JP2013053114A - Therapeutic agent for liver cancer, hepatoblastoma, and pancreas cancer - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a therapeutic agent that is effective in liver cancer, hepatoblastoma, and pancreas cancer.SOLUTION: The therapeutic agent includes a compound having activity in suppressing the expression and/or the function of frizzled-2. The compound having activity in suppressing the expression and/or the function of frizzled-2 is siRNA to frizzled-2. Further, the compound having activity in suppressing the expression and/or the function of frizzled-2 is shRNA to frizzled-2. When Hep3B and MIA-Paca2 are selected as a liver cancer and a pancreas cancer cell lines, and the expression level of Cyclin D1 is analyzed, in both the cell lines, the expression level of Cyclin D1 reduces.

Description

  The present invention relates to a cancer therapeutic agent effective for a plurality of types of cancer, and more specifically to a cancer therapeutic agent effective for liver cancer, hepatoblastoma and pancreatic cancer.

  Primary double cancer was first reported in 1889 by Billroth et al. With the progress of diagnostic technology, improvement of treatment results, extension of life expectancy, etc., primary multiple cancers have become rare in recent years. For example, liver cancer and pancreatic cancer tend to increase in an aging society, and there are some cases of primary double cancer of both.

  Hepatoblastoma is a malignant tumor that develops in the liver of children and is thought to be caused by abnormalities in the development process of the liver. Liver cancer is thought to be caused by persistent infection with hepatitis B or C virus. Thus, although hepatoblastoma and liver cancer have different causes of occurrence, hepatoblastoma and liver cancer are similar, and differential diagnosis may be difficult.

  The receptor frizzled (hereinafter abbreviated as Fz) has 10 types of members in humans based on structural and functional homology. Fz is a cell surface receptor and mediates the action of Wnt ligands. Fz is known to be involved in carcinogenesis and embryonic development. Its expression is enhanced in, for example, colorectal cancer, gastric cancer and renal cell carcinoma. This suggests that Fz is likely to be related to carcinogenesis.

  It has been reported that tumor growth was suppressed by suppressing the expression of Fz. For example, Patent Document 1 describes a method for treating synovial sarcoma using siRNA against Fz10. Non-Patent Document 1 reports a method for suppressing the growth of colorectal cancer by introducing siRNA for Fz7 into colorectal cancer. Patent Document 2 describes a method of suppressing the growth of cancer cells that overexpress Wnt ligand by contacting them with an agent that inhibits the binding of Wnt ligand and Fz.

  Non-Patent Document 2 reports that Fz3, Fz6, and Fz7 expression is enhanced in hepatocellular carcinoma as compared to the surrounding non-tumor tissue. Non-patent document 3 reports that hepatocellular carcinoma occurs in the liver of Fz7 transgenic mice.

  Patent Document 3 describes a method for treating pancreatic cancer, wherein a soluble receptor containing an amount of Fz4, Fz5, or Fz8 effective to inhibit the growth of pancreatic cancer cells is administered to a subject.

Special table 2008-509076 gazette JP-T-2006-516259 Special table 2009-515513

Ueno K. et al., “Frizzled-7 as a potential therapeutic target in colorectal cancer”, Neoplasia, 2008, Vol. 10, p.697-705 Bengochea A. et al., “Common dysregulation of Wnt / Frizzled receptor elements in human hepatocellular carcinoma”, British Journal of Cancer, 2008, Vol. 99, p.143-150. Merle P. et al., “Functional consequences of frizzled-7 receptor overexpression in human hepatocellular carcinoma”, Gastroenterology, 2004, Vol. 127, p.1110-1122

  However, the above-described method for suppressing tumor growth is not effective in cases of primary double cancer of liver cancer and pancreatic cancer. It is also not effective against hepatoblastoma.

  This invention is made | formed in view of such a problem, Comprising: It aims at providing the therapeutic agent of the cancer effective in liver cancer, hepatoblastoma, and pancreatic cancer.

  The therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer of the present invention comprises a compound having an action of suppressing expression and / or function of frizzled-2.

  According to the present invention, since a common treatment method can be obtained for liver cancer and pancreatic cancer, it is possible to reduce the patient's mental and physical burden and improve the cases of these primary double cancers. In addition, even in cases where differential diagnosis between hepatoblastoma and liver cancer is difficult, a common treatment method can be obtained for hepatoblastoma and liver cancer, so that accurate tumor treatment is possible.

It is a figure which shows the result of RT-PCR in Example 1, (a) is a result of a liver cancer and a hepatoblastoma, (b) is a result of a pancreatic cancer. It is a figure which shows the result of the MTS assay in Example 2, among which (a) is a result of Hep3B, (b) is a result of Huh-6, (c) is a result of MIA-Paca2. It is a figure which shows the expression level analysis result of Cyclin D1 in Example 3, (a) is a result of Hep3B, (b) is a result of MIA-Paca2. FIG. 6 shows the results of MIA-Paca2 luciferase assay in Example 4. It is a figure which shows the result of the MTS assay in Example 5, among which (a) is a result of Hep3B, (b) is a result of Huh-6, (c) is a result of MIA-Paca2.

  Hereinafter, embodiments of the present invention will be specifically described with reference to the accompanying drawings. However, the embodiments are for facilitating understanding of the principle of the present invention, and the scope of the present invention is as follows. The present invention is not limited to the embodiments, and other embodiments in which those skilled in the art appropriately replace the configurations of the following embodiments are also included in the scope of the present invention.

  The therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer according to the present invention contains a compound having an action of suppressing expression and / or function of frizzled-2. An example of Fz2 is a protein encoded by human-derived DNA represented by the nucleotide sequence set forth in SEQ ID NO: 1. Fz2 is not limited to a protein encoded by human-derived DNA represented by the base sequence described in SEQ ID NO: 1, and is a protein encoded by DNA having sequence homology with this DNA, and is the same as Fz2 Proteins having the biological functions of are also included. The sequence homology of the base sequence is at least 80% of the entire base sequence. Preferably it is 85% or more, more preferably 90% or more.

  The DNA having the sequence homology with the DNA represented by the nucleotide sequence set forth in SEQ ID NO: 1 is one or more, for example 1 to 300, preferably 1 to 60, more preferably 1 to 30, in the nucleotide sequence. DNA, represented by a nucleotide sequence having a mutation such as deletion, substitution, addition or insertion of 1 to 10 nucleotides, particularly preferably 1 to 10 nucleotides. The degree and position of the mutation is such that the protein encoded by the DNA having the mutation has the same sequence homology and biological function as the protein encoded by the DNA represented by the nucleotide sequence set forth in SEQ ID NO: 1. As long as it is, it is not particularly limited.

  Further, a DNA selected from the group consisting of DNA represented by the nucleotide sequence set forth in SEQ ID NO: 1, DNA having sequence homology with the present DNA, and DNA represented by a nucleotide sequence having a mutation in the nucleotide sequence of the present DNA Is also included in DNA having homology with the DNA represented by the nucleotide sequence set forth in SEQ ID NO: 1.

  The expression of Fz2 means that gene information of DNA encoding Fz2 is transcribed into Fz2 mRNA, or transcribed into mRNA and translated as an amino acid sequence of Fz2.

  Suppression of Fz2 expression means that Fz2 is inhibited by preventing the reaction that occurs in the process of transcription of gene information of DNA encoding Fz2 into mRNA, or the process of transcription into mRNA and translation as the amino acid sequence of Fz2. This means that the generation of Fz2 by transcription / translation of the gene encoding is reduced.

  Suppression of Fz2 expression can be carried out using a compound having an action of suppressing Fz2 expression. For example, a low molecular weight compound having an action of specifically suppressing the expression of Fz2. To specifically suppress the expression of Fz2 means to strongly suppress the expression of Fz2, but not to suppress the expression of other proteins or to suppress it weakly. Low molecular weight compounds are peptides, polypeptides, nucleic acids, organic compounds and inorganic compounds. The molecular weight of the low molecular weight compound is, for example, a compound of 7000 or less, preferably 5000 or less, and more preferably 500 or less.

  Examples of the compound having an action of suppressing the expression of Fz2 include siRNA (small interfering RNA) having an action of reducing or eliminating the expression of Fz2 by an RNA interference technique. siRNA is a short double-stranded RNA that degrades the target gene mRNA and suppresses its expression.

  The siRNA having the action of suppressing the expression of Fz2 comprises RNA (sense strand) consisting of a partial sequence of Fz2 gene and RNA (antisense strand) consisting of a base sequence complementary to the base sequence of the RNA. It can be produced by designing based on the sequence of mRNA, synthesizing by chemical synthesis method, and annealing both obtained RNAs. The sense RNA and antisense RNA constituting the siRNA are each preferably composed of 20 to 30 nucleotides. Moreover, it is preferable to bind a nucleotide called an overhang sequence to each 3 ′ end. The overhang sequence has the effect of protecting RNA from nucleases.

  As an siRNA having an action of suppressing the expression of Fz2, an oligonucleotide in which the double-stranded RNA portion of the siRNA is represented by the base sequence set forth in SEQ ID NO: 2 and a complementary base sequence of the base sequence SiRNA consisting of Since siRNA against Fz2 reduces Fz2 expression, binding to any ligands does not occur in the extracellular domain, and the intracellular stimulus transmission system below Fz2 remains inactive. When siRNA is used, the expression of Fz2 decreases, so that the interaction with these extracellular domains is also suppressed. That is, when siRNA is used, not only the binding to Wnt is inhibited, but also the binding and interaction with other proteins are inhibited. Thus, the specific action point of Fz2 is not inhibited, but the expression of Fz2 itself is lost. Therefore, the expression of Fz2 is effectively suppressed. Since shRNA described later acts after being metabolized in the cell, the effect is slow to appear, but siRNA has the advantage that the effect is relatively fast.

  Moreover, shRNA can be illustrated as a compound which has the effect | action which suppresses the expression of Fz2. shRNA is a short double-stranded RNA having a hairpin structure and, like siRNA, suppresses gene expression by RNA interference. shRNA has a hairpin-like structure because sense RNA and antisense RNA are linked by, for example, an oligonucleotide, and the sense RNA-derived portion and the antisense RNA-derived portion form a double strand. shRNA is designed based on the mRNA base sequence of the gene encoding Fz2, in addition to sense RNA and antisense RNA, and RNA containing oligonucleotides that link these two RNAs and form a loop structure. Can be manufactured. Preferably, the 3 ′ end of the sense RNA is linked to the 5 ′ end of the oligonucleotide forming the loop structure, and the 3 ′ end of the oligonucleotide forming the loop structure is further linked to the 5 ′ end of the antisense RNA. It is an oligonucleotide. The oligonucleotide that forms a loop structure means an oligonucleotide that exists between a sense RNA and an antisense RNA and that can link both RNAs and itself forms a loop structure. A duplex having a hairpin structure can be formed by annealing a sense RNA-derived portion and an antisense RNA-derived portion.

  As an shRNA having an action of suppressing the expression of Fz2, an oligonucleotide in which the double-stranded RNA portion of the shRNA is represented by a base sequence described in SEQ ID NO: 3 and an oligonucleotide represented by a complementary base sequence of the base sequence; ShRNA consisting of Since shRNA is transcribed in the cell and then metabolized to finally become siRNA, Fz2 expression is decreased for the same reason as the above siRNA. In addition, since shRNA is a plasmid, it has an advantage that it can be easily propagated relatively easily, and has stability, so that it can be handled easily.

  In order to express siRNA in a cell with high efficiency for a long period of time, a method of introducing it into a cell using an expression vector containing siRNA is preferable. An expression vector capable of expressing siRNA having an action of suppressing the expression of Fz2 within the treatment target can be preferably used as a compound having an action of suppressing the expression of Fz2. In general, hairpin RNA expression vectors using the U6 promoter are often used.

  Specifically, an expression vector capable of expressing siRNA having an action of suppressing the expression of Fz2 within the treatment target is at least a ligation restriction enzyme site and a base described in SEQ ID NO: 2 downstream of the promoter of the expression vector. DNA base sequence transcribed into oligonucleotide consisting of sequence, loop sequence, DNA base sequence transcribed into oligonucleotide consisting of complementary base sequence of base sequence described in SEQ ID NO: 2, terminator sequence, and restriction enzyme site for ligation Is an expression vector into which synthetic DNA containing

  In order to express shRNA in cells with high efficiency for a long period of time, a method of introducing the shRNA into cells using an expression vector containing shRNA is preferable. An expression vector that can express an shRNA having an action of suppressing the expression of Fz2 within a treatment target can be preferably used as a compound having an action of suppressing the expression of Fz2.

  The function of Fz2 means a biological function that Fz2 has. Biological functions of Fz2 include the function as a receptor for Wnt ligand, that is, the function of binding to Wnt ligand, the function of transmitting stimulation by binding of Wnt ligand into cells, and, as a result, the physiological function by the action of Wnt ligand. The function which makes a function express can be illustrated.

  Suppressing the function of Fz2 means reducing or eliminating the biological function of Fz2. Specifically, suppressing the function of Fz2 means, for example, suppressing the function of binding Fz2 and Wnt ligand and / or the function of transmitting intracellular stimulation of Fz2.

  Inhibition of the function of Fz2 can be carried out using a compound having an action of suppressing the function of Fz2. For example, a low molecular weight compound having an action of specifically suppressing the expression of Fz2. To specifically suppress the function of Fz2 means to strongly suppress the function of Fz2, but not to suppress the function of other proteins or to suppress it weakly.

  As a compound having an action of suppressing the function of Fz2, for example, there is a compound having an action of inhibiting the binding between Fz2 and a Wnt ligand. Specifically, a polypeptide comprising an amino acid sequence at a site where Fz2 and a Wnt ligand bind can be exemplified. Such a polypeptide can be obtained by selecting a polypeptide that is designed from the amino acid sequence of Fz2 or Wnt ligand and synthesized by a known peptide synthesis method and that inhibits the binding between Fz2 and Wnt ligand.

  Examples of compounds having an action of inhibiting the binding between Fz2 and Wnt ligand include antibodies that recognize Fz2 or Wnt ligand and that inhibit the binding between Fz2 and Wnt ligand, and fragments of the antibody.

  An example of a compound having an action of inhibiting the binding between Fz2 and Wnt ligand is an aptamer that specifically recognizes Fz2 or Wnt ligand and suppresses the binding between Fz2 and Wnt ligand.

  By suppressing the expression and / or function of Fz2, the case of primary double cancer of liver cancer and pancreatic cancer can be improved. Here, double cancer means the case where two or more independent primary tumors have occurred in the same person. Being able to improve the case of primary double cancer of liver cancer and pancreatic cancer means that cell growth of liver cancer and pancreatic cancer can be suppressed.

  The therapeutic agent according to the present invention can be prepared as a pharmaceutical composition. In this case, it is preferable to include one or more pharmaceutical carriers in addition to the active ingredient. The active ingredient contained in the pharmaceutical composition is, for example, 0.00001 to 80% by weight, preferably 0.0001 to 8% by weight. The pharmaceutical carrier is used according to the use form of the preparation, and examples thereof include a filler, a bulking agent, a binder, a moistening agent, a disintegrant, a lubricant, a diluent and an excipient.

  If desired, stabilizers, buffers, tonicity agents, chelating agents, surfactants, and the like can be used as appropriate.

  Examples of the stabilizer include human serum albumin, ordinary L-amino acids, sugars, and cellulose derivatives. L-amino acids are, for example, glycine, cysteine and the like. Examples of the saccharide include monosaccharides such as glucose and mannose, sugar alcohols such as mannitol and inositol, disaccharides such as sucrose and maltose, polysaccharides such as dextran and hydroxypropyl starch. Examples of the cellulose derivative include methyl cellulose and ethyl cellulose.

  Examples of the buffering agent include boric acid, phosphoric acid, and acetic acid. Examples of isotonic agents are sodium chloride and potassium chloride. The chelating agent is, for example, sodium edetate. As the surfactant, both an ionic surfactant and a nonionic surfactant can be used. Examples of the surfactant include polyoxyethylene glycol sorbitan alkyl ester type and polyoxyethylene alkyl ether type.

  The dose range of the pharmaceutical composition is not particularly limited, and is selected according to the effectiveness of the contained component, the administration route, the administration form, the type of disease, and the like. In general, an appropriate dose is, for example, in the range of about 0.01 μg to 100 mg, preferably about 0.1 μg to 1 mg, per kg of the subject's body weight. The dosage can be divided into once to several times a day, and may be administered intermittently at a rate of once every several days or weeks.

  The administration route can be systemic administration or local administration. Examples of parenteral routes include normal intravenous administration and intraarterial administration, as well as subcutaneous and intramuscular administration. It can also be administered by the oral route. Furthermore, transmucosal administration or transdermal administration is also possible.

  Various forms of administration forms are possible. Examples include solid dosage forms such as tablets, pills, powders, capsules, and liquid dosage forms such as aqueous solutions, ethanol solutions, suspensions, fat emulsions, inclusions such as cyclodextrins, syrups, and elixirs. .

  A method for introducing the therapeutic agent according to the present embodiment into the body is not particularly limited, and for example, an introduction method using ultrasonic waves can be used. According to the introduction method using ultrasonic waves, temporary pores are generated in the cell membrane by cavitation that occurs when ultrasonic waves are applied to the cell tissue (sonoporation phenomenon), and can be introduced through the pores. In order to enhance the introduction efficiency, it is preferable to administer an ultrasonic contrast agent composed of microbubbles and introduce a gene by the microjet sonoporation phenomenon that occurs when the ultrasonic contrast agent is crushed. Furthermore, it is preferably introduced using an ultrasonic diagnostic apparatus that can confirm the irradiation field in real time. The ultrasonic diagnostic apparatus includes a probe that transmits ultrasonic waves and receives reflected ultrasonic waves, a processing unit that performs various processes on received signals, and a display unit that displays images in real time. It is prepared for. Since such an ultrasonic diagnostic apparatus can be used while monitoring the irradiation field, the therapeutic agent according to the present embodiment can be efficiently introduced only into the target region.

When the compound having the action of suppressing the expression of Fz2 is a nucleic acid or an expression vector, a gene therapy agent containing at least one of them as an active ingredient can be prepared. When the gene therapy agent is prepared in a form containing cells into which the gene has been introduced, the cell is prepared in a form in which the cells are mixed in phosphate buffered saline, Ringer's solution, or an injection for intracellular composition. You can also. The gene therapy agent can also be prepared in such a form that it is administered together with a substance that enhances gene transfer efficiency such as protamine. The dose of the virus vector containing the desired gene is, for example, about 1 × 10 ³ pfu to 1 × 10 ¹⁵ pfu as the retrovirus titer per kg body weight per day in the case of a retrovirus vector.

  A therapeutic method using a gene therapy agent includes an in vivo method in which the gene is directly introduced into the body, an ex vivo method in which a target cell is once taken out from a patient's body, the gene is introduced outside the body, and then the cell is returned to the body. Includes both methods of law. As a method for introducing a gene into the body or cell, any of a non-viral transfection method and a transfection method using a viral vector can be applied.

Example 1
In Example 1, the expression level of Fz2 in various cells was analyzed. Human normal fetal liver, adult liver, pancreas (Purchased from Lonza with informed consent) and liver cancer cell lines (HLE, HLF, PLC, Huh-7, Hep3B) Prepare hepatoblastoma cell lines (Huh-6, HepG2) and pancreatic cancer cell lines (MIA-Paca2, PANC-1, NOR-P1, PK-45H, PK-1, PK-59, KP-4) The suspension was suspended in 10% calf serum-supplemented DMEM (manufactured by Sigma), seeded on a 10 cm culture dish, and cultured in an incubator at 37 ° C. under 5% carbon dioxide buffer. RNA was extracted and dissolved in 1 × TE buffer (Tris-HCl (pH 7.5) 10 mM, EDTA 1 mM), and the concentration was measured using an absorptiometer. Then, cDNA was prepared using reverse transcriptase (Superscript3 first-strand synthesis system for PCR, manufactured by Invitrogen). Using 50 pg cDNA, AmpliTaq DNA with primers: upper primer: 5'-CAA GGT GCC ATC CTA TCT CAG C (SEQ ID NO: 4), lower primer: 5'-GTA GCA GCC CGA CAG AAA AT (SEQ ID NO: 5) RT-PCR was performed using polymerase (Applied Biosystems). As an internal control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was analyzed.

  The results are shown in FIGS. 1 (a) and (b). FIG. 1 (a) shows the results of liver cancer and hepatoblastoma RT-PCR. FIG. 1 (b) shows the results of RT-PCR for pancreatic cancer. As shown in FIG. 1, the expression of Fz2 is enhanced in many cell lines as compared with normal tissues.

(Example 2)
In Example 2, Hep3B, Huh-6, and MIA-Paca2 were selected as liver cancer, hepatoblastoma, and pancreatic cancer cell lines, and an MTS assay (Promega) was performed. Each cell line was suspended in DMEM supplemented with 10% calf serum, seeded on a 10 cm culture dish, and cultured in an incubator at 37 ° C. under 5% carbon dioxide buffer. The day before transfection, peel off the cells from the culture dish using 0.25% Trypsin-0.53M EDTA, float in DMEM supplemented with 10% calf serum, and count the number of cells using a Neubauer hemocytometer (Minato Medical). In a 96-well plate, 1000 cells per well were suspended in 100 μl and seeded. After 24 hours, siRNA was transfected. That is, 100 μl of siRNA dissolved in Opti-MEM at various concentrations and 100 μl of Lipofectamine 2000 diluted 50-fold in Opti-MEM were mixed, allowed to stand at room temperature for 30 minutes, and added to the medium. After 72 hours, viable cell counts were determined by MTS assay.
3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium inner salt (3- (4,5-dimethylthiazol- 10 μl of 2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium inner salt (hereinafter referred to as “MTS”) was added to each hole, followed by further culturing for 2 hours. Absorbance measurement was performed using a wavelength of 490 nm. Statistical analysis was performed by one-way ANOVA. The base sequence of the siRNA used was human Fz2 siRNA: AAACUUGUAGCUGAGAUAGGAUGGC (SEQ ID NO: 2). As a siRNA as a negative control, Stealth RNAi negative control kit Medium GC manufactured by Invitrogen was used.

  The results are shown in FIGS. 2 (a), (b) and (c). FIG. 2 (a) shows the results of the Hep3B MTS assay. FIG. 2 (b) shows the results of Huh-6 MTS assay. FIG. 2 (c) shows the result of MTS assay of MIA-Paca2. As shown in FIG. 2, cell growth is suppressed in each cell line, and cell growth is suppressed particularly at a concentration of 200 nM. Here, Mock is a group to which no siRNA is added, nega is a negative control siRNA, A11-20 nM is a group in which Fz2 siRNA (A11) is 20 nM, and A11-200 nM is a group in which Fz2 siRNA (A11) is added. 200 nM group.

(Example 3)
In Example 3, Hep3B and MIA-Paca2 were selected as liver cancer and pancreatic cancer cell lines, and the expression level of Cyclin D1 was analyzed in various cells. Fz2 siRNA was added to Hep3B and MIA-Paca2 medium, and RNA was extracted 48 hours later, and cDNA was synthesized according to the procedure of Example 1. Real-time quantitative PCR was performed using SYBR Green Master Mix. As an internal control, ribosomal related protein 19 (RLP19) was analyzed. Cyclin D1 expression level was analyzed. The results are shown in FIGS. 3 (a) and (b). FIG. 3A shows the analysis result of Hep3B. FIG. 3B shows the analysis result of MIA-Paca2. As shown in FIG. 3, the expression level of Cyclin D1 is decreased in each cell line, and the expression level of Cyclin D1 is decreased particularly at a concentration of 200 nM. Here, Mock is a group to which no siRNA is added, nega is a negative control siRNA, A11-20 nM is a group in which Fz2 siRNA (A11) is 20 nM, and A11-200 nM is a group in which Fz2 siRNA (A11) is added. 200 nM group.

Example 4
In Example 4, MIA-Paca2 was selected as a pancreatic cancer cell line and luciferase assay was attempted. MIA-Paca2 was seeded on a 24-well plate, and after 24 hours, TOP flash (Millipore) and FOP flash (Millipore) were introduced by a conventional method. After 3 hours, luciferase assay (Promega) was performed 48 hours after introduction of Fz2 siRNA by a conventional method. The results are shown in FIG. As shown in FIG. 4, a drop in TOP / FOP was observed particularly at 200 nM. Note that FOP is TOP with a mutation in the TCF / LEF binding site, and FOP does not induce transcription even when the Wnt pathway is activated.

(Example 5)
In Example 5, Hep3B, Huh-6, and MIA-Paca2 were selected as liver cancer, hepatoblastoma, and pancreatic cancer cell lines, and an MTS assay (Promega) was performed. Each cell line was suspended in DMEM supplemented with 10% calf serum, seeded on a 10 cm culture dish, and cultured in an incubator at 37 ° C. under 5% carbon dioxide buffer. The day before transfection, peel off the cells from the culture dish using 0.25% Trypsin-0.53M EDTA, float in DMEM supplemented with 10% calf serum, and count the number of cells using a Neubauer hemocytometer (Minato Medical). In a 96-well plate, 1000 cells per well were suspended in 100 μl and seeded. After 24 hours, shRNA was transfected. That is, 100 μl of shRNA dissolved in Opti-MEM at various concentrations and 100 μl of Lipofectamine LTX diluted 50-fold in Opti-MEM were mixed, allowed to stand at room temperature for 30 minutes, and added to the medium. After 72 hours, viable cell counts were determined by MTS assay.
3- (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium inner salt (3- (4,5-dimethylthiazol- 10 μl of 2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) -2H-tetrazolium inner salt (hereinafter referred to as “MTS”) was added to each hole, followed by further culturing for 2 hours. Absorbance measurement was performed using a wavelength of 490 nm. Statistical analysis was performed by one-way ANOVA. The base sequence of the shRNA used was human Fz2 shRNA: ACGGACATCGCCTACAACCAGACCATCAT (SEQ ID NO: 3). As a negative control, Non-effective 29-mer scrambled shRNA cassette in pGFP-V-RS Vector manufactured by Origen (OriGene, Rockville, MD) was used.

  The results are shown in FIGS. 5 (a), (b) and (c). FIG. 5 (a) shows the results of the Hep3B MTS assay. FIG. 5 (b) shows the results of the MTS assay for Huh-6. FIG.5 (c) is a result of the MTS assay of MIA-Paca2. As shown in FIG. 5, cell growth is suppressed in each cell line, and cell growth is suppressed particularly at a concentration of 100 ng per hole. Here, Mock is a group to which shRNA is not added, nega is a negative control shRNA, 29-10 ng is a group of 10 ng per hole of Fz2 shRNA (GI351529), and 29-100 ng is a group of Fz2 shRNA ( GI351529) is a group of 100 ng.

  Useful for the treatment of liver cancer, hepatoblastoma and pancreatic cancer.

SEQ ID NOs: 2-3: oligonucleotides SEQ ID NOs: 4-5: primers

Claims (7)

  A therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer comprising a compound having an action of suppressing expression and / or function of frizzled-2.   The compound having the action of suppressing the expression of frizzled-2 contains siRNA or shRNA that suppresses the expression of frizzled-2 as an active ingredient. Therapeutic agent.   The compound having the action of suppressing the expression of frizzled-2 is siRNA against frizzled-2, wherein the double-stranded RNA portion of the siRNA is represented by the nucleotide sequence shown in SEQ ID NO: 2 and the base The therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer according to claim 2, comprising an oligonucleotide represented by a complementary base sequence of the sequence.   The compound having the action of suppressing the expression of frizzled-2 is shRNA against frizzled-2, wherein the double-stranded RNA portion of the shRNA is represented by the nucleotide sequence shown in SEQ ID NO: 3 and the base The therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer according to claim 2, comprising an oligonucleotide represented by a complementary base sequence of the sequence.   The liver cancer, hepatoblastoma and hepatoblastoma according to claim 1, wherein the compound having an action of suppressing expression of frizzled-2 is an expression vector capable of expressing siRNA or shRNA against frizzled-2 in a treatment target. A therapeutic agent for pancreatic cancer.   The compound having the action of suppressing the expression of frizzled-2 is an expression vector capable of expressing the siRNA against frizzled-2 within the treatment target, wherein the double-stranded RNA portion of the siRNA is a base described in SEQ ID NO: 2. The therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer according to claim 5, comprising an oligonucleotide represented by a sequence and an oligonucleotide represented by a complementary base sequence of the base sequence.   The compound having the action of suppressing the expression of frizzled-2 is an expression vector capable of expressing shRNA against frizzled-2 within the treatment target, wherein the double-stranded RNA portion of the shRNA is a base described in SEQ ID NO: 3. The therapeutic agent for liver cancer, hepatoblastoma and pancreatic cancer according to claim 5, comprising an oligonucleotide represented by a sequence and an oligonucleotide represented by a complementary base sequence of the base sequence.