipped with a stirrer, temperature control and an upper cooling device, 200 mg (1.41 mmol) of 1,3-bisaminomethylcyclohexane (1,3-BAC) and 760 mg of dimethyl carbonate (8. 43 mmol), immobilized lipase prepared in Examples 1 to 4 (supported enzyme amount: 3 wt%) in a reaction solution containing 20.0 mg of tetradecane as an internal standard substance and then added with toluene to a constant volume of 2.0 ml. 0 mg was mixed and reacted at 70 ° C. for 48 hours with stirring. During the reaction, 50 μl of the reaction solution was collected over time, 150 μl DMF added was filtered, and 1.0 μl was subjected to gas chromatographic analysis. The reaction yield was calculated by quantifying the product amount from a standard product and a calibration curve of the internal standard ratio.

Gas chromatographic analysis conditions Column: DB-5 30m × 0.25mmID 0.25μm
Column temperature: 80 ℃ (2min) → 10 ℃ / min → 250 ℃ (2min)
INJ: 200 ° C DET: FID at 250 ° C
Carrier Gas: He, linear velocity 30cm / sec
Sprit ratio 50: 1, injection volume: 1.0μ
Retention time: Tetradecane: 11.0 min,
1,3BAC-monocarbamate (isomer mixture): 14.9 min,
1,3BAC-dicarbamate (isomer mixture): 18.9, 19.2 min,

result

  As shown in Table 2 and FIG. 4 described above, Q193E modified lipase improved the synthesis activity of the carbamate compound by about 1.5 times compared to wild-type lipase (reaction time 24, 48 h). On the other hand, the synthetic activity of W104F modified lipase was slightly reduced compared to wild-type lipase for this substrate. Surprisingly, the W104F / Q193E modified lipase improved the synthesis activity of the carbamate compound by about 2.0 times compared to the wild type lipase (reaction time 24, 48 h).

  The modified lipase (W104F, Q193E, W104F / Q193E) was used to evaluate the carbamate compound synthesis activity from 1,12-diaminododecane which is a carbonate compound and a diamine compound.

  1,12-diaminododecane 200 mg (1.0 mmol) and dimethyl carbonate 540 mg (6.0 mmol) were added to a glass container having an internal volume of about 19 ml equipped with a stirrer, temperature control and upper cooling device, and then toluene was added. Then, 10 mg of the immobilized lipase prepared in Examples 1 to 4 (supported enzyme amount: 3 wt%) was mixed with the reaction solution having a constant volume of 2.0 ml and reacted at 70 ° C. for 44 hours while stirring. During the reaction, 50 μl of the reaction solution was collected over time, and 150 μl methanol was added to stop the reaction. Subsequently, after concentrating under reduced pressure with a centrifugal concentrator, 1.0 ml of methanol was added and dissolved, followed by filtration with a 0.45 μm filter for HPLC analysis. The reaction yield was calculated by quantifying the product amount from a calibration curve prepared in advance from the peak area of the standard product.

HPLC analysis conditions
Column: Inertsil ODS-3V 4.6mm x 250mm (GLScienceInc)
Mobile Phase: MeOH / H2O (20mM KH ₂ PO ₄ , pH7.0) = 70/30
Flow Rate: 1.0ml / min
Detecter: RI
Column Temp: 40 ℃
Injection Vol. 10μl
Retention time: DMD-dicarbamate: 17.4 min,

result

  As shown in Table 3 and FIG. 5, the Q193E modified lipase improved the synthetic activity of the dicarbamate compound by about 2-fold compared to the wild-type lipase (reaction time 20, 44 h). On the other hand, the synthetic activity of W104F modified lipase was slightly reduced compared to wild-type lipase for this substrate. Surprisingly, the W104F / Q193E modified lipase exceeded the synthetic activity of the dicarbamate compound compared to the Q193E modified lipase.

  The modified lipase (W104F, Q193E, W104F / Q193E) was used to evaluate the carbamate compound synthesis activity from xylylenediamine (XDA) which is a carbonate compound and a diamine compound.

  In a glass container having an internal volume of about 19 ml equipped with a stirrer, temperature control and upper cooling device, 200 mg (1.46 mmol) of xylylenediamine compound, 0.79 g (8.81 mmol) of dimethyl carbonate, tetradecane as an internal standard substance 20.0 mg was added, toluene was added to the reaction solution, and the volume was adjusted to 2.0 ml. 10 mg of the immobilized lipase prepared in Examples 1 to 4 (supported enzyme amount: 3 wt%) was mixed and stirred at 70 ° C. For 24 hours. During the reaction, 50 μl of the reaction solution was collected over time, 150 μl DMF added was filtered, and 1.0 μl was subjected to gas chromatographic analysis. The reaction yield was calculated by quantifying the product amount from a standard product and a calibration curve of the internal standard ratio.

Gas chromatographic analysis conditions Column: DB-5 30m × 0.25mmID 0.25μm
Column temperature: 80 ℃ (2min) → 10 ℃ / min → 250 ℃ (2min)
INJ: 200 ° C DET: FID at 250 ° C
Carrier Gas: He, linear velocity 30cm / sec
Sprit ratio 50: 1, injection volume: 1.0μ
Retention time: Tetradecane: 11.0 min,
XDA-monocarbamate: 15.5 min,
XDA-dicarbamate: 19.6 min,

result

  As shown in Table 4 and FIG. 6 above, when a xylylenediamine compound is used as a substrate as a diamine compound, the synthetic activity of the dicarbamate compound of Q193E modified lipase and W104F modified lipase is 3 times that of the wild type. In addition, the W104F / Q193E modified lipase, which is a double-modified product, showed an improvement in activity of 5 times or more compared to the wild-type lipase.

Synthesis of Q193D (SEQ ID NO: 19 and 35), L278R (SEQ ID NO: 21 and 37), L278K (SEQ ID NO: 22 and 38) and A283V (SEQ ID NO: 60 and 61) modified lipase 1) Introduction of modification Each modified lipase In order to construct it, site mutation was introduced into the pYES2CT / SUC2sig / mCALB vector (FIG. 1) prepared in Example 1. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.
Using the primers listed in Table 5 below (the underlined sequence is the sequence corresponding to the mutation), a mutagenesis reaction (94 ° C for 2 minutes followed by 10 cycles of 98 ° C for 10 seconds and 68 ° C for 7 minutes) was performed. .

  0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured for 16 hours in an LB liquid medium containing 50 μg / mL carbenicillin, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vectors into which the modifications are introduced are referred to as pYES2CT / SUC2sig / mCALB-Q193D, pYES2CT / SUC2sig / mCALB-L278R, pYES2CT / SUC2sig / mCALB-L278K and pYES2CT / SUC2sig / mCALB-A283V, respectively.

2) Yeast transformation, expression of Q193D, L278R, L278K and A283V modified lipase, purification and preparation of immobilized enzyme The same procedure as described in Example 1 was performed.

Synthesis of Q193E / L278R modified lipase (SEQ ID NOs: 23 and 39) 1) Introduction of mutation To construct Q193E / L278R modified lipase, a site relative to the pYES2CT / SUC2sig / mCALB-Q193E vector prepared in Example 2 Mutagenesis was performed. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two kinds of primers, CalB-L278Rf (SEQ ID NO: 53): 5′-CTC AGG GCGCCGGCGGCTGCAGCCATCGTG-3 ′ (underlined portion corresponds to the L278R mutation) and CalB-L278r (SEQ ID NO: 54): 5′- CGCAGCCGCGGCGACCTTTTGCTC-3 ′ was used for mutagenesis reaction (after heating at 94 ° C. for 2 minutes, 10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes). 0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured for 16 hours in an LB liquid medium containing 50 μg / mL carbenicillin, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-Q193E / L278R.

2) Yeast transformation, expression of Q193E / L278R modified lipase, purification and preparation of immobilized enzyme The same procedure as described in Example 1 was performed.

Synthesis of Q193E / W104F / L278K Modified Lipase (SEQ ID NOS: 28 and 44) 1) Introduction of Modification To construct a modified lipase, L278K was first used against the pYES2CT / SUC2sig / mCALB-Q193E vector prepared in Example 9. Site mutation was introduced. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two types of primers, CalB-L278Kf (SEQ ID NO: 55): 5′-CTC AAG GCGCCGGCGGCTGCAGCCATCGTG-3 ′ (underlined portion corresponds to the L278K mutation) and CalB-L278r (SEQ ID NO: 56): 5′- CGCAGCCGCGGCGACCTTTTGCTC-3 ′ was used for mutagenesis reaction (after heating at 94 ° C. for 2 minutes, 10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes).

  0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) 50 μL was transformed with a part (5 μL) of the reaction solution obtained by this operation. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-Q193E / L278K.

  Next, in order to introduce the W104F mutation, site mutation was introduced into the pYES2CT / SUC2sig / mCALB-Q193E / L278K vector. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two types of primers, CalB-W104Ff (SEQ ID NO: 15): 5′-ACC TTT TCCCAGGGTGGTCTGGTTGCACAG-3 ′ (underlined portion corresponds to the W104F mutation) and CalB-W104r (SEQ ID NO: 16): 5′- GAGCACGGGAAGCTTGTTGTTG-3 ′ was used for mutagenesis reaction (after heating at 94 ° C. for 2 minutes, 10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes).

  0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured for 16 hours in an LB liquid medium containing 50 μg / mL carbenicillin, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-W104F / Q193E / L278K.

2) Yeast transformation, expression of W104F / Q193E / L278K modified lipase, purification, and preparation of immobilized enzyme The same procedure as described in Example 1 was performed.

Synthesis of Q193D / W104F / L278K modified lipase (SEQ ID NOs: 30 and 46) 1) Introduction of modification To construct a modified lipase, the W104F was first constructed against the pYES2CT / SUC2sig / mCALB-L278K vector prepared in Example 9. Site mutation was introduced. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two types of primers, CalB-W104Ff (SEQ ID NO: 15): 5′-ACC TTT TCCCAGGGTGGTCTGGTTGCACAG-3 ′ (underlined portion corresponds to the W104F mutation) and CalB-W104r (SEQ ID NO: 16): 5′- GAGCACGGGAAGCTTGTTGTTG-3 ′ was used for mutagenesis reaction (after heating at 94 ° C. for 2 minutes, 10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes).

  0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured for 16 hours in an LB liquid medium containing 50 μg / mL carbenicillin, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-W104F / L278K.

  Next, in order to introduce the Q193D mutation, a site mutation was introduced into the pYES2CT / SUC2sig / mCALB-W104F / L278K vector. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two kinds of primers, CalB-Q193Df (SEQ ID NO: 51): 5′-CCT GAC GTGTCCAACTCGCCACTCGACTCATCCTAC-3 ′ (underlined portion corresponds to the Q193D mutation) and CalB-Q193r (SEQ ID NO: 52): 5′- CTGAACGATCTCGTCGGTCGC-3 ′ was used for mutagenesis reaction (heating at 94 ° C. for 2 minutes, followed by 10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes).

  0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured in LB liquid medium containing 50 μg / mL carbenicillin for 16 hours, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-W104F / Q193D / L278K.

2) Yeast transformation, expression of W104F / Q193D / L278K modified lipase, purification and preparation of immobilized enzyme The same procedure as described in Example 1 was performed.

Synthesis of Q193E / W104F / L278R / A283V Mutant Lipase (SEQ ID NOS: 31 and 47) 1) Introduction of Modifications pYES2CT / SUC2sig / mCALB-W104F / Q193E vector prepared in Example 4 to construct each modified lipase Site mutations were introduced. For site mutation introduction, KOD-Plus-Mutagenesis Kit (manufactured by Toyobo Co., Ltd.) was used, and mutation introduction was performed according to the method described in the attached manual.

The following two types of primers, CalB-L278R / A283Vf (SEQ ID NO: 59): 5′-CTC AGG GCGCCGGCGGCT GTA GCCATCGTG-3 ′ (underlined portions are sequences corresponding to the L278R mutation and A283V mutation, respectively) and CalB-L278r ( SEQ ID NO: 54): Mutagenesis reaction was carried out using 5′-CGCAGCCGCGGCGACCTTTTGCTC-3 ′ (10 cycles of 98 ° C. for 10 seconds and 68 ° C. for 7 minutes after heating at 94 ° C. for 2 minutes). 0.8 μL of restriction enzyme Dpn I was added to 20 μL of the reaction solution, and reacted at 37 ° C. for 4 hours. Using a part (5 μL) of the reaction solution obtained by this operation, 50 μL of ECOS E. coli DH5α competent cell (manufactured by Nippon Gene) was transformed. The total amount of the transformant was applied to an LB agar medium containing 50 μg / mL carbenicillin and cultured at 37 ° C. for 16 hours. Bacteria were isolated from the obtained colonies, cultured for 16 hours in an LB liquid medium containing 50 μg / mL carbenicillin, and then the plasmid was extracted using Wizard® Plus Minipreps DNA Purification System (Promega).

  The obtained plasmid was analyzed for nucleotide sequence and confirmed to be the target sequence. The vector into which the mutation has been introduced is referred to as pYES2CT / SUC2sig / mCALB-W104F / Q193E / L278R / A283V.

2) Yeast transformation, expression of W104F / Q193E / L278R / A283V modified lipase, purification and preparation of immobilized enzyme The same procedure as described in Example 1 was performed.

  Using the modified lipase prepared in Examples 9 to 13 (W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R, L278R, L278K, Q193D, A283V), Example 5 The carbamate compound synthesis activity from a carbonate compound (dimethyl carbonate) and a monoamine compound (n-hexylamine compound) was evaluated in the same manner as described above.

result

For wild type to W104F / Q193E, the data in Table 1 of Example 5 are listed for comparison.

As shown in the above Table 6 and FIG. 7, W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R modified lipase were reacted with Reactions 3, 6, 8 from Q193E modified lipase. The yield in time was significantly higher and further reaction rate improvements were observed.
The yield of the W104F / Q193E / L278R / A283V modified lipase in the reaction for 3 hours is about 4 times higher than that of the wild type lipase.

  Example 6 Using the modified lipase prepared in Examples 9 to 13 (W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R, L278R, L278K, Q193D, A283V) In the same manner as described above, the carbamate compound synthesizing activity of 1,3-bisaminomethylcyclohexane (1,3-BAC) which is a carbonate compound and a diamine compound was evaluated. However, experimental conditions differ in the following points.

  In Example 6, 1,3-BAC containing 2.0% by weight of water was used, whereas in Example 14, 1,3-BAC containing 0.03% by weight of water was used. The moisture is measured with a Karl Fischer moisture meter.

result

  As shown in Table 7 above, W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R modified lipases have significantly higher yields than Q193E modified lipases, and further reactions An increase in speed was observed. In particular, the improvement in yield and reaction rate in the Q193E / L278R modified lipase is remarkable.

  Example 8 using the modified lipase prepared in Examples 9 to 13 (W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R, L278R, L278K, Q193D, A283V) The carbamate compound synthesis activity from xylylenediamine (XDA) which is a carbonate compound and a diamine compound was evaluated in the same manner.

result

Wild type to W104F / Q193E listed the data in Table 4 of Example 8 for comparison.

  As shown in Table 8 above, W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, and Q193E / L278R modified lipase showed improved activity over Q193E modified lipase. However, W104F / Q193E / L278R / A283V and W104F / Q193E modified lipase were the highest. It was shown that the optimal modified lipase differs depending on the substrate.

  Using the modified lipase prepared in Examples 9 to 13 (W104F / Q193E / L278R / A283V, W104F / Q193D / L278K, W104F / Q193E / L278K, Q193E / L278R, L278R, L278K, Q193D, and A283V) The transesterification activity from the alcohol compound was evaluated.

In a glass container having an internal volume of about 19 ml equipped with a stirrer, temperature control and upper cooling device, n-butanol 200 mg (2.69 mmol), vinyl acetate 0.463 g (5.38 mmol), tetraethylene as an internal standard substance After adding 20.0 mg of glycol dimethyl ether and adding toluene to a constant volume of 2.0 ml, 10.0 mg of the immobilized lipase prepared in Example 1 and Examples 9 to 13 (supported enzyme amount 3 wt%) was mixed. The mixture was reacted at 30 ° C. for 3 hours with stirring. During the reaction, 50 μl of the reaction solution was collected over time, 150 μl acetone added was filtered, and 1.0 μl was subjected to gas chromatographic analysis.
The reaction yield was calculated by quantifying the product amount from a standard product and a calibration curve of the internal standard ratio.

Gas chromatographic analysis conditions
GC Analysis (GC-1700)
Column: DB-1701 30m × 0.25mmID 0.25μm
Oven: 40 ℃ (2min) → 10 ℃ / min → 250 ℃ (2min)
INJ: Sprit at 250 ° C DET: FID 250 ° C
Carrier Gas: He
Linear speed 30cm / sec
Sprit ratio 50: 1
Injection volume: 1.0μ
Retention time: Tetraethylene glycol dimethyl ether: 17.3 min,
n-Butylamine: 3.2 min
Butyl propionate: 5.6 min

result

  As shown in Table 9 above, Q193E / L278R, L278R, and L278K modified lipases showed a marked improvement in reaction rate over the wild-type lipase.

  The present invention can be used for industrial production of a transesterification product from a carbamate compound or an alcohol compound and an ester compound from a carbonate compound and an amine compound.

Claims (13)

  A modified lipase obtained by substituting leucine at position 278 of SEQ ID NO: 1 with another amino acid residue, or a variant thereof having further one or several amino acid substitutions, deletions, insertions, additions or inversions A modified lipase or a mutant thereof, which exhibits a higher carbamate activity and transesterification activity than the wild type lipase shown in SEQ ID NO: 1.   The modified lipase according to claim 1, wherein leucine at position 278 is substituted with arginine or lysine, or further having one or several amino acid substitutions, deletions, insertions, additions or inversions, Its variant showing the same carbamate and transesterification activity.   Furthermore, glutamic acid at position 193 is substituted with glutamic acid or aspartic acid, or the modified lipase according to claim 1 or 2, or further having one or several amino acid substitutions, deletions, insertions, additions or inversions. And their mutants exhibiting the same carbamation activity and transesterification activity as the modified lipase.   A DNA encoding the modified lipase according to any one of claims 1 to 3, or a mutant thereof.   A transformed microorganism comprising the DNA according to claim 4.   A method for producing a modified lipase or a mutant thereof, comprising culturing the transformed microorganism according to claim 5 in a medium and accumulating the modified lipase or a mutant thereof in the medium and / or the microorganism.   The modified lipase according to any one of claims 1 to 3 or a variant thereof, or the modified lipase obtained by the method according to claim 6 or a variant thereof immobilized on a carrier, or a variant thereof .   Use of the modified lipase or variant thereof according to any one of claims 1 to 3 and 7 or the modified lipase obtained by the method according to claim 6 in a carbamate reaction or transesterification reaction .   The use according to claim 8, wherein the carbamate reaction comprises reacting a carbonate compound and an amine compound to produce a carbamate compound.   The use according to claim 8, wherein the transesterification reaction comprises reacting an ester compound and an alcohol compound to produce a transesterification product.   A dialkyl carbonate compound and an amine compound in the presence of the modified lipase or variant thereof according to any one of claims 1 to 3 and a variant thereof, or the modified lipase obtained by the method of claim 6 or a variant thereof. A process for producing a carbamate compound, characterized in that the reaction is carried out using as a substrate.   An alkyl alcohol compound and a fatty acid vinyl alcohol in the presence of the modified lipase according to any one of claims 1 to 3 and 7 or a variant thereof or the modified lipase obtained by the method according to claim 6 or a variant thereof. A method for producing a transesterification product, characterized by reacting an ester compound as a substrate.   The method for producing a carbamate compound according to claim 11, wherein the dialkyl carbonate compound is a dimethyl carbonate compound.