JP2006284413A - Blocking agent for pigment sensitization type biosensor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a blocking agent for working electrode processing capable of improving greatly detection sensitivity of a test material in specific detection of the test material using a photoelectric current generated by photoexcitation of a sensitizing pigment. <P>SOLUTION: A molecule including a phosphoric acid group in a molecular skeleton is used as the blocking agent used in the contact state with a working electrode 3 used for the specific detection of the test material 1 using the photoelectric current generated by photoexcitation of the sensitizing pigment 2, thereby greatly improving the detection sensitivity of the test material. <P>COPYRIGHT: (C)2007,JPO&INPIT

Description

  The present invention relates to an electrode surface of a test substance in a dye-sensitized biosensor that specifically detects a test substance having specific binding properties such as a nucleic acid, an exogenous endocrine disrupting substance, and an antigen using a photocurrent. It is related with the blocking agent used in order to suppress nonspecific adsorption | suction to.

  Gene diagnosis methods for analyzing DNA in biological samples are promising as new prevention and diagnosis methods for various diseases. The following are proposed as techniques for performing such DNA analysis simply and accurately.

  There is known a DNA analysis method in which a sample DNA is hybridized with a DNA probe having a base sequence complementary thereto and a fluorescent substance labeled, and a fluorescent signal at that time is detected (for example, Patent Document 1 and Patent Document 2). In this method, the formation of double-stranded DNA by hybridization is detected by fluorescence of the dye.

  In addition, a gene sample denatured into a single strand is hybridized with a complementary single-stranded nucleic acid probe, and then a double-stranded recognizer such as an intercalator is added for electrochemical detection. There are known methods (see, for example, Patent Document 3 and Non-Patent Document 1).

  On the other hand, in recent years, damage to the reproductive system and nervous system of exogenous endocrine disrupting substances (environmental hormones) such as dioxins has become a social problem. Currently, the detection of exogenous endocrine disrupting toxicity is carried out by various methods, but such substances are toxic at very low concentrations of the order of only 10 ppt. Therefore, a method for detecting an exogenous endocrine disrupting substance in such a low concentration range is desired.

  In particular, an exogenous endocrine disrupting substance binds to a target DNA via a protein such as a receptor, thereby affecting the expression of the DNA and causing toxicity. That is, the exogenous endocrine disrupting substance does not directly bind to DNA but binds indirectly to DNA via a protein such as a receptor. Therefore, in conventional methods such as prescreening using DNA binding properties, the evaluation of the binding is not easy.

Recently, dye sensitization in which a sensitizing dye is immobilized on a working electrode through direct or indirect specific binding between a test substance and a probe substance, and the photocurrent generated by photoexcitation of the sensitizing dye is detected. A dye-sensitized biosensor that can detect a specific signal derived from the binding between biomolecules has been proposed, applying the principle of the solar cell, and detecting and quantifying analytes with high sensitivity and simplicity. It has been reported that it can be performed (for example, see Patent Document 4).
JP-A-7-107999 Japanese Patent Laid-Open No. 11-315095 Japanese Patent No. 2573443 JP 2004-092672 A Surface Science Vol. 24, No. 11. Pp. 671-676, 2003

  As a result of diligent research, the inventors of the present invention have excellent selectivity and quantification by using an optimal blocking agent that suppresses nonspecific adsorption of a test substance to the electrode surface in a dye-sensitized biosensor. We have obtained knowledge that sensing of living body related substances is possible.

  Therefore, an object of the present invention is to provide a blocking agent that enables selective and quantitative detection and quantification of a test substance having specific binding properties in a dye-sensitized biosensor.

  And the blocking agent of this invention comprises the molecule | numerator characterized by having a phosphate group.

  Therefore, the present invention provides a blocking agent that enables selective and quantitative detection and quantification of a test substance having specific binding properties by suppressing non-specific adsorption reaction in a dye-sensitized biosensor. The purpose is to do.

Blocking agent that suppresses non-specific adsorption of test substance The blocking agent according to the present invention is used for the detection of a test substance on a working electrode used for specific detection of a test substance using a photocurrent generated by photoexcitation of a sensitizing dye. It is used to suppress non-specific adsorption. Details of the specific detection of the test substance using the photocurrent generated by photoexcitation of the sensitizing dye will be described later, but as an example of use to suppress nonspecific adsorption of the test substance to the working electrode, As a step when using the blocking agent, preferably, after the solution containing the blocking agent is brought into contact with the working electrode provided with the probe substance on the surface, the test substance is directly or indirectly specific. It is the process of combining. Specifically, a step of immobilizing the working electrode after immobilizing the probe substance by contacting or dipping a solution in which the blocking agent is dissolved may be mentioned.

  The blocking agent in the present invention is not particularly limited as long as it contains a phosphate group in the molecular skeleton, and any blocking agent can be used as long as it can be adsorbed to the electron accepting layer of the electrode used in the dye-sensitized biosensor. As a molecule containing a phosphate group in the present invention, in addition to the phosphate group, in the skeleton of an organic phosphate compound containing a hydrocarbon in the skeleton or an inorganic phosphate compound such as polyphosphoric acid condensed with phosphoric acid. Any material containing phosphoric acid may be used. As the blocking agent in the present invention, an organic phosphate compound can be preferably used. More preferably, in the molecular skeleton, an alkyl group which is a saturated hydrocarbon, an allyl group which is an unsaturated hydrocarbon, carbon, and hydrogen. A phosphoric acid compound containing a heterofunctional group containing an element can be used. Here, the alkyl group may be either a linear alkyl group or an alkyl group having a chain measurement, and a linear alkyl group is preferably used.

  Here, the alkyl group contained in the blocking agent in the present invention is preferably a linear alkyl group having 1 to 18 carbon chains. Here, a molecule having a linear alkyl group having 1 to 18 carbon atoms can be expected to have a very strong adsorption force on a solid polar surface because the molecule itself has a large dipole moment. Furthermore, the longer the carbon chain of the linear alkyl group, the stronger the van der Waals force of the alkyl group between adjacent molecules, which enables high-density surface packing. An increase in the effect of suppressing specific adsorption can be expected. Here, the phosphoric acid compound having a linear alkyl group is preferably methyl phosphoric acid, ethyl phosphoric acid, n-propyl phosphoric acid, n-butyl phosphoric acid, n-pentyl phosphoric acid, n-hexyl phosphoric acid, n-heptyl phosphoric acid, n -Octyl phosphate, n-nonyl phosphate, n-decyl phosphate, n-dodecyl phosphate, n-tetradecyl phosphate, n-hexadecyl phosphate, n-octadecyl phosphate and their salts, ie ammonium salts and alkyls Organic salts such as ammonium salts and inorganic salts such as sodium and potassium are used. Here, if the carbon chain of the linear alkyl group is less than 1, for example, when a material having a polar surface such as a titanium oxide electrode is used, the dipole moment is reduced, leading to a decrease in the amount of adsorption, and When the carbon chain is 19 or more, the hydrophobicity of the molecule becomes too strong, so that the dissolution in the solvent is extremely deteriorated, so that efficient adsorption may not occur.

  The allyl group which is an unsaturated hydrocarbon may be an aromatic functional group such as a phenyl group or a naphthyl group, or an unsaturated hydrocarbon functional group containing a double bond or a triple bond. Here, the interaction between the molecules of the unsaturated hydrocarbon contained in the allyl group, that is, the hydrophobic interaction or the π-π interaction, strengthens the interaction between the molecules, thereby achieving a high-density surface packing. Since it becomes possible, an increase in the effect of suppressing nonspecific adsorption of the test substance can be expected. Here, examples of the blocking agent containing an allyl group in the present invention include phenylphosphoric acid, naphthylphosphoric acid, and salts thereof, that is, organic salts such as ammonium salts and alkylammonium salts, and inorganic salts such as sodium and potassium.

  In addition, phosphoric acid having a heterofunctional group can also be preferably used as the blocking agent in the present invention, and the elements contained in the heterofunctional group include carbon, hydrogen, oxygen, nitrogen, sulfur, phosphorus, boron, fluorine. And those containing elements such as chlorine, bromine and iodine. A nucleic acid such as an oligonucleotide can be used as the phosphate compound having a heterofunctional group preferably used here. By using polyvalent phosphoric acid such as DNA as a blocking agent in the present invention, it is possible to more strongly adsorb to the surface of the electron accepting layer by forming bonds at multiple points to the substance used in the electron accepting layer. It becomes.

  Moreover, as a kind of coupling | bonding of the substance used for a phosphate group and an electron-accepting layer, Preferably, a covalent bond, an ester bond, a coordination bond, an ionic bond etc. are mentioned. The type of bond is known to vary greatly depending on the surface physical properties of the electron-accepting layer used. For example, as the solid basicity of the surface increases, the number of covalently bonded elements increases. For example, when a transition metal oxide such as titanium oxide is used as the electron-accepting layer, the phosphate group present in the molecule is shared with the hydroxyl group present on the titanium oxide surface, such as Ti-OP, by dehydration condensation. It is known to form bonds.

  The blocking agent in the present invention preferably contains a functional group that induces an intermolecular interaction in the molecular skeleton. Here, in the present invention, “interaction between molecules is induced” means, for example, that blocking agent molecules are adsorbed on the electrode surface, and at the same time, blocking agent molecules existing in the vicinity have their respective functionalities. Due to the electronic interaction between groups, the so-called “self-organizing” associations that become oriented and associate on the electrode surface will cause packing of higher density blocking agents on the electrode surface. Indicates that this is possible. Therefore, this leads to the formation of a dense blocking molecular layer, and as a result, the direct adsorption of the test substance to the electrode is suppressed (blocked), leading to a decrease in non-specific adsorption reaction. Here, in the blocking agent in the present invention, the interaction induced between molecules preferably includes van der Waals force, hydrophobic interaction, π-π interaction, hydrogen bond and the like. Moreover, you may use polymeric compounds, such as polyphosphoric acid containing many phosphoric acid units.

  By using such a blocking agent, it is possible to dramatically improve the detection sensitivity of the test substance by the photocurrent without hindering the characteristics of the measurement object and the working electrode.

  According to a preferred embodiment of the present invention, the blocking agent can be immobilized on the electrode by dissolving or dissolving the blocking agent in a solvent and then contacting or immersing the electrode in the liquid phase. At this time, the solvent for dissolving the blocking agent may be either an organic solvent or a solvent in which these are mixed. Furthermore, when the blocking agent is liquid, it is possible to react the blocking agent and the electrode directly without adding a solvent.

  According to a preferred embodiment of the present invention, the solvent for dissolving the blocking agent is water, methanol, ethanol, isopropanol, n-butanol, tert-butanol, acetone, n-hexane, n-heptane, n-octane, benzene, Those containing at least one solvent selected from toluene, chloroform, and cyclohexane can be used. When water is used as the solvent, a solvent containing a buffer may be used.

  According to a preferred embodiment of the present invention, the concentration of the solution containing a blocking agent is preferably 0.01 mM to 1 M, more preferably 0.1 mM to 500 mM, and still more preferably 10 to 100 mM.

Specific detection of a test substance using photocurrent As described above, the blocking agent of the present invention is used for processing a working electrode used for specific detection of a test substance using photocurrent generated by photoexcitation of a sensitizing dye. It is what is done. A specific detection method for a test substance using a photocurrent generated by photoexcitation of the sensitizing dye will be specifically described below.

  In this method, first, a sample solution containing a test substance, a working electrode, and a counter electrode are prepared. The working electrode used in the present invention is an electrode provided on the surface with a probe substance capable of specifically binding directly or indirectly to a test substance. That is, the probe substance specifically binds not only to a substance that directly binds specifically to the test substance, but also to a conjugate obtained by specifically binding the test substance to a mediator such as a receptor protein molecule. It may be a possible substance. Next, in the presence of the sensitizing dye, the sample solution is brought into contact with the working electrode to specifically bind the test substance directly or indirectly to the probe substance, and the sensitizing dye is fixed to the working electrode by this binding. Sensitizing dyes are substances that can emit electrons to the working electrode in response to photoexcitation, and can be pre-labeled to the test substance or mediator, or intercalated to the conjugate of the test substance and the probe substance. When a sensitizing dye is used, it may be simply added to the sample solution.

  Then, after bringing the working electrode and the counter electrode into contact with the electrolyte medium, when the sensitizing dye is photoexcited by irradiating the working electrode with light, electron transfer occurs from the photoexcited sensitizing dye to the electron acceptor. By detecting the photocurrent flowing between the working electrode and the counter electrode due to this electron movement, the test substance can be detected with high sensitivity. Further, since the detected current has a high correlation with the test sample concentration in the sample solution, the test sample can be quantitatively measured based on the measured current amount or electric quantity.

Test substance and probe substance
The test substance in the method of the present invention is not limited as long as it has a specific binding property, and various substances may be used. In such a test substance, the test substance is directly or indirectly attached to the probe substance by supporting on the surface of the working electrode a probe substance that can specifically or directly bind to the test substance. It becomes possible to detect it by specifically binding to.

  That is, in the method of the present invention, it is possible to select a test substance and a probe substance that can specifically bind to each other. That is, according to a preferred embodiment of the present invention, it is preferable that a substance having specific binding properties be a test substance and a substance that specifically binds to the test substance be carried on the working electrode as a probe substance. As a result, the test substance can be directly bound and detected on the working electrode. Preferable examples of the combination of the test substance and the probe substance in this embodiment include a single-stranded nucleic acid and a combination of single-stranded nucleic acids having complementarity to the nucleic acid, and a combination of antigen and antibody.

  According to a more preferred embodiment of the present invention, it is preferable that the test substance is a single-stranded nucleic acid and the probe substance is a single-stranded nucleic acid having complementarity to the nucleic acid. The steps of specific binding of the test substance to the working electrode in this embodiment are shown in FIGS. As shown in these figures, a single-stranded nucleic acid 1 as a test substance is hybridized with a single-stranded nucleic acid 4 having complementarity as a probe substance carried on the working electrode 3, A double-stranded nucleic acid 7 is formed.

  When a single-stranded nucleic acid is used as a test substance, it only needs to have a portion complementary to the nucleic acid that is the probe substance, and the length of the base pairs constituting the test substance is not limited. It preferably has a complementary portion of 15 bp or more. According to the method of the present invention, even when a nucleic acid having a base length of 200 bp, 500 bp, and 1000 bp is relatively long, a specific binding formation between the nucleic acid of the probe substance and the test substance can be performed with high sensitivity. Can be detected as

  Sample liquids containing single-stranded nucleic acids as test substances are blood such as peripheral venous blood, white blood cells, serum, urine, feces, semen, saliva, cultured cells, tissue cells such as various organ cells, etc. Nucleic acids can be extracted from various specimen samples containing nucleic acids by a known method. At this time, destruction of the cells in the specimen sample can be performed, for example, by applying a physical action such as shaking or ultrasonic waves from the outside and vibrating the carrier. In addition, nucleic acid can be released from cells using a nucleic acid extraction solution. Examples of the nucleic acid elution solution include a solution containing a surfactant such as SDS, Triton-X, Tween-20, saponin, EDTA, protease, and the like. When nucleic acids are eluted using these solutions, the reaction can be accelerated by incubating at a temperature of 37 ° C. or higher.

  According to a more preferred embodiment of the present invention, when the content of a gene as a test substance is very small, detection is preferably performed after the gene is amplified by a known method. A typical method for amplifying a gene would be a method using an enzyme such as polymerase chain reaction (PCR). Examples of enzymes used in the gene amplification method include DNA polymerases, DNA-dependent DNA polymerases such as Taq polymerase, and DNA-dependent RNA polymerases such as RNA polymerase I. And RNA-dependent RNA polymerases such as Qβ replicase, and the PCR method using Taq polymerase is preferred in that amplification can be repeated continuously only by adjusting the temperature.

  According to a preferred embodiment of the present invention, the nucleic acid can be specifically labeled with a sensitizing dye during the amplification. Generally, it can be carried out by incorporating aminoallyl-modified dUTP into DNA. This molecule is incorporated with the same efficiency as unmodified dUTP. In the next coupling step, a fluorescent dye activated by N-hydroxysuccinimide specifically reacts with the modified dUTP, and a test substance uniformly labeled with a sensitizing dye is obtained.

  According to a preferred embodiment of the present invention, the nucleic acid crude extract solution or purified nucleic acid solution obtained as described above is first subjected to heat denaturation at a temperature of 90 to 98 ° C., preferably 95 ° C. or higher, to obtain a single strand. Nucleic acids can be prepared.

  In the method of the present invention, the test substance and the probe substance may indirectly bind specifically. That is, according to another preferred embodiment of the present invention, a substance having specific binding properties is used as a test substance, a substance that specifically binds to the test substance is used as a mediator, and It is preferable to carry a substance capable of binding to the working electrode as a probe substance. Thereby, even a substance that cannot specifically bind to the probe substance can be detected by specifically binding indirectly to the working electrode via the mediator substance. In this embodiment, preferred examples of the combination of the test substance, the mediator, and the probe substance include a ligand, a receptor protein molecule that can accept the ligand, and two molecules that can specifically bind to the receptor protein molecule. A combination of nucleic acids in a strand is mentioned. Preferable examples of the ligand include exogenous endocrine disrupting substances (environmental hormones). An exogenous endocrine disrupting substance is a substance that binds to DNA via a receptor protein molecule and produces toxicity by affecting its gene expression. According to the method of the present invention, the receptor produced by a test substance is used. It is possible to easily monitor the binding of a protein such as a body to DNA. The specific binding process of the test substance to the working electrode in this embodiment is shown in FIG. As shown in FIG. 2, a ligand 10 as a test substance first specifically binds to a receptor protein molecule 11 that is a mediator. Then, the receptor protein molecule 13 to which the ligand is bound specifically binds to a double-stranded nucleic acid 14 as a probe substance.

  In the present invention, a plurality of identical test substances having different origins can be reacted simultaneously with one probe, and the difference in the amount of the test substance due to the origin of the sample can be judged and quantified.

  Specific application examples include expression profile analysis by competitive hybridization on a microarray. In this method, in order to analyze the difference in the expression pattern of a specific gene among cells, test substances labeled with different fluorescent dyes are competitively hybridized with the same probe. In the present invention, by using the same technique, there is an unprecedented advantage that an expression difference analysis between cells can be performed electrochemically.

Sensitizing dye
In the method of the present invention, in order to detect the presence of a test substance with a photocurrent, the test substance is directly or indirectly specifically bound to the probe substance in the presence of a sensitizing dye, The sensitizing dye is fixed to the working electrode by binding. Therefore, in the method of the present invention, the test substance 1 or the mediating substance 11 can be labeled with the sensitizing dyes 2 and 12 in advance as shown in FIG. 1 (a) and FIG. In addition, when using a sensitizing dye 8 that can be intercalated with a conjugate 7 (for example, a double-stranded nucleic acid after hybridization) of a test substance and a probe substance as shown in FIG. By adding a sensitizing dye to the solution, the sensitizing dye can be fixed to the probe substance.

  According to a preferred embodiment of the present invention, when the test substance is a single-stranded nucleic acid, it is preferable to label one sensitizing dye per molecule of the test substance. The labeling position in the single-stranded nucleic acid should be either the 5 ′ end or the 3 ′ end of the single-stranded nucleic acid from the viewpoint of easily forming a specific bond between the test substance and the probe substance. From the viewpoint of further simplifying the labeling step, the 5 ′ end of the test substance is more preferable.

  According to another preferred embodiment of the present invention, in order to increase the amount of sensitizing dye supported per molecule of the test substance, two or more sensitizing dyes are labeled per molecule of the test substance. preferable. As a result, the amount of dye supported per unit specific surface area of the working electrode on which the electron accepting material is formed can be increased, and the photocurrent response can be observed with higher sensitivity.

  The sensitizing dye used in the present invention is a substance that can emit electrons to the working electrode in response to photoexcitation, can be changed to the photoexcited state by irradiation with a light source, and can be injected into the working electrode from the excited state. Anything that can take a state may be used. Therefore, any sensitizing dye can be used as long as it can take the above-described electronic state with the working electrode, particularly the electron accepting layer. Therefore, various sensitizing dyes can be used, and expensive dyes can be used. There is no need to use it.

  In the embodiment in which individual detection of a plurality of test substances is performed, the sensitizing dye that labels each test substance may be any one that can be excited by different wavelengths of light. It is only necessary that each test substance can be excited individually by selecting. For example, when a plurality of sensitizing dyes corresponding to a plurality of substances to be detected are used and light having different excitation wavelengths is irradiated for each sensitizing dye, signals are detected individually even if the plurality of probes are on the same spot. It becomes possible. The number of test substances is not limited, but 1 to 5 types are appropriate considering the wavelength of light emitted from the light source and the absorption characteristics of the sensitizing dye.

  Therefore, the sensitizing dye that can be used in this embodiment only needs to be photoexcited in the wavelength region of the irradiation light, and the absorption maximum is not necessarily in the wavelength region. In addition, the presence or absence of the light absorption reaction of the sensitizing dye at a specific wavelength can be measured using an ultraviolet-visible spectrophotometer (for example, UV-3150 manufactured by Shimadzu Corporation).

  Specific examples of the sensitizing dye include metal complexes and organic dyes. Preferred examples of metal complexes include metal phthalocyanines such as copper phthalocyanine and titanyl phthalocyanine; chlorophyll or derivatives thereof; hemin, ruthenium, osmium, iron described in JP-A-1-220380 and JP-A-5-504023, and Zinc complexes such as cis-dicyanate-bis (2,2′-bipyridyl-4,4′-dicarboxylate) ruthenium (II)) are mentioned. Preferred examples of the organic dye include metal-free phthalocyanine, 9-phenylxanthene dye, cyanine dye, methocyanine dye, xanthene dye, triphenylmethane dye, acridine dye, oxazine dye, coumarin dye, Examples include merocyanine dyes, rhodacyanine dyes, polymethine dyes, and indigo dyes. As another preferred example of the sensitizing dye, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Cy7.5, Cy9 manufactured by Amersham Biosciences; AlexaFluor 355, AlexaFluor 405, AlexaFluor 430 manufactured by Molecular Probes, Inc. , AlexaFluor 488, AlexaFluor 532, Alexa Fluor 546, Alexa Fluor 555, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Alexa Fluor 680, Alexa Fluor 680, Alexa Fluor 680, Alex Fluor 680, Alex Fluor 680 633, DY-635, DY-636, EVOblue10, EVOblue30, DY-647, DY-650, DY-651, DYQ-660, DYQ-661 and the like.

  Preferable examples of the sensitizing dye capable of intercalating with a double-stranded nucleic acid include acridine orange and ethidium bromide. When such a sensitizing dye is used, a double-stranded nucleic acid labeled with a sensitizing dye is formed simply by adding to the sample solution after hybridization of the nucleic acid. Therefore, it is necessary to label the single-stranded nucleic acid in advance. No.

Working electrode and its manufacture
The working electrode used in the present invention is an electrode having the probe substance on its surface, and is an electrode capable of receiving electrons emitted by a sensitizing dye immobilized via the probe substance in response to photoexcitation. Accordingly, the configuration and material of the working electrode are not limited as long as the above-described electron transfer occurs with the sensitizing dye to be used, and may be various configurations and materials.

  According to a preferred embodiment of the present invention, the working electrode has an electron accepting layer containing an electron accepting material capable of accepting electrons emitted by the sensitizing dye in response to photoexcitation, and a probe material is provided on the surface of the electron accepting layer. Is preferably provided. According to a more preferred aspect of the present invention, it is preferable that the working electrode further comprises a conductive substrate, and an electron accepting layer is formed on the conductive substrate. An electrode of this embodiment is shown in FIGS. The working electrode 4 shown in FIGS. 1 and 2 includes a conductive substrate 5 and an electron accepting layer 6 formed on the conductive substrate and containing an electron accepting substance. A probe substance is supported on the surface of the electron accepting layer 6.

  The electron-accepting layer in the present invention comprises an electron-accepting material that can accept electrons emitted by a sensitizing dye immobilized via a probe material in response to photoexcitation. That is, the electron-accepting substance can be a substance that can take an energy level in which electrons can be injected from the photoexcited labeling dye. Here, the energy level (A) capable of injecting electrons from the photoexcited labeling dye means, for example, a conductor (conduction band: CB) when a semiconductor is used as the electron-accepting material. When a metal is used as the electron-accepting material, it means the Fermi level. When an organic material or a molecular inorganic material such as C60 is used as the electron-accepting material, the lowest unoccupied molecular orbital (Lowest Unoccupied Molecular Orbital: LUMO). That is, in the electron acceptor used in the present invention, this A level is lower than the LUMO energy level of the sensitizing dye, in other words, lower than the LUMO energy level of the sensitizing dye. Any material having an energy level may be used.

Preferred examples of the electron accepting material include simple semiconductors such as silicon and germanium; oxides such as titanium, tin, zinc, iron, tungsten, zirconium, hafnium, strontium, indium, cerium, yttrium, lanthanum, vanadium, niobium, and tantalum. Semiconductors: Perovskite type semiconductors such as strontium titanate, calcium titanate, sodium titanate, barium titanate, potassium niobate; cadmium, zinc, lead, silver, antimony, bismuth sulfide semiconductors; cadmium, lead selenide semiconductors Cadmium telluride semiconductors; phosphide semiconductors such as zinc, gallium, indium and cadmium; gallium arsenide, copper-indium selenide, copper-indium-sulfide compound semiconductors; gold, platinum, silver, copper, aluminum Rhodium, indium, a metal such as nickel, polythiophene, polyaniline, polyacetylene, organic polymer polypyrrole; is C60, C70, etc. molecular inorganic, and more preferably include _{silicon, TiO 2, SnO 2, Fe} 2 O 3, WO ₃ , ZnO, Nb ₂ O ₅ , strontium titanate, CdS, ZnS, PbS, Bi ₂ S ₃ , CdSe, CdTe, GaP, InP, GaAs, CuInS ₂ , CuInSe, C60, and more preferably TiO _2. ZnO, SnO ₂ , Fe ₂ O ₃ , WO ₃ , Nb ₂ O ₅ , strontium titanate, CdS, PbS, CdSe, InP, GaAs, CuInS ₂ , and CuInSe ₂ , most preferably TiO ₂ .

  When a semiconductor or metal is used as the electron-accepting substance, the semiconductor or metal may be single crystal or polycrystalline, but a polycrystalline body is preferable, and a porous material is more preferable than a dense material. As a result, the specific surface area is increased, and a large amount of the test substance and sensitizing dye can be adsorbed to detect the test substance with higher sensitivity. Therefore, according to the preferable aspect of this invention, it is preferable that the electron-accepting layer has porosity, and the diameter of each hole is 3-1000 nm, More preferably, it is 10-100 nm.

  According to a preferred aspect of the present invention, the surface area in a state where the electron-accepting layer is formed on the conductive substrate is preferably 10 times or more, more preferably 100 times or more with respect to the projected area. . The upper limit of the surface area is not particularly limited, but will usually be about 1000 times. The particle diameter of the fine particles of the electron accepting material constituting the electron accepting layer is preferably 5 to 200 nm as a primary particle in terms of an average particle diameter using a diameter when the projected area is converted into a circle, and more preferably 8 to It is 100 nm, More preferably, it is 20-60 nm. The average particle diameter of the electron-accepting substance fine particles (secondary particles) in the dispersion is preferably 0.01 to 100 μm. For the purpose of improving the light capture rate by scattering incident light, an electron-accepting layer may be formed by using fine particles of an electron-accepting material having a large particle size, for example, about 300 nm.

  According to a preferred embodiment of the present invention, it is preferred that the working electrode further comprises a conductive substrate, and the electron accepting layer is formed on the conductive substrate. The conductive substrate that can be used in the present invention is not only a substrate having conductivity, such as a metal such as titanium, but also a substrate having a conductive material layer on the surface of a glass or plastic support. Good. When a conductive substrate having this conductive material layer is used, the electron accepting layer is formed on the conductive layer. Examples of the conductive material constituting the conductive material layer include metals such as platinum, gold, silver, copper, aluminum, rhodium, and indium; conductive ceramics such as carbon, carbide, and nitride; and indium-tin composite oxides, Examples include conductive metal oxides such as tin oxide doped with fluorine, tin oxide doped with antimony, zinc oxide doped with gallium, or zinc oxide doped with aluminum. Is an indium-tin composite oxide, a metal oxide in which tin oxide is doped with fluorine.

According to a preferred embodiment of the present invention, the conductive substrate is substantially transparent, specifically, the light transmittance is preferably 10% or more, more preferably 50% or more, and still more preferably. 70% or more. Moreover, according to the preferable aspect of this invention, it is preferable that the thickness of a electrically-conductive material layer is about 0.02-10 micrometers. Furthermore, according to the preferable aspect of this invention, it is preferable that the surface resistance of an electroconductive base material is 100 ohms / cm < ² > or less, More preferably, it is 40 ohms / cm < ² > or less. The lower limit of the surface resistance of the conductive substrate is not particularly limited, but will usually be about 0.1 Ω / cm ² .

  Examples of a preferable method for forming an electron-accepting layer on a conductive substrate include a method of coating a dispersion or colloidal solution of an electron-accepting material on a conductive support, and a precursor of semiconductor fine particles on the conductive support. And a method of obtaining a fine particle film by being hydrolyzed with moisture in the air (sol-gel method), a sputtering method, a CVD method, a PVD method, and a vapor deposition method. As a method for preparing a dispersion of semiconductor fine particles as an electron acceptor, in addition to the sol-gel method described above, a method of grinding with a mortar, a method of dispersing while grinding using a mill, or a semiconductor synthesis Examples thereof include a method in which it is precipitated as fine particles in a solvent and used as it is. Examples of the dispersion medium include water or various organic solvents (for example, methanol, ethanol, isopropyl alcohol, dichloromethane, acetone, acetonitrile, ethyl acetate, etc.). At the time of dispersion, a polymer, a surfactant, an acid, a chelating agent, or the like may be used as a dispersion aid as necessary.

  Preferred examples of the application method of the electron acceptor dispersion or colloidal solution include the roller method as the application system, the dip method, the air knife method as the metering system, the blade method, etc., and the application and metering in the same part. The wire bar method disclosed in Japanese Patent Publication No. 58-4589, the slide hopper method, the extrusion method, the curtain method, the spin method, and the spray method described in US Pat. Nos. 2,681,294, 2761419, 2761791, etc. Is mentioned.

According to a preferred aspect of the present invention, when the electron accepting layer is composed of semiconductor fine particles, the thickness of the electron accepting layer is preferably 0.1 to 200 μm, more preferably 0.1 to 100 μm, and still more preferably. Is 1-30 μm, most preferably 2-25 μm. As a result, the probe substance per unit projected area and the amount of sensitizing dye to be fixed can be increased to increase the photoelectric flow rate, and the loss of generated electrons due to charge recombination can also be reduced. The coating amount of the semiconductor fine particles per 1 m ² of the conductive base material is preferably 0.5 to 400 g, more preferably 5 to 100 g.

  According to a preferred embodiment of the present invention, it is preferable to apply heat treatment after coating the semiconductor fine particles on the conductive substrate. Thereby, particle | grains can be made to contact electrically and the improvement of coating-film intensity | strength and adhesiveness with a support body can be improved. A preferable heat treatment temperature is 40 to 700 ° C, more preferably 100 to 600 ° C. Moreover, preferable heat processing time is about 10 minutes-10 hours.

  According to another preferred embodiment of the present invention, when a conductive base material having a low melting point or softening point, such as a polymer film, is used, the film is formed by a method that does not use high-temperature treatment in order to prevent deterioration due to heat. The film is preferably formed, and examples of such a film forming method include a method such as pressing, low-temperature heating, electron beam irradiation, microwave irradiation, electrophoresis, sputtering, CVD, PVD, and vapor deposition.

  A probe substance is supported on the surface of the electron accepting layer of the working electrode thus obtained. Loading of the probe substance on the working electrode can be performed according to a known method. According to a preferred embodiment of the present invention, when a single-stranded nucleic acid is used as a probe substance, an oxidized layer is formed on the surface of the working electrode, and the nucleic acid probe and the working electrode are connected via the oxidized layer. This can be done by bonding. At this time, the nucleic acid probe can be immobilized on the working electrode by introducing a functional group at the end of the nucleic acid. As a result, the nucleic acid probe into which the functional group has been introduced can be immobilized on the carrier as it is by an immobilization reaction. Introduction of a functional group at the end of a nucleic acid can be performed using an enzymatic reaction or a DNA synthesizer. Examples of the enzyme used in the enzymatic reaction include terminal deoxynucleotidyl transferase, poly A polymerase, polynucleotide kinase, DNA polymerase, polynucleotide adenyl transferase, RNA ligase. Can be mentioned. Moreover, a functional group can also be introduce | transduced by a polymerase chain reaction (PCR method), a nick translation, and a random primer method. The functional group may be introduced at any part of the nucleic acid, and can be introduced at the 3 ′ end, 5 ′ end or at a random position.

  According to a preferred embodiment of the present invention, amine, carboxylic acid, sulfonic acid, thiol, hydroxyl group, phosphoric acid and the like can be suitably used as the functional group for immobilizing the nucleic acid probe to the working electrode. Moreover, according to the preferable aspect of this invention, in order to fix | immobilize a diffusion probe firmly to a working electrode, it is also possible to use the material which bridge | crosslinks between a working electrode and a diffusion probe. Preferable examples of such a cross-linking material include silane coupling agents and conductive polymers such as polythiophene, polyacetylene, polypyrrole, and polyaniline.

  According to a preferred embodiment of the present invention, the nucleic acid probe can be immobilized efficiently by a simple operation called physical adsorption. The physical adsorption of the nucleic acid probe to the electrode surface can be performed, for example, as follows. First, the electrode surface is cleaned with distilled water and alcohol using an ultrasonic cleaner. Thereafter, the electrode is inserted into a buffer containing the nucleic acid probe to adsorb the nucleic acid probe onto the surface of the carrier. Moreover, nonspecific adsorption | suction can be suppressed by adding a blocking agent after adsorption | suction of a nucleic acid probe.

  According to a preferred aspect of the present invention, it is preferable that the probe substance is divided and supported on each of the plurality of regions separated from each other on the working electrode, and the light irradiation by the light source is performed individually on each region. . Thereby, since a plurality of samples can be measured on one working electrode, integration of DNA chips and the like are possible. According to a more preferable aspect of the present invention, a plurality of regions separated from each other, on which a probe substance is supported on the working electrode, is patterned, and a sample in each region is scanned while scanning with light emitted from a light source. It is preferable that the detection or quantification of the test substance is continuously performed in one operation.

  According to a more preferred aspect of the present invention, a plurality of types of probe substances can be carried on each of a plurality of regions separated from each other on the working electrode. As a result, a large number of samples can be simultaneously measured by multiplying the number of regions by the number of types of probe substances for each region.

  According to a more preferable aspect of the present invention, a different probe substance can be carried in each of a plurality of regions separated from each other on the working electrode. As a result, the number of types of probe substances corresponding to the number of the divided areas can be carried, so that multiple types of analytes can be measured simultaneously. This aspect can be preferably used for multi-item analysis of single nucleotide polymorphism analysis (SNPs) because different test substances can be analyzed for each region.

Counter electrode
The counter electrode used in the present invention is not particularly limited as long as a current can flow between it and the working electrode when it is brought into contact with an electrolyte medium. Glass or plastic on which a metal or a conductive oxide is deposited is used. Ceramics can be used. Moreover, the metal thin film as a counter electrode can be formed by a method such as vapor deposition or sputtering so as to have a film thickness of 5 μm or less, preferably 3 nm to 3 μm. Preferable examples of materials that can be used for the counter electrode include conductive polymers such as platinum, gold, palladium, nickel, carbon, and polythiophene, and conductive ceramics such as oxide, carbide, and nitride, and more preferably. Platinum and carbon, and most preferably platinum.

Measuring method and apparatus
In the method of the present invention, the sample liquid is brought into contact with the working electrode in the presence of the sensitizing dye, and the test substance is directly or indirectly specifically bound to the probe substance. Is fixed to the working electrode.

  According to a preferred embodiment of the present invention, when a single-stranded nucleic acid previously labeled with a sensitizing dye is used as a test substance, a hybridization reaction can be performed with a single-stranded nucleic acid that is a probe substance. . The preferred temperature for the hybridization reaction is in the range of 37-72 ° C., but the optimum temperature varies depending on the base sequence and length of the probe used.

  According to another preferred embodiment of the present invention, when a sensitizing dye that can be intercalated is used for a conjugate of a test substance and a probe substance (for example, a double-stranded nucleic acid after hybridization), it is added to the sample solution. By adding a sensitizing dye, the conjugate can be specifically labeled with a sensitizing dye.

  In the method of the present invention, a working electrode in which a test substance is fixed together with a sensitizing dye is brought into contact with an electrolyte medium together with a counter electrode, and the working electrode is irradiated with light to photoexcite the sensitizing dye, thereby being photoexcited. The photocurrent flowing between the working electrode and the counter electrode due to the electron transfer from the sensitizing dye to the working electrode is detected.

  An example of such a measurement cell is shown in FIG. The measurement cell 21 shown in FIG. 3 is formed by filling an electrolyte solution 24 into a gap formed by being sandwiched between a working electrode 22 and a counter electrode 23. The working electrode 22 includes a conductive base material 26 and an electron accepting layer 27, and is disposed so that the electron accepting layer 27 side is in contact with the electrolytic solution 24. By inserting an insulating spacer 25 between the working electrode 22 and the counter electrode 23, a space for accommodating the electrolytic solution 24 is secured. The distance between the electrodes is preferably short in order to efficiently perform the oxidation-reduction cycle, and is preferably several tens of μm in view of work accuracy. Further, if a so-called MEMS-like manufacturing method is used, it is possible to make the distance between electrodes closer to each other.

The electrolyte medium used in the present invention can comprise an electrolyte, a solvent, and optionally an additive. Preferable examples of the electrolyte include a combination of I ₂ and iodide (as iodide, metal iodide such as LiI, NaI, KI, CsI, CaI ₂ , tetraalkylammonium iodide, pyridinium iodide, imidazolium iodide). Quaternary ammonium compounds such as iodine salts), Br ₂ and bromide combinations (bromides include metal bromides such as LiBr, NaBr, KBr, CsBr, CaBr ₂ , or quaternary ammonium compounds such as tetraalkylammonium bromide and pyridinium bromide). Bromine salts), metal complexes such as ferrocyanate-ferricyanate and ferrocene-ferricinium ions, sulfur compounds such as sodium polysulfide, alkylthiol-alkyldisulfides, and viologens Examples thereof include dyes, hydroquinone-quinones, and the like. More preferable is an electrolyte in which I ₂ and iodine salt of a quaternary ammonium compound such as LiI, pyridinium iodide, imidazolium iodide and the like are combined. The electrolytes described above may be used in combination.

  According to the preferable aspect of this invention, it is preferable that the electrolyte concentration of electrolyte solution is 0.1-15M, More preferably, it is 0.2-10M. Further, when iodine is added to the electrolyte, a preferable iodine concentration is 0.01 to 0.5M.

  Examples of preferred solvents include water, alcohol (methanol, ethanol, etc.), aprotic polar solvents (eg, nitriles such as acetonitrile, carbonates such as propylene carbonate and ethylene carbonate, dimethylformamide, dimethyl sulfoxide, sulfolane, 1 , 3-dimethylimidazolinone, 3-methyloxazolidinone, heterocyclic compounds such as dialkylimidazolium salts, and the like.

  According to a preferred embodiment of the present invention, the electrolyte medium can be used after gelation (solidification). Examples of the gelation method can be carried out by techniques such as addition of a polymer, addition of an oil gelling agent, polymerization including polyfunctional monomers, and a crosslinking reaction of the polymer. Examples of the polymer used in the matrix of the gel electrolyte include polyacrylonitrile and polyvinylidene fluoride.

  As shown in FIG. 3, a light source 28 is disposed above the working electrode 21 via a light source cover 29. The light source used in the present invention is not limited as long as it can irradiate light having a wavelength capable of photoexciting the labeling dye. Preferred examples include fluorescent lamps, black lights, sterilizing lamps, incandescent lamps, low pressure mercury lamps, high pressure mercury Lamps, xenon lamps, mercury-xenon lamps, halogen lamps, metal halide lamps, LEDs (white, blue, green, red), laser light and sunlight can be used, more preferably fluorescent lamps, incandescent lamps, xenon lamps. , Halogen lamp, metal halide lamp, LED (white, blue, green, red), sunlight and the like. Moreover, you may irradiate only the light of a specific wavelength range using a spectroscope and a band pass filter as needed.

  According to a preferred aspect of the present invention, when two or more kinds of test substances are individually detected using two or more sensitizing dyes that can be excited at different light wavelengths, a specific wavelength is detected from the light source via the wavelength selection means. It is possible to excite a plurality of dyes individually by irradiating the light. Examples of the wavelength selection means include a spectroscope, a colored glass filter, an interference filter, a band pass filter, and the like. In addition, a plurality of light sources capable of irradiating light of different wavelengths depending on the type of sensitizing dye may be used. Examples of preferable light sources in this case include laser light and LED irradiated with light of a specific wavelength. It may be used. Further, in order to efficiently irradiate the working electrode with light, light may be guided using quartz, glass, or a liquid light guide.

  According to a preferred embodiment of the present invention, it is preferable that the light emitted from the light source is essentially free of ultraviolet light, or the light irradiation from the light source is performed through a means for removing the ultraviolet light. As a result, the background current due to photoexcitation of the electron-accepting substance itself, that is, noise, which can be generated when the irradiation light includes ultraviolet light having a wavelength of 400 nm or less can be effectively suppressed, and more accurate measurement can be performed. . In general, since sensitizing dyes can be excited by absorption of visible light, even if ultraviolet rays are removed, photocurrent can be detected with high sensitivity by irradiation with visible light.

  Preferable examples of the means for removing ultraviolet rays include an optical filter and a spectroscope. By using an optical filter or a spectroscope, the wavelength of irradiation light can be controlled, and only the sensitizing dye can be excited while preventing the photoexcitation of the working electrode itself. Examples of preferred optical filters include colored glass filters such as ultraviolet cut filters. As an example of a preferable spectroscope, there is a spectroscope having a built-in diffraction grating in that precise wavelength control is possible.

  Preferred examples of light sources that emit light that is essentially free of ultraviolet light include lasers, inorganic electroluminescence (EL) elements, organic electroluminescence (EL) elements, and light emitting diodes (LEDs), most preferably Light emitting diode (LED). According to the LED, it is possible to irradiate controlled light with a narrow wavelength distribution, and there are also advantages such as small size, light weight, low power consumption, and long life.

According to a more preferable aspect of the present invention, light having a wavelength shorter than the cutoff wavelength shown in Table 1 calculated by substituting the known band gap for the electron accepting material to be used in the following equation is removed. Is preferred. Thereby, generation | occurrence | production of a background current can be suppressed effectively according to the characteristic of an electron accepting substance.

Band gap (eV) = hν = hc / λ = 1239.8 / λ (mm)
(H: Planck constant, c: speed of light)
Table 1
Electron acceptor band gap Suitable cutoff wavelength
(EV) (nm)
Rutile type titanium oxide 3.2 387
Anatase type titanium oxide 3.0 413
Zinc oxide 3.1 400
Strontium titanate 3.2 387
Tin oxide 3.5 354
Tungsten oxide 2.8 443
Niobium oxide 3.1 400
Iron oxide 2.2 564

  Note that since the electron-accepting material may contain an impurity level, the cutoff wavelength may be set longer than the wavelength shown in Table 1 for the sake of completeness. When the working electrode is composed of a plurality of electron accepting substances, it is preferable to remove wavelengths shorter than the cutoff wavelength of the component having the narrowest band gap among the constituent components.

  As shown in FIG. 4, an ammeter 30 is connected between the working electrode 21 and the counter electrode 22, and the photocurrent flowing through the system by light irradiation is measured by the ammeter. Thereby, the test substance can be detected. The current value at that time reflects the amount of sensitizing dye trapped on the working electrode. For example, when the test substance is a nucleic acid, the amount of double strands formed between complementary nucleic acids is reflected as a current value. Therefore, the test substance can be quantified from the obtained current value. Therefore, according to a preferred aspect of the present invention, it is preferable that the ammeter further comprises means for calculating the concentration of the test substance in the sample solution from the obtained amount of current or electricity.

  According to a preferred aspect of the present invention, the step of detecting the photocurrent can measure the current value, and calculate the concentration of the test substance in the sample liquid from the obtained current value or electric quantity. The calculation of the test substance concentration can be performed by comparing a calibration curve between the test substance concentration and the current value or the electric quantity prepared in advance with the obtained current value or the electric quantity. In the method of the present invention, since the current value reflects the amount of the sensitizing dye trapped on the working electrode, an accurate current value corresponding to the concentration of the test substance can be obtained, which is suitable for quantitative measurement. .

  According to another preferred embodiment of the present invention, a test substance previously labeled with a sensitizing dye is used as a competitor, and a second substance capable of specifically binding to a probe substance that is not labeled with a sensitizing dye. The test substance can be quantified. It is preferable that the second test substance has a property of easily binding to the probe substance more specifically than the labeled test substance. When these two kinds of test substances are made to compete and specifically bind to the probe substance, a correlation is obtained between the detected current value and the concentration of the second test substance. That is, as the number of second analytes that are not dye-labeled increases, the number of competitors that specifically bind to the probe substance decreases, so that the detection current increases as the second analyte concentration increases. A calibration curve with decreasing values can be obtained. Therefore, it is possible to detect and quantify the second test substance that is not labeled with a sensitizing dye.

  According to a more preferred embodiment of the present invention, the test substance and the second test substance are preferably antigens, and the probe substance is preferably an antibody. FIG. 5 shows the step of immobilizing the test substance and the second test substance on the probe substance in this embodiment. As shown in FIG. 5, the antigen 41 labeled with a sensitizing dye and the antigen 42 not labeled with the dye compete with each other and specifically bind to the antibody 43. Therefore, as the amount of the antigen 42 that is not dye-labeled increases, the amount of the dye-labeled antigen 43 that specifically binds to the antibody decreases. Therefore, the detection current value decreases as the second analyte concentration increases. You can get a line.

The following examples further illustrate the present invention. The present invention is not limited to these examples.
(Example 1) Preparation of n-octyl phosphate / test substance and probe substance as blocking agent The 5 ′ end was labeled with Cy5 as a dye-labeled test substance (hereinafter also referred to as test DNA). A 25-base nucleobase (5′Cy5DNA-A) having the following base sequence was prepared. In addition, a 15-base nucleobase (5 ′ amine DNA) having a complementary strand to the test DNA was prepared as a probe substance (hereinafter also referred to as probe DNA). That is, this probe DNA and test DNA can form a double-stranded DNA by a hybridization reaction. As a control, a 24-base nucleobase (5′Cy5DNA-B) having no complementary strand to the probe DNA was prepared.
Test DNA (5′Cy5DNA-A):
3'TGGAAGTAGTTTTTGTAGTAGTAGG-Cy5-5 '
Probe DNA (5 ′ amine DNA):
5'NH ₂ -ACCTTCATCAAAAACATCATCATCC-3'
Control (5'Cy5DNA-B):
3'GAATTGGTCCGACTTGAACGAGTT -Cy5-5 '

-Production of working electrode and loading of probe substance First, 1 g of titania fine powder (manufactured by Showa Titanium Co., F2, average particle size 60 nm, anatase: rutile = 4: 6) and 1 g of an organic vehicle having the following composition were automatically While kneading in a mortar, 1 g of a solvent (α terpineol: butyl carbitol = weight ratio 60:40) was gradually added to obtain a titanium oxide paste. This series of mixing was carried out for a total of 5 hours.
α-Terpineol 65% by weight
Butyl carbitol 15% by weight
Polyvinyl butyral 20% by weight

Mask the edge frame on the conductive surface of fluorine-doped tin oxide (F-SnO ₂ : FTO) coated glass (manufactured by AI Special Glass Co., Ltd., U film, sheet resistance: 15Ω / □) with a metal metal screen mask, and A film having a thickness of 120 μm and a size of 5 mm × 5 mm was produced using the paste. The obtained film was dried at 60 ° C. for 3 hours and then baked at 500 ° C. for 30 minutes to obtain a working electrode having a titanium oxide porous film as an electron-accepting layer. The working electrode thus obtained was irradiated with UV light overnight with a BLB lamp to remove dirt and residual organic matter.

  Subsequently, 5 'amine DNA as probe DNA was dissolved in 50 mM HEPES (pH 7.0) to prepare an aqueous solution (DNA concentration 50 μM). This solution was previously held at 95 ° C. for 3 minutes and then heat-denatured by cooling on ice (2 ° C.) for 3 minutes or more.

  A spacer-perforated tape was affixed on the electron-accepting layer of the working electrode obtained earlier, and air remaining on the tape adhesive surface was removed using the tip of a tweezers. On this tape, a silicon sheet having an opening of 5 mm × 5 mm square was placed and brought into close contact. This opening was charged with 25 μl of the previously prepared 5 ′ amine DNA solution (200 μM). At this time, the tip of the pipette tip was used so that the DNA solution was sufficiently distributed to the four corners of the opening of the silicon seal. Subsequently, the glass solution was covered with a glass plate so that air bubbles would not enter the DNA solution as much as possible, and then stored in a plastic container whose vapor pressure was adjusted with wet paper or the like. The 5 'amine DNA was incubated for 6 hours at 60 ° C in this vessel. Thereafter, the DNA solution was removed, and the electrode surface was gently washed with running water for 2 seconds, and then air was blown to scatter the remaining water. Thus, a working electrode carrying the probe DNA was obtained.

  Next, a blocking solution having a concentration of 50 mM is prepared by dissolving n-octyl phosphoric acid (manufactured by Wako Pure Chemical Industries, Ltd.) as a blocking agent in a mixed solvent of ethanol and water (volume ratio ethanol: water = 4: 1). did. Then, the working electrode carrying the probe substance was immersed in a sterilized plastic container having a capacity of 10 ml containing 5 ml of the blocking solution, and kept at 50 ° C. for 2 hours to incubate the blocking agent. After completion of the reaction, the electrode is taken out from the blocking solution, and the surface is gently washed with running water for 2 seconds, then immersed in 10 ml of ultrapure water for 30 minutes, and the surface is washed again with running water for 2 seconds, and then air is blown onto it. Residual water was scattered. Thus, a working electrode subjected to blocking was obtained.

-Hybridization 5'Cy5DNA-A as a dye-labeled test DNA and 5'Cy5DNA-B as a control were each dissolved in a 50 mM HEPES aqueous solution to prepare a test DNA and a control solution (DNA concentration 10 μM). These solutions were kept at 95 ° C. for 3 minutes in advance, and then heat-denatured by cooling on ice (2 ° C.) for 3 minutes or more.

  A spacer-perforated tape was attached to the working electrode on which the probe substance and the blocking agent obtained above were immobilized, and air remaining on the tape adhesive surface was removed using the tip of a tweezers. On this tape, a silicon sheet having an opening of 5 mm × 5 mm square was placed and brought into close contact. The opening was charged with 25 μl of the previously prepared test DNA and control DNA solution (50 μM). At this time, the tip of the pipette tip was used so that the DNA solution was sufficiently distributed to the four corners of the opening of the silicon seal. Subsequently, the glass solution was covered with a glass plate so that air bubbles would not enter the DNA solution as much as possible, and then stored in a plastic container whose vapor pressure was adjusted with wet paper or the like. Thus, hybridization was performed by incubating at 60 ° C. for 15 hours.

The working electrode thus hybridized was immersed in a washing solution and washed with gentle shaking. The cleaning liquid shown in the following Table 2 was used, and each cleaning liquid was cleaned at the cleaning time, the number of cleanings, and the temperature shown in the following table. The cleaning container was replaced every time the cleaning liquid was changed. Further, the working electrode was rinsed with water for 5 seconds, and air was quickly blown to scatter the remaining water.
Table 2
Cleaning fluid Cleaning time Number of cleanings per cleaning Temperature
HEPES, 0.1% Tween20 12 minutes 3 times, room temperature HEPES, 0.1% Tween20 13 minutes, 1 time 60 ° C
HEPES 6 minutes 2 times room temperature
Ultrapure water 15 minutes once Room temperature
Note) HEPES: 0.1% Tween 20 manufactured by Dojin Chemical Laboratory: Surfactant manufactured by SERVA Co. diluted to 0.1 vol% in ultrapure water

-Assembly of measuring cell A working electrode thus obtained and a platinum electrode as a counter electrode were bonded to each other while facing a spacer for preventing a short circuit to obtain a sandwich type measuring cell. At this time, a lead wire was connected to the end of the platinum electrode coated with platinum so that current could be taken out. The working electrode was also connected to an ammeter via a lead wire. As an electrolytic solution, a mixed solution was prepared by dissolving 0.05M iodine and 0.5M tetrapropylammonium iodide in a mixed solvent of ethylene carbonate and acetonitrile having a volume ratio of 8: 2. After 5 μL of this electrolytic solution was dropped on the platinum electrode, the working electrode was placed so that its electron-accepting layer was opposed to the platinum electrode. In this way, a sandwich type measurement cell was obtained in which the spacer and the electrolyte were sandwiched between the working electrode and the counter electrode.

-Measurement of photocurrent The lead wire of the working electrode and the lead wire of the counter electrode were connected to a potentiostat (manufactured by Hokuto Denko Corporation, HSV-100). Using a red LED (TOL-50aURsCEs manufactured by CCS Co., Ltd.), the working electrode surface was irradiated with light. At this time, the current value flowing between the working electrode and the counter electrode was measured over time by an ammeter. The current value was measured for 60 seconds, but the light irradiation was performed only for 30 seconds after 10 seconds from the start of current measurement.
(Example 2) Oligo DNA as blocking agent
As a blocking agent, the same procedure as in Example 1 was carried out except that a reaction was performed using a 200-mer 50 mM HEPES aqueous solution of 15-mer oligo DNA (5′-AACGTCTGACTGGGG-3 ′).

(Comparative example)
The procedure was the same as in Example 1 except that the blocking treatment was not performed.

The ratio of the photocurrent value obtained with the test DNA (5′Cy5DNA-A) having a complementary base sequence to the probe DNA and the non-complementary control DNA (5′Cy5DNA-B) From this, the S (A) / N (B) ratio was calculated. The results were as shown in Table 3.
Table 3
Blocking agent S (A) / N (B) ratio
Example 1 n-octyl phosphate 1.8
Example 2 15mer DNA 1.9
Comparative example None 1.3

From the results shown in Table 3, when n-octyl phosphate containing a phosphate group or oligo DNA is used as a blocking agent, the S / N ratio is remarkably high compared to a system not using a blocking agent. I understand. Therefore, it can be said that n-octyl phosphate or oligo DNA, which is the blocking agent of the present invention, is advantageous for base sequence selectivity between probe DNA and test DNA.

FIG. 4 is a diagram showing a process of immobilizing a test substance on a probe substance when the test substance is a single-stranded nucleic acid and the probe substance is a single-stranded nucleic acid complementary to the nucleic acid. (A) shows the case where the test substance is previously labeled with a sensitizing dye, and (b) shows the case where a sensitizing dye capable of intercalation is added to a double-stranded nucleic acid. It is a figure which shows the immobilization process to the probe substance of a test substance in case a test substance is a ligand, a mediator is a receptor protein molecule, and a probe substance is a double-stranded nucleic acid. It is a figure which shows the measurement cell by which the light source is arrange | positioned, and the part 21 enclosed with the dotted line in a figure is a measurement cell. FIG. 4 is a plan view of the measurement cell shown in FIG. 3. It is a figure which shows the fixation process to the probe substance of a test substance in case the test substance and the 2nd test substance which have the specific binding property which mutually compete are antigens, and a probe substance is an antibody.

Claims (18)

A blocking agent used in contact with a working electrode used for specific detection of a test substance using a photocurrent generated by photoexcitation of a sensitizing dye, characterized by having a phosphate group in the molecular skeleton Blocking agent 2. The blocking agent according to claim 1, wherein the molecular skeleton contains a functional group that induces an interaction between molecules. The blocking agent according to claim 2, wherein the interaction between molecules is van der Waals force. The blocking agent according to claim 2, wherein the interaction between the molecules is a hydrophobic interaction. The blocking agent according to claim 2, wherein the interaction between the molecules is a π-π interaction. The blocking agent according to claim 2, wherein the interaction between the molecules is a hydrogen bond. The blocking agent according to any one of claims 1 to 6, wherein the blocking agent is an organic phosphate compound. The blocking agent according to claim 7, wherein the blocking agent contains an alkyl group in a molecular skeleton. The blocking agent according to claim 7, wherein the blocking agent contains an allyl group in a molecular skeleton. The blocking agent according to claim 7, wherein the blocking agent contains a heterofunctional group in a molecular skeleton. The blocking agent for a dye-sensitized biosensor according to claim 8, wherein the organic phosphate compound is an alkyl phosphate. The blocking agent for a dye-sensitized biosensor according to claim 11, wherein the alkyl chain of the alkyl phosphate is a linear alkyl group having 1 to 18 carbon atoms. 8. The blocking agent according to claim 7, wherein the organic phosphoric acid compound is phenylphosphonic acid. The blocking agent according to claim 1, wherein the blocking agent is an oligo DNA. The specific detection of a test substance using a photocurrent generated by photoexcitation of the sensitizing dye comprises a sample solution containing the test substance and a probe substance capable of specifically binding directly or indirectly to the test substance. A working electrode provided on the surface and a counter electrode are prepared. In the presence of a sensitizing dye, the sample solution is brought into contact with the working electrode, and the test substance is directly or indirectly specific to the probe substance. The sensitizing dye is fixed to the working electrode by the bonding, the working electrode is washed with a cleaning solution, the working electrode and the counter electrode are brought into contact with an electrolyte medium, and light is applied to the working electrode. To photoexcite the sensitizing dye, and to detect a photocurrent flowing between the working electrode and the counter electrode due to electron transfer from the photoexcited sensitizing dye to the working electrode. Claims made by the process comprising Blocking agent according to any one of 1 to 14 Specific detection of a test substance using a photocurrent generated by photoexcitation of the sensitizing dye is performed by bringing a solution containing a probe substance capable of specifically binding directly or indirectly with the test substance into contact with the working electrode, The blocking agent according to claim 15, further comprising a step of obtaining a working electrode having the probe substance on the surface. A step of contacting or immersing a solution containing the blocking agent on a working electrode provided with a surface of the probe substance and then specifically or indirectly binding the test substance. The blocking agent according to claim 15 or 16, A specific detection of a test substance using a photocurrent includes a working electrode comprising a probe substance on the surface, to which a test substance is directly or indirectly specifically bound, and a sensitizing dye fixed by the binding. The counter electrode is brought into contact with an electrolyte medium, the working electrode is irradiated with light to photoexcite the sensitizing dye, and the working electrode is caused by electron transfer from the photoexcited sensitizing dye to the working electrode. The blocking agent as described in any one of Claims 1-14 performed by the process which comprises detecting the photocurrent which flows between between and the said counter electrode

Images