JP2013072665A - Working electrode used in test agent detection using photoelectric current, and measuring apparatus and measuring method using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a detection method capable of easily checking whether a plurality of detection spots formed on a working electrode and light radiated from a light irradiation mechanism provided in a detector are accurately aligned, and accurately detecting a current value generated at each detection spot as a result, in a peculiar detection method of a test agent using a photoelectric current.SOLUTION: In the method, a dye mark spot carrying sensitizing dye is provided in addition to a spot carrying a probe substance on the working electrode, and a failure of a device is reported when a current value when the dye mark spot is irradiated with light is out of a prescribed range. Especially, by turning the plurality of dye mark spots to two points at relatively most separated positions among the spots provided on the working electrode, whether or not a working electrode 11 is appropriately attached is easily recognized.

Description

  The present invention easily knows whether measurement conditions are appropriate in a method for specifically detecting a test substance having specific binding properties such as a nucleic acid, an exogenous endocrine disruptor, and an antigen using photocurrent. And a sensor unit and a measuring device used therefor.

  Genetic diagnostic methods for detecting and analyzing DNA in biological samples are promising as new preventive and diagnostic methods for various diseases. The following have been proposed as techniques for easily and accurately detecting such DNA.

  There is known a DNA analysis method in which a sample DNA is hybridized with a DNA probe having a base sequence complementary thereto and a fluorescent substance labeled, and a fluorescent signal at that time is detected (for example, JP, 7-107999, A (patent documents 1) and JP, 11-315095, A (patent documents 2)). In this method, the formation of double-stranded DNA by hybridization is detected by fluorescence of the dye. In fluorescence detection, since a plurality of detection spots on which probe DNA is immobilized can be formed on the same substrate, the specificity to a plurality of probe DNAs can be elucidated by one detection. However, the detection device including a light receiver necessary for fluorescence detection is large and expensive, and double-stranded DNA must be single-stranded, hybridized, washed, and fluorescence detected separately. DNA cannot be easily detected.

  Incidentally, a solar cell that generates electric energy from light using a sensitizing dye is known (see, for example, JP-A-1-220380 (Patent Document 3)). This solar cell has a polycrystalline metal oxide semiconductor and has a sensitizing dye layer formed over its surface area over a wide range.

  As an attempt to apply the characteristics of such a solar cell to biochemical analysis, there is a proposal to use a photocurrent generated by photoexcitation of a dye for detection of a test substance (biomolecules such as DNA and protein). (For example, Nakamura et al. "New DNA Double-Strand Detection Method by Photoelectric Conversion" (The Chemical Society of Japan, Proceedings Vol.81ST NO.2 (2002), page 947 (Non-patent Document 1)).

  Furthermore, some of the present inventors have previously proposed a method for specifically detecting a test substance having specific binding properties such as a nucleic acid, an exogenous endocrine disrupting substance, and an antigen using photocurrent. ing. For example, WO2007 / 037341 (Patent Document 4), JP-A-2006-119111 (Patent Document 5), JP-A-2006-119128 (Patent Document 6), JP-A-2007-085941 (Patent Document 7). ), JP-A-2008-020205 (Patent Document 8), JP-A-2008-157915 (Patent Document 9), JP-A-2008-157916 (Patent Document 10), JP-A-2008-192770 (Patent Document). Document 11), JP 2008-202995 A (Patent Document 12), JP 2009-186453 A (Patent Document 13), JP 2009-186454 A (Patent Document 14), and JP 2009-186462 A. (Patent Document 15), Japanese Patent Application Laid-Open No. 2010-038813 (Patent Document 16), and Japanese Patent Application No. 2010. No. 232919 (Patent Document 17) proposes Japanese Patent Application No. 2011-504882 (the patent document 18).

  In these methods proposed by the present inventors, light irradiation is performed sequentially on a plurality of detection spots carrying a substance that can specifically bind to the test substance formed on the working electrode. Detection is possible. On the other hand, since it is a method of performing detection at a plurality of spots in a single operation, if the measurement conditions are not appropriate, the operation must be repeated.

JP-A-7-107999 Japanese Patent Laid-Open No. 11-315095 Japanese Patent Laid-Open No. 1-220380 WO2007 / 037341 JP 2006-119111 A JP 2006-119128 A Japanese Patent Laid-Open No. 2007-059441 JP 2008-020205 A JP 2008-157915 A JP 2008-157916 A JP 2008-192770 A JP 2008-202995 A JP 2009-186453 A JP 2009-186454 A JP 2009-186462 A JP 2010-038813 A Japanese Patent Application No. 2010-232919 Japanese Patent Application No. 2011-504882

Nakamura et al. "New DNA double strand detection method by photoelectric conversion" (Proceedings of the Chemical Society of Japan Vol.81ST NO.2 (2002), p. 947)

The inventors of the present invention can now easily check whether the plurality of detection spots formed on the working electrode and the light emitted from the light irradiation mechanism provided in the detection device are accurately aligned. I found.
Therefore, according to the present invention, in a specific detection method of a test substance using photocurrent, a plurality of detection spots formed on the working electrode and light irradiated from a light irradiation mechanism provided in the detection device are provided. An object of the present invention is to provide a detection method capable of easily confirming whether or not the alignment is accurately performed and, as a result, accurately detecting a current value generated at each detection spot.

And the specific detection method of the test substance by this invention is the following.
A test electrode to which a test substance to which a sensitizing dye is bound is immobilized via a probe substance is brought into contact with an electrolyte medium together with a counter electrode, and the working electrode is irradiated with light to photoexcite the sensitizing dye, and is photoexcited. Detecting a photocurrent flowing between the working electrode and the counter electrode due to electron transfer from the sensitizing dye to the working electrode, comprising:
The working electrode has an electron accepting layer containing an electron accepting material capable of accepting electrons emitted by the sensitizing dye in response to photoexcitation, and the probe material is supported on the surface of the electron accepting layer. ,
In addition to the spot carrying the probe substance on the working electrode, a dye labeling spot carrying the sensitizing dye is provided,
A reaction step of obtaining a working electrode in which the test substance bound with the sensitizing dye is immobilized via a probe substance, comprising at least contacting the working electrode with the test substance;
A measurement step of supplying the electrolyte medium, irradiating light, and measuring a photocurrent;
A result notification step for displaying the result of the measurement,
In the result informing step, a malfunction of the apparatus is informed when the current value when the dye-labeled spot is irradiated with light is outside a predetermined range.

It is a figure which shows an example of the apparatus for implementing the detection method by this invention. It is a figure which shows the sensor cell structure for enforcing the detection method by this invention. It is a figure which shows the structure of the electrode part of a sensor cell. It is a figure which shows the working electrode provided with the several detection spot used for the detection method by this invention. It is a figure which shows the working electrode provided with the pigment | dye label | marker spots 30-1 and 30-2 which carry | supported the sensitizing dye used for the detection method by this invention. FIG. 6A is a diagram showing a state in which the positions of the plurality of spots provided on the working electrode 11 and the plurality of openings 19 provided in the pressing member 20 coincide with each other. B) is a diagram showing a state in which the positions of the plurality of spots provided on the working electrode 11 and the plurality of openings 19 provided in the pressing member 20 are shifted from each other. 2 is a graph showing detected current values for each target DNA concentration in a control probe DNA-immobilized spot obtained in Example 1. FIG. Whether the detected target DNA prepared based on the detection current value at each concentration of the target DNA in the probe DNA-immobilized spot including the detection site and the value obtained by subtracting the standard deviation × 3 obtained in Example 2 is a perfect match It is a graph showing the boundary which determines whether it is a single base difference. The current values obtained in Example 3 using the completely matched target DNA adjusted to 75 nM and the target DNA with one base difference (110.2 nA and 108 nA of the control in the figure, respectively), and from these current values, FIG. The calculated current value (130.2 nA of the detection site in the figure) and the boundary line value (62.8 nA of the detection site in the figure) obtained from the graph shown in FIG. Has been. By comparing the actual measured values with the boundary line values, it was possible to determine whether the target DNA was a perfect match target DNA or a single base difference target DNA.

Specific Detection of Test Substance Using Photocurrent In the method of the present invention, first, a sample solution containing a test substance, a working electrode, and a counter electrode are prepared. The working electrode used in the present invention is an electrode provided on the surface with a probe substance capable of specifically binding directly or indirectly to a test substance. That is, the probe substance is not only a substance that binds directly and specifically to the test substance, but also a conjugate obtained by specifically binding the test substance to a mediator such as a receptor protein molecule. It may be a bindable substance. Next, in the presence of the sensitizing dye, the sample solution is brought into contact with the working electrode to specifically bind the test substance directly or indirectly to the probe substance, and the sensitizing dye is fixed to the working electrode by this binding. Sensitizing dyes are substances that can emit electrons to the working electrode in response to photoexcitation, and can be pre-labeled to the test substance or mediator, or intercalated to the conjugate of the test substance and the probe substance. When a sensitizing dye is used, it may be simply added to the sample solution.

  Then, after bringing the working electrode and the counter electrode into contact with the electrolyte medium, when the sensitizing dye is photoexcited by irradiating the working electrode with light, the electron acceptor present on the surface of the working electrode is photoexcited from the photoexcited sensitizing dye. Electron transfer to the material occurs. By detecting the photocurrent flowing between the working electrode and the counter electrode due to this electron movement, the test substance can be detected with high sensitivity. Further, since the detected current has a high correlation with the test sample concentration in the sample solution, the test sample can be quantitatively measured based on the measured current amount or electric quantity.

  The present invention can be basically applied to these apparatuses and methods to confirm that appropriate measurements are performed. Specifically, the present invention relates to WO2007 / 037341, JP2006-119111, JP2006-119128, JP2007-085941, JP2008-020205, and JP2008. JP-A Nos. 157915, 2008-157916, 2008-192770, 2008-202995, 2009-186453, 2009-186454, 2009-186462. It is applicable to the method and apparatus described in Japanese Patent Application No. 2010-038813, Japanese Patent Application No. 2010-232919, and Japanese Patent Application No. 2011-504882.

Measuring Device The basic features of the device and detection method according to the present invention based on the above basic principle will be described with reference to the drawings. As shown in FIG. 1, a measurement apparatus 10 that uses a photocurrent generated by photoexcitation of a dye for specific detection of a test substance has a sensor cell 1 and a fluid supply means 2 for supplying fluid to the sensor cell 1 as a basic configuration. And a switching valve 3 placed between them, and a light source laser head 4 for irradiating light to a spot carrying a probe substance provided on the electron accepting layer of the working electrode provided in the sensor cell 1; , An XY automatic stage 5, and a temperature adjustment control unit 6 for controlling a temperature adjustment function at the time of reaction and detection provided in the sensor cell, and is connected to a personal computer 7 that processes a signal from the measuring apparatus 10.

  FIG. 2 is a diagram showing the structure of the sensor cell 1. The working electrode 11 includes a counter electrode 12, a working electrode conducting portion 13 and a counter electrode conducting portion 14 that enable energization of the counter electrode 12. Is provided with an inlet port 15 and an outlet port 16 through which an electrolyte is supplied and discharged. The working electrode 11 and the counter electrode 12 are fixed together with a working electrode heater 17 by a pressing member 20. The working electrode 11 is irradiated with light from the direction A in FIG. 2, and this light passes through a pressing member 20 having a plurality of openings 19 at locations corresponding to the positions of a plurality of spots on the working electrode 11. To the working electrode 11. When the sensitizing dye is photoexcited, electron transfer occurs from the photoexcited sensitizing dye to an electron accepting substance (not shown). By detecting the photocurrent flowing between the working electrode and the counter electrode due to this electron movement, the test substance can be detected with high sensitivity.

  FIG. 3 is a diagram for further explaining the structure of the working electrode 11 and the counter electrode 12. Between the working electrode 11 and the counter electrode 12, an O-ring 21 that puts them at a predetermined distance is placed while being fitted in the counter electrode recess 22. The inlet port 15 and the outlet port 16 are provided at both ends in the O-ring so that air and solution can be easily replaced in the sensor cell.

  Furthermore, in the present invention, a plurality of detection spots 30 are provided on the surface of the working electrode 11 facing the counter electrode 12 as shown in FIG. Is omitted). At least one of the spots carries a probe substance capable of specifically binding directly or indirectly to the test substance. Furthermore, the present invention is characterized in that other spots described below are provided.

Dye-labeled spot In the present invention, the working electrode is provided with a dye-labeled spot carrying the sensitizing dye in addition to the spot carrying the probe substance. When light is applied to the dye-labeled spot, electron transfer occurs from the sensitizing dye in the spot, and a photocurrent flows between the working electrode and the counter electrode. The sensitizing dye supported on the spot is set in a predetermined amount, and the photoelectric flow rate at that time is obtained in advance. By measuring the photoelectric flow rate of another working electrode similarly produced and comparing it with a current value acquired in advance, it is possible to know whether the measurement conditions are predetermined. Specifically, the following can be known. That is, (1) deficiencies related to the electrolytic solution can be known. For example, if the cell is not filled with an electrolyte, no current flows, and if the electrolyte is qualitatively different (quality is poor), a predetermined current value cannot be obtained. (2) It is possible to know inadequate measurement conditions. For example, in the case of a difference in light source intensity (change due to deterioration), a defect in a light source moving mechanism, or a failure in obtaining a current value (lead wire disconnection, conduction part failure), a predetermined current value cannot be obtained. (3) The deficiency of the working electrode can be known. For example, a predetermined current value cannot be obtained when the working electrode is not prepared according to the standard or is deteriorated.

  In the method according to the present invention, as a result notification step, the current value of the dye-labeled spot is compared with the current value obtained in advance, and whether the measurement conditions are predetermined is presented. The comparison with the current value acquired in advance is configured to define a predetermined range having a certain width with respect to the current value acquired in advance, and to notify the device as a malfunction when the current value is out of the range. Preferably, the predetermined range may be configured to obtain a standard deviation of the obtained current value, and to report, for example, a value out of the three times (3σ) range as a failure.

  According to a preferred aspect of the present invention, the working electrode comprises a plurality of dye label spots. More preferably, the plurality of dye-labeled spots are two points that are relatively farthest among the spots provided on the working electrode. The working electrode according to this embodiment will be described with reference to the drawings. FIG. 5 shows a working electrode 11 provided with a plurality of spots. Among the provided spots, two spots 30-1 and 30-2 that are relatively farthest positions are defined as dye-labeled spots. At least one of the other spots carries a probe substance capable of specifically binding directly or indirectly to the test substance. This working electrode is used as the sensor cell 1 having the configuration shown in FIG. 3, and is attached to the apparatus shown in FIGS. At that time, it is necessary for accurate measurement that the positions of the plurality of spots provided on the working electrode 11 and the plurality of openings 19 provided in the pressing member 20 are coincident. On the other hand, if the working electrode 11 is not properly attached, the measurement cannot be performed accurately if the positions of the two do not match. According to this aspect of the present invention, it is possible to know whether the positional relationship between the two is appropriate.

  FIG. 6A is a diagram illustrating a state in which the positions of the plurality of spots provided on the working electrode 11 and the plurality of openings 19 provided in the pressing member 20 are coincident with each other. In this figure, in addition to the spots 30-1 and 30-2, other spots also correctly coincide with the position of the opening 19. In such a state, the current value measured from the spots 30-1 and 30-2 should be almost the same if the amount of the sensitizing dye carried on the dye-labeled spot is the same. .

  On the other hand, FIG. 6B is a diagram illustrating a state in which the positions of the plurality of spots provided on the working electrode 11 and the plurality of openings 19 provided in the pressing member 20 are shifted from each other. In this figure, the spot 30-1 substantially coincides with the position of the opening 19, but the other spots including the spot 30-2 do not coincide with the position of the opening 19, respectively. As a result, the light amounts due to light irradiation are different, and the current values measured from the spots 30-1 and 30-2 are different values (spots) even if the amount of the sensitizing dye carried on the dye-labeled spot is the same. 30-2 is smaller than the spot 30-1). Even in this mode, as a result notification step, the current value of the dye-labeled spot is compared with the current value acquired in advance, and whether the measurement conditions are predetermined is presented. When a different value is indicated, it is configured to be notified as a malfunction. In a preferred embodiment of the present invention, the two dye-labeled spots are the two points that are relatively farthest among the spots provided on the working electrode. It is provided in the position. Therefore, it is possible to know even a slight mounting defect.

  The dye label spot may fix only the dye label, but preferably the dye label is fixed to the working electrode via the same type of substance as the probe substance. For example, when the probe substance is DNA, the dye label is preferably fixed to the working electrode via the DNA. The fixing method in this case may be the same as the fixing method of the probe substance. Advantages of fixing the dye label via the same substance as that of the probe substance in the same manner are as follows. As will be described later, for example, when the current value obtained at the perfect match probe spot is small, various causes such as the PCR product not being amplified or not being temperature-controlled can be considered. It is also conceivable that the amount of immobilization does not meet the regulations. In this case, the probe substance is not immobilized for some reason, but if the dye-labeled spot does not satisfy the prescribed immobilization amount, the spot device condition is bad and the working electrode is prescribed. This is advantageous in that the cause of the failure can be further specified, for example, it is not satisfied. A more specific method for immobilizing a dye-labeled spot is to detect a genetic polymorphism of a test substance, and determine whether it binds specifically in the step where the probe DNA is immobilized. A solution containing probe DNA and a solution containing dye-labeled probe DNA are prepared, and each solution is spotted only when the solution is spotted. The probe substance labeled with the dye is preferably used under the same conditions as possible except for the dye label. For example, if the probe substance is DNA, it is more preferable if the number of bases is the same.

Perfectly matched probe DNA spot According to a preferred embodiment of the present invention, the working electrode has a sequence that completely matches a region where no base substitution occurs when the probe substance detects a genetic polymorphism of the test substance. And a perfect match probe DNA spot carrying a probe material to which a sensitizing dye is bound. In the sequence of this perfect match probe DNA spot, no base substitution occurs, and therefore a test substance that does not hybridize by base substitution hybridizes to the spot carrying the probe substance. By comparing the current values obtained from the perfectly matched probe DNA spot and the spot carrying the probe substance, more appropriate measurement and detection can be performed as follows. According to a preferred embodiment of the present invention, the genetic polymorphism is a single nucleotide polymorphism.

  In this embodiment, light is applied to this perfectly matched probe DNA spot, electron transfer occurs from the sensitizing dye carried on the probe at this spot, and a photocurrent flows between the working electrode and the counter electrode. A perfectly matched probe DNA carried on the spot, that is, a sensitizing dye, is set in a predetermined amount, and the following calibration curve is created. First, a first calibration curve is created between the concentration of a substance that is not a gene polymorphism with respect to the test substance and the photocurrent value in the perfectly matched probe DNA spot. Next, a second calibration curve is created between the concentration of the substance that is not a genetic polymorphism with respect to the test substance and the photocurrent value at the spot carrying the probe substance. By comparing the calibration curve prepared in advance with the measured value, the DNA concentration in the sample can be known. That is, the concentration of the test substance is first determined by comparing the current value in the perfectly matched probe DNA spot obtained by the measurement process with the first calibration curve. Next, a current value corresponding to this concentration is obtained from the second calibration curve, and this current value is compared with the current value in the spot carrying the probe substance obtained in the measurement process. It is assumed that a substance that is not a gene polymorphism with respect to the test substance is not detected when it is outside the predetermined range. Here, “outside the predetermined range” preferably means that the standard deviation of the obtained current value is obtained, for example, out of the range of 3 times (3σ). Therefore, it is possible to determine the gene polymorphism more reliably.

  Furthermore, according to this aspect, in addition to the dye-labeled spot, in the case of a value far from the calibration curve from which the measured value was obtained, it can be known that the following problem may occur. That is, it is considered that defects such as DNA cannot be extracted from the specimen, DNA cannot be amplified, DNA is not single-stranded, and hybridization conditions are not appropriate. In this case, the method according to the present invention may be configured to notify the malfunction as in the case of the dye-labeled spot.

Specific detection method for a test substance The specific detection method for a test substance according to the present invention is the same as the conventionally known or known specific detection method for a test substance, except that the above working electrode is used. It's okay.

  To describe a general method, for example, first, a hybridization reaction solution is supplied into the sensor cell 1. Next, a test substance for hybridization reaction is supplied from the inlet 15 provided in the sensor cell 1 and directly or directly with the test substance provided on the working electrode in the sensor cell 1 adjusted to a set temperature. A hybridization reaction is performed with a probe substance capable of binding specifically and indirectly. Thereafter, a cleaning solution for cleaning unbound material is supplied.

  In this washing, it is necessary to remove only the unbound substance while the test substance bound to the probe substance remains bound. Therefore, it is preferable to add a surfactant to the cleaning solution. However, reaction bubbles on the surface of the working electrode may be generated if bubbles generated with the supply and discharge of the cleaning fluid remain on the probe provided on the working electrode for reaction and detection on the working electrode in the sensor cell. Careful attention must be paid to the generation and remaining of bubbles.

  After cleaning, the cleaning liquid is discharged from the discharge port 16 from the inside of the sensor cell, and then the electrolyte medium is supplied. The sensor cell 1 is irradiated with light from the light source, and the current value associated with photoexcitation is measured. The composition of the electrolyte medium is as described above. After completion of the measurement, the electrolyte medium in the sensor cell 1 is discharged out of the sensor cell.

  According to a preferred aspect of the present invention, the distance between the working electrode and the counter electrode is preferably 0.1 to 3 mm. The volume of the sensor cell is preferably a small amount of the test substance when performing the hybridization reaction, but the amount of the solution is constant in consideration of the diffusion efficiency of the solution with respect to the solid surface to the probe substance provided on the working electrode. This is necessary. According to this configuration, the hybridization reaction can be completed in a short time within the same sensor cell, and photocurrent detection can be reliably performed.

Electrolyte-containing solution The electrolyte-containing solution used in the present invention preferably comprises an electrolyte, at least one solvent selected from an aprotic solvent and a protic solvent, and optionally an additive. The electrolyte is not limited as long as it can move freely in the water-containing substrate and participate in the exchange of electrons between the sensitizing dye, the working electrode, and the counter electrode, and a wide variety of electrolytes can be used. is there. A preferable electrolyte is a substance that can function as a reducing agent (electron donor) for donating an electron to a dye excited by light irradiation. Examples of such a substance include sodium iodide (NaI), iodide Potassium (KI), calcium iodide (CaI ₂ ), lithium iodide (LiI), ammonium iodide (NH ₄ I), tetrapropylammonium iodide (NPr ₄ I), sodium thiosulfate (Na ₂ S ₂ O ₃₎ ), sodium sulfite _(Na 2 _SO 3), _{hydroquinone, K 4 [Fe (CN)} 6] · 3H 2 O, ferrocene-1,1'-dicarboxylic acid, ferrocene carboxylic acid, hydrogen sodium borohydride (NaBH _4), Triethylamine, ammonium thiocyanate, hydrazine (N ₂ H ₄ ), acetaldehyde (CH ₃ CHO ), N, N, N ′, N′-tetramethyl-p-phenylenediamine dihydrochloride (TMPD), L-ascorbic acid, sodium tellurite (Na ₂ TeO ₃ ), iron (II) chloride tetrahydrate (FeCl ₂ .4H ₂ O), EDTA, cysteine, triethanolamine, tripropylamine, iodine-containing lithium iodide (I / LiI), tris (2-chloroethyl) phosphate (TCEP), dithiothreitol (DTT), 2-mercaptoethanol, 2-mercaptoethanol amine, thiourea _{dioxide, (COOH)} 2, HCHO, and include those combinations, more _{preferably, NaI, KI, CaI 2,} LiI, NH 4 I , tetrapropylammonium iodide _(NPr 4 I), sodium thiosulfate _{(Na 2 S 2 O 3)} , and nitrous Sodium acid _(Na 2 _SO 3), and a mixture thereof, more preferably tetrapropylammonium iodide _(NPr 4 I). The solvent is an aprotic solvent, a protic solvent, or a mixture thereof. That is, a polar solvent system in which buffer components are mainly mixed with water and an aprotic polar solvent can be used. Examples of aprotic polar solvents include nitriles such as acetonitrile, carbonates such as propylene carbonate and ethylene carbonate, heterocyclic compounds such as 1,3-dimethylimidazolinone, 3-methyloxazolinone, and dialkylimidazolium salts. Dimethylformamide, dimethyl sulfoxide, sulfolane and the like can be used. A plurality of types of solvents contained in the electrolyte medium can be mixed and used, and in actual use, the solvent composition can be appropriately changed according to the detection target.

In addition, the electrolyte may include a substance that can function as a supporting electrolyte that lowers the solution resistance. Examples of such a substance include sodium chloride (NaCl), potassium chloride (KCl), lithium chloride (LiCl), Chloride salts such as rubidium chloride (RbCl), cesium chloride (ScCl), calcium chloride (CaCl ₂ ), magnesium chloride (MgCl ₂ ), ammonium chloride (NH ₄ Cl), and sodium sulfate (Na ₂ SO ₄ ), sulfuric acid Potassium (K ₂ SO ₄ ), lithium sulfate (Li ₂ SO ₄ ), rubidium sulfate (Rb ₂ SO ₄ ), cesium sulfate (Cs ₂ SO ₄ ), calcium sulfate (CaSO ₄ ), magnesium sulfate (MgSO ₄ ), ammonium sulfate _{((NH 4) 2 SO 4} ) sulfates such and nitric acid sodium, Beam (NaNO _3), potassium nitrate _(KNO 3), lithium nitrate (LiNO _3), rubidium nitrate (RbNO _3), cesium nitrate (ScNO _3), calcium nitrate _{(Ca (NO 3) 2)} , magnesium nitrate (Mg (NO ₃ ) ₂ ), nitrates such as ammonium nitrate (NH ₄ NO ₃ ), and sodium bromide (NaBr), potassium bromide (KBr), lithium bromide (LiBr), rubidium bromide (RbBr), cesium bromide (CsBr) ), Bromide salts such as calcium bromide (CaBr ₂ ), magnesium bromide (MgBr ₂ ), ammonium bromide (NH ₄ Br), and monosodium citrate (NaH ₂ (C ₆ H ₅ O ₇ )), disodium _{(Na 2 H (C 6 H} 5 O 7)), trisodium citrate _(Na 3 _{(C 6 5} O _7)), monopotassium citrate _{(KH 2 (C 6 H 5} O 7)), citric acid dipotassium _{(K 2 H (C 6 H} 5 O 7)), tripotassium citrate _(K 3 (C Citrates such as ₆ H ₅ O ₇ )), and acids / bases such as sulfuric acid (H ₂ SO ₄ ), hydrochloric acid (HCl), sodium hydroxide (NaOH), potassium hydroxide (KOH), and Tris buffer , Phosphate buffer, Good's buffer (ADA, PIPES, POPSO, ACES, MOPSO, BES, MOPS, TES, HEPES, DIPSO, TAPSO, POPSO, HEPPSO, EPPS, Tricine, Bicine and TAPS) A buffer solution or a combination thereof, more preferably sodium chloride (NaCl), potassium chloride (KCl), magnesium chloride. Um (MgCl _2), sodium sulfate _(Na 2 _SO 4), potassium sulfate _(K 2 _SO 4), magnesium sulfate (MgSO _4), sodium nitrate (NaNO _3), potassium nitrate _(KNO 3), magnesium nitrate (Mg (NO ₃ ) ₂ ), sodium bromide (NaBr), potassium bromide (KBr), magnesium bromide (MgBr ₂ ), and mixtures thereof, more preferably sodium chloride (NaCl).

Washing Solution According to a preferred embodiment of the present invention, it is preferred that after the hybridization step, a washing solution is supplied a plurality of times to wash unbound material and the spot is washed. Thereby, it becomes possible to remove the unbound substance and leave only the test substance bound to the probe substance on the spot.

  According to a preferred embodiment of the present invention, a surfactant is preferably added to the cleaning solution, and more preferably 0.001% to 10%. By incorporating the surfactant in an amount of 0.001% or more, the cleaning efficiency can be increased. By setting the surfactant to 10% or less, it is possible to prevent bubbles remaining due to supply and discharge of the cleaning fluid on the probe provided on the working electrode in order to perform reaction and detection on the working electrode in the sensor cell. It is possible to suppress the reaction unevenness on the surface of the working electrode.

  According to a preferred aspect of the present invention, it is preferable to wash the inside of the sensor cell including the counter electrode surface by supplying the cleaning solution a plurality of times even after the photocurrent detection step. Since the inside of the sensor cell can be cleaned after the measurement is completed, the next reaction and detection can be continuously performed only by replacing the working electrode without replacing the counter electrode.

In the present invention, the light source used is not limited as long as it can irradiate light having a wavelength capable of photoexciting the labeling dye. Preferred examples include fluorescent lamps, black lights, sterilizing lamps, incandescent lamps, and low-pressure mercury lamps. , High pressure mercury lamp, xenon lamp, mercury-xenon lamp, halogen lamp, metal halide lamp, LED (white, blue, green, red), laser (CO2 laser, dye laser, semiconductor laser), sunlight can be used, More preferable examples include fluorescent lamps, incandescent lamps, xenon lamps, halogen lamps, metal halide lamps, LEDs (white, blue, green, red), and sunlight. Moreover, you may irradiate only the light of a specific wavelength range using a spectroscope and a band pass filter as needed.

  According to a preferred aspect of the present invention, when two or more kinds of test substances are individually detected using two or more sensitizing dyes that can be excited at different light wavelengths, a specific wavelength is detected from the light source via the wavelength selection means. It is possible to excite a plurality of dyes individually by irradiating the light. Examples of wavelength selection means include a spectroscope, a colored glass filter, an interference filter, a bandpass filter, and the like. In addition, a plurality of light sources capable of irradiating light of different wavelengths depending on the type of sensitizing dye may be used. Examples of preferable light sources in this case include laser light and LED irradiated with light of a specific wavelength. It may be used. Further, in order to efficiently irradiate the working electrode with light, light may be guided using quartz, glass, or a liquid light guide.

Test substance and probe substance The test substance in the present invention is not limited as long as it has a specific binding property, and may be various substances. In such a test substance, the test substance is directly or indirectly attached to the probe substance by supporting on the surface of the working electrode a probe substance that can specifically or directly bind to the test substance. It becomes possible to detect it by specifically binding to.

  That is, in the present invention, substances that can specifically bind to each other can be selected as the test substance and the probe substance. That is, according to a preferred embodiment of the present invention, it is preferable that a substance having specific binding properties be a test substance and a substance that specifically binds to the test substance be carried on the working electrode as a probe substance. As a result, the test substance can be directly bound and detected on the working electrode. Preferable examples of the combination of the test substance and the probe substance in this embodiment include a single-stranded nucleic acid and a combination of single-stranded nucleic acids having complementarity to the nucleic acid, and a combination of antigen and antibody.

  According to a more preferred embodiment of the present invention, it is preferable that the test substance is a single-stranded nucleic acid and the probe substance is a single-stranded nucleic acid having complementarity to the nucleic acid.

  When a single-stranded nucleic acid is used as a test substance, it only needs to have a portion complementary to the nucleic acid that is the probe substance, and the length of the base pairs constituting the test substance is not limited. It preferably has a complementary portion of 10 bp or more. According to the method of the present invention, even when a nucleic acid having a base length of 200 bp, 500 bp, and 1000 bp is relatively long, a specific binding formation between the nucleic acid of the probe substance and the test substance can be performed with high sensitivity. Can be detected as

  Sample liquids containing single-stranded nucleic acids as test substances are blood such as peripheral venous blood, white blood cells, serum, urine, feces, semen, saliva, cultured cells, tissue cells such as various organ cells, etc. Nucleic acids can be extracted from various specimen samples containing nucleic acids by a known method. At this time, destruction of the cells in the specimen sample can be performed, for example, by applying a physical action such as shaking or ultrasonic waves from the outside and vibrating the carrier. In addition, nucleic acid can be released from cells using a nucleic acid extraction solution. Examples of the nucleic acid elution solution include a solution containing a surfactant such as SDS, Triton-X, Tween-20, saponin, EDTA, protease, and the like. When nucleic acids are eluted using these solutions, the reaction can be accelerated by incubating at a temperature of 37 ° C. or higher.

  According to a more preferred embodiment of the present invention, when the content of a gene as a test substance is very small, detection is preferably performed after the gene is amplified by a known method. A typical method for amplifying a gene would be a method using an enzyme such as polymerase chain reaction (PCR). Examples of enzymes used in the gene amplification method include DNA polymerases, DNA-dependent DNA polymerases such as Taq polymerase, and DNA-dependent RNA polymerases such as RNA polymerase I. And RNA-dependent RNA polymerases such as Qβ replicase, and the PCR method using Taq polymerase is preferred in that amplification can be repeated continuously only by adjusting the temperature.

  According to a preferred embodiment of the present invention, the nucleic acid can be specifically labeled with a sensitizing dye during the amplification. In general, a test substance labeled with a sensitizing dye is obtained by gene amplification using a PCR primer labeled with a sensitizing dye at the 5 'end. In addition, a nucleic acid can be labeled with a sensitizing dye by incorporating dUTP labeled with a sensitizing dye or aminoallyl-modified dUTP. When aminoallyl-modified dUTP is incorporated, the sensitizing dye activated by N-hydroxysuccinimide reacts specifically with the modified dUTP in the next coupling step, and is uniformly sensitized dye. A labeled test substance is obtained.

  According to a preferred embodiment of the present invention, the nucleic acid crude extract solution or purified nucleic acid solution obtained as described above is first subjected to heat denaturation at a temperature of 90 to 98 ° C., preferably 95 ° C. or higher, to obtain a single strand. Nucleic acids can be prepared. Moreover, alkali denaturation can be performed to prepare single-stranded nucleic acids.

  In the present invention, the test substance and the probe substance may indirectly bind specifically. That is, according to another preferred embodiment of the present invention, a substance having specific binding properties is used as a test substance, a substance that specifically binds to the test substance is used as a mediator, and It is preferable to carry a substance capable of binding to the working electrode as a probe substance. Thereby, even a substance that cannot specifically bind to the probe substance can be detected by specifically binding indirectly to the working electrode via the mediator substance. In this embodiment, preferred examples of the combination of the test substance, the mediator, and the probe substance include a ligand, a receptor protein molecule that can accept the ligand, and two molecules that can specifically bind to the receptor protein molecule. A combination of nucleic acids in a strand is mentioned. Preferable examples of the ligand include exogenous endocrine disrupting substances (environmental hormones). An exogenous endocrine disrupting substance is a substance that binds to DNA via a receptor protein molecule and produces toxicity by affecting its gene expression. According to the method of the present invention, the receptor produced by a test substance is used. It is possible to easily monitor the binding of a protein such as a body to DNA.

  According to the present invention, a target substance can be obtained by simultaneously reacting a single probe substance with a plurality of identical test substances derived from different acquisition routes and determining the difference in the amount of the test substance depending on the origin of the sample. It is also possible to quantify the test substance derived from the route. Specific application examples include expression profile analysis by competitive hybridization on a microarray. In this method, in order to analyze the difference in expression pattern of a specific gene among cells, a test substance labeled with different fluorescent dyes is competitively hybridized with the same probe substance. In the present invention, by using such a technique, an advantage that has not been obtained in the past can be obtained, in which an expression difference analysis between cells can be performed electrochemically.

Sensitizing dye In the present invention, in order to detect the presence of a test substance with a photocurrent, the test substance is directly or indirectly specific to the probe substance in the presence of the sensitizing dye. The sensitizing dye is fixed to the working electrode by the binding. Therefore, in the present invention, the test substance or mediator can be labeled with a sensitizing dye in advance. In addition, when using a sensitizing dye that can be intercalated in a conjugate of a test substance and a probe substance (for example, a double-stranded nucleic acid after hybridization), a probe can be obtained by adding a sensitizing dye to the sample solution. A sensitizing dye can be fixed to the substance.

  According to a preferred embodiment of the present invention, when the test substance is a single-stranded nucleic acid, it is preferable to label one sensitizing dye per molecule of the test substance. The labeling position in the single-stranded nucleic acid is either the 5 ′ end or the 3 ′ end of the single-stranded nucleic acid from the viewpoint of easily forming a specific bond between the test substance and the probe substance. From the viewpoint of further simplifying the labeling step, the 5 ′ end of the test substance is more preferable.

  According to another preferred embodiment of the present invention, it is preferable to label two or more sensitizing dyes per molecule of the test substance in order to increase the carrying amount of the sensitizing dye per molecule of the test substance. As a result, the amount of dye supported per unit specific surface area of the working electrode on which the electron accepting material is formed can be increased, and the photocurrent response can be observed with higher sensitivity.

  The sensitizing dye used in the present invention is a substance that can emit electrons to the working electrode in response to photoexcitation, can be changed to the photoexcited state by irradiation with a light source, and can be injected into the working electrode from the excited state. Anything that can take a state may be used. Therefore, any sensitizing dye can be used as long as it can take the above-described electronic state with the working electrode, particularly the electron accepting layer. Therefore, various sensitizing dyes can be used, and expensive dyes can be used. There is no need to use it.

  In the embodiment in which individual detection of a plurality of test substances is performed, the sensitizing dye that labels each test substance may be any one that can be excited by different wavelengths of light. It is only necessary that each test substance can be excited individually by selecting. For example, when a plurality of sensitizing dyes corresponding to a plurality of test substances are used and light having different excitation wavelengths is irradiated for each sensitizing dye, signals are detected individually even if the plurality of probes are on the same spot. It becomes possible. In the present invention, the number of test substances is not limited, but considering the wavelength of light emitted from the light source and the absorption characteristics of the sensitizing dye, 1 to 5 types may be appropriate. The sensitizing dye that can be used in this embodiment only needs to be photoexcited in the wavelength region of the irradiation light, and the absorption maximum is not necessarily in the wavelength region. In addition, the presence or absence of the light absorption reaction of the sensitizing dye at a specific wavelength can be measured using an ultraviolet-visible spectrophotometer (for example, UV-3150 manufactured by Shimadzu Corporation).

Specific examples of the sensitizing dye include metal complexes and organic dyes. Preferred examples of the metal complex include metal phthalocyanines such as copper phthalocyanine and titanyl phthalocyanine; chlorophyll or derivatives thereof; hemin, JP-A-1-220380 and JP-A-5-504023.
And a complex of ruthenium, osmium, iron and zinc (for example, cis-dicyanate-bis (2,2′-bipyridyl-4,4′-dicarboxylate) ruthenium (II)) and europium complexes described in the above publication. Preferred examples of organic dyes include metal-free phthalocyanine, 9-phenylxanthene dyes, cyanine dyes, metalocyanine dyes, carbocyanine dyes, xanthene dyes, triphenylmethane dyes, acridine dyes, and oxazine dyes. , Coumarin dyes, merocyanine dyes, rhodacyanine dyes, polymethine dyes, indigo dyes, and the like. As another preferred example of the sensitizing dye, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Cy7.5, Cy9 manufactured by GE Healthcare Life Sciences; AlexaFluor 355, AlexaFluor 405 manufactured by Molecular Probes, Inc. , AlexaFluor430, AlexaFluor488, AlexaFluor532, AlexaFluor546, AlexaFluor555, AlexaFluor568, AlexaFluor594, AlexaFluor633, AlexaFluor647, AlexaFluor660, AlexaFluor680, AlexaFluor700, AlexaFluor750; Dyomics manufactured by DY-610, DY-615, DY-630, DY-631, Y-633, DY-635, DY-636, EVOblue10, EVOblue30, DY-647, DY-650, DY-651, DYQ-660, DYQ-661 and the like.

  Preferable examples of the sensitizing dye capable of intercalating with a double-stranded nucleic acid include acridine orange and ethidium bromide. When such a sensitizing dye is used, a double-stranded nucleic acid labeled with a sensitizing dye is formed simply by adding to the sample solution after hybridization of the nucleic acid. Therefore, it is necessary to label the single-stranded nucleic acid in advance. No.

Working electrode and production thereof The working electrode used in the present invention is an electrode having the probe substance on its surface, and the sensitizing dye immobilized via the probe substance emits electrons emitted in response to photoexcitation. It is an acceptable electrode. Accordingly, the configuration and material of the working electrode are not limited as long as the above-described electron transfer occurs with the sensitizing dye to be used, and may be various configurations and materials.

  According to a preferred embodiment of the present invention, the working electrode has an electron accepting layer containing an electron accepting material capable of accepting electrons emitted by the sensitizing dye in response to photoexcitation, and a probe material is provided on the surface of the electron accepting layer. Is preferably provided. According to a more preferred aspect of the present invention, it is preferable that the working electrode further comprises a conductive substrate, and an electron accepting layer is formed on the conductive substrate.

  In the present invention, the electron-accepting layer comprises an electron-accepting material that can accept electrons emitted by the sensitizing dye fixed via the probe material in response to photoexcitation. That is, the electron-accepting substance can be a substance that can take an energy level in which electrons can be injected from the photoexcited labeling dye. Here, the energy level (A) in which electrons can be injected from the photoexcited labeling dye means, for example, a conduction band (conduction band: CB) when a semiconductor is used as the electron-accepting material. . That is, in the electron acceptor used in the present invention, this A level is lower than the LUMO energy level of the sensitizing dye, in other words, lower than the LUMO energy level of the sensitizing dye. Any material having an energy level may be used.

According to a preferred embodiment of the present invention, the electron accepting material is titanium oxide, zinc oxide, tin oxide, niobium oxide, strontium titanate, indium oxide, indium-tin composite oxide (ITO), fluorine-doped tin oxide. It is preferably at least one selected from the group consisting of (FTO). Most preferably, TiO ₂ , indium-tin composite oxide (ITO) or fluorine-doped tin oxide (FTO) can be used. Since ITO and FTO have the property of functioning not only as an electron-accepting layer but also as a conductive substrate, by using these materials, only the electron-accepting layer can function as a working electrode without using a conductive substrate. Can do.

  When a semiconductor is used as the electron-accepting substance, the semiconductor may be either single crystal or polycrystalline, but a polycrystalline body is preferable, and a porous body is more preferable than a dense body. As a result, the specific surface area is increased, and a large amount of the test substance and sensitizing dye can be adsorbed to detect the test substance with higher sensitivity. Therefore, according to the preferable aspect of this invention, it is preferable that the electron-accepting layer has porosity, and the diameter of each hole is 3-1000 nm, More preferably, it is 10-100 nm.

  According to a preferred aspect of the present invention, the surface area in a state where the electron-accepting layer is formed on the conductive substrate is preferably 10 times or more, more preferably 100 times or more with respect to the projected area. . The upper limit of the surface area is not particularly limited, but will usually be about 1000 times. The particle diameter of the fine particles of the electron accepting material constituting the electron accepting layer is preferably 5 to 200 nm as a primary particle in terms of an average particle diameter using a diameter when the projected area is converted into a circle, and more preferably 8 to It is 100 nm, More preferably, it is 20-60 nm. The average particle diameter of the electron-accepting substance fine particles (secondary particles) in the dispersion is preferably 0.01 to 100 μm. Further, for the purpose of improving the light capture rate by scattering incident light, an electron-accepting layer may be formed using a combination of fine particles of an electron-accepting material having a large particle size, for example, about 300 nm.

  With the concavo-convex structure, the detection sensitivity can be increased by increasing the surface area of the electron-accepting layer and immobilizing many probe molecules. Since the size of the biomolecule is about 0.1 to 20 nm, the pore diameter formed by the concavo-convex structure is preferably 20 nm or more and 150 nm or less. If the entrance of the space generated by the concavo-convex structure is less than that, the specific surface area increases, but the biomolecule cannot be bonded to the probe, and the detection signal decreases. If the irregularities are rough, the surface area will not increase so much and the signal intensity will not increase that much. A more preferable range suitable for sensing biomolecules is 50 nm or more and 150 nm or less.

  According to a preferred aspect of the present invention, it is preferable to employ a pillar structure in which nanoscale pillars (pillars) are regularly arranged on the surface as the convex structure. Various production methods are known, but a method using anodized alumina having nanometer-scale pores as a template is common. There are a method of removing the alumina mold by etching after filling the mold with a ceramic sol and heat treatment, and a method of performing a heat treatment after releasing the filled ceramic sol from the mold. Examples of a method for producing a pillar-shaped nanostructure include a method for producing a nanostructure on a transparent substrate and a transparent conductive layer described in JP-A-2004-130171. Here, a method is used in which a mold of anodized alumina is filled with titania sol, heat-treated at 300 to 400 ° C., and then removed by etching. As a result, titania nanotubes and nanowires are formed as nanostructures.

According to a preferred embodiment of the present invention, it is preferable to employ pores generated as a concave structure by firing an inorganic-organic hybrid precursor containing a ceramic component to form a gas phase by oxidative decomposition of organic matter. The inorganic-organic hybrid precursor is a compound in which an organic polymer, a metal-oxygen network structure produced by oxidation of an organometallic compound (metal alkoxide) and subsequent polycondensation reaction coexist. In addition, there is a method of adding an organic polymer or the like to commercially available titanium oxide particles (for example, anatase type crystals manufactured by Teika Co., Ltd., trade name AMT-600 (average particle size 30 nm), etc.) or a titanium oxide dispersion. Various proposals have been made for these compositions. For example, JP-A-10-212120 discloses a glyme solvent (HO — (— CH ₂ CH ₂ O—) n—R, n is 1 to 10, and R is alkyl. A composition in which titanium oxide particles are dispersed in a group or an aryl group and an organic polymer is added as a dispersion aid has been proposed. A dispersion having this composition is applied onto a support by an appropriate method (dip coating method, spray coating method, spinner coating method, blade coating method, roller coating method, wiper bar coating method, reverse roll coating method), and 200 to When fired at 800 ° C., a specific surface area of 40 to 50 cm 2 per 1 cm 2 (thickness 1 μm) is achieved. Japanese Patent Laid-Open No. 2001-233615 discloses that a sol solution composed of tetraalkoxytitanium and ethylene oxide, propylene oxide, ethylene oxide block copolymer, stabilizer and solvent is dropped on the substrate, and the substrate is rotated at high speed. An organic-inorganic composite titania thin film having a three-dimensional structure obtained by evaporating and gelling the solvent is sintered at a high temperature to remove the block copolymer, thereby achieving a fine three-dimensional concave structure. Furthermore, a method using oligosaccharide (trehalose) as an organic polymer is also disclosed (Japanese Patent Laid-Open No. 2004-83376), and a ceramic porous membrane having a porosity of 38 to 56% is obtained.

  As described above, various methods for controlling a fine concavo-convex structure of ceramic have been proposed, and an electrode material having a large specific surface area can be created by applying to a ceramic electrode material suitable for the present invention.

  According to a preferred embodiment of the present invention, it is preferred that the working electrode further comprises a conductive substrate, and the electron accepting layer is formed on the conductive substrate. The conductive base material usable in the present invention is not only a material having conductivity on the support itself, such as a metal such as titanium, but also a material having a conductive material layer on the surface of a glass or plastic support. It's okay. When a conductive substrate having this conductive material layer is used, the electron accepting layer is formed on the conductive material layer. Examples of the conductive material constituting the conductive material layer include metals such as platinum, gold, silver, copper, aluminum, rhodium, and indium; conductive ceramics such as carbon, carbide, and nitride; and indium-tin composite oxides, Examples include conductive metal oxides such as tin oxide doped with fluorine, tin oxide doped with antimony, zinc oxide doped with gallium, or zinc oxide doped with aluminum. Are indium-tin composite oxide (ITO) and metal oxide (FTO) in which tin oxide is doped with fluorine. However, as described above, when the electron-accepting layer itself also functions as a conductive substrate, the conductive substrate can be omitted. Further, in the present invention, the conductive substrate is not limited as long as it is a material that can ensure conductivity, and includes a thin film-like or spot-like conductive material layer that does not have strength as a support by itself. To do.

According to a preferred embodiment of the present invention, the conductive substrate is substantially transparent, specifically, the light transmittance is preferably 10% or more, more preferably 50% or more, and still more preferably. 70% or more. As a result, the cell is configured such that light is irradiated from the back side of the working electrode (that is, the conductive substrate), and the light transmitted through the working electrode (that is, the conductive substrate and the electron accepting layer) excites the sensitizing dye. can do. Moreover, according to the preferable aspect of this invention, it is preferable that the thickness of a electrically-conductive material layer is about 0.02-10 micrometers. Furthermore, according to the preferable aspect of this invention, it is preferable that the surface resistance of an electroconductive base material is 100 ohms / cm < ² > or less, More preferably, it is 40 ohms / cm < ² > or less. The lower limit of the surface resistance of the conductive substrate is not particularly limited, but will usually be about 0.1 Ω / cm ² .

  Examples of a preferable method for forming an electron-accepting layer on a conductive substrate include a method of coating a dispersion or colloidal solution of an electron-accepting material on a conductive support, and a precursor of semiconductor fine particles on the conductive support. And a method of obtaining a fine particle film by being hydrolyzed with moisture in the air (sol-gel method), a sputtering method, a CVD method, a PVD method, and a vapor deposition method. As a method for preparing a dispersion of semiconductor fine particles as an electron acceptor, in addition to the sol-gel method described above, a method of grinding with a mortar, a method of dispersing while grinding using a mill, or a semiconductor synthesis Examples thereof include a method in which it is precipitated as fine particles in a solvent and used as it is. Examples of the dispersion medium include water or various organic solvents (for example, methanol, ethanol, isopropyl alcohol, dichloromethane, acetone, acetonitrile, ethyl acetate, etc.). At the time of dispersion, a polymer, a surfactant, an acid, a chelating agent, or the like may be used as a dispersion aid as necessary.

  Preferred examples of the application method of the electron acceptor dispersion or colloidal solution include the roller method as the application system, the dip method, the air knife method as the metering system, the blade method, etc., and the application and metering in the same part. The wire bar method disclosed in Japanese Patent Publication No. 58-4589, the slide hopper method, the extrusion method, the curtain method, the spin method, and the spray method described in US Pat. Nos. 2,681,294, 2,761,419, 2,761791, etc. Is mentioned.

  According to a preferred aspect of the present invention, when the electron accepting layer is composed of semiconductor fine particles, the thickness of the electron accepting layer is preferably 0.1 to 200 μm, more preferably 0.1 to 100 μm, and still more preferably. Is 1-30 μm, most preferably 2-25 μm. As a result, the probe substance per unit projected area and the amount of sensitizing dye to be fixed can be increased to increase the photoelectric flow rate, and the loss of generated electrons due to charge recombination can also be reduced. Moreover, it is preferable that the application quantity of the semiconductor fine particle per 1 m <2> of electroconductive base materials is 0.5-400g, More preferably, it is 5-100g.

  According to a preferred embodiment of the present invention, when the electron-accepting material comprises indium-tin composite oxide (ITO) or metal oxide (FTO) doped with fluorine in tin oxide, the thickness of the electron-accepting layer is 1 nm. It is preferable that it is above, More preferably, it is 10 nm-1 micrometer.

  According to a preferred embodiment of the present invention, it is preferable to apply heat treatment after coating the semiconductor fine particles on the conductive substrate. Thereby, particle | grains can be made to contact electrically and the improvement of coating-film intensity | strength and adhesiveness with a support body can be improved. A preferable heat treatment temperature is 40 to 700 ° C, more preferably 100 to 600 ° C. Moreover, preferable heat processing time is about 10 minutes-10 hours.

  According to another preferred embodiment of the present invention, when a conductive base material having a low melting point or softening point such as a polymer film is used, the film is formed by a method that does not use high-temperature treatment in order to prevent deterioration due to heat. Preferably, the film is formed, and examples of such a film forming method include a method such as pressing, low-temperature heating, electron beam irradiation, microwave irradiation, electrophoresis, sputtering, CVD, PVD, and vapor deposition.

  A probe substance is supported on the surface of the electron accepting layer of the working electrode thus obtained. Loading of the probe substance on the working electrode can be performed according to a known method. According to a preferred aspect of the present invention, when a single-stranded nucleic acid is used as the probe substance, an oxidized layer is formed on the surface of the working electrode, and the nucleic acid probe and the working electrode are bonded via the oxidized layer. Can be done. At this time, the nucleic acid probe can be immobilized on the working electrode by introducing a functional group at the end of the nucleic acid. Thereby, the nucleic acid probe into which the functional group has been introduced can be immobilized on the carrier as it is by an immobilization reaction. Introduction of a functional group at the end of a nucleic acid can be performed using an enzymatic reaction or a DNA synthesizer. Examples of the enzyme used in the enzymatic reaction include terminal deoxynucleotidyl transferase, poly A polymerase, polynucleotide kinase, DNA polymerase, polynucleotide adenyl transferase, RNA ligase. Can be mentioned. Moreover, a functional group can also be introduce | transduced by a polymerase chain reaction (PCR method), a nick translation, and a random primer method. The functional group may be introduced at any part of the nucleic acid, and can be introduced at the 3 ′ end, 5 ′ end or at a random position.

  According to a preferred embodiment of the present invention, amine, carboxylic acid, sulfonic acid, thiol, hydroxyl group, phosphoric acid and the like can be suitably used as the functional group for immobilizing the nucleic acid probe to the working electrode. According to a preferred embodiment of the present invention, a material that crosslinks between the working electrode and the nucleic acid probe can be used in order to firmly fix the nucleic acid probe to the working electrode. Preferable examples of such a crosslinking material include silane coupling agents, titanate coupling agents, and conductive polymers such as polythiophene, polyacetylene, polypyrrole, and polyaniline.

  According to a preferred embodiment of the present invention, the nucleic acid probe can be immobilized efficiently by a simple operation called physical adsorption. The physical adsorption of the nucleic acid probe to the electrode surface can be performed, for example, as follows. First, the electrode surface is cleaned with distilled water and alcohol using an ultrasonic cleaner. Thereafter, the electrode is inserted into a buffer containing the nucleic acid probe to adsorb the nucleic acid probe onto the surface of the carrier.

  Moreover, nonspecific adsorption | suction can be suppressed by adding a blocking agent after adsorption | suction of a nucleic acid probe. The blocking agent that can be used is not limited as long as it can fill a site on the surface of the electron accepting layer on which the nucleic acid probe is not adsorbed and can adsorb the electron accepting material by chemical adsorption or physical adsorption. However, it is preferably a substance having a functional group that can be adsorbed via a chemical bond. For example, preferable examples of the blocking agent in the case of using titanium oxide as an electron-accepting layer include functional groups that can be adsorbed to titanium oxide such as carboxylic acid group, phosphoric acid group, sulfonic acid group, hydroxyl group, amino group, pyridyl group, and amide. Examples thereof include substances having a group.

  According to a preferred aspect of the present invention, it is preferable that the probe substance is divided and supported on each of the plurality of regions separated from each other on the working electrode, and the light irradiation by the light source is performed individually on each region. . Thereby, since a plurality of samples can be measured on one working electrode, integration of DNA chips and the like are possible. According to a more preferable aspect of the present invention, a plurality of regions separated from each other, on which a probe substance is supported on the working electrode, is patterned, and a sample in each region is scanned while scanning with light emitted from a light source. It is preferable that the detection or quantification of the test substance is continuously performed in one operation.

  According to a more preferred aspect of the present invention, a plurality of types of probe substances can be carried on each of a plurality of regions separated from each other on the working electrode. As a result, a large number of samples can be simultaneously measured by multiplying the number of regions by the number of types of probe substances for each region.

  According to a more preferable aspect of the present invention, a different probe substance can be carried in each of a plurality of regions separated from each other on the working electrode. As a result, the number of types of probe substances corresponding to the number of the divided areas can be carried, so that multiple types of analytes can be measured simultaneously.

Counter electrode The counter electrode used in the present invention is not particularly limited as long as a current can flow between it and the working electrode when it is brought into contact with the electrolyte medium. Glass, plastic, ceramics, A substrate made of SUS or the like on which a metal or conductive oxide is deposited can be used. Moreover, the metal thin film as a counter electrode can be formed by a method such as vapor deposition or sputtering so as to have a film thickness of 5 μm or less, preferably 3 nm to 3 μm. Preferable examples of materials that can be used for the counter electrode include conductive polymers such as platinum, gold, palladium, nickel, carbon, and polythiophene, and conductive ceramics such as oxide, carbide, and nitride, and more preferably. Platinum and carbon, and most preferably platinum. These materials can be formed into a thin film by the same method as the electron accepting layer.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

DNA used
Single nucleotide polymorphisms were detected using the apparatus, working electrode, and detection method according to the present invention. Each base sequence was as follows.
Probe DNA (detection site): 5'-TGTAGGAGCTGCTGGTGCA-3 '(SEQ ID NO: 1)
Probe DNA (control probe): 5'-GCTTCATCTGGACCTGGGT-3 '(SEQ ID NO: 2)
A perfect match target DNA and a single base difference target DNA to be hybridized with the probe DNA were amplified by PCR. Primers and template DNA used for amplification of target DNA by PCR were as follows.
Primers for perfect match and single base amplification:
Forward Primer: 5′-Cy5-GATATTGAACAATGGTTCACTGAAGAC-3 ′ SEQ ID NO: 3)
Reverse Primer: 5′-GCCCCTCAGGGCAACTGAC-3 ′ (SEQ ID NO: 4)
In order to amplify using a Forward Primer having a Cy5 label on the 5 ′ end side, one molecule of Cy5 dye is labeled per target DNA molecule.
Perfectly matched target DNA:
PM-DNA:
5'-GATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGC A GCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCGCCATCGAGGTGTTTCCGTCTCCTTC
Single base difference target DNA:
SNP-DNA:
5'-GATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGC T GCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCGCCATCGATGTGTTTCCGTCTCCTTC
Here, the underlined base indicates a single base difference between PM and SNP.
The sequence of the dye-labeled DNA with the sensitizing dye immobilized as the dye-labeled spot was as follows.
Dye-labeled DNA: 5'-TGAGCAAGTTCAGCCTGGT-3 '(SEQ ID NO: 7)

Example 1. Grasping the relationship between the current value obtained from the control probe-immobilized spot and the target DNA concentration Using the control probe-immobilized working electrode and the target DNA whose concentration was measured in advance (using the exact match target DNA), the target DNA concentration And the relationship between the current value obtained from the control probe-fixed spot was clarified.

Fluorine-doped tin oxide (F-SnO ₂ : FTO) coated glass (manufactured by AGC Fabrytec Co., Ltd., U film, sheet resistance: 12Ω / □, shape: 75 mm × 25 mm) as a glass substrate for the working electrode Prepared. This glass substrate was subjected to ultrasonic cleaning in acetone for 15 minutes and then in ultrapure water for 15 minutes to remove dirt and residual organic matter. The glass substrate was shaken in a 0.5 M aqueous sodium hydroxide solution for 15 minutes. Then, for removal of sodium hydroxide, shaking washing for 5 minutes in ultrapure water was performed three times with the water changed. After the glass substrate was taken out and air was blown to scatter the remaining water, the glass substrate was immersed in anhydrous methanol for dehydration. Using 95% methanol 5% ultrapure water as a solvent, add 3-aminopropyltrimethoxysilane (APTMS) to 0.2 vol%, and stir at room temperature for 5 minutes to obtain a solution for coupling treatment Was prepared. The glass substrate was dipped in this coupling treatment solution and slowly shaken for 15 minutes.

  Subsequently, the glass substrate was taken out and shaken in methanol for 3 minutes was performed three times by replacing methanol, and an operation for removing excess coupling treatment solution was performed. Thereafter, the glass substrate was held at 110 ° C. for 30 minutes to bond the coupling agent to the glass substrate. After cooling the glass substrate at room temperature, the above control probe DNA and dye-labeled DNA are each prepared to 10 μM, held at 95 ° C. for 10 minutes, then immediately transferred to ice and held for 10 minutes to denature the DNA. It was. Each of the denatured DNAs was spotted with a microarrayer (LT-BA manufactured by Philgen Co., Ltd., spot pin diameter = 1.5 mm) so that the center distance between spots was 5 mm. Thereafter, the mixture was kept at 95 ° C. for 3 minutes to evaporate the solvent, and irradiated with 120 mJ ultraviolet light using a UV crosslinker (UVP CL-1000 type) to immobilize the probe DNA and the dye-labeled DNA on the glass substrate. . The dye-labeled DNA was immobilized at the positions of spots 30-1 and 30-2 as shown in FIG. Then, shaking washing for 5 minutes in a 0.2% SDS solution was repeated 3 times, and shaking washing for 5 minutes in ultrapure water was further repeated 3 times. The glass substrate was immersed in boiling water for 2 minutes and taken out, and then air was blown to scatter the remaining water. Subsequently, the glass substrate was immersed in absolute ethanol at 4 ° C. for 1 minute for dehydration, and air was blown to disperse residual ethanol. Thus, a probe DNA and a dye-labeled DNA immobilization working electrode were obtained.

The probe DNA-immobilized electrode was used as a working electrode and installed in the apparatus shown in FIG. 1 to constitute a sensor cell 1 shown in FIG. Further, in the configuration shown in FIG. 3, an O-ring 21 is installed in the counter electrode recess 22 so that the distance between the working electrode 11 and the counter electrode 12 is 0.1 mm. The O-ring also has a function for preventing a short circuit due to contact between the working electrode and the counter electrode. The fluid inlet 15 and outlet 16 of the sensor cell are provided at both ends of the O-ring so that air and solution can be easily replaced in the sensor cell. As the counter electrode, a platinum electrode formed by sputtering a platinum thin film on a stainless steel (SUS316) surface was used. Further, the holding member 20 is provided with an opening 19 for irradiating the detection spot with light. A probe-immobilized electrode serving as a counter electrode and a working electrode is disposed to face each other via the O-ring, and a counter cell, a sensor cell including the O-ring and the working electrode are configured. The sensor cell has a flow cell structure having a flow path formed by the inside of the O-ring and both electrodes. In addition, a fluid supply port and a fluid discharge port provided in the counter electrode connected to the flow path are formed. A piping tube connected to a pump for supplying fluid into the sensor cell is connected to the fluid supply port, and a piping tube for discharging the fluid supplied into the sensor cell is connected to the fluid discharge port. Yes. Since the area in the sensor cell used this time is about 1032 mm ² , the capacity in the sensor cell is about 103.2 mm ³ .

Next, 100 μL of perfectly matched target DNA solution adjusted to 50 nM, 100 nM, and 200 nM and 100 μL of 0.2 M NaOH alkaline denaturing solution containing 2 mM EDTA were mixed and held at room temperature for 5 minutes, and double-stranded DNA was Single-stranded DNA was obtained by alkali denaturation. To these solutions, 700 μL of 5 × SSC / 0.1% SDS solution, which is a temperature-adjusted hybridization solution at the hybridization set temperature, and 100 μL of 0.2 M HCl neutralizing solution for neutralizing the alkaline solution are added. And mixed. 1 mL of the mixed solution was fed into the sensor cell, and the temperature in the sensor cell was maintained at 45 ° C. for 10 minutes to allow hybridization with the probe DNA immobilized on the working electrode. At this time, before sending the hybridization solution into the sensor cell, the temperature inside the sensor cell was maintained at the hybridization set temperature using a ceramic heater, a temperature controller, and a resistance temperature detector. After 10 minutes, the hybridization solution was completely discharged from the sensor cell by supplying air using a pump. Next, 0.5 × SSC / solution was fed into a 1500 μL sensor cell in order to wash away excess target DNA and the like that were not subjected to hybridization. Thereafter, the electrolyte-containing solution was fed into the sensor cell to fill the sensor cell, and photocurrent was detected. Note that 0.4 M tetrapropylammonium iodide (NPr ₄ I) / acetonitrile was used for the electrolyte-containing solution.

  A light source (wavelength: 658 nm, light diameter: about 0.2 mm, output 40 mW) attached to an XY stage provided in parallel with the holding member of the sensor cell 1 is sequentially irradiated to the probe DNA-immobilized spot on the working electrode for 5 seconds at a time. In addition, the current value observed between the openings (that is, the current value in the state where light is blocked and is not irradiated on the working electrode) is used as the base current value, and the photocurrent value derived from each spot and the immediately preceding value The difference from the base current value was recorded as the photocurrent value of each spot as the observed value.

  At this time, it is confirmed that the difference between the photocurrent value derived from the dye-labeled spots 30-1 and 30-2 and the immediately preceding base current value is within a predetermined range, and the mounting position of the sensor cell 1 is normal. It was confirmed that there was no abnormality in the measuring device.

The results (N = 4) of summarizing the difference between the photocurrent value for each concentration of target DNA and the base current value just before that were as shown in FIG. The photocurrent value and the base current value derived from each spot were calculated using the average of five points at each center as values. Looking at the obtained current value, it was confirmed that the current value of the control probe-immobilized spot satisfies the following expression with respect to the target DNA concentration under the present conditions.
(Current value of control probe immobilization spot) = 0.3364 x (target DNA concentration) + 83.65

Example 2: Understanding the relationship between the current value obtained from the probe DNA-immobilized spot containing the detection site and the target DNA concentration Using the probe DNA-immobilized working electrode containing the detection site and the completely matched target DNA whose concentration was measured in advance Thus, the relationship between the completely matched target DNA concentration and the current value obtained from the probe DNA-immobilized spot including the detection site was clarified.

  Using the same treatment as in Example 1, 4 spots of probe DNA containing a detection site on the working electrode side were immobilized, and using the same device and detection method as in Example 1, the current value when using perfectly matched target DNA was obtained. did.

  As in Example 1, it is confirmed that the difference between the photocurrent value derived from the dye-labeled spots 30-1 and 30-2 and the base current value immediately before the same is within a predetermined range, and the mounting position of the sensor cell 1 Was confirmed to be normal and the measurement device was normal.

FIG. 8 shows the result (N = 4) of the difference between the spot-derived photocurrent value and the base current value just before that for the target DNA. Looking at the obtained current value, it was confirmed that the current value obtained from the probe DNA-immobilized spot including the detection site satisfies the following formula with respect to the completely matched target DNA concentration under the present conditions. .
(Current value obtained from the probe DNA immobilization spot including the detection site) = 61.459ln (perfect match target DNA concentration)-140.29

The following approximate curve created based on the value obtained by subtracting (standard deviation x 3) from the current value obtained this time was defined as the boundary line of perfect match and single base difference.
(Boundary line between exact match and single base difference) =
52.37ln (perfect match target DNA concentration)-129.34
Using the above results, if the target DNA concentration can be calculated (calculated from the current value obtained from the control probe DNA-immobilized spot as described above), it can be detected from the current value obtained from the probe DNA-immobilized spot including the detection site. It is possible to determine whether the target DNA is completely identical or different by one base.

Example 3: Determination of single nucleotide polymorphism The target DNA concentration was calculated from the current value obtained from the control probe-immobilized spot, and the current value obtained from the probe DNA-immobilized spot including the detection site was used. It was confirmed whether the target DNA was correctly matched to the probe DNA or was correctly identified.

  In the same experiment as in Example 1, the control probe-immobilized DNA and the probe DNA including the detection site were immobilized on each of the four spots on the working electrode side. A current value was obtained when using a completely identical target DNA adjusted to 75 nM and a target DNA with a single base difference.

  As in Example 1, it is confirmed that the difference between the photocurrent value derived from the dye-labeled spots 30-1 and 30-2 and the base current value immediately before the same is within a predetermined range, and the mounting position of the sensor cell 1 Was confirmed to be normal and the measurement device was normal.

  The results (N = 4) of the differences between the spot-derived photocurrent value and the base current value just before that for each target DNA were as shown in FIG. Looking at the current values obtained, the current values of the control probe-immobilized spots are 110.2 nA and 108.3 nA, respectively, which are completely identical target DNA and single-base target DNA. The DNA concentrations were calculated as 78.9 nM and 73.3 nM, respectively. When the target DNA concentrations 78.9 nM and 73.3 nM are applied to the formulas representing the boundary lines of the exact match target DNA and the single base difference target DNA defined in Example 2, they are 99.4 nA and 95.6 nA, respectively. The current values obtained from the probe DNA-immobilized spots including the detection sites at 130.2 nA and 62.8 nA, respectively, were able to be correctly determined for both the perfectly matched target DNA and the single-stranded target DNA.

Claims (15)

A test electrode to which a test substance to which a sensitizing dye is bound is immobilized via a probe substance is brought into contact with an electrolyte medium together with a counter electrode, and the working electrode is irradiated with light to photoexcite the sensitizing dye, and is photoexcited. Detecting a photocurrent flowing between the working electrode and the counter electrode due to electron transfer from the sensitizing dye to the working electrode, comprising:
The working electrode has an electron accepting layer containing an electron accepting material capable of accepting electrons emitted by the sensitizing dye in response to photoexcitation, and the probe material is supported on the surface of the electron accepting layer. ,
In addition to the spot carrying the probe substance on the working electrode, a dye labeling spot carrying the sensitizing dye is provided,
A reaction step of obtaining a working electrode in which the test substance bound with the sensitizing dye is immobilized via a probe substance, comprising at least contacting the working electrode with the test substance;
A measurement step of supplying the electrolyte medium, irradiating light, and measuring a photocurrent;
A result notification step for displaying the result of the measurement,
A specific detection method for a test substance, characterized in that, in the result notification step, a malfunction of the apparatus is reported when the current value when the dye-labeled spot is irradiated with light is outside a predetermined range.   The method of claim 1, wherein the working electrode comprises a plurality of dye-labeled spots.   The method according to claim 2, wherein the plurality of dye-labeled spots are two points at positions that are relatively farthest among spots provided on the working electrode.   The method according to any one of claims 1 to 3, wherein the sensitizing dye is fixed to the working electrode through the same type of substance as the probe substance in the dye-labeled spot.   The method according to claim 4, wherein when the probe substance is DNA, the sensitizing dye is fixed to the working electrode via DNA having the same base number as the DNA. When the working electrode detects the genetic polymorphism of the test substance, the working electrode has a sequence that completely matches the region where no base substitution has occurred and a sensitizing dye is bound. Further comprising a perfectly matched probe DNA spot carrying the probe material,
Create a first calibration curve of the concentration of the substance that is not a genetic polymorphism with respect to the test substance and the photocurrent value in the perfectly matched probe DNA spot,
Create a second calibration curve of the concentration of the substance that is not a genetic polymorphism with respect to the test substance and the photocurrent value in the spot carrying the probe substance,
In contrast to the current value in the completely matched probe DNA spot obtained by the measurement step and the first calibration curve, the concentration of the test substance is determined, and the current value corresponding to the concentration is determined as the second calibration value. When the current value obtained from the line is compared with the current value at the spot carrying the probe substance obtained in the measurement step, and the difference is outside the predetermined range, the gene is detected for the test substance. The method according to any one of claims 1 to 5, wherein a substance that is not a polymorphism is determined not to be detected.   The method according to claim 6, wherein the genetic polymorphism is a single nucleotide polymorphism.   The method according to claim 6 or 7, wherein, in the result informing step, incompleteness of the sample or the working electrode is informed when the current value when the perfect coincidence probe DNA spot is irradiated with light is outside a predetermined range.   The method for specific detection of a test substance according to claim 1, wherein the test substance is a biomolecule.   The method for specific detection of a test substance according to claim 9, wherein the probe substance is a biomolecule.   The method for specific detection of a test substance according to claim 9 or 10, wherein the biomolecule is DNA. A working electrode used in the method according to any one of claims 1 to 11,
A conductive substrate;
An electron-accepting layer comprising an electron-accepting material capable of accepting electrons emitted by the sensitizing dye in response to photoexcitation, formed on the conductive substrate;
A working electrode comprising a dye-labeled spot carrying the sensitizing dye in addition to the spot carrying the probe substance on the electron-accepting layer.   The working electrode according to claim 12, wherein a plurality of the dye labeling spots are provided.   The working electrode according to claim 13, wherein the plurality of dye-labeled spots are two points at positions that are relatively farthest among spots provided on the working electrode. An apparatus for carrying out the method according to any one of claims 1 to 11, comprising:
A single light source or a plurality of light sources for irradiating the working electrode with light;
An ammeter for measuring a current flowing between the working electrode and the counter electrode;
An apparatus comprising: a leaving means for notifying a measurement result.

Images