JP2013059273A - New function of sphingosine 1-phosphate transporter - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a medicine or reagent, having a new mechanism of action to immune system diseases, based on findings obtained by functional analysis of a Spns2 gene, and to provide a method useful for development and the like of medicines or reagents.SOLUTION: There are provided an immune function depressed non-human model animal provided by defection of the Spns2 gene, and a screening method for substances that controls the transmigration of lymphocytes from lymphoid organs into blood or lymph vessels, which method comprises: (a) a step of administering a test substance to the non-human model animal and a wild type control thereof; (b) a step of examining and comparing the number of lymphocytes in the blood or the lymph before and after the administration and of the non-human animal model and the wild type control, administered with the test substance; and (c) a step of selecting the test substance fluctuating the number of lymphocytes in the blood or the lymph based on the comparison result in the step (b).

Description

  The present invention provides immune function-reduced non-human model animals, screening methods for substances that control the release of lymphocytes from the lymphoid organs into the blood or lymph vessels, and immune function modulators.

Sphingosine 1-phosphate (hereinafter referred to as “S1P”) interacts with S1P receptor 1 (S1P ₁ ) -5 (S1P ₅ ), which is a G protein-coupled receptor present in the cell membrane, to cause vascular endothelial cells, It acts on vascular smooth muscle cells and the like to regulate vascular endothelial cell proliferation, smooth muscle contraction, and cell migration. In particular, the function of S1P during thrombus formation has attracted attention, and a new function as an immunomodulator has been clarified (Non-patent Document 1). The physiological significance of S1P and its receptor in the vascular system and immune system is being elucidated. Since S1P is present in a high concentration in the blood, the importance of S1P in the vascular system is predicted. In addition, the importance of S1P and its receptor in the immune system is being clarified by a new immunosuppressant (FTY720, Novartis Pharma Co., Ltd.) under clinical evaluation. FTY720, rather than acting directly in vivo, FTY720-P becomes phosphorylated, is said to act as agonists of SlP ₂ other than the receptor. Thus, the action of S1P and its receptor is being clarified.

S1P is generated intracellularly by phosphorylation of the 1-position hydroxyl group of sphingosine metabolized from cell membrane sphingomyelin by sphingokinase. In order to activate the S1P receptor S1P ₁ -S1P ₅ at the cell membrane surface, S1P needs to be transported out of the cell (FIG. 1).

  There are reports that ABCA1 and ABCC1 belonging to the ABC transporter are involved in the transport of S1P to the outside of cells (Non-Patent Documents 2 and 3), but whether or not it functions as a transporter of S1P depending on the assay method. This is not yet fully understood. On the other hand, it has recently been reported that SPNS2 is a transporter involved in the extracellular release of S1P (Patent Document 1, Non-Patent Documents 2 and 3).

  It has not been clarified or predicted at all what specific diseases this SPNS2 protein functional defect as an S1P transporter is directly linked to.

JP 2010-77045 A

Nat. Rev. Mol. Cell Biol., 9, 139-150 (2008) Science, 323, 524-527 (2009) Curr. Biol., 18, 1882-1888 (2008)

  Functional analysis of genes leads to the development of drugs or reagents having new action mechanisms for various diseases. The present invention is based on the knowledge obtained by functional analysis of a gene encoding SPNS2 (hereinafter sometimes abbreviated as "Spns2 gene" or "Spns2"). It is an object of the present invention to provide a useful means for developing pharmaceuticals or reagents. Another object of the present invention is to provide a useful means for the functional analysis of the Spns2 gene itself.

  The present inventor created a Spns2 knockout (KO) mouse and analyzed its trait, and found that the number of immune cells in the blood was decreased in the mouse. Therefore, the Spns2 gene is thought to play an important role in immune function. In addition, animals lacking the Spns2 gene are considered useful for development of drugs and research reagents for diseases such as immune system diseases, and for research use such as analysis of the Spns2 gene or immune function regulation mechanism.

Based on the above, the present inventors have completed the present invention. That is, the present invention is as follows:
[1] A non-human animal model with reduced immune function, which is deficient in the Spns2 gene.
[2] The non-human model animal according to [1], wherein the Spns2 gene deficiency is vascular endothelial cell-specific.
[3] The non-human model animal according to [1] or [2], wherein the animal is a mouse.
[4] The non-human model animal according to [1] to [3], wherein the number of lymphocytes in blood or lymph is reduced as compared to a wild-type control.
[5] The following steps:
(A) a step of administering a test substance to the non-human model animal according to [1] to [4] and a wild type control thereof,
(B) examining and comparing the number of lymphocytes in blood or lymph before and after administration in the non-human model animal and wild-type control administered with the test substance; and
(C) migration of lymphocytes from the lymph organ to the blood or lymph vessels, including the step of selecting a test substance that varies the number of lymphocytes in blood or lymph based on the comparison result of (b). A screening method for substances that regulate the release.
[6] The test substance has the following steps:
(1) a step of allowing SPNS2 expression cells to express SPNS2 and sphingosine kinase;
(2) The labeled sphingosine is added to the cell culture medium of (1) and cultured, the labeled sphingosine is introduced into the cell, and the sphingosine kinase expressed in the cell of (1) is reacted to give labeled sphingosine Producing 1-phosphate;
(3) A step of adding a test substance to the cell culture solution of (2) above and culturing, and allowing the test substance to interact with SPNS2 expressed in the cells;
(4) A step of measuring the amount of sphingosine 1-phosphate inside and outside the cell after culturing for a certain time.
The method according to [5], which is an antagonist and / or agonist screened by an SPNS2 antagonist and / or agonist screening method.
[7] The screening method according to [5] or [6], wherein the substance that controls lymphocyte emigration from a lymphoid organ into blood or lymphatic vessels is a substance that promotes the emigration.
[8] The screening method according to [5] or [6], wherein the substance that controls lymphocyte emigration from a lymphoid organ into blood or lymphatic vessels is a substance that inhibits the emigration.
[9] A regulator of lymphocyte emigration from a lymphoid organ into blood or lymphatic vessels, comprising a substance that regulates the expression or function of Spns2 gene or SPNS2.
[10] The agent according to [9], wherein the substance is a substance that inhibits the expression or function of the Spns2 gene or SPNS2, and regulation of lymphocyte emigration from a lymphoid organ into blood or lymphatic vessels is inhibition of emigration.
[11] The agent according to [10], wherein the substance that inhibits the expression or function of the Spns2 gene or SPNS2 is any of the following (i) or (ii):
(I) an antisense nucleic acid of the Spns2 gene, a ribozyme or RNAi-inducible nucleic acid molecule, or an expression vector containing these;
(Ii) An expression vector comprising an antibody or aptamer against SPNS2 or a nucleic acid encoding them.
[12] The agent according to [11], wherein the expression vector is expressed specifically in vascular endothelial cells.

  The animal of the present invention is useful as a model animal for immune system diseases and the like, and for analysis of the Spns2 gene and immune function regulation mechanism. The immune function-modulating agent of the present invention is useful as a medicine and a research reagent for immune system diseases and the like. The screening method of the present invention is useful for development of drugs and research reagents for immune system diseases and the like.

It is the schematic diagram which showed the action mechanism of S1P. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. Representative flow cytometric analysis of peripheral blood cells, numbers represent the percentage of CD4 single positive (SP) T cells and CD8 single positive (SP) T cells in total lymphocytes. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. The frequency (left) and total number (right) of CD4 SP (CD4) T cells and CD8 SP (CD8) T cells are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. Representative flow cytometric analysis of peripheral blood cells, numbers in the gate of the plot, of IgD ⁺ CD23 ⁺ cells in CD19 ⁺ peripheral blood lymphocytes (mature recirculating B cells; Mature rec. B) Represents a percentage. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. The frequency (left) and total number (right) of mature recirculating B cells (CD19 ⁺ CD23 ⁺ IgD ⁺ ) are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. Representative flow cytometric analysis of T cells in thymus, numbers indicate percentages of CD4 SP T cells, CD8 SP T cells, CD4CD8 double positive (DP) T cells, and CD4CD8 double negative (DN) T cells . Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. CD4 / CD8 DN (DN), CD4 / CD8 DP (DP), CD4 SP (CD4) and CD8 SP (CD8) thymocyte and T cell frequency (left) and total number (right) are shown (n = 11) . Bars and circles indicate values for average and individual mice, respectively. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. The frequency and total number of CD4 SP (CD4) T cells and CD8 SP (CD8) T cells in the peripheral lymph nodes are shown in the left and right panels, respectively (n = 11). Bars and circles indicate values for average and individual mice, respectively. Flow cytometric analysis of control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^{− / −} ) mice is shown. The frequency and total number of CD4 SP (CD4) T cells and CD8 SP (CD8) T cells in the spleen are shown in the left and right panels, respectively (n = 11). Bars and circles indicate values for average and individual mice, respectively. Shown are spleen sections from control (Spns2 ^{+ / +} ) and global Spns2 KO (Spns2 ^-/- ) mice stained to detect CD3 ⁺ T cells (dark grey) and B220 ⁺ B cells (light grey) . Expand the upper box area to the lower box. The scale bar represents 200 μm (top) and 50 μm (bottom). Flow cytometric analysis of B cells in control (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice is shown. Shown is a representative flow cytometric analysis of progenitor B cells, immature B cells and mature recirculating B cells in the medullary canal. Numbers indicate the percentage of IgM expressing cells and B220 expressing cells in total lymphocytes. Flow cytometric analysis of B cells in control (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice is shown. The frequency (left) and total number of pro- / pre-B cells (B220 ⁺ IgM ⁻ ), immature B cells (B220 ^low IgM ⁺ ) and mature recirculating B cells (B220 ^high IgM ⁺ ) as defined in FIG. Shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. Flow cytometric analysis of B cells in control (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice is shown. The frequency (left) and total number (right) of mature recirculation (Mature rec. B) B cells (CD19 ⁺ CD23 ⁺ IgD ⁺ ) in peripheral lymph nodes are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. Flow cytometric analysis of B cells in control (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice is shown. Transitional in the spleen relational (T1) B cells and B1 B cells ^{(T1 + B1; CD19 + CD21} - CD23 -), marginal zone ^{(MZ; CD19 + CD21 + CD23} low) B cells and follicular (FO; CD19 ⁺ CD21 ^low CD23 ⁺ ) B cell frequency (left) and total number (right) are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. Spns2 is a diagram showing that it is involved in S1P release from endothelial cells. (A-D) S1P (A), sphingosine (SPH) (B), lysophosphatidic acid (LPA) (C) and lysophosphocholine in control (Spns2 ^{+ / +} ) or Spns2 KO (Spns2 ^-/- ) mice The plasma concentration of (LPC) (D) is shown. Data are shown as mean ± SD (n = 3-5). (E) S1P release by blood cells isolated from control (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice. Cells were incubated for 90 minutes at either 4 ° C or 37 ° C. Data are expressed as a percentage of the total amount of S1P in unincubated cells and are expressed as mean ± SD (n = 4). (F, G) shows the release of S1P from endothelial cells depleted of Spns2. (F) S1P by endothelial cells transfected with either control siRNA (Control) or two independent siRNAs targeting Spns2 (Spns2 # 1 and Spns2 # 2) or without (-) release. (G) Real-time RT-PCR analysis to assess the effectiveness of siRNA-mediated Spns2 knockdown. In F and G, data are expressed relative to that observed in untransfected cells and are shown as the mean ± SD of 3 independent experiments. (H) In situ hybridization of Spns2 mRNA in thymus. Antisense (upper panel) and sense (lower panel) probes were hybridized to serial sections of the thymus. The box area in the left column is expanded to the right column. Arrows indicate blood vessels. The cortical and medullary regions are denoted by “C” and “M”, respectively. The scale bar represents 50 μm. The flow cytometry analysis of the lymphocyte of a control mouse (Spns2 ^{f / f} ) or a conditional EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mouse | mouth is shown. The frequency (left) and number (right) of CD4 SP (CD4) and CD8 SP (CD8) T cells in peripheral blood are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. The flow cytometry analysis of the lymphocyte of a control mouse (Spns2 ^{f / f} ) or a conditional EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mouse | mouth is shown. CD4 / CD8 DN (DN), CD4 / CD8 DP (DP), CD4 SP (CD4) and CD8 SP (CD8) thymocyte and T cell frequency (left) and number (right) in the thymus (n = 11). Bars and circles indicate values for average and individual mice, respectively. The flow cytometry analysis of the lymphocyte of a control mouse (Spns2 ^{f / f} ) or a conditional EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mouse | mouth is shown. The frequency (left) and number (right) of CD4 SP (CD4) and CD8 SP (CD8) T cells in the spleen are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. The flow cytometry analysis of the lymphocyte of a control mouse (Spns2 ^{f / f} ) or a conditional EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mouse | mouth is shown. The frequency (left) and number (right) of mature recirculating B (Mature rec. B) cells (CD19 ⁺ CD23 ⁺ IgD ⁺ ) in peripheral blood are shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. The flow cytometry analysis of the lymphocyte of a control mouse (Spns2 ^{f / f} ) or a conditional EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mouse | mouth is shown. Pro in the bone marrow - / pre -B cells (B220 ⁺ IgM ^-), indicating the frequency of immature B cells (B220 ^low IgM ⁺⁾ and mature recirculating B cells (B220 ^high IgM ⁺⁾ (left) and number (right) (N = 11). Bars and circles indicate values for average and individual mice, respectively. The flow cytometry analysis of the lymphocyte of a control mouse (Spns2 ^{f / f} ) or a conditional EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mouse | mouth is shown. Shows the frequency (left) and number (right) of transitional (T1) and B1 B cells (T1 + B1), marginal zone (MZ) B cells and follicular (FO) B cells in the spleen (n = 11). T1 and B1 B cells, marginal zone B cells and follicular B cells were defined by phenotype as described in the description of FIG. 3D. Bars and circles indicate values for average and individual mice, respectively. The creation of a conditional Spns2 knockout mouse is shown. (A) Schematic representation of wild-type Spns2 locus (Spns2 ⁺ ), targeted allele, floxed allele (Spns2 ^f ) and deleted allele (Spns2 ⁻ ). In the targeted allele, exon 2 (dark gray box) of the Spns2 gene is flanked by two loxP sites (light gray arrowheads). Along with the first loxP site, a neomycin selection cassette, PKG-Neo-pA (light gray box), adjacent to two frt sites (dark gray arrowheads) is inserted. Mice carrying the targeted Spns2 allele are crossed with transgenic mice expressing Flp recombinase under the control of the cytomegalovirus early enhancer / chicken beta actin (CAG) promoter to remove the PKG-Neo-pA cassette , Spns2 floxed mice were obtained. To create a conventional Spns2 knockout mouse, a mouse having a floxed Spns2 allele was bred with a transgenic mouse expressing Cre recombinase under the control of the cytomegalovirus (CMV) promoter. In order to inactivate the Spns2 gene in endothelial cells, Spns2 floxed mice were bred with Tie2-Cre mice with Cre recombinase driven by the Tie2 promoter. (B) Southern blot of genomic DNA from tail biopsies of Spns2 ^{f / f} , Spns2 ^{− / −} and Spns2 ^{+ / +} mice digested with AvrII using the probe indicated in A (black line) Analysis was performed. As expected, bands of 7.2 kb, 7.5 kb and 7.0 kb were detected in wild type mice (Spns2 ^{+ / +} ), Spns2 floxed mice (Spns2 ^{f / f} ) and Spns2 knockout mice (Spns2 ^-/- ) . (C) PCR analysis of genomic DNA from Spns2 ^{f / f} mice, Spns2 ^{− / −} mice and Spns2 ^{+ / +} mice using the primer set (arrow) for amplifying exon 2 shown in A It was. Amplified 552-bp, 842-bp and 316-bp fragments in wild-type mice (Spns2 ^{+ / +} ), Spns2 floxed mice (Spns2 ^{f / f} ) and Spns2 knockout mice (Spns2 ^-/- ) . (D) Spns2 ^{+ / +} mice, Spns2 ^{− / −} mice, Spns2 using a primer set for amplifying the exon 2 (upper panel) of the Spns2 gene and a primer set for amplifying the Cre recombinase gene (lower panel) Genomic PCR analysis of ^{f / −} mice, Spns2 ^{f / −} ; Tie2Cre mice, Spns2 ^{f / f} mice, and Spns2 ^{f / f} ; Tie2Cre mice was performed. It shows that Spns2 KO mice develop almost normally. (AF) Body weight and organ weight (body weight (A), heart (B), lung (C), 10 week old wild type (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice, Liver (D), spleen (E), kidney (F)) were measured. There was no difference in body weight and organ weight between wild type and Spns2 KO mice. Data are shown as mean ± SD (wild type, n = 11; Spns2 KO, n = 10). The blood biochemical test of Spns2 KO mice is shown. Total protein (TP) (A), total bilirubin (TBIL) (B), aspartate aminotransferase (AST) in 8-week-old wild type (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^-/- ) mice ) (C), alanine aminotransferase (ALT) (D), triglycerol (TG) (E), glucose (GLU) (F), blood urea nitrogen (BUN) (G) and albumin (ALB) (H) Plasma levels. There were no differences in blood biochemical parameters between wild-type mice (left) and Spns2 KO mice (right). Data are shown as mean ± SD (n = 4). The hematological profile of Spns2 KO mice is shown. Blood was drawn from 8-week-old wild type (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^-/- ) mice, and white blood cells (WBC) (A), red blood cells (RBC) (B), platelets (C), Analysis of hemoglobin (HBG) (D), hematocrit value (HCT) (E), mean red blood cell volume (MCV) (F), mean red blood cell hemoglobin content (MCH) (G), and mean red blood cell hemoglobin concentration (MCHC) (H) did. Spns2 KO (right) showed a decrease in white blood cell count compared to wild-type mice (left). Data are shown as mean ± SD (n = 4). The histological analysis of the thymus and peripheral lymph nodes (LN) of Spns2 KO mice is shown. Representative hematoxylin and eosin stained sections of thymus and peripheral LN of wild type (Spns2 ^{+ / +} ) and Spns2 KO (Spns2 ^{− / −} ) mice. No significant structural differences were detected in thymus and peripheral LN between Spns2 KO mice and control mice. Fig. 6 shows a decrease in the number of mature recirculating B (Mature rec. B) cells in the bone marrow of Spns2 KO mice. Representative flow cytometric analysis of bone marrow derived B cells from control (Spns2 ^{+ / +} ) or Spns2 KO (Spns2 ^{− / −} ) mice. (A) Numbers indicate the percentage of CD19 ⁺ B cells that express IgM and IgD. Mature recirculation B (. Mature rec B) cells and immature B cells, respectively CD19 ⁺ IgM ⁺ IgD ⁺ and CD19 ⁺ IgM ⁺ IgD ^- was identified as. (B) Shows the frequency (left) and number (right) of mature recirculating B cells and immature B cells (n = 11). Bars and circles indicate values for average and individual mice, respectively. The plasma concentration of glycerophospholipid in Spns2 KO mice is shown. Control (Spns2 ^{+ / +} ) or Spns2 KO (Spns2 ^-/- ) mice lysophosphatidylethanolamine (LPE) (A), lysophosphatidylglycerol (LPG) (B), lysophosphatidylinositol (LPI) (C) and Plasma levels of lysophosphatidylserine (LPS) (D). Data are shown as mean ± SD (n = 3). The expression of Spns2 in endothelial cells is shown. RT-PCR analysis was performed to verify the expression of Spns2 in endothelial cells. Total RNA is isolated and reverse transcribed from human umbilical vein endothelial cells (HUVEC), human microvascular endothelial cells (HMVEC), human aortic endothelial cells (HAEC), human skin lymphatic endothelial cells (HDLEC), HeLa cells and HEK293 cells CDNA was generated. PCR was performed using primers specific for either Spns2 (upper panel) or GAPDH (lower panel). Reactions for Spns2 and GAPDH were performed for 30 and 25 cycles, respectively. RT-PCR was also performed in the absence of reverse transcriptase (-) to confirm the presence of contaminating genomic DNA. FIG. 6 shows a decrease in the number of mature T cells in peripheral lymph nodes of EC-Spns2 cKO mice. Frequency of CD4 SP (CD4) and CD8 SP (CD8) T cells in the peripheral lymph nodes from control mice (Spns2 ^{f / f} ) or EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mice (left) and Number (right) is shown (n = 11). Bars and circles indicate values for average and individual mice, respectively. FIG. 5 shows a decrease in the number of mature recirculating B cells in the bone marrow of EC-Spns2 cKO mice. Flow cytometric analysis of bone marrow-derived B cells from control mice (Spns2 ^{f / f} ) or EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mice. (A) Numbers indicate the percentage of CD19 ⁺ B cells that express IgM and IgD. Mature recirculation B (. Mature rec B) cells and immature B cells, respectively CD19 ⁺ IgM ⁺ IgD ⁺ and CD19 ⁺ IgM ⁺ IgD ^- was identified as. (B) The frequency (left) and number (right) of mature recirculating B cells and immature B cells are shown in the left and right panels, respectively (n = 11). Bars and circles indicate values for average and individual mice, respectively. Number of mature recirculating B cells in peripheral lymph nodes of EC-Spns2 cKO mice. Frequency (left) and number of mature recirculating B cells (CD19 ⁺ CD23 ⁺ IgD ⁺ ) in peripheral lymph nodes from control mice (Spns2 ^{f / f} ) or EC-Spns2 cKO (Spns2 ^{f / f} ; Tie2Cre) mice ( Right) (n = 11). Bars and circles indicate values for average and individual mice, respectively.

(1. Definition)
In the present invention, “gene” is used to include not only double-stranded DNA but also each single-stranded DNA such as sense strand and antisense strand constituting the DNA. The length is not particularly limited. In the present invention, unless otherwise specified, a gene (DNA) is a double-stranded DNA containing human genomic DNA and a single-stranded DNA containing DNA (positive strand) and a single-stranded DNA having a sequence complementary to the positive strand. (Complementary strands) and any of these fragments are included. The “gene” includes not only a “gene” represented by a specific base sequence (SEQ ID NO: 1) but also a protein having a biological function equivalent to the protein encoded by these (eg, a homolog (homologue or "Genes" encoding splice variants, etc.), variants and derivatives) are included. Specifically, a “gene” encoding such a homologue, variant or derivative is a base sequence that hybridizes with a complementary sequence of the specific base sequence shown in SEQ ID NO: 1 under stringent conditions. The “gene” possessed can be mentioned. Here, the stringent conditions are the melting temperature (Tm) of the nucleic acid as taught by Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). Can be determined based on For example, as washing conditions after hybridization, conditions of about “1 × SSC, 0.1% SDS, 37 ° C.” can be given. The complementary strand is preferably one that maintains a hybridized state with the target positive strand even when washed under such conditions. Although it is not particularly limited, washing conditions such as “0.5 × SSC, 0.1% SDS, 42 ° C.” are set as stricter hybridization conditions, and “0.1 × SSC, 0.1% SDS, 65 ° C.” are set as stricter hybridization conditions. Can do.

  For example, as a gene encoding a homologue of a human-derived protein, genes of other species such as mouse and rat corresponding to the human gene encoding the protein can be exemplified, and these genes (homologues) are homologous genes (http: / /www.ncbi.nlm.nih.gov/HomoloGene/). Specifically, a specific human base sequence is matched by BLAST (Proc. Natl. Acad. Sci. USA 90: 5873-5877, 1993, http://www.ncbi.nlm.nih.gov/BLAST/) ( Get the accession number of the sequence (Score is the highest, E-value is 0 and Identity is 100%). The UniGene Cluster ID (number indicated by Hs.) Obtained by inputting the accession number to UniGene (http://www.ncbi.nlm.nih.gov/UniGene/) is input to the homologene. From the list showing the correlation of gene homologues between the other species gene and the human gene obtained as a result, genes of other species such as mice and rats as homologues corresponding to the human gene indicated by a specific base sequence Can be selected.

  In the present invention, “Spns2 gene” or “Spns2 DNA” refers to a human Spns2 gene (DNA) represented by a specific base sequence (SEQ ID NO: 1), and its homologues, mutants, derivatives and the like (DNA) ). Specifically, the human Spns2 gene set forth in SEQ ID NO: 1 and mouse homologs and rat homologs thereof are included. The gene or DNA does not ask for distinction of the functional region, and can include, for example, an expression control region, a coding region, an exon, or an intron.

  In the present invention, the term “protein” or “peptide” includes not only “protein” or “peptide” represented by a specific amino acid sequence (SEQ ID NO: 2) but also a biological function equivalent thereto. , Homologues thereof (homologs and splice variants), mutants, derivatives, matured forms and amino acid modified forms. Here, examples of homologs include proteins of other species such as mice and rats corresponding to human proteins, and these were identified by HomoloGene (http://www.ncbi.nlm.nih.gov/HomoloGene/). It can be identified a priori from the base sequence of the gene. Such variants include naturally occurring allelic variants, non-naturally occurring variants, and variants having amino acid sequences modified by artificial deletions, substitutions, additions and insertions. . Examples of the mutant include those that are at least 70%, preferably 80%, more preferably 95%, and still more preferably 97% homologous to a protein or (poly) peptide without mutation. The derivatives include those substituted at the amino terminus or carboxy terminus or side chain of the protein. The amino acid modifications include naturally occurring amino acid modifications and non-naturally occurring amino acid modifications, and specific examples include phosphorylated forms of amino acids.

  When the term “SPNS2” is used in the present invention, human SPNS2 represented by the specific amino acid sequence (SEQ ID NO: 2) and its homologues, mutants, derivatives, matures, amino acid modifications, etc., unless otherwise specified by the SEQ ID NO: It is used for the purpose of including.

  In the present specification, SPNS2 usually means those derived from warm-blooded animals (mammals or birds). Examples of mammals include, for example, laboratory animals such as rodents and rabbits such as mice, rats, hamsters, and guinea pigs, domestic animals such as pigs, cows, goats, horses, sheep and minks, pets such as dogs and cats, humans, Examples include, but are not limited to, primates such as monkeys, cynomolgus monkeys, rhesus monkeys, marmosets, orangutans and chimpanzees. Examples of the birds include chickens, quails, ducks, geese, turkeys, emu, ostriches, guinea fowls, and pigeons. SPNS2 is preferably derived from a mammal, more preferably from a primate (human etc.) or a rodent (mouse etc.).

  “SPNS2 is derived from a mammal” means that the sequence (nucleotide sequence or amino acid sequence) of SPNS2 is mammalian.

  In the present invention, “the function of the Spns2 gene” means that SPNS2, which is a transmembrane protein, transports S1P through the biological membrane (transport function) and the lymphocytes in vivo based on the transport function. It functions to control the export of lymph organs into the blood and lymph vessels.

In the present invention, the Spns2 gene, for example, the human Spns2 gene is disclosed in Japanese Patent Application Laid-Open No. 2010-77045, and can be isolated by a method known per se. Moreover, representative nucleotide sequences and amino acid sequences of human and mouse SPNS2 are registered in NCBI as follows.
[Human SPNS2]
Nucleotide sequence (cDNA sequence): Accession No. AB441165 (SEQ ID NO: 1)
Amino acid sequence: Accession number No. BAH15192.1 (SEQ ID NO: 2)
[Mouse SPNS2]
Nucleotide sequence (cDNA sequence): Accession number AB441166 (SEQ ID NO: 3)
Amino acid sequence: Accession number BAH15193.1 (SEQ ID NO: 4)

  In this specification, the nucleotide sequence is described as a DNA sequence unless otherwise specified. However, when the polynucleotide is RNA, thymine (T) is appropriately read as uracil (U).

(2. Animals)
The present invention provides a non-human animal with reduced immune function, which is deficient in the Spns2 gene.

  The species of the animal of the present invention is not particularly limited as long as it is an animal excluding humans, but mammals and birds are preferred. Mammals include, for example, laboratory animals such as mice, rats, hamsters, guinea pigs and rabbits, domestic animals such as pigs, cows, goats, horses and sheep, pets such as dogs and cats, primates such as monkeys, orangutans and chimpanzees. Is mentioned. Examples of birds include chickens. Mice are preferred because of their ease of use in genetic engineering.

  Spns2 gene deficiency refers to a state in which the normal function inherent to the Spns2 gene cannot be sufficiently exerted, for example, the state in which the Spns2 gene is not expressed at all, or the normal function inherent to the Spns2 gene cannot be exhibited. A state in which the expression level is reduced, a state in which the function of the Spns2 gene product is completely lost, or a state in which the function of the Spns2 gene product is reduced to such an extent that the normal function inherent to the Spns2 gene cannot be exhibited.

  The vascular cell in the present invention refers to a cell constituting a blood vessel in a living body or a precursor cell thereof. Examples of vascular cells include vascular endothelial cells, vascular wall cells, vascular smooth muscle cells, hemangioblasts, and endothelial progenitor cells, with vascular endothelial cells being preferred.

  As used herein, a vascular endothelial cell refers to a cell that constitutes the inner surface of a blood vessel and is in contact with a blood circulation lumen. These cells line the inner wall of all circulatory systems from the heart to capillaries.

As used herein, a lymphocyte refers to a cell that is an immune cell and plays a role in immunity (eg, humoral immunity, cellular immunity) in vivo, or a precursor cell thereof, for example, B Examples include cells, T cells, NKT cells, etc., but B cells are more preferable. B cells can be any B-lineage cell, eg, pro-B cells, pre-B cells, immature B cells found in bone marrow, depending on the stage of differentiation, and It can be classified into mature B cells, GC (germinal center) B cells found in the spleen, and memory B cells, plasma cells, and the like based on their properties. Since cell markers specific to each cell are known, those skilled in the art can identify the type of immune cell by immunological techniques, and by using a cell sorting method such as FACS. It is possible to sort immune cells according to their type. For example, in mice, the cell markers are as follows: B cells (B220 ⁺ ); T cells (CD3 ⁺ ), NK cells (NK1.1 ⁺ ), NKT cells (TCR ⁺ , NK1.1 ⁺ ); Macrophages (Mac1 ⁺ ); pro B cells (B220 ⁺ , CD43 ⁺ , IgM ⁻ ), pre-B cells (B220 ⁺ , CD43 ⁻ , IgM ⁻ ); immature B cells (B220 ⁺ , CD43 ⁻ , IgM ⁺ ); mature B Cells (B220 ⁺ , PNA ⁻ ); GC B cells (B220 ⁺ , PNA ⁺ ).

  The animal of the present invention has various characteristics associated with a functional defect of the Spns2 gene. For example, the animals of the present invention may have a reduced number of lymphocytes in blood or lymph as compared to wild type animals.

  In one embodiment, the animal of the present invention may be an animal with genomic DNA modification, a so-called knockout animal. The animal of the present invention may be a Spns2 gene-deficient heterozygote or a Spns2 gene-deficient homozygote.

  The animal of the present invention may also be an animal containing a cell-specific deletion of the Spns2 gene. Such an animal preferably contains at least a Spns2 gene deficiency in vascular endothelial cells. Such animals can also exhibit the traits described above.

  The animal of the present invention can be produced by a method known per se. First, a method for producing a chimeric animal useful for producing the animal of the present invention will be described. The animals of the present invention also include chimeric animals useful for producing the animals of the present invention.

A chimeric animal can be produced, for example, by a method including the following steps (a) to (c).
(A) providing an embryonic stem cell containing a deletion of the Spns2 gene;
(B) introducing the embryonic stem cell into an embryo to obtain a chimeric embryo;
(C) transferring the chimeric embryo to an animal to obtain a chimeric animal;

  In step (a) of the above method, embryonic stem cells (ES cells) containing a Spns2 gene deficiency can be prepared, for example, by the method described below.

  In step (b) of the above method, the animal species from which the embryo is derived may be the same as the animal species of the present invention, and is preferably the same as the animal species from which the embryonic stem cells to be introduced are derived. Examples of embryos include blastocysts and 8-cell stage embryos. Embryos can be obtained by mating female animals that have undergone superovulation treatment with hormone agents (for example, using PMSG having FSH-like action and hCG having LH action) and the like. Examples of methods for introducing embryonic stem cells into the embryo include micromanipulation methods and aggregation methods.

  In step (c) of the above method, the chimeric embryo can be transferred to the uterus of the animal. The animal into which the chimeric embryo is transferred is preferably a pseudopregnant animal. A pseudopregnant animal can be obtained by mating a female animal having a normal cycle with a male animal castrated by vagina ligation or the like. The animal into which the chimeric embryo has been introduced becomes pregnant and gives birth to the chimeric animal.

  Next, it is confirmed whether the born animal is a chimeric animal. Whether or not the animal born is a chimeric animal can be confirmed by a method known per se, for example, by body color or coat color. Further, for discrimination, DNA may be extracted from a part of the body, and Southern blot analysis or PCR may be performed.

The animal of the present invention can be produced, for example, by a method including the following steps (a) to (d):
(A) providing an embryonic stem cell containing a deletion of the Spns2 gene;
(B) introducing the embryonic stem cell into an embryo to obtain a chimeric embryo;
(C) transferring the chimeric embryo to an animal to obtain a chimeric animal;
(D) A step of mating the chimeric animal to obtain a Spns2 gene-deficient heterozygote.

  Steps (a) to (c) of the above method can be performed in the same manner as the method for producing a chimeric animal described above.

  In step (d) of the above method, the chimeric animal obtained in step (c) is mated after it matures. The mating can preferably take place between wild-type animals and chimeric animals or between chimeric animals. Whether or not the Spns2 gene deficiency has been introduced into germline cells of a chimeric animal and a Spns2 gene deficient heterozygous offspring has been obtained can be confirmed by various methods using indices known per se, for example, the body of a progeny animal It can be distinguished by color and coat color. For discrimination, DNA may be extracted from a part of the body, and Southern blot analysis or PCR assay may be performed. Furthermore, a Spns2 gene-deficient homozygote can be produced by crossing the thus obtained Spns2 gene-deficient heterozygotes.

  In general, in the process of creating a knockout animal, a progeny animal having a genotype in which a gene derived from an embryonic stem cell and a gene derived from the animal used for mating are hybridized is obtained. In some cases, it may be difficult to examine the unique effects due to the loss. Therefore, in order to more appropriately extract only the effects peculiar to the Spns2 gene deficiency, the obtained Spns2 gene deficient animal (heterozygote or homozygote) is backcrossed to a pure animal strain for about 5 to 8 generations. It is preferable to do. In addition, when backcrossing is carried out only by natural mating, it may take a long time, so in vitro fertilization techniques can be used as appropriate when it is desired to speed up generational changes.

  In addition, when the animal of the present invention is an animal lacking the cell-specific Spns2 gene, such an animal includes, for example, an animal prepared by using a predetermined targeting vector (described later) containing a recombinase target sequence, and at least It can be produced by crossing a knockout animal that expresses recombinase in vascular cells (for example, a knockout animal that expresses recombinase specifically in vascular endothelial cells). Moreover, you may make a recombinase or a recombinase expression vector act on the vascular cell of the animal produced by use of the targeting vector (after-mentioned) containing a recombinase target sequence. For example, as a method of causing recombinase to act on vascular endothelial cells, or a method of causing recombinase to act specifically on the cells, a method using an expression vector containing a vascular endothelial cell-specific promoter (for example, Tie2 promoter), Examples thereof include a method using Epstein-Barr virus as an expression vector and a method using a liposome in which an antibody against a cell surface molecule specifically expressed in vascular endothelial cells is incorporated.

  In another embodiment, the animal of the present invention can be an animal without genomic DNA modification. Such animals can be prepared, for example, by forced expression in animals of substances (for example, antisense nucleic acids, RNAi-inducible nucleic acids) that suppress the expression or function of the Spns2 gene described below. Administration can be carried out using a suitable delivery means such as, for example, liposomes. It is also possible to achieve cell-specific deletion of the Spns2 gene. For example, in order to achieve vascular endothelial cell-specific deletion of the Spns2 gene, a method similar to the method of allowing recombinase to act specifically on vascular endothelial cells can be used.

The animal of the present invention is useful as an immune system disease model. The immunodeficiency disease that the animal of the present invention can serve as a model can be a disease accompanied by a decrease in immune function, for example, a disease accompanied by a decrease in humoral or cellular immune function. A disease accompanied by a decrease in humoral immune function may be a disease that can be caused by a decrease in the number of B cells in blood or lymph. On the other hand, a disease accompanied by a decrease in cellular immune function can be a disease that can be caused by a decrease in the number of T cells in blood or lymph. As an immunodeficiency disease accompanied by suppression of humoral immune function, for example, diseases accompanied by a decrease in antibody production ability (for example, γ-globulinosis, BLNK deficiency) can be mentioned. On the other hand, examples of immunodeficiency diseases accompanied by suppression of cellular immune function include Di George syndrome, class II MHC deficiency, and T cell depletion / deficiency (for example, idiopathic CD4 ⁺ T cell depletion). .

  The animal of the present invention is also useful for analysis of the Spns2 gene and immune function regulating mechanism, and development of immune function regulating agents. For example, by comprehensively analyzing gene expression in the animal of the present invention, it becomes possible to identify other genes involved in immune function regulation (for example, genes showing an expression pattern linked to the expression pattern of the Spns2 gene). . In this case, for example, in the animal of the present invention, a gene expression profile is measured by means (for example, microarray) that enables comprehensive analysis of gene expression, and a control animal (such as a wild-type animal or other immune disease model animal) Compared to gene expression profiles of homologous or xenogeneic animals). In addition, the gene expression profile of the animal of the present invention can be traced over time, and the link between the expression and progression of the disease state and the change in the gene expression profile can be evaluated.

  The animal of the present invention can be produced by using a targeting vector capable of inducing homologous recombination of the Spns2 gene, comprising a first polynucleotide and a second polynucleotide homologous to the Spns2 gene, and a selectable marker.

  The first and second polynucleotides are polynucleotides having sufficient sequence identity and length to cause homologous recombination with the genomic DNA containing the Spns2 gene. The first and second polynucleotides each correspond to a different region of genomic DNA containing the Spns2 gene.

  Also, the first and second polynucleotides are selected so as to cause deletion of the Spns2 gene by homologous recombination. That is, when the genomic DNA containing the Spns2 gene in the first and second polynucleotides deletes a genomic DNA partial region existing between two regions homologous to the first and second polynucleotides, Selected to result in a deletion of the Spns2 gene. Such a region can be appropriately determined by those skilled in the art. For example, the first and second polynucleotides are such that one or more exons (eg, exons 3 to 5), or at least a promoter region or an enhancer region are deleted. Is selected.

  The degree of identity of the first and second polynucleotides to the genomic DNA containing the Spns2 gene is not particularly limited as long as homologous recombination is possible. For example, the degree of identity that allows homologous recombination depends on the length of the polynucleotide, but for example at least about 80% or more, preferably at least about 85% or more, more preferably at least about 90% or more, most Preferably it may be about 95-100%. The percent identity can be determined by a method known per se, for example, by using BLASTN available on the NCBI homepage with default settings. % Identity also uses the Smith-Waterman algorithm to affine gap search with a gap open penalty of 12 and a gap extension penalty of 1. ) May be determined.

  The length of the first and second polynucleotides is not particularly limited as long as homologous recombination of genomic DNA occurs. However, in general, a longer homologous region is better for efficient homologous recombination of genomic DNA with a targeting vector. On the other hand, the length of DNA that can be inserted is limited to a certain value depending on the type of targeting vector. Therefore, considering these, the length of the first polynucleotide and the second polynucleotide can be, for example, 0.5 kb-20 kb, preferably 1 kb-10 kb.

  In one embodiment, a selectable marker is included between the first polynucleotide homologous to the Spns2 gene and the second polynucleotide (in other words, inside). In this case, the selection marker is preferably a positive selection marker. A positive selectable marker is a gene that encodes a product that allows only cells carrying the gene to survive and / or proliferate under certain conditions, such as the neomycin resistance gene, the hygromycin B phosphotransferase (BPH) gene, Examples include the shidine S deaminase gene and the puromycin resistance gene.

  In another embodiment, a selectable marker is included outside the first polynucleotide homologous to the Spns2 gene and the second polynucleotide. In this case, the selection marker is preferably a negative selection marker. Negative selectable markers are genes that act toxic to cells having DNA inserts integrated into non-targeting chromosomal sites, such as the herpes simplex virus (HSV) thymidine kinase (tk) gene, diphtheria toxin A fragment (DTA) gene etc. are mentioned.

  The targeting vector can contain either a positive selection marker or a negative selection marker, preferably both.

  The vector serving as the basic skeleton of the targeting vector is not particularly limited as long as it is capable of self-replication in a cell to be transformed (for example, E. coli). For example, commercially available pBluescript (manufactured by Stratagene), pZErO 1.1 (Invitrogen), pGEM-1 (Promega) and the like can be used.

  The targeting vector may also contain more than one recombinase target sequence. Two or more recombinase target sequences can be placed in the same or opposite orientation. Two or more recombinase target sequences are located between the first and second polynucleotides homologous to the Spns2 gene (in other words, inside). Such targeting vectors allow so-called conditional knockouts.

  As a recombinase target sequence, a sequence known in the art, for example, a loxP sequence used in a Cre / loxP system derived from bacteriophage P1, or an FRT sequence used in a FLP / FRT system derived from yeast can be used.

  In one embodiment, a partial region in genomic DNA containing the Spns2 gene, or the region and a positive selection marker are placed between two recombinase target sequences (in other words, inside). Specifically, the recombinase target sequence is arranged in the form of a recombinase target sequence—partial region in genomic DNA containing the Spns2 gene (and a positive selection marker) —recombinase target sequence.

  In another embodiment, a partial region in the genomic DNA containing the Spns2 gene and a positive selection marker are individually placed between the three recombinase target sequences. Specifically, the recombinase target sequence is arranged in the form of recombinase target sequence-partial region in genomic DNA containing the Spns2 gene-recombinase target sequence-positive selection marker-recombinase target sequence.

  A partial region in genomic DNA contained between two or more recombinase target sequences is a region in which deletion of the Spns2 gene is caused by the deletion of the region under the action of recombinase. Such a region can be appropriately determined by those skilled in the art, and may be, for example, a region including at least one exon, or a promoter region or an enhancer region.

  The targeting vector can be produced by a method known per se. For example, a targeting vector can be produced by inserting a first polynucleotide and a second polynucleotide homologous to the Spns2 gene and the selectable marker into the vector. In order to prepare such a targeting vector, it is necessary to first isolate a genomic DNA fragment containing the Spns2 gene. However, the genomic DNA fragment may be efficiently recombined during homologous recombination. It is preferable to isolate from the same animal species from which the ES cells to be produced are derived. In order to further increase the efficiency of homologous recombination, it is more preferable to isolate genomic DNA from animals of the same strain among animals of the same species from which ES cells are derived.

For details of the production of the animal of the present invention and the production of the targeting vector, see, for example, the following documents.
1. Separate Experiment Medicine The Protocol Series “The Latest Technology of Gene Turding” (2000, Yodosha) Conditional Targeting Method p.115-120
2. BioManual Series 8 “Gene Targeting” -Generation of mutant mice using ES cells (1995, Yodosha) p.71-77
3. Sambrook et al., Molecular Cloning: A LABORATORY MANUAL, 3rd edition, COLD SPRING HARBO
R LABORATORY PRESS, 2001, 4. 82-4.85
4). Robertson EJ in Teratocarcinomas and embryonic stem cells-a practical approach, ed. Robertson, EJ (IRL Press, Oxford), 1987: pp.108-112
5. Dynecki, SM et al., Gene Targeting -a practical approach, 2nd edition, ed.Joyner, AL (Oxford Univ. Press), 2000: pp.68-73
6). Dynecki, SM et al., Gene Targeting -a practical approach, 2nd edition, ed.Joyner, AL (Oxford Univ. Press), 2000: pp.75-81

(3. Screening method for substances capable of regulating immune function)
The present invention also provides a screening method for a substance that controls the release of lymphocytes from the lymph organ into blood or lymph vessels, characterized in that the test substance regulates the expression or function of the Spns2 gene.

  The test substance to be subjected to the screening method may be any known compound and novel compound, for example, nucleic acid, carbohydrate, lipid, protein, peptide, low molecular organic compound, compound prepared using combinatorial chemistry technology Examples include libraries, random peptide libraries prepared by solid phase synthesis and phage display methods, or natural components derived from microorganisms, animals and plants, marine organisms, and the like. Before being subjected to the screening method of the present invention, it is desirable to select as a candidate substance a test substance that regulates the expression and function of the Spns2 gene or SPNS2 as a primary screening.

The screening method of the present invention is a screening method for a substance that controls the release of lymphocytes from the lymphoid organs into the blood or lymph vessels, including the following steps (a) to (c):
(A) a step of administering a test substance to the non-human model animal of the present invention and the wild-type control of the non-human model animal;
(B) examining and comparing changes in the number of lymphocytes in blood or lymph before and after administration in the non-human model animal and wild type control to which the test substance has been administered; and
(C) A step of selecting a test substance that varies the number of lymphocytes in blood or lymph based on the comparison result of (b).

  The method for administering the test substance to the animal of the present invention is not particularly limited, and can be administered orally or parenterally. Examples of parenteral routes of administration include systemic administration such as intravenous, intraarterial, intramuscular, intraperitoneal, and intratracheal routes, or local administration near the target cell.

  The dosage of the test substance can be appropriately set according to the type of active ingredient, the size of the molecule, the administration route, the animal species to be administered, the drug acceptability of the administration subject, body weight, age, and the like.

  In the step (b), the number of lymphocytes in blood or lymph before and after administration in the wild-type control to which the test substance is administered is examined, and blood in the non-human model animal of the present invention to which the test substance is administered or Compare with the number of lymphocytes in the lymph.

  In the step (b), the number of lymphocytes in blood or lymph before and after administration in the non-human model animal of the present invention and wild type control to which the test substance is administered is examined by a method known per se. For example, blood or lymph is collected from a non-human model animal and its wild type control, stained with an antibody against a cell surface marker characteristic of lymphocytes, etc., and using a measuring instrument such as a flow cytometer, The number of lymphocytes in lymphatic vessels can be measured.

  As the “blood”, blood derived from any tissue can be assumed, but peripheral blood is usually used for ease of collection. As a blood collection method, a method known per se can be applied. The collected blood may be used in this step as it is, or may be used after being treated with an anticoagulant.

  “Lymph fluid” is a generally alkaline yellow serous fluid present in lymphatic vessels that contains plasma proteins leaked from blood vessels and macromolecular substances excreted from cells in tissues as components. A body fluid that exhibits similar properties. Collection of lymph can be performed, for example, by placing a collection catheter in the duodenum and thoracic lymph of the non-human model animal or its wild type control.

  Alternatively, in the step (b), in the screening method, instead of measuring the number of lymphocytes, lymph nodes are removed from the non-human model animal and its wild-type control and fixed, and a cell surface characteristic of lymphocytes is obtained. It may be stained with an antibody against the marker or the like and compared for promotion / inhibition of lymphocyte migration immunohistochemically.

  In the step (c), based on the comparison result obtained in the step (b), a substance that controls the release of lymphocytes from the lymph organ into the blood or lymphatic vessels is selected. The number of lymphocytes in blood or lymph vessels in the wild type control after administration of the test substance is relatively larger than the number of lymphocytes in blood or lymph vessels in the wild type control before administration, and the test substance If the change in the number of lymphocytes in the blood or lymphatic vessels before and after administration of the test substance in the non-human model animal to which is administered is smaller or substantially less than that in the wild control type, the test substance is It can be selected as a substance that promotes the migration of lymphocytes from the lymphoid organs into the blood or lymph vessels in an SPNS2-dependent manner. Conversely, the number of lymphocytes in blood or lymph vessels in the wild type control after administration of the test substance is relatively less than the number of lymphocytes in blood or lymph vessels in the wild type control before administration, If the change in the number of lymphocytes in the blood or lymph vessels before and after administration of the test substance in the non-human model animal to which the test substance is administered is smaller or substantially less than that in the wild control type, the test The substance can be selected as a substance that suppresses the release of lymphocytes from the lymphoid organs into the blood or lymph vessels in an SPNS2-dependent manner.

  In step (c) of the above method, a test substance that regulates the expression / function of the Spns2 gene or SPNS2 can be selected. The regulation of the expression / function of the Spns2 gene or SPNS2 can be the increase or decrease of expression / promotion or inhibition of function. For example, a test substance that increases (promotes expression) the expression of the Spns2 gene or SPNS2 can be a substance that promotes migration from a lymphoid organ into the blood or lymphatic vessels, for example, prevention / treatment of immunodeficiency diseases Can be a medicine. On the other hand, a test substance that decreases (suppresses expression) the expression of the Spns2 gene or SPNS2 can be a substance that inhibits the release from the lymph organ into the blood or lymph vessels, such as an autoimmune disease or an allergic disease. It can be a preventive / therapeutic agent. Similarly, the test substance that promotes the function of the Spns2 gene or SPNS2 can be a substance that promotes the migration of lymph organs into the blood or lymph vessels, and can be, for example, a prophylactic / therapeutic agent for immunodeficiency diseases. On the other hand, the test substance that inhibits the function of the Spns2 gene or SPNS2 can be a substance that inhibits the release from the lymph organ into the blood or lymph vessels, and can be, for example, a prophylactic / therapeutic agent for autoimmune diseases or allergic diseases. . Therefore, it is possible to select a candidate substance for a medicine such as a preventive / therapeutic agent for immune system diseases or a research reagent, using the expression level of Spns2 gene or SPNS2 as an index.

  The screening method of the present invention can also be useful as a secondary screening for antagonists or agonists of SPNS2, for example. The antagonist or agonist of SPNS2 may be a known substance. For example, the antagonist or agonist candidate substance selected by the SPNS2 antagonist or agonist screening method disclosed in JP 2010-770451 A You may use for the screening method of invention.

The SPNS2 antagonist or agonist screening method can be performed, for example, by the following steps (1) to (4).
(1) a step of allowing SPNS2 expression cells to express SPNS2 and sphingosine kinase;
(2) A step of adding Sphingosine to the cell culture medium of (1) above, culturing, introducing the sphingosine into the cell, and reacting the sphingosine kinase expressed in the cell of (1) to produce S1P ;
(3) A step of adding a test substance to the cell culture solution of (2) above and culturing, and allowing the test substance to interact with SPNS2 expressed in the cells;
(4) A step of measuring the amount of S1P inside and outside the cell after culturing for a certain time.

  In the step (1), the cell contains cDNA encoding SPNS2. Specifically, a cell capable of expressing SPNS2 can be constructed by constructing a plasmid having the cDNA downstream of the promoter of the expression vector, preparing an expression vector, and introducing it into a host cell. Here, the expression vector is not particularly limited as long as it is a vector capable of expressing SPNS2. Specific examples include a vector containing a CMV promoter and the like, and for example, commercially available pcDNA3.1 (Invitrogen) can be used. For confirmation of SPNS2 expression, an expression vector that expresses a fusion protein with a reporter protein may be used.

  The gene introduction method is not particularly limited, and a method known per se or a method developed in the future can be applied. For example, a gene introduction reagent (Lipofectamine ™ -200 reagent, Invitogen) can be used.

  The host cell is not particularly limited, and for example, bacteria, yeast, animal cells, plant cells and the like can be used. In order to perform screening for agonists and / or antagonists of SPNS2, when cells are used, the cells must be capable of transporting S1P extracellularly by expressing SPNS2, and preferably Animal cells can be used, and more specifically, CHO (Chinese Hamster Ovary) cells and the like can be used.

  In order to use the above-mentioned SPNS2 agonist and / or antagonist screening method, cells capable of expressing SPNS2 are preferably cells capable of confirming the function of SPNS2. The function of SPNS2 can be confirmed, for example, by measuring the amount of S1P inside and outside the cell. For example, when S1P is not found outside the cell, the function of SPNS2 is considered to be low, and when more S1P is found outside the cell than inside the cell, SPNS2 is considered to be functioning.

  Therefore, the cell capable of expressing SPNS2 may further contain cDNA encoding sphingosine kinase. Each expression vector may be any vector as long as each protein can be expressed separately, and may be a different vector, or may contain an expression cassette capable of expressing each in one vector. For the sequence of cDNA encoding sphingosine kinase, the sequence disclosed in NCBI Accession No. NP_079643 can be referred to.

More specifically, the SPNS2 antagonist or agonist screening method can be performed by the following steps (1) to (5).
(1) A step of constructing cells expressing sphingosine kinase and SPNS2 molecule.
(2) A step of adding sphingosine to the constructed cell culture medium and culturing, and introducing sphingosine into the cell. The introduced sphingosine becomes S1P by intracellular sphingosine kinase. Here, the sphingosine to be introduced may be labeled and labeled for later detection.
(3) A step of detecting S1P inside and outside the cells by allowing the cells to interact with the test substance, culturing for a predetermined time, separating the cells and the culture solution by centrifugation or the like. The detection method is not particularly limited as long as S1P can be detected. For example, it can be detected by chromatography, mass spectrometry, or a combination thereof, or the label can be detected if it is a labeled S1P produced from labeled sphingosine.
(4) A step of comparing the amount of S1P inside and outside the cell when the test substance and the cell do not interact with each other and comparing the amount of S1P inside and outside the cell when the test substance and the cell interact.
(5) When the extracellular S1P when the test substance interacts with cells increases relative to the control extracellular S1P amount, the test substance is an SPNS2 agonist and the test is performed when the extracellular S1P decreases. The step of determining the substance as an SPNS2 antagonist.

In the above screening method, cells that have been constructed in advance may be used as cells expressing sphingosine kinase and SPNS2. In addition, a pre-labeled sphingosine may be used as the label-labeled sphingosine. A method for labeling sphingosine is not particularly limited, and a labeling method known per se can be applied. Considering ease of determination, it can be labeled with a radioactive substance or a fluorescent substance, for example, with ³ H.

More specifically, SPNS2 agonists and / or antagonists can be screened by the following method.
(1) A plasmid having a sphingosine kinase-encoding cDNA downstream of an expression vector promoter is constructed, an expression vector is prepared and introduced into a CHO (Chinese Hamster Ovary) cell, and a sphingosine kinase 1 expressing CHO cell (CHO) -SphK). Further, an expression vector that expresses SPNS2 is prepared and introduced into CHO-SphK. For confirmation of SPNS2 expression, an expression vector that expresses a fusion protein with a reporter protein may be used. For gene introduction, for example, a gene introduction reagent (Lipofectamine ™ -200 reagent, Invitogen) can be used.
(2) After culturing CHO-SphK for about 6 to 16 hours, the culture solution is exchanged and labeled sphingosine is added. Lipid-soluble sphingosine is phosphorylated by mouse sphingosine kinase 1 expressed in cells and converted to labeled S1P.
(3) A test substance is added to the culture solution, and after about 30 minutes at 37 ° C. in a CO ₂ incubator, the medium (supernatant: S) and the cells (precipitation: P) are obtained for CHO-SphK into which each gene has been introduced. The extracted labeled S1P is developed by thin layer chromatography and detected using a bioimaging analyzer.
(4) The amount of S1P inside and outside the cell when the test substance and the cell are not interacted is used as a control, and the S1P inside and outside the cell when the test substance and the cell are interacted is compared.
(5) When the extracellular S1P when the test substance interacts with cells increases relative to the control extracellular S1P amount, the test substance is an SPNS2 agonist and the test is performed when the extracellular S1P decreases. The substance is determined to be an SPNS2 antagonist.

  The screening method of the present invention makes it possible to screen for substances that can regulate immune function by targeting SPNS2. The screening method of the present invention is useful for the development of the above-mentioned pharmaceutical or research reagents, or the above-mentioned immune function regulator by regulating the number of immune cells.

(4. Immune function regulator)
The present invention also provides an immune function regulator comprising a substance that regulates the expression or function of the Spns2 gene or SPNS2. The immune function regulator of the present invention can be a regulator of lymphocyte migration from a lymphoid organ into blood or lymphatic vessels.

  In one embodiment, the substance that modulates immune function identified by the screening method of the present invention is a substance that regulates the expression or function of the Spns2 gene or SPNS2, and that promotes the expression of the Spns2 gene or SPNS2. possible.

  The expression of the Spns2 gene means that a translation product (namely, SPNS2 protein) from the Spns2 gene is produced and functionally localized at the site of action. Therefore, the substance that promotes the expression of the Spns2 gene may act at any stage such as transcription, post-transcriptional regulation, translation, post-translational modification, localization and protein folding of the Spns2 gene. As used herein, promotion of Spns2 gene expression includes SPNS2 protein supplementation.

  An example of a substance that promotes the expression of the Spns2 gene or SPNS2 may be an expression vector containing a SPNS2 protein or a nucleic acid encoding the Spns2 gene.

  In another embodiment, the substance that regulates immune function may be a substance that regulates the expression or function of the Spns2 gene and suppresses the expression of the Spns2 gene. The substance that suppresses the expression of the Spns2 gene may act at any stage such as transcription of the Spns2 gene, post-transcriptional regulation, translation, post-translational modification, localization, and protein folding.

  An example of a substance that suppresses the expression of the Spns2 gene or SPNS2 is an antisense nucleic acid against a transcription product of the Spns2 gene, specifically, mRNA or an initial transcription product. The antisense nucleic acid is composed of a base sequence capable of hybridizing with the target mRNA (initial transcription product) under physiological conditions of cells expressing the target mRNA (early transcription product), and the target mRNA in a hybridized state. A nucleic acid capable of inhibiting translation of a polypeptide encoded by (early transcript). The type of the antisense nucleic acid may be DNA or RNA, or may be a DNA / RNA chimera.

  The length of the antisense nucleic acid is not particularly limited as long as it can specifically hybridize with the transcription product of the Spns2 gene. The short one is about 15 bases, and the long one is complementary to the entire mRNA (initial transcription product) sequence. The sequence may include a sequence. From the viewpoint of ease of synthesis, antigenicity problems, etc., for example, oligonucleotides comprising about 15 bases or more, preferably about 15 to about 30 bases are exemplified.

  The target sequence of the antisense nucleic acid is not particularly limited as long as the antisense nucleic acid is hybridized to inhibit the translation of the Spns2 gene or a functional fragment thereof. Or an intron portion of the initial transcript, but when an oligonucleotide is used as the antisense nucleic acid, the target sequence is from the 5 ′ end of the mRNA of the Spns2 gene to the C terminus of the coding region. It is desirable to be located by.

  Furthermore, antisense nucleic acids not only hybridize with the transcription product of the Spns2 gene and inhibit translation, but also bind to double-stranded DNA to form a triplex and inhibit transcription into mRNA. It may be obtained.

  Another example of a substance that suppresses the expression of the Spns2 gene or SPNS2 is specific to the transcript of the Spns2 gene, specifically mRNA or the initial transcript, within the coding region (including the intron in the case of the initial transcript) A ribozyme that can be cleaved. Ribozyme refers to RNA having an enzyme activity that cleaves nucleic acid. Recently, it has been clarified that an oligo DNA having a base sequence of the enzyme active site also has a nucleic acid cleaving activity. As long as it has specific nucleic acid cleavage activity, it is used as a concept including DNA. The most versatile ribozyme is self-splicing RNA found in infectious RNA such as viroid and virusoid, and the hammerhead type and hairpin type are known. Further, when the ribozyme is used in the form of an expression vector containing DNA encoding the ribozyme, it can be a hybrid ribozyme in which a sequence modified with tRNA is further linked in order to promote the transfer to the cytoplasm [ Nucleic Acids Res., 29 (13): 2780-2788 (2001)].

  Yet another example of a substance that suppresses the expression of the Spns2 gene or SPNS2 is an RNA interference (RNAi) inducible nucleic acid. An RNAi-inducible nucleic acid refers to a nucleic acid that can induce an RNAi effect when introduced into a cell, and is preferably RNA. Examples of the RNAi-inducible nucleic acid include siRNA, stRNA, miRNA and the like. As the RNAi-inducing nucleic acid, one synthesized by itself can be used as described below, but a commercially available one may be used (for example, stealth RNAi (manufactured by Invitrogen, catalog number: 10620-310)).

  When a short double-stranded RNA is introduced into a cell, a phenomenon called RNA interference (RNAi), in which mRNA complementary to the RNA is degraded, has been known in nematodes, insects, plants, etc. Recently, it has been confirmed that this phenomenon also occurs in animal cells [Nature, 411 (6836): 494-498 (2001)], and has attracted attention as an alternative technique for ribozymes.

  siRNA is typically a double-stranded oligo RNA consisting of RNA having a sequence complementary to the nucleotide sequence of mRNA of a target gene or a partial sequence thereof (hereinafter referred to as target nucleotide sequence) and its complementary strand. A single-stranded RNA in which a sequence complementary to a target nucleotide sequence (first sequence) and its complementary sequence (second sequence) are linked via a hairpin loop portion, and the hairpin loop type The RNA (small hairpin RNA: shRNA) in which the first sequence forms a double-stranded structure with the second sequence by adopting the structure is a preferred embodiment of siRNA.

  The length of the portion complementary to the target nucleotide sequence contained in the siRNA is usually about 18 bases or more, preferably about 19 bases or more, more preferably about 21 bases or more. As long as it can be specifically suppressed, it is not particularly limited. If the siRNA is longer than 23 bases, the siRNA can be degraded in the cell to produce siRNA of about 20 bases, so theoretically the upper limit of the length of the portion complementary to the target nucleotide sequence is , The full length of the nucleotide sequence of the target gene mRNA (mature mRNA or early transcript). However, considering the avoidance of interferon induction, ease of synthesis, antigenicity problems, etc., the length of the complementary portion is, for example, about 50 bases or less, preferably about 25 bases or less, and most preferably about 23 bases or less. is there. That is, the length of the complementary portion is usually about 18 to about 50 bases, preferably about 19 to about 25 bases, more preferably about 21 to about 23 bases.

  In addition, the length of each RNA strand constituting the siRNA is usually about 18 bases or more, preferably about 19 bases or more, more preferably about 21 bases or more, but it specifically suppresses the expression of the target gene. As long as it is possible, there is no particular limitation, and theoretically there is no upper limit on the length of each RNA strand. However, in consideration of avoidance of interferon induction, ease of synthesis, antigenicity problems, etc., the length of siRNA is, for example, about 50 bases or less, preferably about 25 bases or less, and most preferably about 23 bases or less. That is, the length of each RNA strand is, for example, usually about 18 to about 50 bases, preferably about 19 to about 25 bases, more preferably about 21 to about 23 bases. In addition, the length of shRNA shall be shown as the length of the double-stranded part when taking a double-stranded structure.

  The target nucleotide sequence and the sequence complementary to that contained in the siRNA are preferably completely complementary. However, with respect to base mutations at positions off the center of siRNA (which may be within the range of identity of at least 90% or more, preferably 95% or more), the cleavage activity due to RNA interference is not completely lost. Partial activity may remain. On the other hand, the mutation of the base at the center of siRNA has a large influence, and the cleavage activity of mRNA due to RNA interference can be extremely reduced.

  The siRNA may have additional bases that do not form base pairs at the 5 'and / or 3' ends. The length of the additional base is not particularly limited as long as siRNA can specifically suppress the expression of the target gene, but is usually 5 bases or less, for example, 2 to 4 bases. The additional base may be DNA or RNA, but the use of DNA can improve the stability of siRNA. Examples of such additional base sequences include ug-3 ', uu-3', tg-3 ', tt-3', ggg-3 ', guuu-3', gttt-3 ', ttttt-3 Examples include, but are not limited to, ', uuuuu-3'.

  The length of the loop portion of the shRNA hairpin loop is not particularly limited as long as the expression of the target gene can be specifically suppressed, but is usually about 5 to 25 bases. The nucleotide sequence of the loop part is not particularly limited as long as it can form a loop and the shRNA can specifically suppress the expression of the target gene.

  Since natural nucleic acids are easily degraded in phosphodiester bonds by nucleolytic enzymes present in cells, antisense nucleic acids, ribozymes and RNAi-inducible nucleic acids used in the present invention are stable to degrading enzymes. It can also be synthesized using a modified thiophosphate type (P = O in the phosphate bond is replaced with P = S) or a 2′-O-methyl type modified nucleotide. Other important factors for the design of antisense nucleic acid include enhancement of water solubility and cell membrane permeability. These can also be overcome by devising dosage forms such as the use of liposomes and microspheres.

  Antisense oligonucleotides and ribozymes, for example, determine the target sequence of the Spns2 gene transcript, specifically mRNA or early transcript, based on the cDNA sequence or genomic DNA sequence of the Spns2 gene, and commercially available DNA / RNA automated synthesis It can be prepared by synthesizing a complementary sequence using a machine (Applied Biosystems, Beckman, etc.). The RNAi-inducible nucleic acid is synthesized, for example, by synthesizing a sense strand and an antisense strand with a DNA / RNA automatic synthesizer, denatured in an appropriate annealing buffer at about 90 to about 95 ° C. for about 1 minute, It can be prepared by annealing at 30 to about 70 ° C. for about 1 to about 8 hours. In addition, longer double-stranded polynucleotides can be prepared by synthesizing complementary oligonucleotide strands so as to alternately overlap, annealing them, and then ligating with ligase.

Another example of a substance that suppresses the expression or function of the Spns2 gene or SPNS2 is an antibody against the SPNS2 protein. The antibody may be a polyclonal antibody or a monoclonal antibody, and can be prepared by a known immunological technique. The antibody may be an antibody fragment (eg, Fab, F (ab ′) ₂ ) or a recombinant antibody (eg, a single chain antibody). Furthermore, a nucleic acid encoding the antibody (that is operably linked to a nucleic acid having promoter activity) is also preferable as a substance that suppresses the expression or function of the Spns2 gene.

  For example, a polyclonal antibody is a commercially available adjuvant (SPNS2 protein or a fragment thereof (which may be a complex cross-linked to a carrier protein such as bovine serum albumin or KLH (Keyhole Limpet Hemocyanin) if necessary) as an antigen. For example, complete or incomplete Freund's adjuvant) is administered to the animal subcutaneously or intraperitoneally about 2 to 4 times every 2 to 3 weeks (the antibody titer of the partially collected serum is measured by a known antigen-antibody reaction, It can be obtained by collecting whole blood about 3 to about 10 days after the final immunization and purifying the antiserum. Examples of animals to which the antigen is administered include mammals such as rats, mice, rabbits, goats, guinea pigs, and hamsters.

  Monoclonal antibodies can also be produced by cell fusion methods (for example, Takeshi Watanabe, Principles of Cell Fusion Methods and Production of Monoclonal Antibodies, Akira Taniuchi, Toshitada Takahashi, “Monoclonal Antibodies and Cancer: Basic and Clinical”, 2-14). Page, Science Forum Publishing, 1985). For example, the factor is administered to a mouse subcutaneously or intraperitoneally 2-4 times together with a commercially available adjuvant, and about 3 days after the final administration, the spleen or lymph node is collected and white blood cells are collected. The leukocytes and myeloma cells (for example, NS-1, P3X63Ag8, etc.) are fused to obtain a hybridoma that produces a monoclonal antibody against the factor. Cell fusion may be PEG method [J. Immunol. Methods, 81 (2): 223-228 (1985)] or voltage pulse method [Hybridoma, 7 (6): 627-633 (1988)]. A hybridoma producing a desired monoclonal antibody can be selected by detecting an antibody that specifically binds to an antigen from the culture supernatant using a well-known EIA or RIA method. The hybridoma producing the monoclonal antibody can be cultured in vitro or in vivo, such as mouse or rat, preferably mouse ascites, and the antibody can be obtained from the culture supernatant of the hybridoma and the ascites of the animal, respectively.

  However, considering the therapeutic effect and safety in humans, the antibody of the present invention may be a chimeric antibody, a humanized or humanized antibody. Chimeric antibodies include, for example, “Experimental Medicine (Special Issue), Vol. 6, No. 10, 1988”, Japanese Patent Publication No. 3-73280, and humanized antibodies include, for example, Japanese Patent Publication No. 4-506458, JP-A-62-296890 and the like, human antibodies include, for example, `` Nature Genetics, Vol.15, p.146-156, 1997 '', `` Nature Genetics, Vol.7, p.13-21, 1994 '', JP 4-504365 Publication, International Application Publication No. WO 94/25585 Publication, “Nikkei Science, June, 40 to 50, 1995”, “Nature, Vol.368, p.856-859, 1994 ", Japanese Patent Publication No. 6-500233, and the like.

  Another example of a substance that suppresses the expression of the Spns2 gene or SPNS2 is an oligonucleotide, ie, an aptamer, that specifically binds to SPNS2 protein and inhibits its functional expression. An aptamer against SPNS2 can be obtained, for example, by the following procedure. That is, first, oligonucleotides (for example, about 60 bases) are randomly synthesized using a DNA / RNA automatic synthesizer to create a pool of oligonucleotides. Next, the target protein, that is, the oligonucleotide that binds to SPNS2, is separated by an affinity column. The separated oligonucleotides are amplified by PCR and selected again by the selection process described above. By repeating this process about 5 times or more, aptamers having strong affinity for SPNS2 can be selected.

  When the substance that regulates the expression or function of the Spns2 gene or SPNS2 is a nucleic acid molecule or a protein molecule, the immune function regulator of the present invention comprises an expression vector containing a nucleic acid molecule encoding the nucleic acid molecule or protein molecule as an active ingredient. You can also In the expression vector, the oligonucleotide or polynucleotide encoding the nucleic acid molecule must be operably linked to a promoter capable of exhibiting promoter activity in a mammalian cell to be administered. The promoter to be used is not particularly limited as long as it can function in the mammal to be administered. For example, SV40-derived early promoter, cytomegalovirus LTR, Rous sarcoma virus LTR, MoMuLV-derived LTR, adenovirus-derived early promoter Examples thereof include viral promoters such as promoters, and mammalian constituent protein gene promoters such as β-actin gene promoter, PGK gene promoter, transferrin gene promoter, and the like.

  The expression vector preferably contains a transcription termination signal, ie a terminator region, downstream of the oligo (poly) nucleotide encoding the nucleic acid molecule. In addition, selectable marker genes for selection of transformed cells (such as genes that confer resistance to drugs such as tetracycline, ampicillin, kanamycin, hygromycin, phosphinothricin, genes that complement auxotrophic mutations, etc.) You can also

  The vector may be a basic skeleton vector, a plasmid or a viral vector used as an expression vector, but suitable vectors for administration to mammals such as humans include adenovirus, retrovirus, adeno-associated virus, herpes virus, vaccinia virus. And viral vectors such as poxvirus, poliovirus, Sindbis virus, Sendai virus, Epstein-Barr virus, and the like.

  The immune function modulator of the present invention may act on a specific vascular cell specific (for example, vascular endothelial cell specific) or non-specifically. For example, when a substance that regulates the expression or function of the Spns2 gene or SPNS2 is used in the form of an expression vector, by using a vector in which a nucleic acid molecule is linked to a vascular cell-specific promoter, vascular cell-specific (for example, (For example, see the section of “(1. animal)”).

  The immune function-modulating agent of the present invention can be added to any substance that modulates the expression or function of the Spns2 gene or SPNS2, particularly any substance that regulates the expression or function of the Spns2 gene or SPNS2 identified by the screening method of the present invention. Agents such as pharmaceutically acceptable additives can be included.

  Examples of pharmaceutically acceptable additives include sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate and other excipients, cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone , Gelatin, gum arabic, polyethylene glycol, sucrose, starch and other binders, starch, carmellose, hydroxypropyl starch, sodium-glycol starch, sodium bicarbonate, calcium phosphate, calcium citrate and other disintegrants, magnesium stearate, Lubricants such as Aerosil (registered trademark), talc, sodium lauryl sulfate, etc., flavoring agents such as citric acid, menthol, diammonium glycyrrhizinate, glycine, orange oil, benzoic acid Preservatives such as sodium, sodium hydrogen sulfite, methyl paraben, propyl paraben, stabilizers such as citric acid, sodium citrate, acetic acid, suspension agents such as methyl cellulose, povidone, aluminum stearate, dispersants such as surfactants, Examples include, but are not limited to, water, physiological saline, diluents such as orange juice, base waxes such as cacao butter, polyethylene glycol, and white kerosene.

  Preparations suitable for oral administration include solutions in which effective amounts of substances are dissolved in diluents such as water and physiological saline, capsules or tablets containing effective amounts of substances as solids or granules, and appropriate dispersions. Examples thereof include a suspension obtained by suspending an effective amount of a substance in a medium, and an emulsion obtained by dispersing and emulsifying a solution in which an effective amount of a substance is dissolved in an appropriate dispersion medium.

  Formulations suitable for parenteral administration (eg, subcutaneous injection, intramuscular injection, local infusion, intraperitoneal administration, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which include antioxidants Further, a buffer solution, an antibacterial agent, an isotonic agent and the like may be contained. Aqueous and non-aqueous sterile suspensions are also included, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives and the like. The preparation can be enclosed in a container in unit doses or multiple doses like ampoules and vials. In addition, the active ingredient and a pharmaceutically acceptable carrier can be lyophilized and stored in a state that may be dissolved or suspended in a suitable sterile vehicle immediately before use.

  The dose of the immune function regulator of the present invention varies depending on the activity and type of the active ingredient, the severity of the disease, the animal species to be administered, the drug acceptability of the administration target, body weight, age, etc. Usually, the amount of active ingredient per day for an adult is about 0.001 to about 500 mg / kg.

  The immune function regulator of the present invention is useful, for example, as a pharmaceutical or research reagent.

  When the immune function-modulating agent of the present invention contains a substance that inhibits the expression or function of the Spns2 gene or SPNS2, the immune function regulation can be a decrease in immune function.

  The immune function-modulating agent of the present invention can be a substance that regulates the expression or function of the Spns2 gene or SPNS2, and thus can be a substance that regulates the release of lymphocytes from the lymph organ into the blood or lymph vessels.

  As used herein, the term “treatment” refers to the prevention, reduction, or improvement, partial or complete alleviation, or cure of a disease, disorder, or condition, where “prevention” refers to that Complete or partial treatment of animals at risk of developing such diseases, disorders or conditions.

  Specifically, when the immune function regulator of the present invention contains a substance that promotes the expression or function of the Spns2 gene or SPNS2 as an active ingredient, for example, as an immune system disease, a disease accompanied by a decrease in immune function, for example, It can be used for the prophylaxis or treatment of diseases associated with decreased humoral or cellular immune function. Diseases associated with a decrease in humoral or cellular immune function are as described above (for example, see the section “(2. Animals)”).

  In addition, when the immune function regulator of the present invention contains a substance that suppresses the expression or function of the Spns2 gene or SPNS2 as an active ingredient, the immune system disease is a disease associated with enhanced immune function, such as an autoimmune disease or It can be used for the prevention and treatment of allergic diseases. Examples of autoimmune diseases with enhanced humoral immune function include systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, multiple sclerosis, autoimmune thyroiditis, Hashimoto's disease, autoimmune hemolytic anemia, Pernicious anemia, autoimmune thrombocytopenia, autoimmune cytopenia, myasthenia gravis, scleroderma, polymyositis, secondary Addison's disease, infertility, autoimmune glomerulonephritis, Sjogren's disease, vascular A flame is mentioned. Examples of the autoimmune disease accompanied by enhancement of cellular immune function include autoimmune myelitis, insulin-dependent diabetes mellitus, ulcerative colitis, Crohn's disease and the like. On the other hand, examples of allergic diseases accompanied by enhanced humoral immune function include, for example, type I allergic diseases (for example, bronchial asthma, allergic rhinitis, urticaria, atopic dermatitis), type II allergic diseases (for example, Hashimoto disease) (Chronic thyroiditis), Goodpasture syndrome, organ transplant rejection), type III allergic diseases (for example, systemic vasculitis, cryoglobulinemia, glomerulonephritis). Examples of allergic diseases accompanied by enhancement of cellular immune function include type IV allergic diseases (for example, contact dermatitis, various organ transplant rejection).

  Furthermore, when the immune function regulator of the present invention is a research reagent, it can be used, for example, as an inducer of immune system diseases in experimental animals. Specifically, when the research reagent of the present invention contains a substance that promotes the expression or function of the Spns2 gene or SPNS2 as an active ingredient, it can be used, for example, to induce autoimmune disease or allergic disease. When the research reagent of the present invention contains a substance that suppresses the expression or function of the Spns2 gene or SPNS2 as an active ingredient, it can be used, for example, to induce immunodeficiency diseases.

  The immune function regulator of the present invention is also useful as a regulator of the number of lymphocytes in blood or lymph. Specifically, when the modulator of the present invention contains a substance that promotes the expression or function of the Spns2 gene or SPNS2 as an active ingredient, it can be used to increase the number of lymphocytes in blood or lymph. Moreover, when the regulator of the present invention contains a substance that suppresses the expression or function of the Spns2 gene or SPNS2 as an active ingredient, it can be used to reduce the number of lymphocytes in blood or lymph.

  The contents of all publications, including patents and patent application specifications cited in this specification, are hereby incorporated by reference herein to the same extent as if all were explicitly stated. Is.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

Creating a conditional Spns2 knockout mouse
A conditional Spns2 knockout mouse (Acc.No.CDB0705K: http://www.cdb.riken.jp/arg/mutant%20mice%20list.html) in which two loxP sites are adjacent to exon 2 is (http: / /www.cdb.riken.jp/arg/Methods.html; Prepared as described in FIG. 6A). TT2 embryonic stem (ES) cells (T. Yagi et al., Anal. Biochem. 214, 70 (1993)) were transfected with the targeting vector, selected in the presence of G418, homologous by PCR and Southern blot Screening for recombination (http://www.cdb.riken.jp/arg/Methods.html). Two kinds of ES clones were introduced into host embryos to produce chimeric mice. Chimeric mice with high ES cell contribution were bred with C57BL / 6J mice to create mice with targeted alleles. These mice were then crossed with transgenic mice expressing the Flp recombinase under the control of the cytomegalovirus early enhancer / chicken beta actin promoter to remove the PKG-Neo-pA cassette, and the Spns2 floxed mice Obtained. In order to generate Spns2 global knockout mice, Spns2 floxed mice were mated with transgenic mice expressing Cre recombinase under the control of the cytomegalovirus promoter (FIG. 6). In order to inactivate the Spns2 gene in endothelial cells, Spns2 floxed mice were transformed into Tie2-Cre mice with Cre recombinase driven by the Tie2 promoter (TN Sato (Nara Institute of Science and Technology, Japan), M Produced by Yanagisawa (provided by the University of Texas Southwestern Medical Center, Dallas, TX); To confirm the targeting accuracy, the probe located outside of the region used in the targeting vector (Figure 6), DIG DNA Labeling and Detection Kit (Roche) was used for probe preparation and hybridization The Southern blot analysis was conducted according to the protocol described in http://www.cdb.riken.jp/arg/protocol.html. Forward primer, 5'-aggctcatttcatggctgat-3 '(SEQ ID NO: 5) and reverse primer, 5'-agccctgtgctctctgttgt-3' (SEQ ID NO: 6) (552-bp fragment of wild type allele for mouse genotyping , Which produces products of floxed allele 842-bp fragment and deletion allele 316-bp fragment). All mice were raised under specific pathogen-free conditions. All animal experiments were approved by the Animal Committee of the National Cardiovascular Research Center and conducted according to the rules of the National Cardiovascular Research Center.

Biochemical and hematological tests of blood
Using EDTA as an anticoagulant, blood from wild-type (Spns2 ^{+ / +} , n = 4) and Spns2 KO (Spns2 ^-/- , n = 4) mice via the abdominal aorta under inhalation anesthesia (isoflurane) Collected. Blood biochemical parameters (total protein, total bilirubin, aspartate aminotransferase, alanine aminotransferase, triglycerol, glucose, blood urea nitrogen and albumin) were measured using the blood biochemical analyzer Fuji DRI-CHEM3500V (Fuji Film). Hematological and blood coagulation parameters (white blood cells, red blood cells, platelets, hemoglobin, hematocrit, average red blood cell volume, average red blood cell hemoglobin content and average red blood cell hemoglobin concentration) were determined by using the Sysmex XT-1800iv hematology analyzer (Sysmex) .

Antibody and Flow Cytometry Analysis Unless otherwise stated, anti-mouse monoclonal antibodies were obtained from eBioscience Inc. The antibodies used for cell surface staining were phycoerythrin (PE) -conjugated anti-CD19 (ebio1D3) and anti-CD23 (B3B4), fluorescein isothiocyanate (FITC) -conjugated anti-B220 (RA3-6B2), anti-CD19 (1D3) (BD Biosciences) and anti-CD8 (53-6.7), Pacific Blue-conjugated anti-IgD (11-26) and anti-CD4 (RM4-5) (BD Biosciences), PeCy7-conjugated anti-IgM (II / 41) and PerCP-Cy5. 5-bound anti-CD21 / CD35 (7E9) (BioLegend). A single cell suspension of whole bone marrow cells of freshly isolated thymus, spleen, peripheral lymph nodes (groin, axilla and upper arm) and femur and tibia is subsequently incubated with anti-CD16 / CD32 for 10 minutes, followed by Bound antibody was combined and stained for 30 minutes in FACS buffer (PBS + 4% heat inactivated FCS + 2 mM EDTA). Prior to antibody staining, 250 μl of fresh isolated blood was treated with heparin solution and erythrocytes were lysed with BD Pharm Lyse® solution (BD Biosciences) according to the manufacturer's protocol. Stained cells were analyzed on a FACSCanto II flow cytometer (BD Biosciences) equipped with blue (488 nm), purple (405 nm), and red (633 nm) lasers. FACS data were statistically analyzed with FlowJo software (TreeStar Inc.).

Histopathology and immunohistochemistry Tissue samples from the spleen, thymus, axillary lymph nodes, mesenteric lymph nodes and small intestine (including Peyer's patches) were wild type (Spns2 ^{+ / +} , n = 3) and Spns2 KO (Spns2 ^-/- , n = 3) Collected from mice and fixed in 20% formalin (neutral phosphate buffer). Each paraffin-embedded tissue was sectioned 4 μm thick and stained with eosin-hematoxylin for light microscopy.

Next, for immunohistochemistry, the paraffin was removed from the sections, and antigen recovery was performed in 10 mM citrate buffer (pH 6.0) by placing the sections in a pressure cooker for 3 minutes. Endogenous peroxidase activity was blocked with 0.3% H ₂ O _{2 in} methanol. Sections were exposed to 1% BSA in PBS and then incubated overnight at 4 ° C. with goat anti-CD3ε (M-20, Santa Cruz biotechnology). Immune complexes were labeled with biotinylated anti-goat IgG and streptavidin-conjugated alkaline phosphatase (Nichirei). The signal was visualized with Vector Blue alkaline phosphatase substrate kit (Vector laboratories). Sections were subsequently incubated with rat anti-CD45R (BD Biosciences Pharmingen) for double immunostaining. The immune complex was detected with horseradish peroxidase (HRP) -conjugated anti-rat IgG (simple stain Max-Po, Nichirei) and 3-amino-9-ethyl carbazole (AEC) substrate system (Lab Vision) for color development.

Quantification of S1P using LC-MS / MS
Quantification of S1P was performed by slightly modifying the previously described method (A. Inoue et al., EMBO J. Posting). Briefly, plasma and conditioned media were mixed and sonicated with 10 volumes of methanol and an internal standard (sphinganin-1-phosphate containing C17 base). Similarly, S1P extraction from cells was performed by homogenizing and sonicating the cells in methanol. After centrifugation at 21,500 xg, the resulting supernatant was recovered and used for LC-MS / MS analysis. Inject 20 μl of methanol extract and use solvent A (5 mM ammonium formate in water) and solvent B (95 mM (v / v) 5 mM ammonium formate in acetonitrile) using a C18 CAPCELL PAK ACR column (1.5 x 250 mm, Separation with Nanospace LC (Shiseido) equipped with Shiseido). The eluent was sequentially ionized with an ESI probe and the parent ion (m / z 380.2) and fragment ion (m / z 264.2) were monitored in positive mode on a Quantum Ultra triple quadrupole mass spectrometer (Thermo Fisher Scientific). Similarly, other lysophospholipids including lysophosphatidic acid (LPA), lysophosphatidylcholine (LPC), lysophosphatidylethanolamine (LPE), lysophosphatidylglycerol (LPG), lysophosphatidylinositol (LPI), lysophosphatidylserine (LPS) Was extracted with methanol and analyzed by LC-MS / MS system. For each class of lysophospholipid, there are 12 acyl chains (14: 0, 16: 0, 16: 1, 18: 0, 18: 1, 18: 2, 18: 3, 20: 3, 20: 4, 20: 5, 22: 5 and 22: 6) were monitored.

S1P release from blood cells Blood from the anesthetized wild type (Spns2 ^{+ / +} , n = 4) and Spns2 KO (Spns2 ^-/- , n = 4) mice via the inferior vena cava using heparinized syringes Were collected and transferred to tubes containing EDTA as an anticoagulant. Blood cells were separated from plasma by centrifugation at 4 ° C., 1,200 × g for 5 minutes, and washed twice with ice-cold PBS to remove plasma residues. Blood cells were ice-cold with 20 mM Hepes, pH 7.4, 138 mM NaCl, 3.3 mM NaH ₂ PO ₄ , 2.9 mM KCl, 1.0 mM MgCl ₂ , 1 mg / ml glucose and 1% fatty acid-free bovine serum albumin. Resuspended in incubation buffer at a cell density of 5 × 10 ⁸ cells / ml. 500 μl of blood cell suspension (2.5 × 10 ⁸ cells / ml) was incubated at 4 ° C. or 37 ° C. for 90 minutes. After incubation, blood cells were pelleted by centrifugation at 1,200 xg for 5 minutes at 4 ° C. S1P levels in the supernatant were determined as described above. To quantify the total amount of S1P in the blood cells, the cells were collected from 500 μl of cell suspension by centrifugation at 1,200 × g for 5 minutes at 4 ° C. and homogenized in 100 μl of methanol.

Cell culture and siRNA-mediated gene silencing Human umbilical vein endothelial cells (HUVEC), human microvascular endothelial cells (HMVEC) and human aortic endothelial cells (HAEC) were purchased from Kurabo and previously described (S. Fukuhara et al., Nat. Cell Biol 10, 513 (2008)). Human cutaneous lymphatic endothelial cells (HDLEC) were obtained from Lonza and maintained in endothelial cell growth medium, EGM-2 (Lonza). HeLa and HEK293 cells were cultured in Dulbecco's modified Eagle's medium (Nissui) supplemented with 10% bovine serum and antibiotics (streptomycin 100 μg / ml and penicillin 100 U / ml). Stealth siRNA targeting human Spns2, Spns2 # 1 (HSS151335 (auaucucggagccaugagguccgggcccggaccucauggcuccgagauau; SEQ ID NO: 7)) and Spns2 # 2 (HSS151336 (aaucccguaaagcaggugauggcccgggccaucaccugvi) sequence purchased from troucgengen Corp. As a control, an irrelevant sequence siRNA duplex was used. HUVECs were transfected with 20 nM siRNA duplex using Lipofectamine RNAi MAX reagent (Invitrogen Corp.). After 48 hours of culture, the cells were used for experiments.

S1P release from endothelial cells Transfected HUVECs with or without control siRNA or two independent Spns2 siRNAs were detached and re-plated on collagen-coated 24-well plates (2.5 x 10 ⁵ cells / well) and cultured for 12 hours. The cells were then washed twice with medium 199 (Invitrogen Corp.), 20 mM Hepes, pH 7.4, 10 mM sodium glycerophosphate, 5 mM sodium fluoride, 1 mM semicarbazide, 0.5% fatty acid free bovine serum albumin, Incubated in 200 μl medium 199 containing 40 ng / ml vascular endothelial growth factor, 40 ng / ml fibroblast growth factor 2, and 400 ng / ml angiopoietin 1. After 12 hours, the conditioned medium was collected and centrifuged at 15,000 xg for 5 minutes at 4 ° C to remove cell debris. Conditioned medium S1P levels were determined as described above.

in situ hybridization
In situ hybridization was performed by Genostaff Co., Ltd. The thymus of an 8-week-old mouse was excised after perfusion, fixed with Tissue Fixative (Genostaff), then embedded in paraffin using its dedicated procedure and made into 6 μm sections. For in situ hybridization, tissue sections were dewaxed with xylene and rehydrated with ethanol series and PBS. Sections were fixed with 4% paraformaldehyde in PBS for 15 minutes and then washed with PBS. The sections were treated with 8 μg / ml proteinase K in PBS for 30 minutes at 37 ° C., washed with PBS, re-fixed with 4% paraformaldehyde in PBS, washed again with PBS, 10% in 0.2 N HCl. Left for a minute. After washing with PBS, sections were acetylated by incubation with 0.1 M triethanolamine-HCl, pH 8.0, 0.25% acetic anhydride for 10 minutes. After washing with PBS, the sections were dehydrated with an ethanol series. The cDNA template of Spns2 was a 535-bp fragment corresponding to the 1629-2163 bases of mouse Spns2 cDNA (GenBank Accession No. NM_153060.2). Spns2 mRNA sense and antisense riboprobes were synthesized using digoxigenin RNA labeling kit (Roche) according to the manufacturer's protocol. Hybridization was performed in Probe Diluent-1 (Genostaff) at a probe concentration of 300 ng / ml at 60 ° C. for 16 hours. After hybridization, sections were washed in 5xHybriWash (Genostaff) equivalent to 5xSSC for 20 minutes at 50 ° C, then washed in 50% formamide, 2xHybriWash for 20 minutes at 50 ° C, then 10 mM Tris-HCl, The RNase was treated with 50 μg / ml RNase A in pH 8.0, 1 M NaCl and 1 mM EDTA at 37 ° C. for 30 minutes. The sections were then washed with 2 × HybriWash for 20 minutes at 50 ° C. twice, 0.2 × HybriWash for 20 minutes at 50 ° C. twice and once with TBST (0.1% Tween20 in TBS). After treatment with 0.5% blocking reagent (Roche) in TBST for 30 minutes, the sections were incubated with anti-DIG AP conjugate (Roche) diluted 1: 1000 with TBST for 2 hours at room temperature. Sections were washed twice with TBST and then incubated in 100 mM NaCl, 50 mM MgCl 2, 0.1% Tween 20, 100 mM Tris-HCl, pH 9.5. The color reaction was performed overnight with NBT / BCIP solution (Sigma) and then washed with PBS. Sections were counterstained with Kernechtrot stain solution (Mutoh), dehydrated, and mounted with Malinol (DBS).

Reverse transcription-PCR and real-time reverse transcription PCR
To measure the expression of Spns2 in endothelial cells, total RNA was prepared from the cells shown in the description of FIG. 13 using TRIzol reagent (Invitrogen Corp.), and manufactured using Superscript II (Invitrogen Corp.). Reverse transcription was performed with random hexamer primers according to the manufacturer's instructions. PCR was performed using gene-specific primers for human Spns2. Amplification of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was also performed in parallel as a control. To assess the efficacy of Spns2 siRNA-mediated knockdown, total RNA was extracted from HUVECs transfected with or without control siRNA, two independent Spns2 siRNAs, or as previously reported (J. Zhang et al., J. Biol. Chem. 286, 8055 (2011)) for quantitative real-time reverse transcription (RT) -PCR analysis using QuantiFast SYBR Green RT-PCR kit (Qiagen). For each reaction, 100 ng of total RNA was transcribed for 10 minutes at 50 ° C, followed by a 95 ° denaturation process for 5 minutes and 40 cycles of 95 ° C for 10 seconds and 60 ° C for 30 seconds. Fluorescence data was collected and analyzed using Mastercycler ep realplex (Eppendorf). For normalization, human GAPDH expression was measured in parallel as an endogenous control. The following primers for both RT-PCR and real-time RT-PCR studies:
Human Spns2, 5'-actttggggtcaaggaccga-3 '(SEQ ID NO: 9) and 5'-aatcaccttcctgttgaagcg-3' (SEQ ID NO: 10)
Human GAPDH, 5'-atggggaaggtgaaggtcg-3 '(SEQ ID NO: 11) and 5'-ggggtcattgatggcaacaata-3' (SEQ ID NO: 12)
Was used.

Statistical data were analyzed using GraphPad Prism software (GraphPad Software Inc.). Statistical significance was determined using Mann-Whitney U test (two-sided test) for paired samples and one-way analysis of variance and nonparametric tests for groups. A P-value <0.05 was considered statistically significant.

Results and discussion
S1P is produced inside the cell by two closely related isozymes, sphingosine kinases 1 and 2, and translocates outside the cell to stimulate its cell surface receptors (S. Spiegel, S. Milstien, J. Biol. Chem. 282, 2125 (2007)). In vitro analysis has shown that ATP-binding cassette transporters mediate S1P release in several cell types such as mast cells, erythrocytes, breast cancer cells and astrocytes (N. Kobayashi, N Kobayashi, A. Yamaguchi, T. Nishi, J. Biol. Chem. 284, 21192 (2009), P. Mitra et al., Proc. Natl. Acad. Sci. USA 103, 16394 (2006), K. Sato et al., J. Neurochem. (2007), K. Takabe et al., J. Biol. Chem. 285, 10477 (2010)). We and others have identified Spns2 as an S1P transporter in zebrafish (A. Kawahara et al., Science 323, 524 (2009), N. Osborne et al., Curr. Biol. 18, 1882 (2008)). However, the physiological function of Spns2 in animals has been completely unknown. Furthermore, no S1P transporter responsible for S1P-mediated lymphocyte transport has been identified.

To address these issues, we have identified a Spns2 conditional knockout mouse in which the loxP site is flanked by exon 2 of the Spns2 gene and a mouse expressing Cre recombinase under the control of the cytomegalovirus promoter. By breeding, global Spns2 knockout (Spns2 KO: Spns2 ^{− / −} ) mice were created (FIG. 6). Spns2 KO mice develop normally, survive and become adults, and have fertility (FIG. 7). Furthermore, biochemical verification of blood revealed that there was no significant difference between wild type and Spns2 KO mice (FIG. 8). In particular, hematological analysis showed that the number of leukocytes was significantly reduced in Spns2 KO compared to control mice. There was no difference in other hematological parameters (Figure 9). This suggests a role for Spns2 in leukocyte trafficking. In the blood of Spns2 KO mice, the number and proportion of CD4 single positive (SP) T cells and CD8 single positive (SP) T cells were dramatically reduced (FIGS. 2A and B). Similarly, mature circulating B cells (CD19 ⁺ CD23 ⁺ IgD ⁺ ) were significantly reduced in the blood of Spns2 KO mice (FIGS. 2C and D). These findings suggest that Spns2 is involved in the transport of both T and B lymphocytes.

  To study the cause of the decrease in blood mature T lymphocytes, the inventors examined the thymus where T lymphocytes mature and migrate into the blood. The thymus structure of Spns2 KO mice was normal (FIG. 10). In the thymus of Spns2 KO mice, the number and proportion of mature CD4 SP T cells and CD8 SP T cells contained were increased compared to those of wild type mice. However, the number of immature CD4 / CD8 double positive (DP) cells was slightly reduced and the number of more immature CD4 / CD8 double negative (DN) cells was comparable (FIGS. 2E and F). These findings indicate that Spns2 plays an important role in the migration of mature T cells from the thymus to the blood. Consistent with this, in contrast to the accumulation of mature T cells in the thymus, in the peripheral lymph nodes and spleen of Spns2 KO mice, although their structures were normal, mature CD4 SP T cells and mature CD8 The number and proportion of SP T cells was dramatically reduced (FIGS. 2G-I and FIG. 10). Taken together, these results suggest that Spns2 is involved in the release of S1P required for T cell transmigration from the thymus.

In later stages of B cell development in the bone marrow, neonatal immature B cells, the SlP / SlP ₁ signal dependent shifts in peripheral blood (ML Allende et al., J. Exp. Med. 207, 1113 (2010) JP Pereira, Y. Xu, JG Cyster, PLoS. One. 5, e9277 (2010)). The immature B cells then mature in the secondary lymphoid tissue and return to the bone marrow through the blood. To understand why the number of mature B cells is reduced in the peripheral blood of Spns2 KO mice (FIGS. 2C and D), we examined the number and proportion of lymphocytes at the maturation stage. In the bone marrow of Spns2 KO mice, the number and frequency of mature recirculating B cells (B220highIgM ⁺ or CD19 ⁺ IgM ⁺ IgD ⁺ ) were significantly reduced compared to that of control mice (FIGS. 3A and B and FIG. 11). ). However, the bone marrow of Spns2 KO mice contained normal numbers of pro- / pre-B cells (B220lowIgM ⁺ ) and immature B cells (B220 ⁺ IgM ⁻ or CD19 ⁺ IgM ⁺ IgD ⁻ ). However, their frequency was slightly higher than that of control mice, probably due to a decrease in the number of mature recirculating B cells (FIGS. 3A and B and FIG. 11). These results suggest two possibilities: 1) In Spns2 KO mice, immature B cell emigration from bone marrow is impaired; 2) In Spns2 KO mice, mature circulating B cells are secondary lymphoid It is suggested that it is captured by the tissue.

  To verify these two possibilities, we counted the number of mature circulating B cells in the secondary lymphoid tissue. In peripheral lymph nodes of Spns2 KO mice, the number of contained mature B cells was decreased, but the frequency was not different from that of control mice (FIG. 3C). Furthermore, the number and proportion of follicular B cells were significantly reduced in the spleen of Spns2 KO mice compared to that of control mice. There was no difference in the number of marginal zone B cells, T1 (transitional) B cells, and B1 B cells between control mice and Spns2 KO mice (FIGS. 2I and 3D). Together with evidence for the loss of mature B cells in the blood (FIGS. 2C and D), these findings suggest that Spns2 is required for migration of immature B cells from the bone marrow into the blood.

Which cells that express Spns2 are responsible for the release of S1P required for lymphocyte trafficking? Blood cells, especially erythrocytes, produce S1P, thereby contributing to high plasma S1P concentrations (R. Pappu et al., Science 316, 295 (2007), P. Hanel, P. Andreani, MH Graler, FASEB J. 21, 1202 (2007), K. Ito et al., Biochem. Biophys. Res. Commun. 357, 212 (2007)). Therefore, it was examined whether Spns2 is involved in S1P release from blood cells. In Spns2 KO mice, plasma S1P levels were reduced to 54% of control mice (0.39 ± 0.03 μM in control mice; 0.21 ± 0.01 μM in Spns2 KO mice). Sphingosine and glycerophospholipid in plasma of Spns2 KO mice were equivalent to those in control mice (FIGS. 4A-D and FIG. 12). However, S1P release from blood cells in Spns2 KO mice occurred to the same extent as in control mice (FIG. 4E). When cells were incubated at 4 ° C., as previously reported (K. Ito et al., Biochem. Biophys. Res. Commun. 357, 212 (2007)), no release was observed (FIG. 4E). This S1P release was not caused by membrane damage. These results suggest that Spns2 acts as an S1P transporter in animals and is involved in the release of S1P into plasma from cells other than blood cells. However, plasma S1P concentrations in Spns2 KO mice were sufficient to stimulate S1P ₁ in lymphocytes in vitro, so a decrease in plasma S1P in Spns2 KO mice may impair lymphocyte emigration. It cannot be explained (SR Schwab et al., Science 309, 1735 (2005)). Furthermore, plasma S1P is thought to be insufficient to promote T cell migration (R. Pappu et al., Science 316, 295 (2007)). In summary, these findings suggest that cells other than blood cells that express Spns2 in lymphoid tissues secrete S1P and regulate lymphocyte trafficking.

  Although cultured endothelial cells produce S1P in vitro (K. Venkataraman et al., Circ Res 102, 669 (2008)), S1P release from endothelial cells in vivo has not been confirmed. RT-PCR analysis revealed that Spns2 is expressed in several vascular endothelial cell types (FIG. 13). Consistent with this, loss of Spns2 by siRNA inhibited S1P release from endothelial cells (FIGS. 4F and G). Furthermore, in situ hybridization analysis revealed that Spns2 is expressed exclusively in blood vessels in the thymus (FIG. 4H). With these evidences, we hypothesize that S1P released through Spns2 expressed in endothelial cells is required for lymphocyte migration.

To tackle this hypothesis, mice deficient in Spns2 in vascular endothelial cells (EC-Spns2 cKO: Spns2 ^{f / f} ;) were bred with Spns2 conditional knockout mice and mice expressing Cre under the control of the Tie2 promoter. Tie2Cre) was attempted (Fig. 6). The Tie2 promoter is known to be active in endothelial cells and hematopoietic cells. As shown in FIG. 4E, Spns2 does not appear to be involved in S1P release in blood cells. Thus, the phenotype of EC-Spns2 cKO mice is attributed to the loss of Spns2 in vascular endothelial cells. Compared to control mice, the proportion of mature CD4 SP T cells and mature CD8 SP T cells was increased in the thymus of EC-Spns2 cKO mice, but to a lesser extent than Spns2 KO mice (FIGS. 2E and F and 2). FIG. 5B). Furthermore, the number and proportion of CD4 SP T cells and CD8 SP T cells in EC-Spns2 cKO mice were dramatically reduced in peripheral blood, spleen, and peripheral lymph nodes (FIGS. 5A and C and FIG. 14). These findings suggest that S1P released from endothelial cells through Spns2 is involved in the migration of mature T cells from the thymus into the blood. Recently, mature T cells have been reported to exit the thymus through blood vessels at the medullary boundary (MA Zachariah, JG Cyster, Science 328, 1129 (2010)). Furthermore, S1P produced by pericytes enveloping blood vessels is essential for promoting thymocyte migration (MA Zachariah, JG Cyster, Science 328, 1129 (2010)). Because global Spns2 KO mice accumulate more mature T cells in the thymus than EC-Spns2 cKO mice, Spns2 can also function as an S1P transporter in pericytes. Thus, it is suggested that both endothelial cells and pericytes release S1P through Spns2 toward the antiluminal side of the blood vessel, thereby promoting T cell migration into the peripheral blood.

Furthermore, the role of endothelial cells in the migration of immature B cells from the bone marrow was examined. As observed in Spns2 KO mice, the number and proportion of mature recirculating B cells is markedly reduced in the bone marrow of EC-Spns2 cKO compared to control mice, but pro- / pre-B cells and unreacted cells. This was not the case with mature B cells (FIGS. 5E and 15). Mature B cells in the blood and peripheral lymph nodes of EC-Spns2 cKO mice were reduced (FIGS. 5D and 16). Furthermore, the number and frequency of follicular B cells were significantly reduced in the spleens of EC-Spns2 cKO mice compared to control mice (FIG. 5F). However, in the spleen of EC-Spns2 cKO mice, T1 B cells and B1 B cells were increased, but marginal zone B cells were not (FIG. 5F). These results suggest that S1P released through endothelial cells by Spns2 promotes migration of immature B cells from the bone marrow into the blood. During B cell emigration from the bone marrow, immature B cells that are indwelling in the parenchyma are first recruited to sinusoidal capillaries and then translocated to peripheral blood (T. Nagasawa, Nat. Rev. Immunol. 6, 107 (2006), DG Osmond, SJ Batten, Am. J. Anat. 170, 349 (1984), JP Pereira, J. An, Y. Xu, Y. Huang, JG Cyster, Nat. Immunol. 10, 403 (2009) )). SlP-SlP ₁ signaling is to facilitate movement of immature B cells from substantially the sinusoids has been suggested (ML Allende et al., J. Exp. Med. 207, 1113 (2010) JP Pereira, Y. Xu, JG Cyster, PLoS. One. 5, e9277 (2010)). Thus, bone marrow sinusoidal endothelial cells can produce S1P through Spns2, thereby promoting immature B cell migration into the blood.

  In this study, we show for the first time that Spns2 expressed in endothelial cells is essential for lymphocyte emigration from the thymus and bone marrow. By analyzing Spns2-deficient mice, we found that Spns2 is the S1P transporter that is required for the migration of mature T cells and immature B cells from the thymus and bone marrow, respectively, into peripheral blood. I found it. Furthermore, the present inventors have shown that Spns2 regulates S1P secretion in endothelial cells and promotes lymphocyte emigration from primary lymphoid organs by deleting Spns2 in endothelial cells. This study on Spns2 contributes greatly to the understanding of S1P signaling used in lymphocyte emigration from primary lymphoid organs (H. Chi, Trends Pharmacol. Sci. 32, 16 (2011), JG Cyster, Annu. Rev. Immunol. 23, 127 (2005), J. Rivera, RL Proia, A. Olivera, Nat. Rev. Immunol. 8, 753 (2008), S. Spiegel, S. Milstien, Nat. Rev. Immunol. 11 , 403 (2011)).

  Spns2 is the first S1P transporter that functions in mammals, but other S1P transporters may also exert biological functions. In order to stimulate the cell surface receptor, S1P produced in the cell needs to be transported out of the cell. Some evidence from in vitro studies suggests that ABC family transporters are involved in S1P release from several cell types (RH Kim, K. Takabe, S. Milstien , S. Spiegel, Biochim. Biophys. Acta 1791, 692 (2009), Kobayashi, N. et al., J. Lipid Res 47: 614 (2006), N. Kobayashi, N. Kobayashi, A. Yamaguchi, T. Nishi, J. Biol. Chem. 284, 21192 (2009), P. Mitra et al., Proc. Natl. Acad. Sci. USA 103, 16394 (2006), K. Sato et al., J. Neurochem., 103, 2610 (2007), K. Takabe et al., J. Biol. Chem. 285, 10477 (2010)). However, their biological significance in vivo remains unknown. In this study, we demonstrate that Spns2 is a key S1P transporter for regulating lymphocyte trafficking in mammals. Also, Spns2 does not seem to be the only S1P transporter in mammals. The reason is that in Spns2 KO mice, plasma S1P levels are partially reduced compared to control mice and not completely reduced. Blood cells, especially erythrocytes, are thought to be the major source cells of S1P in plasma (R. Pappu et al., Science 316, 295 (2007), P. Hanel, P. Andreani, MH Graler, FASEB J 21, 1202 (2007), K. Ito et al., Biochem. Biophys. Res. Commun. 357, 212 (2007)), blood cells derived from Spns2 KO mice still retained the ability to release S1P. Furthermore, S1P release from erythrocytes has been reported to be reduced by the ABCA1 transporter inhibitor glyburide (N. Kobayashi, N. Kobayashi, A. Yamaguchi, T. Nishi, J. Biol. Chem. 284, 21192 (2009)). These results suggest that blood cells secrete S1P through the ABC transporter and not through Spns2. Furthermore, S1P transporters other than Spns2 may be involved in the release of S1P required for angiogenesis. The reason is that Spns2 KO mice did not show the angiogenic defects observed in S1P1-deficient mice (Liu, Y. et al., J. Clin. Invest 106, 951 (2000)).

  This study clearly demonstrates that Spns2-dependent S1P release from endothelial cells is important for the migration of mature T cells from the thymus to peripheral blood. Emigration from the thymus is strictly controlled by S1P / S1P1 signaling (H. Chi, Trends Pharmacol. Sci. 32, 16 (2011), JG Cyster, Annu. Rev. Immunol. 23, 127 (2005), J. Rivera, RL Proia, A. Olivera, Nat. Rev. Immunol. 8, 753 (2008), S. Spiegel, S. Milstien, Nat. Rev. Immunol. 11, 403 (2011)). In the thymus, thymocytes differentiate into mature T cells and then express S1P1 through up-regulation of Kruppel-like factor2 (S. Spiegel, S. Milstien, Nat. Rev. Immunol. 11, 403 (2011), Takada, K. et al., J. Immunol. 186, 775 (2011)). Mature T cells expressing S1P1 acquire responsiveness to S1P and thereby translocate into peripheral blood. Until recently, an S1P gradient between the thymus and blood was considered necessary for the migration of mature T cells. However, recent results suggest that plasma S1P is not sufficient to promote thymic emigration (R. Pappu et al., Science 316, 295 (2007), MA Zachariah , JG Cyster, Science 328, 1129 (2010)). Consistent with this, the release of mature T cells from the thymus was impaired in Spns2 KO mice, even when plasma contained sufficient concentrations of S1P to stimulate lymphocytes S1P1 in vitro ( SR Schwab et al., Science 309, 1735 (2005)). These findings indicate that endothelial cells release S1P through Spns2 to the antiluminal side of the blood vessel, thereby forming an S1P gradient in the thymic tissue, which is responsible for T cell migration into the peripheral blood It is suggested.

  A gradient of S1P from the blood vessel toward S1P1-expressing cells may be important for T cell migration. Zachariah and Cyster recently reported that mature T cells translocate from the thymus through blood vessels at the medullary boundary in response to S1P produced by perivascular cells derived from neural crest (MA Zachariah, JG Cyster). Science 328, 1129 (2010)). Since global Spns2 KO mice accumulate more mature T cells in the thymus than EC-Spns2 cKO mice (FIGS. 2E and 2F and FIG. 5B), Spns2 can also function as an S1P transporter in pericytes. Thus, mature T cells are recruited to the antiluminal side of the blood vessel at the spinal cord boundary by S1P, which is released locally from both endothelial and pericytes via Spns2 and is highly concentrated in plasma S1P It is thought that it is exported to peripheral blood in response to Consistent with this, Spns2 is expressed at the medullary boundary of blood vessels.

  Spns2, which is expressed in blood vessels, is also essential for the migration of B cells from the bone marrow. Recent reports reveal the role of S1P / S1P1 signaling in the migration of immature B cells from the bone marrow (ML Allende et al., J. Exp. Med. 207, 1113 (2010), JP Pereira , Y. Xu, JG Cyster, PLoS. One. 5, e9277 (2010)), S1P source cells involved in this process have not been identified. In Spns2 KO mice, the number of mature circulating B cells was significantly reduced not only in the bone marrow but also in blood, spleen and peripheral lymph nodes. This indicates that the migration of immature B cells is blocked. A similar decrease in the number of mature circulating B cells was observed in EC-Spns2 cKO mice. These results, therefore, revealed for the first time that endothelial cells are the major source of S1P required for the migration of immature B cells from the bone marrow. Later in the developmental stage of B cells in the bone marrow, newly generated immature B cells placed in the parenchyma are first mobilized to the sinusoidal compartment and then translocated to peripheral blood (T., Nagasawa, Nat Rev. Immunol. 6, 107 (2006), DG Osmond, SJ Batten, Am. J. Anat. 170, 349 (1984), Pereira, JP et al., Nat. Immunol. 10, 403 (2009)). The entry of immature B cells into sinusoidal capillaries is believed to be a key step in bone marrow emigration. Recently, S1P / S1P1 signaling has been reported to promote migration of immature B cells from parenchyma to sinusoids, thereby facilitating migration of immature B cells from the bone marrow (ML Allende et al., J. Exp. Med. 207, 1113 (2010), JP Pereira, Y. Xu, JG Cyster, PLoS. One. 5, e9277 (2010)). Thus, bone marrow sinusoidal endothelial cells can attract S immature B cells from the parenchyma by producing S1P through Spns2, thereby facilitating the migration of immature B cells into peripheral blood.

  Lymphocyte emigration from lymph nodes is also dependent on S1P / S1P1 signaling. Pham et al. Recently reported that lymphatic endothelial cells are an in vivo source of S1P required for lymphocyte emigration from lymph nodes and Peyer's patches (TH Pham et al., J Exp. Med. 207, 17 (2010)). Since Spns2 is expressed not only in vascular endothelial cells but also in lymphatic endothelial cells, Spns2 can also regulate lymphocyte emigration from lymph nodes by inducing S1P release from lymphatic endothelial cells. However, to tackle this hypothesis, mice lacking Spns2 specifically in lymphatic endothelial cells must be analyzed. This is because, in the global Spns2 KO mouse, lymphocyte emigration from the primary lymphoid organ is remarkably impaired.

  In conclusion, we have demonstrated that Spns2 is a key S1P transporter involved in lymphocyte transport, and that vascular endothelial cells are responsible for lymphocyte emigration from the thymus and bone marrow. Is an in vivo source of S1P. Thus, this study not only elucidates the important role of Spns2 as an S1P transporter in mammals, but also contributes to an understanding of the molecular mechanism of S1P-mediated lymphocyte transport. Since S1P signaling is highly involved in inflammatory and autoimmune diseases such as multiple sclerosis, psoriasis, asthma, rheumatoid arthritis and transplant rejection, Spns2 can be a potential therapeutic target for these diseases.

  The animal of the present invention can be used as a model animal for immune system diseases, and enables analysis of immune function regulation mechanisms related to the Spns2 gene. The immune function-modulating agent of the present invention can be used as a medicine for an immune system disease, a research reagent and the like. The screening method of the present invention enables the development of drugs and research reagents for immune system diseases.

Claims (12)

  Non-human animal model with reduced immune function, deficient in Spns2 gene.   The non-human model animal according to claim 1, wherein the Spns2 gene deficiency is vascular endothelial cell-specific.   The non-human model animal according to claim 1, wherein the animal is a mouse.   The non-human model animal according to any one of claims 1 to 3, wherein the number of lymphocytes in blood or lymph is reduced compared to a wild-type control. The following process:
(A) a step of administering a test substance to the non-human model animal according to any one of claims 1 to 4 and a wild-type control thereof;
(B) examining and comparing the number of lymphocytes in blood or lymph before and after administration in the non-human model animal and wild-type control administered with the test substance; and
(C) migration of lymphocytes from the lymph organ to the blood or lymph vessels, including the step of selecting a test substance that varies the number of lymphocytes in blood or lymph based on the comparison result of (b). A screening method for substances that regulate the release. The test substance has the following steps:
(1) a step of allowing SPNS2 expression cells to express SPNS2 and sphingosine kinase;
(2) The labeled sphingosine is added to the cell culture medium of (1) and cultured, the labeled sphingosine is introduced into the cell, and the sphingosine kinase expressed in the cell of (1) is reacted to give labeled sphingosine Producing 1-phosphate;
(3) A step of adding a test substance to the cell culture solution of (2) above and culturing, and allowing the test substance to interact with SPNS2 expressed in the cells;
(4) A step of measuring the amount of sphingosine 1-phosphate inside and outside the cell after culturing for a certain time.
The method according to claim 5, wherein the method is an antagonist and / or agonist screened by an SPNS2 antagonist and / or agonist screening method.   The screening method according to claim 5 or 6, wherein the substance that regulates lymphocyte migration from a lymphoid organ into blood or lymphatic vessels is a substance that promotes the migration.   The screening method according to claim 5 or 6, wherein the substance that controls lymphocyte emigration from a lymphoid organ into blood or lymphatic vessels is a substance that inhibits the emigration.   A regulator of lymphocyte migration from a lymphoid organ into blood or lymphatic vessels, comprising a substance that regulates the expression or function of the Spns2 gene or SPNS2.   The agent according to claim 9, wherein the substance is a substance that inhibits the expression or function of the Spns2 gene or SPNS2, and the regulation of lymphocyte emigration from a lymphoid organ into the blood or lymphatic vessel is inhibition of emigration. The agent according to claim 10, wherein the substance that inhibits the expression or function of the Spns2 gene or SPNS2 is any of the following (i) or (ii):
(I) an antisense nucleic acid of the Spns2 gene, a ribozyme or RNAi-inducible nucleic acid molecule, or an expression vector containing these;
(Ii) An expression vector comprising an antibody or aptamer against SPNS2 or a nucleic acid encoding them.   The agent according to claim 11, wherein the expression vector is expressed specifically in vascular endothelial cells.