JP2013009621A - Method for producing optically-active 4-halo-3-hydroxybutyronitrile - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing 4-halo-3-hydroxybutyronitrile of high concentration and high optical purity.SOLUTION: There is provided the method for producing 4-halo-3-hydroxybutyronitrile from a 1, 3-dihalo-2-propanol and a cyanide donor by enzyme reaction. After the initiation of the enzyme reaction, the 1, 3-dihalo-2-propanol is supplied to a reaction liquid and the concentration of the 1, 3-dihalo-2-propanol is held in the range of not more than 0.43 mol/kg.

Description

  The present invention relates to a process for producing 4-halo-3-hydroxybutyronitrile by enzymatic reaction from 1,3-dihalo-2-propanol and a cyanide donor. Specifically, after the start of the enzyme reaction, the 1,3-dihalo-2-propanol concentration in the reaction solution is maintained in a range not exceeding 0.43 mol / kg, 4-halo-3-hydroxy The present invention relates to a method for producing butyronitrile.

  A halohydrin epoxidase can be exemplified as an enzyme used in producing 4-halo-3-hydroxybutyronitrile from 1,3-dihalo-2-propanol and a cyanide donor by an enzymatic reaction. As halohydrin epoxidases, enzymes produced by microorganisms belonging to the genus Corynebacterium, the genus Microbacterium, the genus Agrobacterium and the genus Aureobacteria are known. ing.

  The present applicants previously described the optically active 4-halo-3-hydroxylase from 1,3-dihalo-2-propanol by the action of dehalogenating enzymes of the genus Corynebacterium, Microbacterium, and Aureobacteria. A method for producing hydroxybutyronitrile (see Patent Document 1 and Patent Document 2) and a method for producing optically active 4-halo-3-hydroxybutyronitrile from epihalohydrin (see Patent Document 3) are proposed. Furthermore, using a gene recombination technique, a recombination vector having a halohydrin epoxidase enzyme gene DNA derived from the genus Corynebacterium is obtained, and using the transformant introduced with this recombination vector, 3-hydroxy Butyronitrile has been successfully produced (see Patent Document 4, Patent Document 5, Patent Document 6, and Non-Patent Document 1).

  Applicants have also identified Corynebacterium sp. In the halohydrin epoxidase derived from N-1074, a recombinant vector having a gene DNA encoding an improved halohydrin epoxidase was obtained by random mutation introduction, and a transformant into which this recombinant vector was introduced was used. -It has succeeded in producing halo-3-hydroxybutyronitrile (Patent Document 7).

  Jansen et al., Agrobacterium radiobacter AD1 strain, Mycobacterium sp. GP1, Arthrobacter sp. A halohydrin epoxidase produced by AD2 has been found. In Agrobacterium radiobacter AD1 strain, the three-dimensional structure of the enzyme has been clarified (Non-patent Documents 2 and 3).

  However, in the method for producing 4-halo-3-hydroxybutyronitrile using the above-mentioned enzyme, the accumulated concentration of the obtained nitrile is as low as about 0.1 mol / kg, or the productivity of the obtained nitrile is low. The optical purity is 94% e.e. e. The method was insufficient and not industrially suitable.

Japanese Patent No. 2840722 Japanese Patent Laid-Open No. 2001-25397 Japanese Patent No. 2840723 Japanese Patent No. 3073037 Japanese Patent No. 3026367 JP 2008-17838 A WO 2008/108466

Biosci. Biotech. Biochem. 58 (8), 1451-1457, 1994. The EMBO Journal. 22 (19), 4933-4944, 2003. J. et al. Bacteriology 183 (17), 5058-5066, 2001

  An object of the present invention is to provide a production method of 4-halo-3-hydroxybutyronitrile having high productivity and industrially suitable.

  As a result of intensive studies to solve the above problems, the present inventors produce 4-halo-3-hydroxybutyronitrile by enzymatic reaction from 1,3-dihalo-2-propanol and cyanide donor. In the method, after the start of the enzyme reaction, the concentration of 1,3-dihalo-2-propanol in the reaction solution is maintained in a range not exceeding 0.43 mol / kg, thereby increasing the optical activity of high concentration and high optical purity. The present inventors have found that halo-3-hydroxybutyronitrile can be produced and have completed the present invention.

That is, the present invention is as follows.
(1) A method for producing optically active 4-halo-3-hydroxybutyronitrile from 1,3-dihalo-2-propanol and a cyanide donor by an enzymatic reaction. , 3-dihalo-2-propanol is supplied, and the 1,3-dihalo-2-propanol concentration in the reaction solution is maintained in a range not exceeding 0.43 mol / kg.
(2) The method according to (1) above, wherein the enzyme is a halohydrin epoxidase.
(3) A halohydrin epoxidase is produced in Corynebacterium sp. The method according to (1) or (2) above, which is derived from a halohydrin epoxidase gene (HHEB) of N-1074.
(4) The method according to any one of (1) to (3) above, wherein the halohydrin epoxidase is an improved halohydrin epoxidase consisting of the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4.

  According to the method of the present invention, 4-halo-3-hydroxybutyronitrile can be accumulated in a high concentration and high optical purity in the reaction system. Therefore, this invention can provide the manufacturing method of optically active 4-halo-3-hydroxybutyronitrile with high productivity and industrially suitable.

FIG. 1 is a structural diagram of plasmid pSTT002. FIG. 2 is a graph showing the transition of the theoretical value of DCP concentration calculated from the reaction profile described in Table 4. FIG. 3 is a graph showing the transition of the theoretical value of DCP concentration calculated from the reaction profile shown in Table 6. FIG. 4 is a graph showing the transition of the theoretical value of DCP concentration calculated from the reaction profile described in Table 8.

Hereinafter, the present invention will be described in detail.
The method for producing optically active 4-halo-3-hydroxybutyronitrile according to the present invention (hereinafter simply referred to as “the present production method”) is a reaction solvent containing water and halohydrin epoxidase, In this method, optically active 4-halo-3-hydroxybutyronitrile is produced from 3-dihalo-2-propanol and a cyanide donor by an enzymatic reaction.

(1) 4-halo-3-hydroxybutyronitrile 4-halo-3-hydroxybutyronitrile is a substance useful as a raw material for synthesizing various pharmaceuticals and physiologically active substances, and particularly as a raw material for synthesizing L-carnitine. Useful. 4-halo-3-hydroxybutyronitrile refers to a compound represented by the following general formula (1).

(In the formula, X represents a halogen atom. Specifically, it is a fluorine atom, a chlorine atom, a bromine atom or an iodine atom, preferably a chlorine atom or a bromine atom, and most preferably a chlorine atom. * Represents an asymmetric carbon. The steric configuration may be either (R) or (S), but (R) is preferred.

  Specific examples include 4-fluoro-3-hydroxybutyronitrile, 4-chloro-3-hydroxybutyronitrile, 4-bromo-3-hydroxybutyronitrile, 4-iodo-3-hydroxybutyronitrile. 4-chloro-3-hydroxybutyronitrile and 4-bromo-3-hydroxybutyronitrile are preferable.

  Moreover, optically active 4-halo-3-hydroxybutyronitrile is 4-halo-3-containing one enantiomer (for example, R form) more than the other enantiomer (for example, S form). It refers to hydroxybutyronitrile or 4-halo-3-hydroxybutyronitrile consisting of only one of the enantiomers. When 4-halo-3-hydroxybutyronitrile consists of only one of the enantiomers, the optical purity is 100%.

  Here, in the present invention, “optical activity” means a state of a substance in which one enantiomer is contained more than the other enantiomer, or a substance consisting of only one of the enantiomers. Say state. In addition, “optical purity” is substantially equal to “enantiomeric excess (% ee)” and is defined by the following formula.

      Optical purity≈enantiomeric excess = 100 × (| [R] − [S] |) / ([R] + [S]) (% ee)

  Here, [R] and [S] indicate the respective concentrations of the enantiomers in the sample. In the present invention, the term “stereoselectivity” refers to a property that halohydrin epoxidase preferentially catalyzes a reaction that one of the enantiomers produces when producing a product from a substrate. To tell.

(2) Halohydrin epoxidase Examples of the enzyme used in the production method include halohydrin epoxidase. The halohydrin epoxidase is an activity of dehydrohalogenating 1,3-dihalo-2-propanol represented by the following general formula (2) to synthesize an epihalohydrin represented by the following general formula (3). And an enzyme having an activity of catalyzing the reverse reaction (EC number: 4.5.1.1.-).

(In the formula, X ₁ and X ₂ represent a halogen atom. Fluorine, chlorine, bromine and iodine are preferred, and chlorine and bromine are particularly preferred. Specifically, 1,3-difluoro-2-propanol, 1,3- Examples include dichloro-2-propanol, 1,3-dibromo-2-propanol, 1,3-diiodo-2-propanol, and preferably 1,3-dichloro-2-propanol, 1,3-dibromo-2 -Propanol.)

(Wherein X represents a halogen atom, fluorine, chlorine, bromine and iodine are preferred, and chlorine and bromine are particularly preferred. Specifically, epifluorohydrin, epichlorohydrin, epibromohydrin and epiiodohydride. Phosphorus etc. are mentioned, Especially preferred are epichlorohydrin and epibromohydrin.)

  Examples of microorganisms that produce this enzyme include Corynebacterium sp. N-1074 (FERM BP-2643), Microbacterium sp. N-4701 (FERM BP-2644), Agrobacterium radiobacter AD1, Mycobacterium sp. GP1, Earth Examples thereof include Arthrobacter sp. AD2.

  A particularly preferred microorganism is Corynebacterium sp. N-1074 (FERM BP-2643).

  The halohydrin epoxidase is published in, for example, GenBank, and the accession number of the halohydrin epoxidase gene (HHEB) derived from Corynebacterium sp. N-1074 is D90350.

  Corynebacterium sp. As for the halohydrin epoxidase HheB derived from the N-1074 strain, since the gene (HHEB) has two initiation codons, as a result, two types of halo differing only in the presence or absence of 8 amino acid residues near the N-terminus. The presence of hydrin epoxidase has been reported (Biosci. Biotechnol. Biochem., 58 (8), 1451-1457, 1994). In the present specification, when both (the above two halohydrin epoxidases) are referred to separately, HheB consisting of the amino acid sequence (SEQ ID NO: 3) translated from the first initiation codon is referred to as “HheB (1st)”. HheB consisting of the amino acid sequence (SEQ ID NO: 1) translated from the second start codon (the next methionine) is referred to as “HheB (2nd)”, both of which are wild-type halohydrin epoxies It shall be a dase.

  Examples of the gene encoding HheB (1st) (HHEB (1st)) include those containing a polynucleotide having the base sequence described in SEQ ID NO: 7. Examples of the gene encoding HheB (2nd) (HHEB (2nd)) include those containing a polynucleotide consisting of the base sequence described in SEQ ID NO: 5.

  Here, “wild-type halohydrin epoxidase” refers to an enzyme having halohydrin epoxidase activity that can be separated from a living organism in nature, and its origin is not limited. Also, it means a halohydrin epoxidase that retains its natural attribute without any intentional or unintentional deletion of amino acids or substitution or insertion with other amino acids in the amino acid sequence constituting the enzyme. .

  In the method of the present invention, substitution of one or several amino acids in the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 1 as well as wild-type halohydrin epoxidase (HheB (1st) and HheB (2nd)) , Having deletions, additions or insertions, and having a biological activity equal to or higher than HheB (1st) or HheB (2nd), or substantially identical to the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 1 And having a biological activity equivalent to or higher than that of HheB (1st) or HheB (2nd) (hereinafter also referred to as “mutant HheB (1st) or mutant HheB (2nd)”) Can also be used.

  In this specification, “equivalent biological activity” means the activity of dehydrohalogenating 1,3-dihalo-2-propanol to synthesize epihalohydrin and the strength of the activity of catalyzing the reverse reaction. It means that it is substantially the same. The “one or several” is an integer of 10 or less, for example, about 1 to 10, preferably about 1 to 5.

  “Substantially identical sequence homology” means at least 90%, more preferably at least 95%, more preferably at least 96%, 97%, 98% or the amino acid sequence shown in SEQ ID NO: 3 or SEQ ID NO: 1 or Having 99% sequence homology.

  Further, the HHEB gene is not limited to the polynucleotide consisting of the base sequence shown in SEQ ID NO: 7 or SEQ ID NO: 5, but is stringent to the complementary strand of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 7 or SEQ ID NO: 5. A polynucleotide that hybridizes under various conditions and encodes a polypeptide having a biological activity equal to or higher than that of HheB (1st) or HheB (2nd) (hereinafter referred to as “mutant HHEB (1st)”, respectively. And “mutant HHEB (2nd)”). A polynucleotide that hybridizes under stringent conditions is, for example, at least 90%, more preferably at least 95%, more preferably at least 96%, 97%, and a polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 7 or SEQ ID NO: 5. It has 98% or 99% sequence homology.

  The halohydrin epoxidase can be prepared by extraction from the microorganism. It can also be produced by a genetically modified microorganism produced by cloning a gene encoding halohydrin epoxidase and incorporating the gene.

  Extraction of the enzyme may be carried out by a conventional method, and even if the preparation contains components other than halohydrin epoxidase, it does not need to be purified if it does not adversely affect the reaction. A halohydrin epoxidase obtained by culturing a genetically modified microorganism prepared by incorporating a halohydrin epoxidase gene is preferably used because it is easy to prepare.

  In addition, examples of host microorganisms used for transformation include microorganisms belonging to the genus Escherichia coli or Rhodococcus, but are not particularly limited, and other host microorganisms can also be used.

  As a medium for culturing microorganisms producing the halohydrin epoxidase, any medium can be used as long as these microorganisms can usually grow. As the carbon source, for example, sugars such as glucose, sucrose, maltose and fructose, organic acids such as acetic acid, citric acid and fumaric acid or salts thereof, alcohols such as ethanol and glycerol can be used. As the nitrogen source, for example, various inorganic and organic acid ammonium salts can be used in addition to general natural nitrogen sources such as peptone, meat extract, yeast extract and amino acids. In addition, inorganic acids such as sulfuric acid, hydrochloric acid, phosphoric acid and boric acid or salts thereof, inorganic salts containing sodium, magnesium, potassium, calcium, etc. that can be used by microorganisms used, iron, manganese, zinc, cobalt, nickel trace metal salts In addition, vitamins such as vitamins B1, B2, C, and K are appropriately added as necessary as a microorganism growth promoter. The culture of the microorganism of the present invention is usually performed by liquid culture, but can also be performed by solid culture.

  The culture is performed at a temperature of 10 to 50 ° C. and in the range of pH 2 to 11. In order to promote the growth of microorganisms, aeration and agitation may be performed. Microorganisms obtained by culturing are microbial cells obtained from the culture solution as it is or by collection operations such as centrifugation from the culture, or treated cells (for example, disrupted cells, crude enzyme, purified enzyme) or It can be used as a halohydrin epoxidase in the form of a microbial cell immobilized by a conventional method or a processed microbial cell product.

(3) Improved halohydrin epoxidase The “improved halohydrin epoxidase” in the present invention mainly uses a gene recombination technique, and is the second against the amino acid sequence of a wild-type halohydrin epoxidase, It consists of amino acid sequences in which substitution mutations have been introduced for the four amino acids of 71st, 125th and 199th (HheB (2nd)) and 2nd, 79th, 133th and 207th (HheB (1st)). Yes, it is a halohydrin epoxidase with improved halohydrin epoxidase activity, stereoselectivity, product inhibition resistance, product accumulation ability and the like per transformant.

  Specifically, the improved halohydrin epoxidase used in the present invention has the following amino acid mutations relative to the amino acid sequence of the wild-type halohydrin epoxidase including the amino acid sequence shown in SEQ ID NO: 1 or 3. It is a protein consisting of an introduced amino acid sequence.

  (1) An amino acid in which the second Ala, the 71st Phe, the 125th Gln, and the 199th Asp of the amino acid sequence represented by SEQ ID NO: 1 are substituted with Lys, Trp, Thr, and His, respectively. Protein consisting of sequence (SEQ ID NO: 2)

  (2) An amino acid in which the second Ala, the 71st Phe, the 125th Gln, and the 199th Asp of the amino acid sequence represented by SEQ ID NO: 1 are substituted with Lys, Trp, Thr, and His, respectively. An amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence excluding the second, 71st, 125th and 199th amino acids, and a halo Protein with hydrin epoxidase activity

  (3) The second Ala, the 79th Phe, the 133rd Gln, and the 207th Asp of the amino acid sequence represented by SEQ ID NO: 3 were substituted with Lys, Trp, Thr, and His, respectively. Protein consisting of amino acid sequence (SEQ ID NO: 4)

  (4) Amino acids in which the second Ala, the 79th Phe, the 133rd Gln, and the 207th Asp of the amino acid sequence represented by SEQ ID NO: 3 have been replaced with Lys, Trp, Thr, and His, respectively. A halohydrin epoxidase, comprising an amino acid sequence wherein one or several amino acids are deleted, substituted or added in the amino acid sequence excluding the second, 79th and 133rd amino acids Active protein

  Examples of the gene encoding improved HheB (2nd) consisting of the amino acid sequence described in SEQ ID NO: 2 include those containing a polynucleotide consisting of the base sequence described in SEQ ID NO: 6. Examples of the gene encoding improved HheB (1st) consisting of the amino acid sequence described in SEQ ID NO: 4 include those containing a polynucleotide consisting of the base sequence described in SEQ ID NO: 8.

  The improved halohydrin epoxidase used in the present invention only needs to have an amino acid sequence having an amino acid mutation selected from the above (1) to (4).

  In the above (2) and (4), “one or several” refers to an integer of 10 or less, for example, about 1 to 10, preferably about 1 to 5.

  In the present invention, the type of amino acid may be represented by a three-letter or one-letter alphabet. Furthermore, it may be described by placing a three-letter or one-letter alphabet before or before the number, and in this case, the position of the amino acid residue and the type of amino acid before and after substitution. That is, unless otherwise specified, the number indicates what amino acid residue is the amino acid residue encoded by the translation initiation codon (usually methionine) when defined as the first. Also, the three-letter or one-letter alphabet displayed before the number represents the three-letter or one-letter code of the amino acid before the amino acid substitution, and the three-letter or one-letter alphabet displayed after the number causes an amino acid substitution. In this case, the three-letter or one-letter code of the amino acid after substitution is to be expressed. For example, the 125th glutamine residue may be expressed as “Gln125” or “Q125”, and when the 71st phenylalanine residue is substituted with tryptophan, it may be expressed as “Phe71Trp” or “F71W”.

(4) Cyanide Donor A cyanide donor means a compound that generates cyanide ion (CN ⁻ ) or hydrogen cyanide when added to a reaction solution, and is not particularly limited, but hydrogen cyanide (HCN), potassium cyanide (KCN), sodium cyanide ( Examples are NaCN) and acetone cyanohydrin (ACH). Hydrogen cyanide, potassium cyanide and sodium cyanide are preferably used.

(5) Enzymatic reaction The enzymatic reaction of this production method is started by adding cyanide donor, 1,3-dihalo-2-propanol and halohydrin epoxidase to water or a buffer solution to the reaction system. As the buffer solution, for example, a buffer solution composed of a salt such as hydrocyanic acid, phosphoric acid, boric acid, citric acid, glutaric acid, malic acid, malonic acid, o-phthalic acid, succinic acid or acetic acid, Tris buffer Or good buffer solution etc. are illustrated. Among them, a buffer solution composed of hydrocyanic acid and a salt thereof, and a Tris buffer solution are preferable. A buffer solution composed only of hydrocyanic acid and a salt thereof is particularly preferable in that impurities derived from the buffer agent are not mixed.

  The order of introducing cyanide donor, 1,3-dihalo-2-propanol, and halohydrin epoxidase into the buffer solution is not particularly limited, but 1,3-dihalo-2-propanol and halohydrin epoxidase are not limited. Before contacting, it is preferable that a cyanide donor is present in the reaction system in that a high reaction rate can be obtained at the start of the reaction and epihalohydrin by-product can be suppressed. The concentration of the cyanide donor to be present is preferably 0.01 to 1.5 mol / kg, more preferably 0.8 to 1.5 mol / kg at the start of the reaction. If the concentration of the cyanide donor exceeds 1.5 mol / kg, it is not preferable from the viewpoint of enzyme stability.

  Further, since cyanide donors are consumed as the reaction proceeds, it is preferable to add them. In such a case, it is preferable to add it so that 0.05 mol / kg or more exists in the reaction system, but it is preferable not to exceed 1.5 mol / kg from the viewpoint of enzyme stability.

  The amount of the cyanide donor used is preferably 1 to 2 equivalents of 1,3-dihalo-2-propanol to be finally used from the viewpoint of improving the reaction rate and efficiently using the cyanide donor.

  Here, the amount of 1,3-dihalo-2-propanol used finally means the total amount of 1,3-dihalo-2-propanol used from the start of the reaction to the end of the reaction.

  The temperature during the enzyme reaction is preferably 0 to 30 ° C. from the viewpoint that the enzyme stability is good and the reaction proceeds smoothly.

  As the reaction proceeds, hydrogen halide is generated in the reaction solution, so that the pH is lowered. Therefore, it is preferable to adjust and maintain the pH in the system in a region where the enzyme activity is exhibited by additionally adding alkali into the reaction system. The pH is preferably 7.0 or more from the viewpoint of smooth progress of the reaction, and is preferably 8.5 or less from the viewpoint of suppressing side reactions.

  The alkali to be used is not particularly limited as long as it forms a salt with hydrogen halide and the aqueous solution of the salt is in a pH range where the activity of the enzyme is exerted. For example, an alkali metal or an alkaline earth metal or Examples thereof include salts of ammonia with hydroxides or weak acids. Sodium hydroxide, potassium hydroxide, aqueous ammonia, sodium cyanide and potassium cyanide are preferred. The form of alkali used is not particularly limited, but an aqueous solution is preferable from the viewpoint of ease of handling.

  It is preferable that 1,3-dihalo-2-propanol is preliminarily present in the reaction system so as to be 0.01 mol / kg or more at the start of the reaction because a high reaction rate can be obtained at the start of the reaction. In addition, 1,3-dihalo-2-propanol is preliminarily added to the reaction system so as to be 1.5 mol / kg or less, preferably 1.0 mol / kg or less, more preferably 0.5 mol / kg or less at the start of the reaction. It is preferable to make it exist in view of the stability of the enzyme.

  1,3-Dihalo-2-propanol is preferably added in accordance with the progress of the reaction from the viewpoint of high productivity. Specifically, after the start of the enzyme reaction, 1,3-dihalo-2-propanol is added to the reaction solution. It is preferable to add propanol intermittently so that the concentration of 1,3-dihalo-2-propanol in the reaction solution is maintained within a range not exceeding 0.43 mol / kg.

  The amount of halohydrin epoxidase used is not particularly limited, and an amount that allows the reaction to proceed smoothly may be used. For example, 1 U to 1000 U can be used per 1 g of the reaction liquid at the start of the reaction. Here, 1 U (unit) means the amount of enzyme capable of producing 1 μmol of epichlorohydrin from 1,3-dichloro-2-propanol in 1 minute in a buffer solution at 20 ° C. and pH 8.0. Means that.

  The concentration of 1,3-dihalo-2-propanol and 4-halo-3-hydroxybutyronitrile in the reaction system can be quantified by, for example, high performance liquid chromatography (HPLC). The concentration of cyanide donor in the reaction system can be quantified by titration, for example. The amount of 1,3-dihalo-2-propanol and cyanide donor to be added can be determined using these quantitative results as an indicator of the progress of the reaction, but 1,3-dihalo-2-propanol and The concentration of cyanide donor can be controlled more easily.

  That is, when the pH is kept constant using a pH controller after the start of the reaction, theoretically, the generated hydrogen halide is theoretically equivalent to the mole of 1,3-dihalo-2-propanol and cyanide donor consumed by the reaction. An equimolar amount of alkali is added. Since the amount of alkali added serves as an indicator of the progress of the reaction, it can be used as a guide when adding 1,3-dihalo-2-propanol and cyanide donor to the reaction system.

  The reaction time is appropriately selected depending on the concentration of the substrate, the enzyme concentration, or other reaction conditions, but the reaction is completed within 1 to 120 hours, preferably 2 to 48 hours, more preferably 5 to 24 hours. Set conditions.

  By the above-mentioned method, optically active 4-halo-3-hydroxybutyronitrile can be accumulated in the reaction system at a rate exceeding 0.3 mol / kg. The optically active 4-halo-3-hydroxybutyronitrile produced and accumulated in the reaction solution can be collected and purified using a known method. For example, after removing cells from the reaction solution using a method such as centrifugation, extraction with a solvent such as ethyl acetate is performed, and the solvent is removed under reduced pressure to remove 4-halo-3-hydroxybutyronitrile. You can get syrup. Further, these syrups can be further purified by distillation under reduced pressure.

  EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to these examples. In addition, the determination of 1,3-dichloro-2-propanol (DCP), epichlorohydrin (ECH), and 4-chloro-3-hydroxybutyronitrile (CHBN) uses high performance liquid chromatography (HPLC). The analysis conditions shown in Table 1 were performed.

  After 100 μl of the reaction finished solution was diluted and mixed with 5 ml of the mobile phase described in the above table, analysis was performed under the analysis conditions described in the above table. A calibration curve was prepared in advance using DCP, ECH, and CHBN solutions with known concentrations, and the DCP, ECH, and CHBN concentrations in the reaction solution were determined using the calibration curve.

<Optical purity analysis of produced CHBN>
The optical purity analysis of the produced CHBN was performed by normal phase HPLC after esterification of CHBN. Normal phase HPLC analysis conditions are shown in Table 2.

  Extraction was carried out by adding an equal amount of ethyl acetate to about 400 μl of the reaction end solution. The ethyl acetate phase was separated, and a small amount of anhydrous magnesium sulfate was added and stirred. A portion of the ethyl acetate phase was dispensed into a flask, set in a rotary evaporator (Tokyo Rika), and concentrated at 50 ° C., 250 torr for 60 minutes. 20 μl of dichloromethane and 20 μl of pyridine, and 20 μl of (+)-α-methoxy-α- (trifluoromethyl) phenylacetyl chloride (hereinafter sometimes referred to as (+)-MTPA) were added to the residue. After reacting overnight at room temperature, 400 μl of diisopropyl ether (hereinafter sometimes referred to as IPE) was added, and 1N hydrochloric acid was added for extraction. The IPE phase was separated and extracted by adding 400 μl of a saturated aqueous sodium hydrogen carbonate solution. The IPE phase was fractionated into a 1.5 ml tube, and the IPE phase was volatilized by an aspirator. The residue was suspended in a mixed solution of n-hexane: 2-propanol = 4: 1, and then analyzed under the analysis conditions described in Table 5. Each concentration was calculated from the area area ratio of (R) -CHBN-(+)-MTPA ester and (S) -CHBN-(+)-MTPA ester, and the CHBN optical properties were as described above (described above). Purity was calculated.

Preparation of recombinant bacteria expressing improved halohydrin epoxidase (1) Preparation of template plasmid A plasmid as a template was prepared as follows.
First, the halohydrin epoxidase gene HHEB (2nd) shown in SEQ ID NO: 5 was amplified by PCR using the primers shown in SEQ ID NO: 9 and SEQ ID NO: 10.

Reaction solution composition:
Template DNA (plasmid pST111) 1 μl
10 μM primer DH-09 (SEQ ID NO: 9) 1 μl
10 μM Primer DH-07 (SEQ ID NO: 10) 1 μl
Sterile water 22μl
2 × PrimeStar Max (Takara Bio Inc.) 25 μl
Total volume 50μl

Temperature cycle:
30 cycles of reaction at 98 ° C .: 10 seconds, 55 ° C .: 5 seconds, 72 ° C .: 4 seconds

Primer:
DH-09: GATCATGAAAAACGGAAGACTGGCAGGCAAGCG (SEQ ID NO: 9)
DH-07: CGCCTGCAGGCTACAACGACGACGAGCGCCTG (SEQ ID NO: 10)

  DH-09 consists of 33 nucleotides, and has a restriction enzyme BspHI recognition site (TCATGA) and a halohydrin epoxidase gene HHEB (2nd) after the translation start codon in the sequence, and the codon corresponding to the second amino acid is Encode lysine with AAA.

  DH-07 consists of 32 nucleotides, and has a restriction enzyme Sse8387I / PstI recognition site (CCTGCAGG) and a halohydrin epoxidase gene HHEB (2nd) stop codon downstream region in its sequence.

  Moreover, pST111 used as a template is described in Japanese Patent Publication No. 5-317066, and E. coli transformant JM109 / pST111 using a recombinant vector containing pST111 is an independent administrative corporation under the accession number “FERM BP-10922”. Deposited at the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center on March 1, 1991.

  The PCR reaction solution subjected to the heat cycle treatment was purified by GFX PCR DNA band and GelBand Purification kit (manufactured by GE Healthcare Bioscience), and the PCR amplification product was subjected to double digestion with restriction enzymes BspHI and PstI. After digestion products were separated by 0.7% agarose gel electrophoresis, a band (about 0.8 kb) containing the full length of the halohydrin epoxidase gene was purified with QIAquick Gel Extraction Kit (manufactured by QIAGEN). On the other hand, the expression vector pTrc99A was digested with restriction enzymes NcoI and PstI, and then purified by phenol extraction, chloroform extraction and ethanol precipitation (Molecular Cloning, A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press (1989))). This was mixed with the PCR amplification product containing the full length halohydrin epoxidase gene described above, and then Solution I (DNA Ligation Kit ver. 2 (manufactured by Takara Bio Inc.)) was added to the mixture to make a ligation mixture. It was. This mixture was incubated for 12 hours at 16 ° C. to bind the PCR amplification product and the expression vector pTrc99A.

  It should be noted that pTrc99A can be purchased from Centralbureau room schema schemes (http://www.cbs.knaw.nl).

  Next, the entire amount of the ligation reaction solution was added to 200 μl of competent cells of Escherichia coli JM109 strain prepared by the method described later, and left at 0 ° C. for 30 minutes.

Subsequently, the competent cell was heat shocked at 42 ° C. for 45 seconds and cooled at 0 ° C. for 2 minutes. Then, 1 ml of SOC medium (20 mM glucose, 2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO ₄ , 1 mM MgCl ₂ ) was added and shaken at 37 ° C. for 1 hour. Cultured. After the culture, 200 μl of the culture solution was applied to LB Amp agar medium (LB medium containing ampicillin 100 mg / L, 2% agar (1% bactotryptone, 0.5% bacto yeast extract, 1% NaCl), 37 The cells were cultured overnight at 0 ° C. A plurality of transformant colonies grown on the agar medium were cultured overnight at 37 ° C. in 1.5 ml of LB Amp medium (LB medium containing 100 mg / L of ampicillin). After collecting each of the culture broths, the recombinant plasmid was recovered using Flexi Prep (GE Healthcare Bioscience) and using a capillary DNA sequencer CEQ2000 (Beckman Coulter) according to the attached manual. Analyzing the base sequence of the PCR amplification product cloned in the plasmid, The plasmid confirmed .PCR amplified from DNA fragment was cloned that over mutation has not occurred named PSTT002, and the Escherichia coli JM109 strain transformants containing the plasmid was named JM109 / pSTT002.

  FIG. 1 shows the structure of pSTT002. pSTT002 is obtained by inserting the halohydrin epoxidase gene (HHEB (2nd)) described in SEQ ID NO: 5 into the NcoI-PstI site of the vector pTrc99A.

  A competent cell of E. coli JM109 was prepared by the following method.

E. coli JM109 strain was inoculated into 1 ml of LB medium and pre-cultured aerobically at 37 ° C. for 5 hours. Next, 0.4 ml of the preculture solution is added to 40 ml of SOB medium (2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO ₄ , 1 mM MgCl ₂ ) at 18 ° C. Cultured for 20 hours. The obtained culture was collected by centrifugation (3,700 × g, 10 minutes, 4 ° C.), and then cooled TF solution (20 mM PIPES-KOH (pH 6.0), 200 mM KCl, 10 mM CaCl ₂ , 40 mM MnCl). ₂ ) 13 ml was added, allowed to stand at 0 ° C. for 10 minutes, and centrifuged again (3,700 × g, 10 minutes, 4 ° C.) to remove the supernatant. The obtained Escherichia coli cells were suspended in 3.2 ml of a cold TF solution, 0.22 ml of dimethyl sulfoxide was added, and the mixture was allowed to stand at 0 ° C. for 10 minutes, and then frozen using liquid nitrogen to obtain a competent cell.

(2) Q125T mutation introduction Q125T mutation was introduced by PCR under the following conditions.

Reaction solution composition:
pSTT002 1 μl
1 μl of 10 μM primer DH-51 (SEQ ID NO: 11)
10 μM primer DH-52 (SEQ ID NO: 12) 1 μl
Sterile water 22μl
2 x PrimeSTAR Max 25 μl
Total volume 50μl

Reaction cycle:
30 cycles of 98 ° C: 10 seconds, 55 ° C: 5 seconds, 72 ° C: 30 seconds

Primer:
DH-51: gcagcgatgcggtacACCgaaggtgcgctggcc (SEQ ID NO: 11)
DH-52: ggccagcgcaccttcGGTgtaccgcatcgctgc (SEQ ID NO: 12)

  1 μl of DpnI was added to each reaction solution, incubated at 37 ° C. for 1 hour, and E. coli JM109 was transformed with 2 μl of the DpnI treatment solution. A plasmid was extracted from the obtained transformant to confirm the DNA sequence, and a plasmid into which a mutation of Q125T was introduced was obtained. The obtained mutation-introduced plasmid was named pSTT118.

(3) Introduction of D199H A plasmid in which PCR, transformation and plasmid extraction were carried out in the same manner as in Example 1 (2) except that pSTT118 was used as a template and DH-125 and DH-126 were used as primers, and a Q125T + D199H mutation was introduced. Was made.

Primer:
DH-125: cgagagcacgcgctgctcgcgtttgtttcctg (SEQ ID NO: 13)
DH-126: cagcgcgtgctctcgggcagtcgcgaggccg (SEQ ID NO: 14)

  The obtained mutation-introduced plasmid was designated as pSTT201.

(4) Introduction of F71W A plasmid in which a Q125T + D199H + F71W mutation was introduced by PCR, transformation and plasmid extraction in the same manner as in Example 1 (2) except that pSTT201 was used as a template and DH-49 and DH-50 were used as primers. Was made.

Primer:
DH-49: gccccac TGGgggggtgaccgtgctgggag (SEQ ID NO: 15)
DH-50: caccccCCAgtggggcgtcgaccgcgaa (SEQ ID NO: 16)

  The resulting mutation-introduced plasmid was named pSTT206, and the E. coli JM109 transformant containing the plasmid was named JM109 / pSTT206.

Cultivation of transformed microorganisms expressing halohydrin epoxidase The recombinant bacterium JM109 / pSTT206 expressing the improved halohydrin epoxidase prepared in Example 1 was added to 100 mL of LB medium containing 1 mM IPTG and 100 mg / l ampicillin. 20 cells were inoculated and cultured with shaking at 37 ° C. for 20 hours.

  The cultured cells were washed with 50 mM Tris-sulfate buffer (pH 8.0), and 50 mM Tris-sulfate buffer (pH 8.0) was added to 20 g and suspended. Add 0.25 g of this bacterial cell suspension to 100 mL of 50 mM Tris-sulfate buffer (pH 8.0), add 1,3-dichloro-2-propanol to 50 mM, and react at 20 ° C. for 10 minutes. did.

  When the amount of epichlorohydrin in the reaction solution was measured by HPLC, it was 13.5 mM. That is, 1350 μmol of epichlorohydrin was produced per 10 minutes, and it was found that the activity of this bacterial cell suspension was 540 U per 1 g of the bacterial cell suspension.

  This bacterial cell suspension was diluted with 50 mM Tris-sulfate buffer (pH 8.0) to 400 U per 1 g of the bacterial cell suspension.

  The reaction was carried out using the conditions shown in Table 3 below as initial amounts. In the reaction, a predetermined amount of water and HCN were charged into a 1000 mL four-necked flask equipped with an alkali charging pipe controlled by a pH electrode and a pH controller, adjusted to pH 8.0 with 30% NaOH, and 1, 3 -Dichloro-2-propanol (DCP) was added and stirred until evenly dissolved.

  Next, 75 g (30.0 kU) of the cell suspension of Example 2 was added, and the reaction was started at 20 ° C. and pH 8.0. After starting the reaction, a pH controller was set to control the pH in the reaction system, and the pH was controlled with 30% NaOH.

  The addition of DCP was started when 0.19 mol of NaOH used for pH control was added, and the addition of HCN was started when 0.243 mol of NaOH used for pH control was added. DCP was added in a proportion of approximately equimolar to the charged NaOH, and a total of 0.395 mol was added.

The yield was calculated by the following method.
Yield (%) = DCP conversion rate × CHBN selectivity / DCP conversion rate (%) = 100 − {(total amount in system × DCP concentration) / (DCP charge amount + DCP cumulative additional amount)}
CHBN selectivity (%) = {(total amount in system × CHBN concentration) / (DCP charge amount + DCP cumulative additional amount)} × DCP conversion rate

  The reaction profile is shown in Table 4, and the transition of the theoretical value of DCP concentration is shown in FIG.

  DCP conversion after reaction 1290 minutes 95.8%, CHBN selectivity 96.7%, R-CHBN optical purity 97.2% e.e. e. Met.

  The reaction was carried out using the conditions shown in Table 5 below as initial amounts. In the reaction, a predetermined amount of water and HCN were charged into a 1000 mL four-necked flask equipped with an alkali charging pipe controlled by a pH electrode and a pH controller, adjusted to pH 8.0 with 30% NaOH, and 1, 3 -Dichloro-2-propanol (DCP) was added and stirred until evenly dissolved.

  Subsequently, 79.3 g (31.7 kU) of the cell suspension of Example 2 was added, and the reaction was started at 20 ° C. and pH 8.0. After starting the reaction, a pH controller was set to control the pH in the reaction system, and the pH was controlled with 30% NaOH.

  The addition of DCP was started when NaOH for pH control began to be added, and the addition of HCN was started when 0.09 mol of NaOH for pH control was added. DCP was added so that it might become about 0.5-1 equivalent with respect to the mol number of NaOH thrown in.

  The reaction profile is shown in Table 6, and the transition of the theoretical value of the DCP concentration is shown in FIG.

  DCP conversion 95.2% after reaction 1290 minutes, CHBN selectivity 96.7%, R-CHBN optical purity 97.2% e.e. e. Met.

<Comparative Example 1>
The reaction was carried out using the conditions shown in Table 7 below as initial amounts. In the reaction, a predetermined amount of water and HCN were charged into a 1000 mL four-necked flask equipped with an alkali charging pipe controlled by a pH electrode and a pH controller, adjusted to pH 8.0 with 30% NaOH, and 1, 3 -Dichloro-2-propanol (DCP) was added and stirred until evenly dissolved.

  Subsequently, 77.3 g (30.9 kU) of the cell suspension of Example 2 was added, and the reaction was started at 20 ° C. and pH 8.0. After starting the reaction, a pH controller was set to control the pH in the reaction system, and the pH was controlled with 30% NaOH.

  The addition of DCP and HCN was started when NaOH for pH control began to be added. DCP and HCN were added at a ratio of approximately equimolar to the input NaOH.

  The reaction profile is shown in Table 8, and the transition of the theoretical value of the DCP concentration is shown in FIG.

  The progress of the reaction was stopped when 0.162 mol of pH control NaOH was added (30 minutes after the start of the reaction).

  After 1380 minutes of reaction, the DCP conversion was 34.6%, the CHBN selectivity was 96.4%, and the R-CHBN optical purity was 78.8% e.e. e. Met.

  From the result of Comparative Example 1, when the DCP concentration in the reaction solution is maintained in a range exceeding 0.43 mol / kg, the enzymatic reaction is terminated quickly, and the resulting 4-halo-3-hydroxybutyronitrile is small. It can be seen that the optical purity is also lowered. On the other hand, from the results of Examples 3 and 4, when the DCP concentration in the reaction solution was kept in a range not exceeding 0.43 mol / kg or not exceeding 0.2 mol / kg, many 4-halo- It can be seen that 3-hydroxybutyronitrile is obtained and the optical purity is increased.

  The present invention can provide a method for producing optically active 4-halo-3-hydroxybutyronitrile which is highly productive and industrially suitable.

SEQ ID NO: 1: Amino acid sequence of HheB (2nd) SEQ ID NO: 2: Amino acid sequence of improved HheB (2nd) SEQ ID NO: 3: Amino acid sequence of HheB (1st) SEQ ID NO: 4: Amino acid sequence of SEQ ID NO: HheB (1st) 5: nucleotide sequence of HHEB (2nd) SEQ ID NO: 6: nucleotide sequence of improved HHEB (2nd) SEQ ID NO: 7: nucleotide sequence of HHEB (1st) SEQ ID NO: 8: nucleotide sequence of improved HHEB (1st) SEQ ID NO: 9: Primer DH-09
Sequence number 10: Primer DH-07
Sequence number 11: Primer DH-51
Sequence number 12: Primer DH-52
Sequence number 13: Primer DH-125
SEQ ID NO: 14: Primer DH-126
SEQ ID NO: 15: Primer DH-49
Sequence number 16: Primer DH-50

Claims (4)

  A method for producing optically active 4-halo-3-hydroxybutyronitrile from 1,3-dihalo-2-propanol and a cyanide donor by an enzymatic reaction, and after the start of the enzymatic reaction, The method is characterized in that dihalo-2-propanol is supplied and the concentration of 1,3-dihalo-2-propanol in the reaction solution is maintained in a range not exceeding 0.43 mol / kg.   The method of claim 1, wherein the enzyme is a halohydrin epoxidase.   The halohydrin epoxidase is a Corynebacterium sp. The method according to claim 1 or 2, which is derived from a halohydrin epoxidase gene (HHEB) of N-1074.   The method according to any one of claims 1 to 3, wherein the halohydrin epoxidase is an improved halohydrin epoxidase consisting of the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 4.