JP2012510815A - Treatment of sirtuin 1 related diseases by suppression of natural antisense transcripts against sirtuin 1 (SIRT1) - Google Patents

Abstract

  Oligonucleotide compounds that modulate the expression and / or function of a sirtuin 1 (SIRT1) polynucleotide and products encoded thereby. A method of treating a disease associated with sirtuin 1 (SIRT1) comprising administering to a patient one or more oligonucleotide compounds designed to repress SIRT1 natural antisense transcripts.

Description

Cross-reference This application is a U.S. provisional application 61 / 119,965 filed December 4, 2008 and a U.S. provisional application 61 / 157,255 and 2009 filed March 4, 2009, which is incorporated herein by reference in its entirety. Claims the benefit of US Provisional Application No. 61 / 259,072, filed Nov. 6,

  Embodiments of the invention include oligonucleotides that modulate the expression and / or function of SIRT1 and related molecules.

  DNA-RNA and RNA-RNA hybridization are important in many aspects of nucleic acid function, including DNA replication, transcription and translation. Hybridization is also the center of various techniques for detecting a specific nucleic acid or changing its expression. For example, antisense nucleotides disrupt gene expression by hybridizing to a target RNA, thereby preventing RNA splicing, transcription, translation and replication. Antisense DNA has the additional property that the DNA-RNA hybrid acts as a substrate for digestion by ribonuclease H, an activity present in most cell types. Antisense molecules may be delivered to cells in the case of oligodeoxynucleotides (ODN) and can be expressed from endogenous genes as RNA molecules. In recent years, the FDA approved the antisense drug VITRAVENE ™ (for the treatment of cytomegalovirus retinitis), reflecting the therapeutic utility of antisense.

US Provisional Application No. 61 / 119,965 US Provisional Application No. 61 / 157,255 US Provisional Application No. 61 / 259,072

  This summary is provided to represent a summary of the present invention in order to provide a brief description of the nature and spirit of the invention. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims.

  In one embodiment, the present invention suppresses and responds to the effects of natural antisense transcripts by using antisense oligonucleotide (s) that target any region of the natural antisense transcript. Methods are provided for effecting upregulation of sense genes. It is also contemplated herein and within the scope of the present invention that repression of natural antisense transcripts can be achieved by siRNAs, ribozymes and small molecules.

  One embodiment is a method of modulating the function and / or expression of a SIRT1 polynucleotide in a patient cell or tissue in vivo or in vitro, comprising nucleotides 1-1028 of SEQ ID NO: 2 or nucleotides 1 to 3 of SEQ ID NO: 3 429, or at least 50% sequence identity to the reverse complement of a polynucleotide comprising 5 to 30 consecutive nucleotides in nucleotides 1-156 of SEQ ID NO: 4 or nucleotides 1-593 of SEQ ID NO: 5 (Figure 11) Contacting said cell or tissue with an antisense oligonucleotide of 5-30 nucleotides in length; thereby modulating the function and / or expression of SIRT1 polynucleotide in the patient's cell or tissue in vivo or in vitro Provide a method.

  In other preferred embodiments, the oligonucleotide is a natural antisense sequence of a SIRT1 polynucleotide, such as the polynucleotides set forth in SEQ ID NOs: 2-5 and any variants, alleles, homologues, variants, derivatives, fragments and complements thereof. Target the sequence. Examples of antisense oligonucleotides are set forth in SEQ ID NOs: 6-47.

  Another embodiment is a method of modulating SIRT1 polynucleotide function and / or expression in a patient cell or tissue in vivo or in vitro, wherein the antisense complement of SIRT1 polynucleotide is at least 50% Contacting said cell or tissue with an antisense oligonucleotide of 5 to 30 nucleotides in length having sequence identity; thereby functioning and / or expressing SIRT1 polynucleotide in a patient's cell or tissue in vivo or in vitro A method is provided that includes adjusting.

  Another embodiment is a method of modulating the function and / or expression of a SIRT1 polynucleotide in a patient cell or tissue in vivo or in vitro, wherein the antisense oligonucleotide to the SIRT1 antisense polynucleotide is at least 50% Contacting said cell or tissue with an antisense oligonucleotide of 5 to 30 nucleotides in length having sequence identity; thereby functioning and / or expressing SIRT1 polynucleotide in a patient's cell or tissue in vivo or in vitro A method is provided that includes adjusting.

  In a preferred embodiment, the composition comprises one or more antisense oligonucleotides that bind to sense and / or antisense SIRT1 polynucleotides.

  In other preferred embodiments, the oligonucleotide comprises one or more modified or substituted nucleotides.

  In other preferred embodiments, the oligonucleotide comprises one or more modified linkages.

  In still other embodiments, the modified nucleotide comprises a modified base comprising a phosphorothioate, methylphosphonate, peptide nucleic acid or locked nucleic acid (LNA) molecule. Preferably the modified nucleotide is a locked nucleic acid molecule comprising α-L-LNA.

  In other preferred embodiments, the oligonucleotide is administered to the patient subcutaneously, intramuscularly, intravenously or intraperitoneally.

  In other preferred embodiments, the oligonucleotide is administered in a pharmaceutical composition. The treatment plan includes administering the antisense compound to the patient at least once, but the treatment can be modified to include multiple doses over a period of time. The treatment may be combined with one or more other types of treatment.

  In another preferred embodiment, the oligonucleotide is encapsulated in a liposome.

  Other embodiments are described below.

Citation by reference All publications, patents and patent applications mentioned in this specification are referenced to the same extent as if each publication, patent or patent application was clearly and individually indicated to be incorporated by reference. Is incorporated herein by reference.

  The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the nature and advantages of the present invention may be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

It is a graph which shows the real-time PCR result of the oligonucleotide designed with respect to SIRT antisense CV396200. The results show that the level of SIRT1 mRNA in HepG2 cells is significantly increased after 48 hours of treatment with one of the siRNAs designed against sirtas (sirtas_5, P = 0.01). sirtas_5, sirtas_6 and sirtas_7 correspond to SEQ ID NOs: 29, 30 and 31, respectively. It is a graph which shows the real-time PCR result of the oligonucleotide designed with respect to SIRT antisense CV396200. The level of sirtas RNA in the same sample as in FIG. 1A was significantly reduced after treatment with sirtas_5, but did not change after treatment with sirtas_6 and sirtas_7, which had no effect on the level of SIRT1 mRNA. sirtas_5, sirtas_6 and sirtas_7 correspond to SEQ ID NOs: 29, 30 and 31, respectively. FIG. 6 is a graph showing results for oligonucleotides traversing SIRT antisense CV396200. Real-time PCR results indicate that the level of SIRT1 mRNA in HepG2 cells is significantly increased after 48 hours of treatment with 3 of the antisense oligonucleotides designed against sirtas. CUR-0292 to CUR-309 correspond to SEQ ID NOs: 6 to 23, respectively. Results for PS, LNA and 2′O Me modified oligonucleotides in HepG2 are shown. Real-time PCR results show that the levels of SIRT1 mRNA in HepG2 cells are treated with antisense oligonucleotides PS, LNA, 2'O Me and 2'O Me mixmers designed against SIRT1 antisense. Shows a significant increase after 48 hours. The bars labeled CUR-0245, CUR-0736, CUR-0688, CUR-0740 and CUR-0664 correspond to SEQ ID NOs: 24-28, respectively. Results for PS, LNA and 2′O Me modified oligonucleotides in Vero76 cells are shown. The level of SIRT1 mRNA in Vero cells also increased 48 hours after treatment with PS and LNA modified antisense oligonucleotides for SIRT1 antisense. The bars labeled CUR-0245, CUR-0736, CUR-0688, CUR-0740 and CUR-0664 correspond to SEQ ID NOs: 24-28, respectively. It is a graph which shows the PCR result of a monkey fat biopsy. Real-time PCR results show increased levels of SIRT1 mRNA in fat biopsies from monkeys dosed with CUR-963, an oligonucleotide designed against SIRT1 antisense CV396200.1. CUR-963 corresponds to SEQ ID NO: 25. It is a graph which shows the PCR result of the hepatocyte of a primary monkey liver. Real-time PCR results show increased levels of SIRT1 mRNA after treatment with CUR-0245, an oligonucleotide against SIRT1 antisense. The bar labeled CUR-0245 corresponds to SEQ ID NO: 24. It is a graph which shows the result about the oligonucleotide designed with respect to SIRT antisense CV396200. Real-time PCR results indicate that the level of SIRT1 mRNA in HepG2 cells is significantly increased in one of the oligonucleotides designed against SIRT1 antisense CV396200. The bars labeled CUR-1230, CUR-1231, CUR-1232 and CUR-1233 correspond to SEQ ID NOs: 32-35. FIG. 5 is a graph showing the results for oligonucleotides designed against SIRT antisense CV428275. FIG. Real-time PCR results indicate that the level of SIRT1 mRNA in HepG2 cells is significantly increased in two of the oligonucleotides designed for SIRT1 antisense CV428275. The bars labeled CUR-1302, CUR-1304, CUR-1303 and CUR-1305 correspond to SEQ ID NOs: 36-39. It is a graph which shows a real-time PCR result. The results show a significant increase in the level of SIRT1 mRNA in HepG2 cells 48 hours after treatment with one of the oligonucleotides designed against SIRT antisense BE717453. The bars labeled CUR-1264, CUR1265, and CUR-1266 correspond to SEQ ID NOs: 40-42, respectively. It is a graph which shows a real-time PCR result. The results show that the level of SIRT1 mRNA in HepG2 cells is significantly increased after 48 hours of treatment with 3 of the oligonucleotides designed against SIRT1 antisense AV718812. The bars labeled CUR-1294, CUR-1297, CUR-1295, CUR-1296, and CUR-1298 correspond to SEQ ID NOs 43-47, respectively. SEQ ID NO: 1: Homo sapiens sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae) (SIRT1), mRNA (NCBI accession number: NM_012238.3) and SEQ ID NO: 1a showing the genome sequence of SIRT (exons are shown in upper case letters and introns are shown in lower case letters). SEQ ID NO: 2: extended natural antisense sequence (CV396200-extension) SEQ ID NO: 3: natural antisense sequence (CV428275) SEQ ID NO: 4: natural antisense sequence (BE717453) SEQ ID NO: 5: natural antisense sequence (AV718812) FIG. It is a figure which shows sequence number 6-23. * Indicates a phosphothioate bond. It is a figure which shows sequence number 24-28. * Indicates a phosphothioate bond, + indicates LNA, and m indicates 2′O Me. FIG. 32 shows SEQ ID NOs: 29 to 31, which are antisense sequences of double-stranded test oligonucleotides designed against SIRT antisense CV396200, corresponding to sirtas_5, sirtas_6 and sirtas_7, respectively. FIG. 4 shows SEQ ID NOs: 32, 33, 34 and 35 designed for SIRT1 antisense CV396200. FIG. 4 shows SEQ ID NOs: 36, 37, 38 and 39 designed for SIRT1 antisense CV428275. FIG. 4 shows SEQ ID NOs: 40, 41 and 42 designed for SIRT1 antisense BE717453. FIG. 4 shows SEQ ID NOs: 43, 44, 45, 46 and 47 designed for SIRT1 antisense AV718812. It is a figure which shows sequence number 48-51. SEQ ID NO: 38 corresponds to exon 4 of SIRT1 natural antisense CV396200, and SEQ ID NOs: 49, 50 and 51 correspond to the forward primer sequence, reverse primer sequence and reporter sequence, respectively. It is a figure which shows the sequence number 52 corresponding to CUR962. * Indicates a phosphothioate bond, and + indicates LNA.

  Several aspects of the invention are described below with reference to illustrative applications. It should be understood that numerous specific details, relationships and methods are described to provide a thorough understanding of the present invention. However, one of ordinary skill in the art will readily recognize that the present invention may be practiced without using one or more specific details or using other methods. The present invention is not limited by the order of actions or events, as some actions may occur in different orders and / or concurrently with other actions or events. Moreover, not all illustrated acts or events are required to implement a method in accordance with the present invention.

  All genes, gene names and gene products disclosed herein are meant to correspond to homologues from any species to which the compositions and methods disclosed herein can be applied. The term thus includes, but is not limited to, genes and gene products derived from humans and mice. When a gene or gene product from a particular species is disclosed, it is understood that this disclosure is not to be construed as limiting unless there is a context that is considered to be clearly shown by way of example only. Thus, for example with respect to the genes disclosed herein, in some embodiments relating to mammals, the nucleic acid and amino acid sequences are from other animals, including but not limited to other mammals, fish, amphibians, reptiles and birds. Of homologous and / or orthologous genes and gene products. In a preferred embodiment, the gene or nucleic acid sequence is human.

Definitions The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms “a”, “an”, and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Further, the terms “including”, “include”, “having”, “has”, “with” or variations thereof are detailed descriptions. And / or is used in any claims, and such terms are intended to be inclusive in a manner similar to the term “comprising”.

  The term "about" or "approximately" means within an acceptable error range for a particular value determined by those skilled in the art and how the value was measured or determined, i.e. the measurement system Partly depends on the limits of For example, “about” can mean 1 or greater than 1 standard deviation per practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5% and more preferably even up to 1% of a given value. Alternatively, a term relating specifically to a biological system or process can mean within a single digit range of a value, preferably within 5 times and more preferably within 2 times. Where a particular value is set forth in the application document and claims, the term “about” should be considered to be within the acceptable error range for the particular value, unless expressly stated otherwise.

  The term “mRNA” as used herein means currently known mRNA (s) of a target gene and any further transcripts that may be revealed.

  By “antisense oligonucleotide” or “antisense compound” is meant an RNA or DNA molecule that binds to other RNA or DNA (target RNA, DNA). For example, in the case of RNA oligonucleotides, it binds to other RNA targets by means of RNA-RNA interaction and alters the activity of the target RNA (Eguchi et al. (1991) Ann. Rev. Biochem. 60, 631-652) . Antisense oligonucleotides can upregulate or downregulate the expression and / or function of a particular polynucleotide. The definition is meant to include any foreign RNA or DNA molecule that is useful from a therapeutic, diagnostic or other point of view. Such molecules include, for example, antisense RNA or DNA molecules, interfering RNA (RNAi), microRNA, decoy RNA molecules, siRNA, enzymatic RNA, therapeutic editing RNA, and agonist and antagonist RNA, antisense Oligomeric compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternative splicers, primers, probes and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. . Thus, these compounds can be introduced in the form of single-stranded, double-stranded, partially single-stranded or cyclic oligomeric compounds.

  In the context of the present invention, the term “oligonucleotide” means an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. The term `` oligonucleotide '' is naturally and / or modified including deoxyribonucleosides, ribonucleosides, their substituted and alpha-anomeric forms, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioates, methylphosphonates, etc. Also included are monomeric or linked linear or cyclic oligomers. Oligonucleotides can be attached to target polynucleotides by the usual methods of monomer-monomer interactions such as Watson-Crick base pairing, Hoogsteen or non-Fogsteen base pairing, etc. Can bind specifically.

  Oligonucleotides can be “chimeric” consisting of different regions. In the context of the present invention, a “chimeric” compound refers to two or more chemical regions, such as (one or more) DNA regions, (one or more) RNA regions, (one or more) PNA regions, etc. Is an oligonucleotide containing Each chemical region consists of at least one monomer unit, ie a nucleotide in the case of oligonucleotide compounds. Typically, these oligonucleotides include at least one region that has been modified to exhibit one or more desired properties. Desired properties of an oligonucleotide include, but are not limited to, for example, increased resistance to nuclease degradation, increased cellular uptake and / or increased binding affinity for a target nucleic acid. Thus, different regions of the oligonucleotide can have different properties. The chimeric oligonucleotides of the present invention can be formed as a mixed structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide analogues as described above.

  Oligonucleotides can be composed of regions that can be bound to a “register”, and are similar to those in natural DNA or linked via a spacer when monomers are bound sequentially. . The spacer is intended to constitute a covalent “bridge” between the regions, and in preferred cases has a length not exceeding about 100 carbon atoms. Spacers can hold a variety of functions (e.g. contain positive or negative charges), can hold special nucleic acid binding properties (interfering substances, groove binders, toxins, fluorophores, etc.), are lipophilic, e.g. alpha helix It induces a special secondary structure such as an alanine-containing peptide that induces

  As used herein, “SIRT1” and “sirtuin 1” includes all members of the family, variants, alleles, fragments, species, coding and non-coding sequences, sense and antisense polynucleotide chains, and the like. ing.

  As used herein, “SIRT1” is a silencing mating type information regulator 2 homolog and is a member of the sirtuin deacetylase protein family. The amino acid sequence of SIRT1 can be found at Genbank accession number NP.sub .-- 08509. SIRT1 is a human homologue of the yeast Sir2 protein and exhibits NAD-dependent deacetylation activity.

  The words sirtuin 1, SIRT1, sirtuin, silent junction information regulator 2 homolog 1, hSIR2, hSIRT1, NAD-dependent deacetylase sirtuin 1, SIR2L1, SIR2-like protein 1 as used herein are considered identical in the literature. And are used interchangeably in this application.

  As used herein, the term “specific oligonucleotide” or “targeting oligonucleotide” refers to (i) a sequence that can form a stable complex with a portion of a target gene, or (ii) a target gene An oligonucleotide having a sequence capable of forming a stable duplex with a portion of an mRNA transcript. Complex and duplex stability can be determined by theoretical calculations and / or in vitro assays. Exemplary methods for determining the stability of hybridization complexes and duplexes are described in the Examples below.

  As used herein, the term “target nucleic acid” refers to DNA, RNA transcribed from such DNA, including pre-mRNA and mRNA, and such RNA, coding sequences, non-coding sequences, sense or antisense. Also included are cDNAs derived from polynucleotides. Specific hybridization of an oligomeric compound with its target nucleic acid interferes with the normal function of the nucleic acid. This regulation of target nucleic acid function by a specifically hybridizing compound is commonly referred to as “antisense”. Examples of DNA functions that are hindered include replication and transcription. The functions of RNA to be hindered may involve, for example, RNA transfer to the protein translation site, protein translation from RNA, RNA splicing to obtain one or more mRNA species, or RNA promoted All biological functions such as possible catalytic activity. The overall effect of such interference on target nucleic acid function is modulation of the expression of the encoded product or oligonucleotide.

  RNA interference “RNAi” is mediated by double-stranded RNA (dsRNA) molecules that have sequence-specific homology to “target” nucleic acid sequences (Caplen, NJ et al. (2001) Proc. Natl. Acad. Sci. USA 98 : 9742-9747). In particular embodiments of the invention, the mediator is a “small interfering” RNA duplex (siRNA) of 5-25 nucleotides. siRNA is derived from the processing of dsRNA by the RNase enzyme known as Dicer (Bernstein, E. et al. (2001) Nature 409: 363-366). The siRNA duplex product enters a multiprotein siRNA complex called RISC (RNA Induced Silencing Complex). Without being bound by any particular theory, RISC then believes that siRNA duplexes interact in a sequence-specific manner and are directed to a target nucleic acid (suitably mRNA) that mediates catalytic cleavage. (Bernstein, E. et al. (2001) Nature 409: 363-366; Boutla, A. et al. (2001) Curr. Biol 11: 1776-780). Small interfering RNAs that can be used in accordance with the present invention are well known in the art and can be synthesized and used according to procedures well known to those skilled in the art. Small interfering RNAs for use in the methods of the invention suitably comprise between about 1 and about 50 nucleotides (nt). In examples of non-limiting embodiments, the siRNA can comprise about 5 to about 40 nt, about 5 to about 30 nt, about 10 to about 30 nt, about 15 to about 25 nt, or about 20 to 25 nucleotides.

  Selection of appropriate oligonucleotides is facilitated by using computer programs that automatically align nucleic acid sequences and display identical or homologous regions. Such a program is used to compare nucleic acid sequences obtained, for example, by searching databases such as GenBank or by sequencing PCR products. Comparison of nucleic acid sequences from different species allows for the selection of nucleic acid sequences that exhibit an appropriate degree of identity between the species. For genes that are not sequenced, Southern blots are performed to allow determination of the degree of identity between genes in the target species and other species. As is well known in the art, it is possible to obtain approximate measures of identity by performing Southern blots with varying degrees of stringency. These procedures allow for the selection of oligonucleotides that exhibit high complementarity to the target nucleic acid sequence in the subject being controlled and low complementarity to the corresponding nucleic acid sequence in other species. One skilled in the art will appreciate that there is considerable tolerance in selecting the appropriate region of a gene for use in the present invention.

  By “enzymatic RNA” is meant an RNA molecule having enzymatic activity (Cech, (1988) J. American. Med. Assoc. 260, 3030-3035). Enzymatic nucleic acids (ribozymes) act by first binding to a target RNA. Such binding occurs through the target binding portion of the enzymatic nucleic acid that is held in close proximity to the enzymatic portion of the molecule that acts to cleave the target RNA. Thus, an enzymatic nucleic acid first recognizes the target RNA, then binds through base pairing, and acts enzymatically to cleave the target RNA once it binds to the correct site.

  By “decoy RNA” is meant an RNA molecule that mimics the natural binding domain for a ligand. Thus, decoy RNA competes with the natural binding target for specific ligand binding. For example, overexpression of HIV transactivation response (TAR) RNA can act as a “decoy” and binds efficiently to the HIV tat protein, thereby binding to the TAR sequence encoded by HIV RNA. (Sullenger et al. (1990) Cell 63, 601-608). This means a specific example. Those skilled in the art will appreciate that this is only an example, and that other embodiments can be readily made using techniques known in the art.

  The term “monomer” as used herein typically ranges in size from several, eg, about 3-4 monomer units to about several hundred monomer units. The monomer connected by the phosphodiester bond which forms the oligonucleotide of this, or its analog bond. Analogous phosphodiester linkages include phosphorothioate, phosphorodithioate, methylphosphonate, phosphoroselenoate, phosphoramidate and the like, and are described in more detail below.

  The term “nucleotide” includes naturally occurring nucleotides as well as non-naturally occurring nucleotides. It should be clear to those skilled in the art that various nucleotides that were previously considered "non-naturally occurring" were later found in nature. Thus, “nucleotide” includes not only the known purine and pyrimidine heterocycle-containing molecules, but also heterocyclic analogues and tautomers thereof. Illustrative examples of other types of nucleotides are adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4, N4 -Ethanoscytosine, N6, N6-ethano-2,6-diaminopurine, 5-methylcytosine, 5- (C3-C6) -alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2- `` Non-naturally occurring '' nucleotides described in 2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, isoguanine, inosine and Benner et al., U.S. Pat.No. 5,432,272 It contains molecules. The term “nucleotide” is intended to include all of these examples as well as analogs and tautomers thereof. Particularly interesting nucleotides are those containing adenine, guanine, thymine, cytosine and uracil which are considered naturally occurring nucleotides relevant for therapeutic and diagnostic applications in humans. Nucleotides include natural 2'-deoxy sugars and 2'-hydroxy sugars and analogs thereof as described, for example, in Kornberg and Baker, DNA Replication, 2nd edition (Freeman, San Francisco, 1992).

  “Analogs” with respect to nucleosides include (eg, Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, (1997) Nucl. Acid. Res., 25 (22), 4429-4443, Toulme, JJ, (2001) Nature Biotechnology 19: 17-18; Manoharan M., (1999) Biochemica et Biophysica Acta 1489: 117-139; Freier SM, (1997) Nucleic Acid Research, 25: 4429-4443, Uhlman, E., ( 2000) Drug Discovery & Development, 3: 203-213, Herdewin P., (2000) Antisense & Nucleic Acid Drug Dev., Generally described by 10: 297-310) modified base component and / or modified Synthetic nucleosides with a sugar moiety; 2'-O, 3'-C-linked [3.2.0] bicycloarabino nucleosides (eg N. K Christiensen. Et al. (1998) J. Am. Chem. Soc, 120: 5458 ~ 5463; Prakash TP, Bhat B. (2007) Curr Top Med Chem. 7 (7): 641-9; Eun Jeong Cho, Joo-Woon Lee, Andrew D. (2009) Annual Review of Analytical Chemistry, 2, 241 -264). Such analogs include synthetic nucleosides designed to enhance binding properties such as duplex or triple chain stability, specificity, and the like.

  “Hybridization” as used herein refers to the pairing of substantially complementary strands of oligomeric compounds. One mechanism of pairing involves hydrogen bonding, which can be Watson-Crick, Hoogsteen or reverse Hoogsteen hydrogen bonding between complementary nucleosides or nucleotide bases (nucleotides) of the chain of oligomeric compounds. For example, adenine and thymine are complementary nucleotides that pair through the formation of hydrogen bonds. Hybridization can occur in a variety of environments.

  Antisense compounds are those where binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid resulting in modulation of function and / or activity, and where specific binding is desired (i.e., for in vivo assays or therapeutic treatments). Under sufficient complementarity to avoid non-specific binding of antisense compounds to non-target nucleic acid sequences (under physiological conditions in vitro and under conditions under which in vitro assays are performed) “Can specifically hybridize”.

As used herein, the expression “stringent hybridization conditions” or “stringent conditions” refers to conditions under which a compound of the invention hybridizes to its target sequence and hybridizes to a minimal number of other sequences. means. Stringent conditions are sequence-dependent and are different under different circumstances, and in the context of the present invention “stringent conditions” under which an oligomeric compound hybridizes to a target sequence are the properties and compositions of the oligomeric compound and They are determined by the assay being investigated. Generally, stringent hybridization conditions include low concentrations of inorganic cation salts such as Na ⁺ or K ⁺ (<0.15M) (i.e., low ionic strength), higher than 20 ° C to 25 ° C, oligomeric compound: target sequence complex And the presence of a modifying agent such as formamide, dimethylformamide, dimethyl sulfoxide or the surfactant sodium dodecyl sulfate (SDS). For example, the hybridization rate decreases 1.1% for every 1% formamide. An example of high stringency hybridization conditions is 0.1 × sodium chloride-sodium citrate buffer (SSC) /0.1% (w / v) SDS at 60 ° C. for 30 minutes.

  “Complementarity” as used herein refers to the ability for precise pairing between two nucleotides on one or two oligomer strands. For example, when a nucleobase at a specific position of an antisense compound can hydrogen bond with a nucleobase at a specific position of the target nucleic acid, and the target nucleic acid is a DNA, RNA, or oligonucleotide molecule, it is between the oligonucleotide and the target nucleic acid. The position of the hydrogen bond is considered to be a complementary position. An oligomeric compound and a further DNA, RNA or oligonucleotide molecule are complementary to each other if a sufficient number of complementary positions in each molecule are occupied by nucleotides that can hydrogen bond with each other. Thus, “specifically hybridizable” and “complementary” are defined to a sufficient degree of precise pairing over a sufficient number of nucleotides such that stable and specific binding occurs between the oligomeric compound and the target nucleic acid. A term used to indicate complementarity.

  It is understood in the art that the sequence of the oligomeric compound need not be 100% complementary to that of its target nucleic acid that can specifically hybridize. In addition, oligonucleotides can hybridize over one or more segments without intervening or adjacent segments participating in the hybridization event (eg, loop structure, mismatch or hairpin structure). The oligomeric compounds of the invention have at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95% or at least about 99% sequence complementarity For the target region in the target nucleic acid sequence to which they are targeted. For example, 18 of the 20 nucleotides of an antisense compound are complementary to the target region, and thus an antisense compound that specifically hybridizes exhibits 90 percent complementarity. In this example, the remaining non-complementary nucleotides may be clustered or interspersed with complementary nucleotides and need not be in proximity to each other or to complementary nucleotides. Antisense compounds that have four (4) non-complementary nucleotides that are 18 nucleotides in length and flanked by two regions that are completely complementary to the target nucleic acid are 77.8% total in the target nucleic acid And therefore fall within the scope of the present invention. The percentage complementarity between the antisense compound and the region of the target nucleic acid can be routinely determined using the BLAST program (basic local alignment search tools) and the PowerBLAST program well known in the art (Altschul et al. (1990). J. Mol. Biol., 215, 403-410; Zhang and Madden, (1997) Genome Res., 7, 649-656). Percent homology, sequence identity or complementarity is determined, for example, by the Gap program (Wisconsin Sequence Analysis Package, Version 8 for the Smith and Waterman algorithm (Adv.Appl. Math., (1981) 2, 482-489)). Unix, Genetics Computer Group, University Research Park, Madison Wis.).

  As used herein, the term “thermomelting point (Tm)” refers to 50% of the oligonucleotides complementary to a target sequence that hybridize to the target sequence in equilibrium under a defined ionic strength, pH, and nucleic acid concentration. It means the temperature of soybean. Typically, stringent conditions are such that the salt concentration is at least a Na ion concentration (or other salt) of about 0.01-1.0 M, pH 7.0-8.3, and for short oligonucleotides (e.g. 10-50 nucleotides) the temperature. Is at least about 30 ° C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.

  The term “modulation” as used herein means an increase (stimulation) or a decrease (suppression) in the expression of a gene.

  The term “variant” when used in the context of polynucleotide sequences encompasses polynucleotide sequences associated with the wild-type gene. This definition may also include, for example, “allelic”, “splice”, “species” or “polymorphic” variants. Splice variants may have significant identity to the reference molecule, but generally have a greater or lesser number of polynucleotides due to alternative splicing of exons during mRNA processing. Corresponding polypeptides can have additional functional domains or domain deletions. A species variant is a polynucleotide sequence that varies from one species to another. Of particular utility in the present invention are variants of wild type gene products. A variant can result from at least one mutation in the nucleic acid sequence and can result in a polypeptide that may or may not be altered in the altered mRNA or its structure or function. Any given natural or recombinant gene may have no allelic form, one, or many. The normal mutational changes that result in variants are generally attributed to natural deletions, additions or nucleotide substitutions. Each of these types of changes can occur in a given sequence one or more times, alone or in combination with the other.

  The resulting polypeptides generally have significant amino acid identity compared to each other. A polymorphic variant is a variant in the polynucleotide sequence of a particular gene among individuals of a given species. Polymorphic variants can also include “single nucleotide polymorphisms” (SNPs) or single base mutations in which the polynucleotide sequence is altered by one base. The presence of SNPs can be an indicator for a particular population, for example, with a certain tendency for a condition that is susceptible to resistance.

  Derivative polynucleotides include nucleic acids that have been subjected to chemical modifications (eg, substitution of hydrogen with alkyl, acyl or amino groups). Derivatives, such as oligonucleotide derivatives, may contain non-naturally occurring moieties such as modified sugar moieties or intersugar linkages. Examples in these are phosphorothioates and other sulfur-containing species well known in the art. The derived nucleic acid can also include labels such as radioactive nucleotides, enzymes, fluorescent agents, chemiluminescent agents, color formers, substrates, cofactors, inhibitory factors, magnetic particles and the like.

  A “derivative” polypeptide or peptide is one that has been modified, for example, by glycosylation, pegylation, phosphorylation, sulfation, reduction / alkylation, acylation, chemical coupling or mild formalin treatment. Derivatives can also be modified either directly or indirectly to contain a detectable label, including but not limited to a radioisotope, fluorescent or enzyme label.

  As used herein, the term `` animal '' or `` patient '' refers to, for example, a human, sheep, elk, deer, mule deer, mink, mammal, monkey, horse, cow, pig, goat, dog, cat, Rats, mice, birds, chickens, and insects are meant to include reptiles, fish, insects and spiders.

  “Mammal” includes warm-blooded mammals (eg, humans and livestock) that are typically under medical care. Examples include cats, dogs, horses, cows and humans in addition to humans only.

  `` Treatment '' or `` treatment '' includes the steps of (a) preventing the occurrence of a condition in a mammal, specifically such a mammal is susceptible to the condition but has not yet been diagnosed A mammal comprising: (b) suppressing the disease state, e.g., stopping its progression; and / or (c) reducing the disease state, e.g., causing regression of the disease state to a desired endpoint Including treatment of pathological conditions. Treatment also includes recovery of disease symptoms (eg, relief of pain or discomfort), and such recovery may or may not directly affect the disease (eg, cause, transmission, manifestation, etc.).

  `` Neurodegenerative disease '' includes, for example, Parkinson's disease, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), dementia, multiple sclerosis, and other neuronal cell death and Refers to a wide range of central and terminal nervous system diseases and disorders, including diseases.

  “Metabolic disease” refers to a wide range of endocrine diseases and disorders including, for example, insulin resistance, diabetes, obesity, glucose tolerance disease, high blood cholesterol, hyperglycemia, dyslipidemia and hyperlipidemia. .

Polynucleotide and Oligonucleotide Compositions and Molecules “SIRT1 protein” refers to a member of the sir2 family of sirtuin deacetylases. In one embodiment, the SIRT1 protein comprises yeast Sir2 (GenBank accession number P53685), nematode Sir-2.1 (GenBank accession number NP.sub .-- 501912), human SIRT1 (GenBank accession number NM.sub.-012238 and NP.sub .-- 036370 (or AF083106)).

  SIRT1 “sirtuin” contains the SIR2 domain, which is a domain defined as an amino acid sequence that is scored by hit in the Pfam family “SIR2” -PF02146 (attached to the attached table). This family is referenced in the INTERPRO database as INTERPRO entry (entry IPR003000). To identify the presence of the “SIR2” domain in the protein sequence and determine whether the polypeptide or protein of interest has a particular profile, the amino acid sequence of the protein, using default parameters, You can search against a Pfam database (eg, Pfam Database Release 9) (http://www.sanger.ac.uk/Software/Pfam/HMM_search). The SIR2 domain is indexed as PF02146 in Pfam and INTERPRO description (entry IPR003000) in INTERPRO. The description of the Pfam database is described in “The Pfam Protein Families Database” Bateman A et al. (2002) Nucleic Acids Research 30 (l): 276-280 and Sonhammer et al. (1997) Proteins 28 (3): 405-420. HMM details can be found, for example, in Gribskov et al. (1990) Meth. Enzymol. 183: 146-159; Gribskov et al. (1987) Proc. Natl. Acad. Sci. USA 84: 4355-4358 Krogh et al. (1994) J. Mol. Biol. 235: 1501-1531; and Stultz et al. (1993) Protein Sci. 2: 305-314.

  Target: In one embodiment, the target comprises a nucleic acid sequence of SIRT1, including, without limitation, sense and / or antisense non-coding and / or coding sequences associated with sirtuin 1 (SIRT1).

  In a preferred embodiment, antisense oligonucleotides are used to prevent or treat diseases or conditions associated with sirtuin 1 (SIRT1). Sirtuins (SIRTs) are protein modifying enzymes that are uniformly distributed in all organisms. SIRT1 is the mammalian homologue of yeast nicotinamide adenine dinucleotide-dependent deacetylase silent information regulator 2 (known as Sir2), the most well-known SIRT family member. SIRT1 controls the physiology of adipocyte lineage cells. Modulators of SIRT1 activity can be used to alleviate, treat, or prevent diseases and conditions related to fat physiology, such as obesity, obesity related diseases, or fat related metabolic disorders.

  SIRT1 regulates longevity in multiple model organisms and is involved in multiple processes in mammalian cells, including cell survival, differentiation, and metabolism. SIRT1 induction by either SIRT active ingredients such as resveratrol or metabolic states related to caloric restriction has neuroprotective properties and will slow the neurodegenerative process and thereby prolong life (Han SH, (2009) J Clin Neurol. Sep; 5 (3): 120-5 .; Michan S, et al. (2007) Biochem J. 404 (1): 1-13.).

  There are multiple reports supporting the role of SIRT1's axonal protection in the nervous system. Axonal degradation is a major morphological feature observed in both peripheral neuropathies and neurodegenerative diseases such as Alzheimer's disease (AD) and amyotrophic lateral sclerosis (Fischer LR, et al. (2004 ) Exp Neurol 185: 232-240; Stokin GB, et al. (2005) Science 307: 1282-1288). Axonal degradation usually occurs early in the degradation process and often precedes or is significantly associated with clinical signs such as cognitive decline (Yamamoto H, et al. (2007) Mol Endocrinol. 21 (8): 1745-1755).

  In a preferred embodiment, the oligonucleotide is specific for a polynucleotide of SIRT1 that includes, but is not limited to, a non-coding region. SIRT1 targets include variants of SIRT1; variants of SIRT1 including SNPs; non-coding sequences of SIRT1; alleles, fragments, and the like. Preferably the oligonucleotide is an antisense RNA molecule.

  According to embodiments of the present invention, the target nucleic acid molecule is not limited to SIRT1 polynucleotides, but extends to any SIRT1 isoform, receptor, homologue, non-coding region, and the like.

  In other preferred embodiments, the oligonucleotide is a natural antisense sequence (coding region and non-coding region) of the SIRT1 target, including but not limited to variants, alleles, homologues, variants, derivatives, fragments and their complementary sequences. Of natural antisense). Preferably the oligonucleotide is an antisense RNA or DNA molecule.

  In other preferred embodiments, the oligomeric compounds of the invention also include variants in which various bases are present at one or more nucleotide positions of the compound. For example, if the first nucleotide is adenine, variants containing thymidine, guanosine or cytidine or other natural or unnatural nucleotides at this position can be produced. This can be done at any position of the antisense compound. These compounds are then tested using the methods described herein to determine their ability to suppress the expression of the target nucleic acid.

  In some embodiments, homology, sequence identity, or complementarity between the antisense compound and the target is about 50% to about 60%. In some embodiments, homology, sequence identity or complementarity is from about 60% to about 70%. In some embodiments, homology, sequence identity or complementarity is from about 70% to about 80%. In some embodiments, homology, sequence identity or complementarity is from about 80% to about 90%. In some embodiments, the homology, sequence identity or complementarity is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or About 100%.

  Antisense compounds are non-specific to non-target nucleic acid sequences of antisense compounds under conditions where binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid resulting in loss of activity and specific binding is desired. Can specifically hybridize if there is a sufficient degree of complementarity to avoid general binding. Such conditions include physiological conditions in the case of in vivo assays and therapeutic treatments, and conditions under which assays in the case of in vitro assays are performed.

  Antisense compounds (regardless of DNA, RNA, chimera, substitutions, etc.) are specific because binding of the compound to the target DNA or RNA molecule interferes with the normal functioning of the target DNA or RNA, resulting in loss of utility. Nonspecificity of antisense compounds to non-target sequences under conditions where binding is desired (i.e., physiological conditions for in vivo assays and therapeutic treatments, and conditions under which assays are performed for in vitro assays) It can specifically hybridize if there is a sufficient degree of complementarity to avoid general binding.

  In other preferred embodiments, targeting SIRT1 comprising, but not limited to, antisense sequences identified and augmented using, for example, PCR, hybridization, etc., one or more sequences set forth in SEQ ID NOs: 6-47, etc. Regulates SIRT1 expression or function. In one embodiment, expression or function is upregulated compared to a control. In other preferred embodiments, expression or function is down-regulated compared to controls.

  In other preferred embodiments, the oligonucleotide comprises a nucleic acid sequence as set forth in SEQ ID NOs: 6-47, including an antisense sequence identified and augmented using PCR, hybridization, and the like. These oligonucleotides can include one or more modified nucleotides, shorter or longer fragments, modified linkages, and the like. Examples of modified bonds or internucleotide bonds include phosphorothioates, phosphorodithioates, and the like. In other preferred embodiments, the nucleotide comprises a phosphorus derivative. Phosphorus derivatives (or modified phosphate groups) that can be attached to the sugar moiety or sugar-like component in the modified oligonucleotide of the present invention are monophosphate, diphosphate, triphosphate, alkyl phosphate It may be a salt, alkanephosphate, phosphorothioate and the like. The preparation of the phosphate analogs described above and their incorporation into nucleotides, modified nucleotides and oligonucleotides are well known per se and need not be described herein.

  Antisense specificity and sensitivity are also utilized by those skilled in the art for therapeutic use. Antisense oligonucleotides are used as therapeutic ingredients in the treatment of disease states in animals and humans. Antisense oligonucleotides have been safely and effectively administered to humans, and numerous clinical tests are currently underway. It is thus established that oligonucleotides can be useful therapeutic methods that can be configured to be useful in therapeutic regimes for the treatment of cells, tissues and animals, particularly humans.

  In embodiments of the invention, oligomeric antisense compounds, in particular oligonucleotides, bind to a target nucleic acid molecule and modulate the expression and / or function of the molecule encoded by the target gene. The functions of DNA that are hindered include, for example, replication and transcription. The function of the RNA to be hindered is, for example, RNA transfer to the protein translation site, protein translation from RNA, RNA splicing to obtain one or more mRNA species, and RNA may be involved or promoted by RNA All biological functions such as possible catalytic activity. The function can be up-regulated or suppressed depending on the desired function.

  Antisense compounds include antisense oligomeric compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternative splicers, primers, probes and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. As such, these compounds can be introduced in the form of single-stranded, double-stranded, partially single-stranded or cyclic oligomeric compounds.

  Targeting an antisense compound to a specific nucleic acid molecule in the context of the present invention can be a multi-step process. This process usually begins with the identification of a target nucleic acid whose function is modulated. The target nucleic acid can be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or condition or a nucleic acid molecule from an infectious agent. In the present invention, the target nucleic acid encodes sirtuin 1 (SIRT1).

  Typically, the targeting process also includes the determination of at least one target region, segment or site in the target nucleic acid where an antisense interaction that results in the desired effect, eg, modulation of expression, occurs. The term “region” in the context of the present invention is defined as a portion of a target nucleic acid having at least one identifiable structure, function or characteristic. Within the region of the target nucleic acid is a segment. A “segment” is defined as a smaller portion or sub-portion of a region within the target nucleic acid. A “site” as used in the present invention is defined as a position in the target nucleic acid.

  In a preferred embodiment, the antisense oligonucleotides bind to the native antisense sequence of sirtuin 1 (SIRT1) and modulate the expression and / or function of sirtuin 1 (SIRT1) (SEQ ID NO: 1). Examples of antisense sequences include SEQ ID NOs: 2-5.

  In other preferred embodiments, the antisense oligonucleotides bind to one or more segments of a sirtuin 1 (SIRT1) polynucleotide and modulate the expression and / or function of sirtuin 1 (SIRT1). The segment comprises at least 5 consecutive nucleotides of a sirtuin 1 (SIRT1) sense or antisense polynucleotide.

  In another preferred embodiment, the antisense oligonucleotide is specific for the natural antisense sequence of sirtuin 1 (SIRT1) and the binding of the oligonucleotide to sirtuin 1 (SIRT1) to the natural antisense sequence is sirtuin 1 (SIRT1). Regulate the expression and / or function of.

  In other preferred embodiments, the oligonucleotide compound comprises a sequence set forth in SEQ ID NOs: 6-47, such as an antisense sequence identified and augmented using PCR, hybridization, and the like. These oligonucleotides can include one or more modified nucleotides, shorter or longer fragments, modified linkages, and the like. Examples of modified bonds or internucleotide bonds include phosphorothioates, phosphorodithioates, and the like. In other preferred embodiments, the nucleotide comprises a phosphorus derivative. Phosphorus derivatives (or modified phosphate groups) that can be attached to the sugar moiety or sugar-like component in the modified oligonucleotide of the present invention are monophosphate, diphosphate, triphosphate, alkyl phosphate It may be a salt, alkane phosphate, phosphorothioate and the like. The preparation of the phosphate analogs described above and their incorporation into nucleotides, modified nucleotides and oligonucleotides are well known per se and need not be described herein.

  As is well known in the art, since the translation initiation codon is typically 5'-AUG (in the transcribed mRNA molecule, 5'-ATG in the corresponding DNA molecule), the translation initiation codon is Also referred to as “AUG codon”, “start codon” or “AUG start codon”. A few genes have translation initiation codons with the RNA sequence 5'-GUG, 5'-UUG or 5'-CUG, and 5'-AUA, 5'-ACG and 5'-CUG function in vivo It has been shown. Thus, the terms “translation start codon” and “start codon” are typically methionine (in eukaryotes) or formylmethionine (in prokaryotes) in each example, but can include multiple codon sequences. . Eukaryotic and prokaryotic genes have two or more alternative initiation codons, either of which can be preferentially used for translation initiation in certain cell types or tissues or under certain conditions . In the context of the present invention, “start codon” and “translation start codon” refer to the translation of mRNA transcribed from a gene encoding sirtuin 1 (SIRT1) regardless of the sequence (s) of such codons. Means one or more codons used in vivo to initiate. The translation stop codon (or “stop codon”) of a gene has three sequences: 5′-UAA, 5′-UAG and 5′-UGA (the corresponding DNA sequences are 5′-TAA and 5′-TAG respectively. And 5′-TGA).

  The terms “start codon region” and “translation start codon region” refer to such mRNAs or genes comprising about 25 to about 50 nucleotides in either direction (ie, 5 ′ or 3 ′) from the translation start codon. Means a part of Similarly, the terms “stop codon region” and “translation stop codon region” include such about 25 to about 50 nucleotides contiguous in either direction (ie, 5 ′ or 3 ′) from the translation stop codon. Means a part of mRNA or gene. As a result, the “start codon region” (or “translation start codon region”) and “stop codon region” (or “translation stop codon region”) are all regions that can be effectively targeted with the antisense compounds of the present invention. is there.

  An open reading frame (ORF) or “coding region”, which is well known in the art to mean a region between a translation initiation codon and a translation termination codon, is also a region that can be effectively targeted. A targeted region in the context of the present invention is an intragenic region that includes the translation start or stop codon of the open reading frame (ORF) of the gene.

  Other target regions include a 5 ′ untranslated region (5′UTR), which is well known in the art to mean a portion of mRNA 5 ′ from the translation initiation codon, and thus a 5 ′ cap site and mRNA ( Or a nucleotide between the translation initiation codon of the corresponding nucleotide on the gene). Still other target regions include a 3 'untranslated region (3'UTR), which is well known in the art to mean a portion of an mRNA 3' from the translation stop codon, and thus, the translation stop codon and mRNA (or gene) Including nucleotides between the 3 ′ end of the corresponding nucleotides above. The 5 ′ cap site of an mRNA contains an N7-methylated guanosine residue attached to the 5 ′ most residue of the mRNA via a 5′-5 ′ triphosphate linkage. The 5 ′ cap region of an mRNA is considered to include the 5 ′ cap structure itself and the first 50 nucleotides adjacent to the cap site. Another target region of the invention is the 5 ′ cap region.

  Some eukaryotic mRNA transcripts are translated directly, but most contain one or more regions known as “introns” that are excised from the transcript before it is translated. The remaining (and therefore translated) regions are known as “exons” and are spliced together to form a continuous mRNA sequence. In one embodiment, the target splice site, ie intron-exon junction or exon-intron junction, is particularly useful in situations where aberrant splicing is involved in the disease or overproduction of a particular splice product is involved in the disease. Abnormal fusion junctions due to rearrangements or deletions are other embodiments of target sites. MRNA transcripts produced through the process of splicing two (or more) mRNAs from different gene sources are known as “fusion transcripts”. Introns can be effectively targeted using, for example, antisense compounds that target DNA or pre-mRNA.

  In other preferred embodiments, the antisense oligonucleotides bind to the coding region and / or non-coding region of the target polynucleotide and modulate the expression and / or function of the target molecule.

  In other preferred embodiments, the antisense oligonucleotides bind to natural antisense polynucleotides and modulate the expression and / or function of the target molecule.

  In other preferred embodiments, the antisense oligonucleotides bind to sense polynucleotides and modulate the expression and / or function of the target molecule.

  Selective RNA transcripts can be produced from the same genetic region of DNA. These selective transcripts are generally known as “variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA, differing from other transcripts produced from the same genomic DNA in either their start or stop positions, introns and Contains both exon sequences.

  In excision of one or more exon or intron regions or portions thereof in splicing, pre-mRNA variants produce smaller “mRNA variants”. As a result, mRNA variants are processed into pre-mRNA variants, each unique pre-mRNA variant always producing a unique mRNA variant as a result of splicing. These mRNA variants are also known as “alternative splice variants”. If splicing of the pre-mRNA variant does not occur, the pre-mRNA variant is identical to the mRNA variant.

  Variants can also be produced through the use of selective signals to initiate or terminate transcription. Pre-mRNA and mRNA can have more than one start or stop codon. Pre-mRNA or mRNA-derived variants that use an alternative start codon are known as “alternative start variants” of the pre-mRNA or mRNA. These transcripts using alternative stop codons are known as pre-mRNAs or “alternative stop variants” of mRNA. One particular type of selective termination variant is a “poly A variant” that produces a large number of transcripts resulting from an alternative selection of one of the “poly A termination signals” by mechanical transcription, thereby A transcript is produced that terminates at a unique poly A site. In the context of the present invention, variants of the type described herein are also embodiments of target nucleic acids.

  The location on the target nucleic acid to which the antisense compound hybridizes is defined as the at least 5 nucleotide long portion of the target region to which the active antisense compound is targeted.

  Although detailed sequences of specific exemplary target segments are described herein, those skilled in the art will appreciate that they can be used to illustrate and describe specific embodiments within the scope of the present invention. Additional target segments can be readily identified by those skilled in the art in view of the present disclosure.

  A target segment of 5-100 nucleotides in length comprising at least 5 (5) consecutive nucleotide ranges selected from within an exemplary preferred target segment is also considered suitable for targeting.

  The target segment can comprise a DNA or RNA sequence comprising at least 5 consecutive nucleotides from the 5′-end of one of the exemplary preferred target segments (the remaining nucleotides are immediately adjacent to the 5′-end of the target segment. A continuous range of the same DNA or RNA starting upstream and continuing until the DNA or RNA contains about 5 to about 100 nucleotides). Similarly preferred target segments are represented by DNA or RNA sequences comprising at least 5 consecutive nucleotides from the 3′-end of one of the exemplary preferred target segments (the remaining nucleotides are 3 ′ of the target segment). -A continuous range of the same DNA or RNA starting just downstream of the ends and continuing until the DNA or RNA contains about 5 to about 100 nucleotides). One skilled in the art using the target segments exemplified herein can identify additional preferred target segments without undue experimentation.

  Once one or more target regions, segments or sites are identified, an antisense that is sufficiently complementary to the target, i.e., sufficiently hybridized, and with sufficient specificity to achieve the desired effect A compound is selected.

  In embodiments of the invention, the oligonucleotide binds to the antisense strand of a particular target. Oligonucleotides are at least 5 nucleotides in length and may be synthesized such that each oligonucleotide targets an overlapping sequence, and the oligonucleotides are synthesized to span the entire length of the target polynucleotide. The target also includes coding and non-coding regions.

  In one embodiment, it is preferred to target a specific nucleic acid with an antisense oligonucleotide. Targeting antisense compounds to specific nucleic acids is a multi-step process. This process usually begins with the identification of a nucleic acid sequence whose function is regulated. This can be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or condition or an untranslated polynucleotide such as untranslated RNA (ncRNA).

  RNA can be classified as (1) messenger RNA (mRNA) that is translated into protein, and (2) non-protein-encoding RNA (ncRNA). ncRNA contains microRNAs, antisense transcripts and other transcription units (TUs) that contain a high density of stop codons and lack any extensive “open reading frame”. Many ncRNAs are thought to begin at the start site in the 3 'untranslated region (3'UTR) of the protein coding locus. ncRNAs are often rare, and it is believed that at least half of the ncRNAs sequenced by the FANTOM consortium are not polyadenylated. For obvious reasons, most researchers are looking at polyadenylated mRNA that is processed and excreted into the cytoplasm. In recent years, a series of unpolyadenylated nuclear RNAs can be very numerous, and many such transcripts have been shown to originate from so-called intergenic regions (Cheng, J. et al. (2005) Science 308 (5725), 1491-1154; Kapranov, P. et al. (2005). Genome Res 15 (7), 987-997). The mechanism by which ncRNA can control gene expression is by base pairing with the target transcript. RNAs that function by base-pairing are (1) cis-encoded RNAs that are encoded on the same locus as the working RNA but on the opposite strand and are therefore fully complementary to their targets And (2) can be classified as trans-encoded RNAs that are encoded at different chromosomal locations from the acting RNA and generally do not show full base-pairing potential with their target.

  Without being bound by theory, variation of the antisense polynucleotide with the antisense oligonucleotides described herein can alter the expression of the corresponding sense messenger RNA. However, this control can be either incongruent (antisense knockdown results in an increase in sense messenger RNA) or in harmony (results in a decrease in sense messenger RNA associated with antisense knockdown). In these cases, the antisense oligonucleotide may be targeted to overlapping or non-overlapping parts of the antisense strand, resulting in its knockdown or sequestration. Coded and non-coded antisense can be targeted by the same means, and the sense transcripts corresponding to either class can be controlled by either harmonic or discordant means. The strategy used to identify new oligonucleotides for use against the target can be based on knockdown of the antisense RNA transcript by the antisense oligonucleotide or any other means to modulate the desired target .

  Strategy 1: In the case of discordant regulation, knockdown of antisense transcription increases the expression of normal (sense) genes. If the latter gene encodes a known or putative drug target, knockdown of its antisense counterpart can possibly mimic the action of a receptor agonist or enzyme stimulator.

  Strategy 2: In the case of harmonic regulation, both antisense and sense transcripts can be knocked down simultaneously, thus achieving a synergistic reduction in normal (sense) gene expression. For example, when an antisense oligonucleotide is used to achieve knockdown, this strategy is based on one antisense oligonucleotide targeted to the sense transcript and the other antisense oligonucleotide to the corresponding antisense transcript. Or can be used to apply to a single energetically symmetric antisense oligonucleotide that targets overlapping sense and antisense transcripts simultaneously.

According to the present invention, an antisense compound comprises at least one of an antisense oligonucleotide, a ribozyme, an external guide sequence (EGS) oligonucleotide, a single-stranded or double-stranded RNA interference (RNAi) compound such as an siRNA compound, an siRNA compound, and a target nucleic acid. Contains other oligomeric compounds that hybridize in part and regulate their function. As such, they can be DNA, RNA, DNA-like, RNA-like, or mixtures thereof, or can be one or more mimetics thereof. These compounds can be single-stranded, double-stranded, cyclic or hairpin oligomeric compounds and can contain structural elements such as internal or terminal bulges, mismatches or loops. Antisense compounds are routinely prepared in a linear form, but can be linked in a circular and / or branched fashion or otherwise prepared. Antisense compounds, for example, to allow hybridization and formation of two strands hybridized to form an entire or partial double-stranded compound, or an entire or partial double-stranded compound Constructs such as single strands with sufficient self-complementarity can be included. The duplexes can be joined internally leaving a free 3 ′ or 5 ′ end, or joined to form a continuous hairpin structure or loop. The hairpin structure can contain an overhang at either the 5 ′ or 3 ′ end, resulting in the extension of a single stranded trait. Optionally, the double stranded compound can contain overhangs at both ends. Further modifications can include a complex group attached to one of the termini, one of the selected nucleotide positions, sugar positions or internucleotide linkages. Alternatively, the duplex can be linked via a non-nucleic acid component or a linker group. When formed from only one strand, a dsRNA can take the form of a self-complementary hairpin-type molecule that folds onto itself to form a duplex. Thus, the dsRNA can be fully or partially double stranded. Although specific regulation of gene expression can be achieved by stable expression of dsRNA hairpins in transgenic cell lines, in some embodiments gene expression or function is upregulated. When formed from a single strand that takes the form of a double-stranded, or self-complementary hairpin-type molecule that folds on itself to form a double strand (or two of a single strand)
The heavy chain forming region) is a complementary RNA strand that base-pairs like Watson-Crick.

  Once introduced into the system, the compounds of the invention can trigger the action of one or more enzymes or structural proteins that affect the cleavage or other modification of the target nucleic acid, or can act via an occupancy-based mechanism. In general, nucleic acids (including oligonucleotides) are `` DNA-like '' (i.e. typically have one or more 2'-deoxy sugars and generally have a T base rather than a U base) or `` RNA-like '' (i.e. Having one or more 2′-hydroxy sugars or 2′-modified sugars, and generally U bases rather than T bases). A nucleic acid helix can take more than one type of structure, most commonly the A-form and the B-form. In general, oligonucleotides having a B-form-like structure are considered “DNA-like” and those having an A-form-like structure are considered “RNA-like”. In some (chimeric) embodiments, the antisense compounds can contain both A- and B-form regions.

  In other preferred embodiments, the desired oligonucleotide or antisense compound is antisense RNA, antisense DNA, chimeric antisense oligonucleotide; antisense oligonucleotide containing modified linkage; interfering RNA (RNAi), small molecule interference RNA (siRNA); micro-interference RNA (miRNA); small transient RNA (stRNA); or small hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small molecule activation RNA (saRNA) Or at least one of these combinations.

  dsRNA can also activate a mechanism called gene expression, “small RNA-induced gene activation” or RNAa. DsRNAs targeting gene promoters induce strong transcriptional activation of related genes. RNAa has been demonstrated in human cells using synthetic dsRNA and has been termed “small molecule activating RNA” (saRNA). Whether RNAa is conserved in other organisms is currently unknown.

  Small double-stranded RNA (dsRNA) such as small interfering RNA (siRNA) and microRNA (miRNA) has been found to trigger an evolutionarily conserved mechanism known as RNA interference (RNAi) ing. RNAi leads to constant gene expression suppression through chromatin remodeling, thereby repressing transcription, degrading complementary mRNA, or blocking protein translation. However, in the examples described in detail in the Examples section below, oligonucleotides have been shown to increase the expression and / or function of sirtuin 1 (SIRT1) polynucleotides and their encoded products. . dsRNA can also act as a small molecule activating RNA (saRNA). Without being bound by theory, by targeting sequences in gene promoters, saRNA induces target gene expression in a phenomenon called dsRNA-induced transcriptional activation (RNAa).

  In further embodiments, “preferred target segments” identified herein can be used in the selection of additional compounds that modulate the expression of a sirtuin 1 (SIRT1) polynucleotide. A “modulator” is a compound comprising at least five nucleotide moieties that reduce or increase expression of a nucleic acid molecule encoding sirtuin 1 (SIRT1) and that are complementary to a preferred target segment. A screening method comprises contacting a preferred target segment of a nucleic acid molecule encoding a sirtuin 1 (SIRT1) polynucleotide with one or more candidate modulators, and a sirtuin 1 (SIRT1) polynucleotide, eg, SEQ ID NOs: 6-47. Selecting one or more candidate modifiers that reduce or increase the expression of the encoding nucleic acid molecule. Once it has been shown that one or more candidate modulators can modulate (eg, decrease or increase) the expression of a nucleic acid molecule encoding a sirtuin 1 (SIRT1) polynucleotide, the modulator is then sirtuin 1 (SIRT1) may be used in further research studies of polynucleotide function or for use as research, diagnostic or therapeutic agents according to the present invention.

  Targeting the natural antisense sequence preferably modulates the function of the target gene, eg, SIRT1 gene (Accession Number: NM — 012238.3; UCSC Genome Database). In a preferred embodiment, the target is a sirtuin 1 antisense polynucleotide. In a preferred embodiment, the antisense oligonucleotide is a sense and / or native antisense sequence (eg, accession number: NM — 012238.3, SEQ ID NO: 1, FIG. 10), variant, allele, isoform, of a sirtuin 1 (SIRT1) polynucleotide, Homologues, variants, derivatives, fragments and their complementary sequences are targeted. Preferably the oligonucleotide is an antisense molecule and the target comprises coding and non-coding regions of an antisense and / or sense SIRT1 polynucleotide.

  Preferred target segments of the invention can be combined with each complementary antisense compound of the invention to form a stabilized double stranded (duplex) oligonucleotide.

  Such double stranded oligonucleotide components have been shown in the art to regulate target expression and to control translation and RNA processing via an antisense mechanism. In addition, double-stranded components can be subjected to chemical modification (Fire et al., (1998) Nature, 391, 806-811; Timmons and Fire, (1998) Nature, 395, 854; Timmons et al., (2001) Gene, 263, 103-112; Tabara et al., (1998) Science, 282, 430-431; Montgomery et al., (1998) Proc. Natl. Acad. Sci. USA, 95, 15502-15507; Tuschl et al., (1999) Genes Dev., 13, 3191-3197; Elbashir et al. (2001) Nature, 411, 494-498; Elbashir et al. (2001) Genes Dev., 15, 188-200). For example, such a double-stranded component has been shown to suppress the target by classical hybridization of the double-stranded antisense strand to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al. (2002) Science, 295, 694-697).

  In a preferred embodiment, the antisense oligonucleotide targets a sirtuin 1 (SIRT1) polynucleotide (eg accession number: NM — 012238.3), variants, alleles, isoforms, homologues, variants, derivatives, fragments and their complementary sequences To do. Preferably the oligonucleotide is an antisense molecule.

  According to embodiments of the invention, the target nucleic acid molecule is not limited to sirtuin 1 (SIRT1), but extends to any isoform, receptor, homologue and sirtuin 1 (SIRT1) -like molecule.

  In other preferred embodiments, the oligonucleotide is a natural antisense sequence of a sirtuin 1 (SIRT1) polynucleotide, such as the polynucleotides set forth in SEQ ID NOs: 2-5 and any variants, alleles, homologues, variants, derivatives, Target fragments and their complementary sequences. Examples of antisense oligonucleotides are set forth as SEQ ID NOs: 6-47.

  In one embodiment, the oligonucleotide is complementary to a sirtuin 1 (SIRT1) antisense nucleic acid sequence, including but not limited to non-coding sense and / or antisense sequences associated with a sirtuin 1 (SIRT1) polynucleotide. Or bind and modulate the expression and / or function of a sirtuin 1 (SIRT1) molecule.

  In other preferred embodiments, the oligonucleotide is complementary or binds to the SIRT1 natural antisense nucleic acid sequence set forth in SEQ ID NOs: 2-5 and modulates the expression and / or function of the SIRT1 molecule.

  In a preferred embodiment, the oligonucleotide comprises a sequence of at least 5 consecutive nucleobases of SEQ ID NOs: 6-47 and modulates the expression and / or function of sirtuin 1 (SIRT1).

  Polynucleotide targets include SIRT1, variants of SIRT1, including its family members; variants of SIRT1, including SNPs; non-coding sequences of SIRT1, alleles of SIRT1, species variants, fragments, and the like. Preferably the oligonucleotide is an antisense molecule.

  In other preferred embodiments, oligonucleotides targeting sirtuin 1 (SIRT1) polynucleotides are antisense RNA, interfering RNA (RNAi), small interfering RNA (siRNA); microinterfering RNA (miRNA); RNA (stRNA); or short hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); or small molecule activation RNA (saRNA).

  In other preferred embodiments, targeting of sirtuin 1 (SIRT1) polynucleotides, eg, SEQ ID NOs: 6-47, modulates the expression or function of these targets. In one embodiment, expression or function is upregulated compared to a control. In other preferred embodiments, expression or function is downregulated compared to controls.

  In another preferred embodiment, the antisense compound comprises a sequence set forth in SEQ ID NOs: 6-47. These oligonucleotides can include one or more modified nucleobases, shorter or longer fragments, modified linkages, and the like.

  In other preferred embodiments, SEQ ID NOs: 6-47 comprise one or more LNA nucleotides.

  Modulation of the desired target nucleic acid can be performed in several ways well known in the art. For example, antisense oligonucleotide, siRNA, etc. Enzymatic nucleic acid molecules (eg, ribozymes) are nucleic acid molecules that can catalyze one or more of a variety of reactions, including the ability to repeatedly cleave other separate nucleic acid molecules in a manner specific to the nucleotide base sequence. Such enzymatic nucleic acid molecules can be used, for example, to target virtually any RNA transcript (Zaug et al., 324, Nature 429 1986; Cech, 260 JAMA 3030, 1988; and Jefferies et al., 17 Nucleic Acids Research 1371, 1989).

  Due to their sequence specificity, trans-cleaving enzymatic nucleic acid molecules show promise as therapeutic agents for human diseases (Usman and McSwiggen, (1995) Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets in a cellular RNA background. Such a cleavage event renders the mRNA non-functional and inhibits protein expression from that RNA. In this way, the synthesis of proteins associated with disease states can be selectively suppressed.

  In general, enzymatic nucleic acids having RNA cleavage activity act by first binding to a target RNA. Such binding occurs through the target binding portion of the enzymatic nucleic acid held in close proximity to the enzymatic portion of the molecule that acts to cleave the target RNA. Thus, an enzymatic nucleic acid molecule first recognizes a target RNA, then binds through complementary base pairing, and acts enzymatically to cleave the target RNA once it binds to the correct site. Such strategic cleavage of the target RNA destroys its ability to direct the synthesis of the encoded protein. After the enzymatic nucleic acid binds to and cleaves its RNA target, it can dissociate from the RNA and repeatedly look for another target and repeatedly bind to and cleave the new target.

  Several approaches, such as in vitro selection (evolutionary) strategies (Orgel, 1979, Proc.R. Soc.London, B 205, 435), perform various reactions such as phosphodiester and amide bond cleavage and ligation. Used to develop new nucleic acid catalysts that can be catalyzed (Joyce, (1989) Gene, 82, 83-87; Beaudry et al. (1992) Science 257, 635-641; Joyce, (1992) Scientific American 267, 90-97; Breaker et al. (1994) TIBTECH 12, 268; Bartel et al. (1993) Science 261: 1411-1418; Szostak, (1993) TIBS 17, 89-93; Kumar et al. (1995) FASEB J., 9, 1183; Breaker, (1996) Curr. Op. Biotech., 7, 442).

The development of optimal ribozymes for catalytic activity contributes significantly to any strategy that uses RNA-cleaving ribozymes for gene expression control purposes. For example, hammerhead ribozymes function at a catalytic rate (k _cat ) of about 1 min ⁻¹ in the presence of a saturated (10 mM) concentration of Mg ²⁺ cofactor. Artificial “RNA ligase” ribozymes have been shown to catalyze the corresponding self-modification reaction at a rate of about 100 min− ¹ . In addition, certain modified hammerhead ribozymes with substrate binding arms made from DNA are well known to catalyze RNA cleavage at multiple turn-over rates approaching 100 min- ^1. is there. Finally, replacement of specific residues in the catalytic core of the hammerhead with specific nucleotide analogues results in modified ribozymes that show as much as a 10-fold improvement in the catalytic rate. These findings indicate that ribozymes can promote chemical transformation at a catalytic rate significantly greater than that exhibited in vitro by most natural self-cleaving ribozymes. Thereby, the structure of certain self-cleaving ribozymes can be optimized to yield maximum catalytic activity, or a completely new RNA motif can be created that exhibits a significantly faster rate for RNA phosphodiester cleavage. Is possible.

  RNA-catalyzed intermolecular cleavage of RNA substrates that fits into the “hammerhead” model was first shown in 1987 (Uhlenbeck, O. C. (1987) Nature, 328: 596-600). The RNA catalyst was recovered and reacted with multiple RNA molecules, indicating that it was truly catalytic.

  Catalytic RNAs designed based on a “hammerhead” motif can be used to cleave specific target sequences by creating appropriate base changes in the catalytic RNA to maintain the base pairing required for the target sequence (Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, OC (1987) Nature, 328: 596-600; Koizumi, M. et al. (1988) FEBS Lett., 228: 228-230). This allows the use of catalytic RNAs to cleave specific target sequences and demonstrates that catalytic RNAs designed by the “hammerhead” model may cleave specific substrate RNAs in vivo (See Haseloff and Gerlach, (1988) Nature, 334, 585; Walbot and Bruening, (1988) Nature, 334, 196; Uhlenbeck, OC (1987) Nature, 328: 596-600).

  RNA interference (RNAi) has become a powerful tool for regulating gene expression in mammals and mammalian cells. This approach requires delivery of small interfering RNA (siRNA), either as RNA itself or as DNA, using expression plasmids or viruses and the coding sequence of small hairpin RNAs that are processed into siRNA. . This system allows for efficient transport of pre-siRNAs into the cytoplasm where they are active and allows the use of controlled tissue specific promoters for gene expression.

  In preferred embodiments, the oligonucleotide or antisense compound comprises an oligomer or polymer of ribonucleic acid (RNA) and / or deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs or homologues thereof. The term includes oligonucleotides consisting of naturally occurring nucleotides, sugars and oligonucleotides containing internucleotide (backbone) covalent bonds and non-naturally occurring moieties that function in a similar manner. Such modified or substituted oligonucleotides are often in natural form due to desirable properties such as enhanced uptake into cells, enhanced affinity for target nucleic acids and increased stability in the presence of nucleases. More desirable.

  According to the present invention, an oligonucleotide or “antisense compound” is an antisense oligonucleotide (eg, RNA, DNA, mimetics, chimera, analog or homologue thereof), ribozyme, external guide sequence (EGS) oligonucleotide, siRNA. Compounds, single or double stranded RNA interference (RNAi) compounds such as siRNA compounds, saRNA, aRNA and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid and modulate its function. As such, they can be DNA, RNA, DNA-like, RNA-like or mixtures thereof, or one or more mimetics thereof. These compounds can be single-stranded, double-stranded, cyclic or hairpin oligomeric compounds and can contain structural elements such as internal or terminal bulges, mismatches or loops. Antisense compounds are routinely prepared in a linear form, but can be linked in a circular and / or branched fashion or otherwise prepared. Antisense compounds, for example, to allow hybridization and formation of two strands hybridized to form an entire or partial double-stranded compound, or an entire or partial double-stranded compound Constructs such as single strands with sufficient self-complementarity can be included. The two strands can be joined internally leaving a free 3 'or 5' end, or joined to form a continuous hairpin structure or loop. The hairpin structure can contain an overhang at either the 5 ′ or 3 ′ end to effect the extension of a single stranded trait. Optionally, the double stranded compound may contain an overhang at both ends. Further modifications can include a complex group attached to one of the termini, one of the selected nucleotide positions, sugar positions or internucleotide linkages. Alternatively, the two strands can be linked via a non-nucleic acid component or a linker group. When formed from only a single strand, a dsRNA can take the form of a self-complementary hairpin-type molecule that folds onto itself to form a duplex. Thus, the dsRNA can be fully or partially double stranded. Specific regulation of gene expression can be achieved by stable expression of dsRNA hairpins in transgenic cell lines (Hammond et al. (1991) Nat. Rev. Genet., 2, 110-119; Matzke et al. (2001). Curr. Opin. Genet. Dev., 11, 221-227; Sharp, (2001) Genes Dev., 15, 485-490). When formed from a single strand that takes the form of a double-stranded or self-complementary hairpin-type molecule that folds onto itself to form a double-stranded (or double-stranded single-stranded) The strand forming region) is a self-complementary RNA strand that base-pairs like Watson-Crick.

  Once introduced into the system, the compounds of the present invention can induce the action of one or more enzymes or structural proteins that result in cleavage or other modification of the target nucleic acid, or can act via an occupancy-based mechanism. In general, nucleic acids (including oligonucleotides) are `` DNA-like '' (i.e. typically have one or more 2'-deoxy sugars and generally have T bases rather than U bases) or `` RNA-like '' (i.e. generally 1 Having one or more 2′-hydroxy sugars or 2′-modified sugars, and generally U bases rather than T bases). A nucleic acid helix can take more than one structure, most commonly the A-form and the B-form. In general, an oligonucleotide having a B-form-like structure is considered “DNA-like”, and an oligonucleotide having an A-form-like structure is considered “RNA-like”. In some (chimeric) embodiments, the antisense compounds can contain both A- and B-form regions.

  An antisense compound according to the invention can comprise an antisense moiety derived from about 5 to about 80 nucleotides in length (ie, about 5 to about 80 linked nucleosides). This refers to the length of the antisense strand or portion of the antisense compound. In other words, the single-stranded antisense compound of the present invention comprises 5 to about 80 nucleotides, and the double-stranded antisense compound of the present invention (such as dsRNA) has a length of 5 to about 80 nucleotides of sense and antisense. Contains a chain or part. Those skilled in the art know that this is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76 , 77, 78, 79, or 80 nucleotides or any length of antisense moiety within these ranges is understood.

  In one embodiment, the antisense compounds of the invention have an antisense moiety that is 10-50 nucleotides in length. The person skilled in the art knows that this is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides or any length within these ranges It is understood that the oligonucleotides having the antisense moiety are embodied. In some embodiments, the oligonucleotide is 15 nucleotides in length.

  In one embodiment, the antisense or oligonucleotide compounds of the invention have an antisense portion that is 12 or 13 to 30 nucleotides in length. Those skilled in the art will know that this is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides or within these ranges It is understood that an antisense compound having an antisense moiety of any length is embodied.

In a preferred embodiment, administration of at least one oligonucleotide targeting any one or more polynucleotides of sirtuin 1 (SIRT1) results in abnormalities in the sirtuin 1 (SIRT1) polynucleotide, its encoded product. Prevent or treat diseases related to expression or function, or other related diseases. Examples of diseases that can be treated with antisense oligonucleotides include cancer (e.g., breast cancer, colorectal cancer, CCL, CML, prostate cancer), neurodegenerative diseases (e.g., Alzheimer's disease (AD), Huntington's disease, ALS, Parkinson's disease, amyotrophic lateral sclerosis, disorders caused by multiple sclerosis and polyglutamine aggregation); skeletal muscle disease (e.g. Duchenne muscular dystrophy, skeletal muscle atrophy, Becker muscular dystrophy or myotonic dystrophy); metabolic disease (E.g. insulin resistance, diabetes, obesity, impaired glucose tolerance, high blood cholesterol, hyperglycemia, dyslipidemia and hyperlipidemia); adult-onset diabetes, diabetic nephropathy, neuropathy (e.g. sensory Neuropathy, autonomic neuropathy, motor neuropathy, retinopathy); bone disease (e.g. osteoporosis), blood disease (e.g. white blood) ); Liver disease (e.g. due to alcohol abuse or hepatitis); obesity; bone resorption, age-related macular degeneration, AIDS-related dementia, ALS, Bell's palsy, atherosclerosis, heart disease (e.g. arrhythmia, chronic congestion) Congenital heart failure, ischemic stroke, coronary artery disease and cardiomyopathy), chronic degenerative diseases (for example, myocardial disease), chronic renal failure, type 2 diabetes, ulcer, cataract, presbyopia, glomerulonephritis, Guillain-Barre syndrome, hemorrhagic Including stroke, rheumatoid arthritis, inflammatory bowel disease, SLE, Crohn's disease, osteoarthritis, osteoporosis, chronic obstructive pulmonary disease (COPD), pneumonia, skin aging and urinary incontinence, other examples related to neuronal cell death Disease and other conditions characterized by aging or unwanted cell loss. Other examples include diseases or illnesses associated with neuronal cell death, aging or other conditions characterized by undesirable cell defects.
In other preferred embodiments, the oligomeric compounds of the invention also include variants in which a different base is present at one or more nucleotide positions in the compound. For example, if the first nucleotide is adenosine, variants containing thymidine, guanosine or cytidine at this position can be produced. This can be done at any position of the antisense or dsRNA compound. These compounds are then tested using the methods described herein to determine their ability to suppress the expression of the target nucleic acid.

  In some embodiments, homology, sequence identity or complementarity between the antisense compound and the target is about 40% to about 60%. In some embodiments, homology, sequence identity or complementarity is from about 60% to about 70%. In some embodiments, homology, sequence identity or complementarity is from about 70% to about 80%. In some embodiments, homology, sequence identity or complementarity is from about 80% to about 90%. In some embodiments, the homology, sequence identity or complementarity is about 90%, about 92%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or About 100%.

  In other preferred embodiments, antisense oligonucleotides, such as the nucleic acid molecules set forth in SEQ ID NOs: 6-47, include one or more substitutions or modifications. In one embodiment, the nucleotide is replaced with a locked nucleic acid (LNA).

  In other preferred embodiments, the oligonucleotide targets one or more regions of nucleic acid molecule sense and / or antisense of coding and / or non-coding sequences associated with SIRT1 and the sequences set forth as SEQ ID NOs: 1-5. To do. The oligonucleotide is also targeted to the overlapping region of SEQ ID NOs: 1-5.

  Certain preferred oligonucleotides of the present invention are chimeric oligonucleotides. In the context of the present invention, a “chimeric oligonucleotide” or “chimera” is an oligonucleotide containing two or more chemically distinct regions each consisting of at least one nucleotide. These oligonucleotides have at least one region of modified nucleotides that confer one or more beneficial properties (e.g., increased nuclease resistance, increased cellular uptake, increased binding affinity for a target, etc.), And typically contain regions that are substrates for enzymes capable of cleaving RNA: DNA or RNA: RNA hybrids. By way of example, RNase H is a cellular endonuclease that cleaves RNA strands of RNA: DNA duplexes. Thus, activation of RNase H results in cleavage of the RNA target, thereby greatly enhancing the efficiency of antisense regulation of gene expression. As a result, when chimeric oligonucleotides are used, comparable results are often obtained with small oligonucleotides compared to phosphorothioate deoxyoligonucleotides that hybridize to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, related nucleic acid hybridization techniques well known in the art. In a preferred embodiment, the chimeric oligonucleotide usually comprises at least one region that increases target binding affinity and a region that acts as a substrate for RNase H. The affinity of an oligonucleotide for its target (in this case, the nucleic acid encoding ras) is the Tm of the oligonucleotide / target pair (the temperature at which the oligonucleotide and target dissociate and dissociation is detected spectrophotometrically) Is routinely determined by measuring The higher the Tm, the greater the affinity of the oligonucleotide for the target.

  The chimeric antisense compounds of the present invention can be formed as a composite structure of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics as described above. Such compounds are also referred to in the art as hybrids or gapmers. Representative US patents describing the preparation of such hybrid structures include, but are not limited to, US Pat. Nos. 5,013,830, 5,149,797, 5,220,007, and 5,256,775, each of which is incorporated herein by reference. No. 5,366,878, No. 5,403,711, No. 5,491,133, No. 5,565,350, No. 5,623,065, No. 5,652,355, No. 5,652,356 and No. 5,700,922.

In other preferred embodiments, the region of the modified oligonucleotide comprises at least one nucleotide modified at the 2 ′ position of the sugar, most preferably 2′-O-alkyl, 2′-O-alkyl-O-alkyl. Or 2'-fluoro modified nucleotides. In other preferred embodiments, the RNA modification comprises pyrimidine, abasic residues or 2′-fluoro, 2′-amino and 2′O-methyl modifications on the ribose of the inverted base at the 3 ′ end of the RNA. Including. Such modifications are routinely incorporated into oligonucleotides, and these oligonucleotides have a higher Tm (i.e. higher target binding affinity) than a 2'-deoxy oligonucleotide for a given target. It has been shown. Such increased affinity effects greatly enhance RNAi oligonucleotide suppression of gene expression. RNAse H is a cellular endonuclease that cleaves the RNA strand of the RNA: DNA duplex, thus activation of this enzyme results in cleavage of the RNA target, thereby greatly enhancing the efficiency of RNAi suppression. Cleavage of the RNA target can be routinely demonstrated by gel electrophoresis. In other preferred embodiments, the chimeric oligonucleotide is also modified to enhance nuclease resistance. Cells contain a variety of exo- and endo-nucleases that can degrade nucleic acids. A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which it is incorporated more resistant to nuclease digestion than natural oligonucleotides. Nuclease resistance is routinely measured by incubating the oligonucleotide with a cell extract or isolated nuclease solution and measuring the amount of unchanged oligonucleotide remaining after a period of time, usually by electrophoresis. The Oligonucleotides that have been modified to enhance nuclease resistance remain unchanged for longer periods than unmodified oligonucleotides. Various oligonucleotide modifications have been demonstrated to enhance or confer nuclease resistance. Currently, oligonucleotides containing at least one phosphorothioate modification are more preferred. Oligonucleotide modifications that enhance target binding affinity in some cases can also alone enhance nuclease resistance. Some desirable modifications can be found in De Mesmaeker et al. (1995) Acc. Chem. Res., 28: 366-374.

Specific examples of some preferred oligonucleotides envisioned for the present invention include modified backbones such as phosphorothioates, phosphotriesters, methylphosphonates, short chain alkyl or cycloalkyl sugar moieties, or short chains Including those containing a heteroatom or a heterocyclic intersugar linkage. Most preferred are oligonucleotides having a phosphorothioate backbone and heteroatom backbones, particularly CH ₂ --NH--O--CH ₂ , CH, --N (CH ₃ )-O--CH ₂ [methylene (methylimino) or known as MMI _{backbone], CH 2 --O - N (} CH 3) - CH 2, CH 2 --N (CH 3) - N (CH 3) - CH 2 and O- -N (CH ₃ )-CH ₂ --CH ₂ skeleton, wherein the natural phosphodiester skeleton is represented as OP--O--CH). The amide skeleton disclosed by De Mesmaeker et al. (1995) Ace. Chem. Res., 28: 366-374) is also preferred. Also preferred are oligonucleotides having a morpholino backbone structure (Summerton and Weller, US Pat. No. 5,034,506). In other preferred embodiments, the peptide nucleic acid (PNA) backbone, the phosphodiester backbone of the oligonucleotide, etc. are replaced with a polyamide backbone, and the nucleotide is directly or indirectly attached to the aza nitrogen atom of the polyamide backbone (Nielsen et al., (1991) Science, 254, 1497). Oligonucleotides can also include one or more substituted sugar moieties. Preferred oligonucleotides are: OH, SH, SCH ₃ , F, OCN, OCH ₃ OCH ₃ , OCH ₃ O (CH ₂ ) _n CH ₃ , O (CH ₂ ) _n NH ₂ or O (CH ₂ ) _n CH ₃ (where n is from 1 to about _10); C ₁ ~C 10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF 3; OCF 3; O- -, S--, or N-alkyl; O--, S--, or N-alkenyl; SOCH ₃ ; SO ₂ ; CH ₃ ; ONO ₂ ; NO ₂ ; N ₃ ; NH ₂ ; heterocycloalkyl; hetero Cycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; RNA cleaving groups; reporter groups; interfering substances; groups that improve the pharmacokinetic properties of oligonucleotides; or groups that improve the pharmacodynamic properties of oligonucleotides and One of the other substituents having similar properties is included at the 2 ′ position. A preferred modification is also known as 2′-methoxyethoxy [2′-O—CH ₂ CH ₂ OCH ₃ , 2′-O- (2-methoxyethyl)] (Martin et al. (1995) Helv. Chim. Acta, 78, 486). Other preferred modifications include 2'-methoxy (2'-OCH _3), 2'- including propoxy _{(2'-OCH 2 CH 2 CH} 3) and 2'-fluoro (2'-F). Similarly, modifications can also be made at other positions of the oligonucleotide, in particular at the 3 ′ position of the sugar of the 3 ′ terminal nucleotide and the 5 ′ position of the 5 ′ terminal nucleotide. Oligonucleotides can also have sugar analogs such as cyclobutyl in place of the pentofuranosyl group.

Oligonucleotides can also include nucleobase (often referred to simply as “bases” in the art) modifications or substitutions in addition or alternatively. “Unmodified” or “natural” nucleotides as used herein include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleotides are nucleotides that are found rarely or only transiently in natural nucleic acids, such as hypoxanthine, 6-methyladenine, 5-Me pyrimidine, in particular 5-methylcytosine (5-methyl-2 (Also referred to as' -deoxycytosine, often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentbiosyl HMC and synthetic nucleotides such as 2-aminoadenine, 2- (Methylamino) adenine, 2- (imidazolylalkyl) adenine, 2- (aminoalkylamino) adenine or other hetero-substituted alkyladenine, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8 -Azaguanine, 7-deazaguanine, N ₆ (6-aminohexyl) adenine and 2,6-diaminopurine. Kornberg, A, DNA Replication, WH Freeman & Co., San Francisco, 1980, 75-77; Gebeyehu, G. et al. (1987) Nucl. Acids Res., 15: 4513). “Universal” bases well known in the art, such as inosine, may also be included. 5-Me-C substitution has been shown to increase nucleic acid duplex stability by 0.6-1.2 ° C (Sanghvi, YS, Crooke, ST and Lebleu, B. (eds.), Antisense Research and Applications, CRC Press, Boca Raton, 1993, pages 276-278), currently preferred base substitutions.

  Other modifications of the oligonucleotides of the invention include chemical attachment of one or more components or complexes to the oligonucleotide that enhances the activity or cellular uptake of the oligonucleotide. Such components include, but are not limited to, cholesterol components, cholesteryl components (Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA, 86, 6553), cholic acid (Manoharan et al. (1994) Bioorg. Med Chem. Let., 4, 1053), thioethers such as hexyl-S-tritylthiol (Manoharan et al., (1992) Ann. NY. Acad. Sci., 660, 306; Manoharan et al., (1993) Bioorg. Med. Chem. Let., 3, 2765), thiocholesterol (Oberhauser et al., (1992) Nucl. Acids Res., 20, 533), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 111; Kabanov et al., (1990) FEBS Lett., 259, 327; Svinarchuk et al., (1993) Biochimie, 75, 49), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2 -Di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. (1995) Tetrahedron Lett., 36, 3651; Shea et al. (1990) Nucl. Acid s Res., 18, 3777), polyamine or polyethylene glycol chains (Manoharan et al. (1995) Nucleosides & Nucleotides, 14, 969) or adamantane acetic acid (Manoharan et al. (1995) Tetrahedron Lett., 36, 3651) Contains lipid components. Oligonucleotides containing lipophilic components and methods for preparing such oligonucleotides are well known in the art, eg, US Pat. Nos. 5,138,045, 5,218,105, and 5,459,255.

  Not all positions in a given oligonucleotide need be uniformly modified, in fact more than one of the above modifications is in a single oligonucleotide or in a single nucleotide in an oligonucleotide Can even be incorporated. The invention also includes oligonucleotides that are chimeric oligonucleotides as defined herein above.

  In other embodiments, the nucleic acid molecules of the invention are complexed with other components including, but not limited to, abasic nucleotides, polyethers, polyamines, polyamides, peptides, carbohydrates, lipids or polyhydrocarbon compounds. One skilled in the art understands that these molecules can be linked to any one or more nucleotides, including nucleic acid molecules at some positions of the sugar, base or phosphate group.

  The oligonucleotides used in accordance with the present invention are conveniently and routinely made through well-known techniques of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for such synthesis can also be used; the actual synthesis of the oligonucleotide is well within the ability of one skilled in the art. It is also well known to use similar techniques to prepare other oligonucleotides such as phosphorothioates and alkylated derivatives. Other similar technologies and other commercially available modified amidites and porous glass (CPG) products (such as biotin, fluorescein, acridine or psoralen modified amidites) and / or fluorescent labels, biotinylated or cholesterol modified oligonucleotides, etc. The use of CPG (available from Glen Research, Sterling VA) to synthesize modified oligonucleotides is well known.

  In accordance with the present invention, the use of modifications, such as the use of LNA monomers to enhance strength, specificity and duration of action as well as to broaden the route of administration of oligonucleotides, can be compared with current chemistry such as MOE, ANA, FANA, PS. (See: Recent advances in the medical chemistry of antisense oligonucleotide (2000) Current Opinions in Drug Discovery & Development Vol. 3, No. 2 by Uhlman). This can be achieved by replacement of several monomers in the current oligonucleotide with LNA monomers. The LNA modified oligonucleotide may have a size similar to the parent compound, or may be larger or preferably smaller. It is preferred that such LNA modified oligonucleotides contain less than about 70%, more preferably less than about 60%, most preferably less than about 50% LNA monomers, and their size is from about 5 to It is preferably between 25 nucleotides, more preferably between about 12 and 20 nucleotides.

  Preferred modified oligonucleotide backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methylphosphonates (including 3 'alkylene phosphonates and chiral phosphonates) and other Alkylphosphonates, phosphinates, phosphoramidates (including 3 'aminophosphoramidates and aminoalkyl phosphoramidates), thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters and conventional 3'-5' Boranophosphates with bonds, these 2'-5 'binding analogs, as well as with reversed orientation (adjacent pairs of nucleotide units from 3'-5' to 5'-3 'or 2'-5 (From 'to 5'-2'). Various salts, salt mixtures and free acid forms are also included.

  Representative U.S. patents describing the preparation of phosphorus-containing linkages above include, but are not limited to, U.S. Patents 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019, each incorporated herein by reference. 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,563,253; 5,571,799;

Preferred modified oligonucleotide backbones do not contain phosphorus atoms and are single chain alkyl or cycloalkyl internucleotide linkages, mixed heteroatoms and alkyl or cycloalkyl internucleotide linkages, or one or more single chain heteroatoms or heterocyclic internucleotide linkages Having a skeleton formed by These are morpholino linkages (partially formed from the sugar portion of the nucleotide); siloxane backbone; sulfide, sulfoxide and sulfone backbone; formacetyl and thioformacetyl backbone; methyleneformacetyl and thioformacetyl backbone; alkene-containing backbone; Sulfamate skeletons; methyleneimino and methylenehydrazino skeletons; sulfonate and sulfonamide skeletons; amide skeletons; and those with other N, O, S and CH ₂ mixed constituent moieties.

  Representative U.S. patents describing the preparation of oligonucleotides above include, but are not limited to, U.S. Patents 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; each incorporated herein by reference. 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,623,070;

  In other preferred oligonucleotide mimetics, both the sugar and internucleotide linkage (ie, the backbone) of the nucleotide unit are replaced with new groups. Base units are maintained for hybridization with the appropriate nucleic acid targeting compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar skeleton of the oligonucleotide is replaced with an amide-containing skeleton, in particular an aminoethylglycine skeleton. The nucleotide is retained and attached directly or indirectly to the aza nitrogen atom of the backbone amide moiety. Representative US patents describing the preparation of PNA compounds include, but are not limited to, US Pat. No. 5,539,082, US Pat. No. 5,714,331 and US Pat. No. 5,719,262, each incorporated herein by reference. A further description of PNA compounds can be found in Nielsen et al. (1991) Science 254, 1497-1500.

In other preferred embodiments of the invention, oligonucleotides having a phosphorothioate backbone and oligonucleosides having a heteroatom backbone, in particular —CH ₂ —NH—O—CH ₂ —, —CH ₂ —N (CH ₃ ) —O -CH _2- (known as methylene (methylimino) or MMI skeleton), -CH ₂ -ON (CH ₃ ) -CH _2, CH ₂ N (CH ₃ ) -N (CH ₃ ) CH ₂ -and -ON (CH ₃ ) —CH ₂ —CH ₂ — (wherein the natural phosphodiester backbone is represented as —OPO—CH ₂ — in US Pat. No. 5,489,677 referenced above), and US Pat. No. 5,602,240 referenced above The amide skeleton is preferred. Also preferred are oligonucleotides having the morpholino backbone structure of US Pat. No. 5,034,506, referenced above.

Modified oligonucleotides can include one or more substituted sugar moieties. Preferred oligonucleotides are: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O alkyl-O- One of the alkyls (wherein alkyl, alkenyl and alkynyl may be substituted or unsubstituted from C to CO alkyl, or C ₂ to CO alkenyl and alkynyl) is included in the 2 ′ position. Particularly preferred are O (CH ₂ ) _n O _m CH ₃ , O (CH ₂ ) _n , OCH ₃ , O (CH ₂ ) _n NH ₂ , O (CH ₂ ) nCH ₃ , O (CH ₂ ) _n ONH ₂ and O (CH _2n ON (CH ₂ ) nCH ₃ ) ₂ , where n and m may be from 1 to about 10. Other preferred oligonucleotides are: C to CO, (lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, Cl, Br, CN, CF ₃ , OCF ₃ , SOCH ₃ , SO ₂ CH ₃ , ONO ₂ , NO ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, One of the reporter group, an interfering substance, a group that improves the pharmacokinetic properties of the oligonucleotide, or a group that improves the pharmacodynamic properties of the oligonucleotide and other substituents with similar properties is included in the 2 ′ position. A preferred modification is 2'-methoxyethoxy (also known as 2'-O-CH ₂ CH ₂ OCH ₃ , 2'-O- (2-methoxyethyl) or 2'-MOE) (Martin et al. (1995) Helv Chim. Acta, 78, 486-504) ie alkoxyalkoxy Including. Additional preferred modification includes 2'-dimethylaminooxyethoxy, i.e. _{O (CH 2) 2 ON (} CH 3) 2 group, also known as as 2'-DMAOE described herein the following examples, and 2'-dimethylaminoethoxyethoxy (also known as 2'-O- dimethylamino or 2'-DMAEOE in the art) _{i.e., 2'-O-CH 2 -O} -CH 2 -N (CH 2 ) Including ₂ .

Other preferred modifications include 2'-methoxy (2'-O CH ₃ ), 2'-aminopropoxy (2'-O CH ₂ CH ₂ CH ₂ NH ₂ ) and 2'-fluoro (2'-F). Including. Similar modifications can also be made at other positions on the oligonucleotide, specifically the 3 ′ position of the sugar at the 3 ′ terminal nucleotide or the 5 ′ position of the 2′-5 ′ linked oligonucleotide and the 5 ′ terminal nucleotide. Oligonucleotides can also have sugar analogs such as a cyclobutyl moiety in place of the pentofuranosyl sugar. Representative U.S. patents describing the preparation of such modified sugar structures include, but are not limited to, U.S. Patents 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785, each incorporated herein by reference. 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920.

  Oligonucleotides can also include nucleobases (often referred to in the art as simply “bases”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleotides include 5-methylcytosine (5-Me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, adenine and 6-methyl and other alkyl derivatives of guanine, 2 of adenine and guanine. -Propyl and other alkyl derivatives, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4 -Thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo especially 5-bromide, 5-trifluoromethyl and other 5 -Substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadeni , 7-deazaguanine and 7-deazaadenine and other synthetic and natural nucleotides such as 3-deazaguanine and 3-deazaadenine.

  In addition, nucleotides are disclosed in U.S. Pat. Et al., `` Angewandle Chemie, International Edition '', 1991, 30, 613, Sanghvi, YS, Chapter 15, `` Antisense Research and Applications '', 289-302, Crooke, ST and Lebleu, B. ea. Including those disclosed by CRC Press, 1993. Certain of these nucleotides are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. The 5-methylcytosine substitute has shown an increase in nucleic acid duplex stability between 0.6 and 1.2 ° C. (Sanghvi, YS, Crooke, ST and Lebleu, B., “Antisense Research and Applications”, CRC Press, Boca Raton, 1993, pp. 276-278), a presently preferred substitution, more preferred when combined with 2′-O-methoxyethyl sugar modification.

  Representative U.S. patents describing the preparation of the modified nucleotides described above and other modified nucleotides include, but are not limited to, U.S. Patents 3,687,808, and 4,845,205; 5,130,302; 5,134,066; 5,175,273, each incorporated herein by reference. 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941

  Other modifications of the oligonucleotides of the invention include chemical linking of one or more components or complexes to the oligonucleotide that enhances activity, cellular distribution or uptake of the oligonucleotide into the cell.

  Such components include, but are not limited to, cholesterol components (Letsinger et al. (1989) Proc. Natl. Acad. Sci USA 86, 6553-6556), cholic acid (Manoharan et al. (1994) Bioorg. Med Chem. Let., 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., (1992) Ann. NY. Acad. Sci., 660, 306-309; Manoharan et al., (1993). Bioorg. Med. Chem. Let., 3, 2765-2770), thiocholesterol (Oberhauser et al. (1992) Nucl. Acids Res., 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues ( Kabanov et al. (1990) FEBS Lett., 259, 327-330; Svinarchuk et al. (1993) Biochimie, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethylammonium 1,2-di -O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al. (1995) Tetrahedron Lett., 36, 3651-3654; Shea et al. (1990) Nucl. Acids Res., 18, 3777-3783) , Polyamine or polyethylene glycol chains (Manoharan et al., (1995) Nucleosides & Nucleotides, 14, 969-973), or adamantane acetic acid (Manoharan et al., (1995) Tetrahedron Lett., 36, 3651-3654), palmitic components (Mishra et al. (1995) Biochim. Biophys. Acta, 1264, 229-237) or octadecylamine or hexylamino-carbonyl-toxycholesterol component (Crooke et al., (1996) J. Pharmacol. Exp. Ther., 277, 923-937. ) And other lipid components.

  Representative U.S. patents describing the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patents 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538, each incorporated herein by reference. 5,578,717,5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241,5,391,723; 5,416,203,5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; Includes 5,599,928 and 5,688,941.

  Drug discovery: The compounds of the invention can also be applied in the fields of drug discovery and target validation. The present invention relates to the use of the compounds identified herein and preferred target segments in drug discovery efforts to elucidate the relationship that exists between a sirtuin 1 (SIRT1) polynucleotide and a disease state, phenotype or condition. Include. These methods involve contacting a sample, tissue, cell, or organism with a compound of the invention, treating nucleic acid or protein levels of a sirtuin 1 (SIRT1) polynucleotide and / or associated phenotype or chemical endpoint after treatment. Detection or modulation of a sirtuin 1 (SIRT1) polynucleotide, comprising measuring at certain times, and optionally comparing the measured value to an untreated sample or a sample treated with a further compound of the invention. These methods are used to determine the function of an unknown gene for the target validation process, or to validate a particular gene product as a target for the treatment or prevention of a particular disease, condition or phenotype. It can be performed in parallel or in combination with other experiments to determine.

Assessment of up-regulation or suppression of gene expression Transport of exogenous nucleic acid into a host cell or organism can be assessed by directly detecting the nucleic acid in the cell or organism. Such detection can be accomplished by several methods well known in the art. For example, the presence of exogenous nucleic acid can be detected by Southern blot or polymerase chain reaction (PCR) techniques using primers that specifically amplify the nucleotide sequence associated with the nucleic acid. The expression of the exogenous nucleic acid can also be measured using conventional methods including gene expression analysis. For example, mRNA produced from exogenous nucleic acid can be detected and quantified using Northern blot and reverse transcription PCR (RT-PCR).

  RNA expression from exogenous nucleic acid can also be detected by measuring enzyme activity or reporter protein activity. For example, antisense-modulating activity can be measured indirectly as a decrease or increase in target nucleic acid expression as an indication that the exogenous nucleic acid is producing effector RNA. Primers can be designed based on sequence conservation and can be used to amplify the coding region of the target gene. Any translational or non-coding region can be used, but the coding region that is most highly expressed from each gene initially can be used to construct model control genes. Each regulatory gene is assembled by inserting each coding region between the reporter coding region and its poly (A) signal. These plasmids produce mRNA with a reporter gene in the upstream portion of the gene and a potential RNAi target in the 3 ′ non-coding region. The effect of individual antisense oligonucleotides is assessed by modulation of the reporter gene. Reporter genes useful in the methods of the present invention include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), Green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamicin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinotricin, puromycin and tetracycline are available. Methods for measuring reporter gene modulation are well known in the art, including but not limited to fluorometric methods (e.g., fluorescence spectroscopy, fluorescence-excited cell sorting (FACS), fluorescence microscopy), Includes antibiotic resistance determination.

Kits, Research Reagents, Diagnosis and Treatment The compounds of the present invention may be utilized for diagnosis, treatment and prevention and as components of research reagents and kits. In addition, antisense oligonucleotides that can suppress gene expression with precise specificity can be used by those skilled in the art to elucidate the function of a particular gene or to distinguish functions among various members of a biological pathway. Often used.

  For use in kits and diagnostics as well as various biological systems, the compounds of the present invention are portions of genes that are expressed in cells and tissues, either alone or in combination with other compounds or therapeutic agents. It is useful as a tool in differential and / or combinatorial analysis to elucidate the mode of expression of target or global complements.

  As used herein, the term “biological system” or “system” refers to any organism, cell, cell culture, or tissue that expresses or is capable of expressing a product of a sirtuin 1 (SIRT1) gene. Defined. These include, but are not limited to, humans, transgenic animals, cells, cell cultures, tissues, xenografts, transplants and combinations thereof.

  As a non-limiting example, the expression pattern in a cell or tissue treated with one or more antisense compounds is compared to a control cell or tissue not treated with the antisense compound, and the resulting pattern is For example, differential levels of gene expression are analyzed because they relate to disease relevance, signal pathways, subcellular localization, expression levels, size, structure or function of the gene being tested. These analyzes can be performed on stimulated or unstimulated cells in the presence or absence of other compounds that affect the mode of expression.

  Examples of gene expression analysis methods well known in the art include DNA arrays or microarrays (Brazma and Vilo, (2000) FEBS Lett., 480, 17-24; Celis et al. (2000) FEBS Lett., 480, 2 to 16), SAGE (continuous analysis of gene expression) (Madden et al. (2000) Drug Discov. Today, 5, 415-425), READS (restriction enzyme amplification of digested cDNA) (Prashar and Weissman, (1999) Methods Enzymol) 303, 258-72), TOGA (total gene expression analysis) (Sutcliffe et al. (2000) Proc. Natl. Acad. Sci. USA, 97, 1976-81), protein arrays and proteomics (Celis et al. (2000) FEBS Lett., 480, 2-16; Jungblut et al., Electrophoresis, 1999, 20, 210-10), expressed sequence tag (EST) sequencing (Celis et al., FEBS Lett., 2000, 480, 2-16) Larsson et al., J. Biotechnol, 2000, 80, 143-57), subtractive RNA fingerprinting (SuRF) (Fuchs et al., (2000) Anal. Biochem., 286, 91-98; Larson et al., (2000) Cytometry. , 41, 203 ~ 208), subtractive cloning, differential display (DD) (Jurecic and Belmont, (2000) Curr. Opin. Microbiol., 3, 316-21), comparative genomic hybridization (Carulli et al., (1998) J. Cell Biochem. Suppl, 31, 286-96), FISH (fluorescence in situ hybridization) technology (Going and Gusterson, (1999) Eur. J. Cancer, 35, 1895-904) and mass spectrometry (To, Comb. (2000) Chem. High Throughput Screen, 3, 235-41).

  The compounds of the present invention are useful for research and diagnosis because these compounds hybridize to nucleic acids encoding sirtuin 1 (SIRT1). For example, oligonucleotides that hybridize as effective sirtuin 1 (SIRT1) modulators under efficiency and conditions as disclosed herein are primers or probes that are effective under conditions favorable for gene amplification or detection, respectively. It is. These primers or probes are used in methods that require specific detection of a nucleic acid molecule encoding sirtuin 1 (SIRT1) and in the amplification of said nucleic acid molecule for detection or use in further studies of sirtuin 1 (SIRT1). Useful. Hybridization of a nucleic acid encoding sirtuin 1 (SIRT1) with the antisense oligonucleotides of the present invention, in particular primers and probes, can be detected by means well known in the art. Such means may include conjugation of the enzyme to the oligonucleotide, radiolabeling of the oligonucleotide, or any other suitable detection means. Kits that use such detection means to detect the level of sirtuin 1 (SIRT1) in a sample can also be prepared.

  Antisense specificity and sensitivity are exploited by those skilled in the art for therapeutic use. Antisense compounds are used as therapeutic ingredients in the treatment of animal pathologies, including humans. Antisense oligonucleotide drugs have been safely and effectively administered to humans and numerous clinical trials are currently underway. Thus, it has been established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in therapeutic regimes for the treatment of cells, tissues and animals, particularly humans.

  For therapy, an animal (preferably a human) suspected of having a disease or disorder that can be treated by modulating the expression of a sirtuin 1 (SIRT1) polynucleotide is treated by administering an antisense compound according to the present invention. The For example, in one non-limiting embodiment, the method includes administering a therapeutically effective amount of a sirtuin 1 (SIRT1) modulator to an animal in need of treatment. The sirtuin 1 (SIRT1) modulator of the present invention effectively regulates the activity of the sirtuin 1 (SIRT1) protein or regulates the expression of the sirtuin 1 (SIRT1) protein. In one embodiment, the activity or expression of sirtuin 1 (SIRT1) in an animal is suppressed by about 10% compared to the control. Preferably, the activity or expression of sirtuin 1 (SIRT1) in an animal is suppressed by about 30%. More preferably, the activity or expression of sirtuin 1 (SIRT1) in the animal is suppressed by 50% or more. Thus, the oligomeric compound has at least 10%, at least 50%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% expression of sirtuin 1 (SIRT1) mRNA relative to the control. Adjust at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100%.

  In one embodiment, the activity or expression of sirtuin 1 (SIRT1) and / or the animal is increased by at least about 10% compared to the control. Preferably the activity or expression of sirtuin 1 (SIRT1) in the animal is increased by about 30%. More preferably, the activity or expression of sirtuin 1 (SIRT1) in the animal is increased by about 50% or more. Thus, the oligomeric compound has at least 10%, at least 50%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% expression of sirtuin 1 (SIRT1) mRNA relative to the control. Adjust at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100%.

  For example, decreased expression of sirtuin 1 (SIRT1) can be measured in animal serum, blood, adipose tissue, liver or any other body fluid, tissue or organ. Preferably, the cells contained in said body fluid, tissue or organ to be analyzed contain a nucleic acid molecule encoding a sirtuin 1 (SIRT1) peptide and / or a sirtuin 1 (SIRT1) protein itself.

  The compounds of the present invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. The use of the compounds and methods of the invention is also useful prophylactically.

Conjugates Other modifications of the oligonucleotides of the invention include chemical linking of one or more components or complexes to the oligonucleotide that enhances the activity, cellular distribution or cellular uptake of the oligonucleotide. These components or complexes can include complex groups covalently linked to functional groups such as primary or secondary hydroxyl groups. The conjugate groups of the present invention include interfering substances, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of the oligomer, and groups that enhance the pharmacokinetic properties of the oligomer. Typical complex groups include cholesterol, lipids, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and dye. Groups that enhance pharmacodynamic properties in the context of the present invention include groups that improve uptake, enhance resistance to degradation, and / or enhance sequence specific hybridization with a target nucleic acid. Groups that enhance pharmacokinetic properties in the context of the present invention include groups that improve the uptake, distribution, metabolism or excretion of the compounds of the present invention. Exemplary conjugate groups are disclosed in International Patent Application PCT / US92 / 09196 and US Pat. No. 6,287,860, filed Oct. 23, 1992, which are incorporated herein by reference. Complex components include but are not limited to cholesterol components, cholic acid, thioethers such as hexyl-S-tritylthiol, thiocholesterol, aliphatic chains such as dodecanediol or undecyl residues, phospholipids such as di-hexadecyl-rac -Glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, polyamine or polyethylene glycol chain, or adamantaneacetic acid, palmityl component, or octadecylamine or hexylamino-carbonyl-oxycholesterol component Contains lipid components such as. The oligonucleotides of the present invention are active drug substances such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-planoprofen, capprofen, dansylsarcosine, 2,3,5 -Triiodobenzoic acid, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diacepine, indomethicin, barbituric acid,
It can also be complexed with cephalosporins, sulfa drugs, antidiabetics, antibacterials or antibiotics.

  Representative U.S. patents describing the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. Patents 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5258

Formulations Compounds of the invention may be mixed with other molecules, molecular structures or compounds, eg, as liposomes, receptor-target molecules, oral, rectal, topical or other formulations, to aid in uptake, distribution and / or absorption. And can be mixed, encapsulated, complexed or otherwise attached. Representative U.S. patents describing the preparation of such formulations that assist in uptake, distribution and / or absorption include, but are not limited to, U.S. Patents 5,108,921; 5,354,844; 5,416,016; 5,459,127, each of which is incorporated herein by reference. ; 5,521,291; 5,543,165; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; 5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and Includes 5,595,756.

  Although antisense oligonucleotides need not be administered in conjunction with a vector to regulate target expression and / or function, embodiments of the invention include promoters, hybrid promoter gene sequences, and strong constitutive promoters. It relates to expression vector constructs for the expression of antisense oligonucleotides having activity or promoter activity that can be induced if desired.

  In one embodiment, the invention practice includes administering at least one of the above-described antisense oligonucleotides with a suitable nucleic acid delivery system. In one embodiment, the system includes a non-viral vector operably linked to the polynucleotide. Examples of such non-viral vectors include oligonucleotides alone (eg, any one or more of SEQ ID NOs: 6-47) or combinations with appropriate protein, polysaccharide or lipid formulations.

  Additionally suitable nucleic acid delivery systems include viral vectors, typically at least of adenovirus, adenovirus associated virus (AAV), helper-dependent adenovirus, retrovirus or Sendai virus (HVJ) -liposome complex. Contains sequences from one. Preferably, the viral vector comprises a strong eukaryotic promoter operably linked to the polynucleotide, such as the cytomegalovirus (CMV) promoter.

  Additional preferred vectors include viral vectors, fusion proteins and chemical complexes. Retroviral vectors include Moloney murine leukemia virus and HIV-based viruses. One preferred HIV-based viral vector comprises at least two vectors in which the gag and pol genes are derived from the HIV genome and the env gene is derived from another virus. DNA viral vectors are preferred. These vectors include pox vectors such as orthopox or tripox vectors, herpesvirus vectors such as herpes simplex virus I (HSV) vectors [Geller, AI et al. (1995) J. Neurochem, 64: 487; Lim, F In DNA Cloning: Mammalian Systems, D. Glover (ed.) (Oxford Univ. Press, Oxford England) (1995); Geller, AI et al. (1993) Proc Natl. Acad. Sci: USA: 90 7603; Geller, AI et al. (1990) Proc Natl. Acad. Sci USA: 87: 1149], adenoviral vectors [LeGal LaSalle et al. Science 259: 988 (1993); Davidson et al. (1993) Nat. Genet. 3: 219; Yang et al. (1995) J. Virol. 69: 2004] and adeno-associated viral vectors [Kaplitt, MG et al. (1994) Nat. Genet. 8: 148].

  The antisense compounds of the present invention can be any pharmaceutically acceptable salt, ester or salt of such an ester, or a metabolite or residue thereof that is biologically active upon administration to an animal, including humans (directly). Or any other compound that can be provided).

  The term “pharmaceutically acceptable salt” refers to a physiologically and pharmaceutically acceptable salt of a compound of the invention: that is, an undesirable toxicological substance that retains the desired biological activity of the parent compound. It means salt that does not give any effect. For oligonucleotides, preferred examples of pharmaceutically acceptable salts and their uses are further described in US Pat. No. 6,287,860, incorporated herein by reference.

  The invention also includes pharmaceutical compositions and formulations comprising the antisense compounds of the invention. The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the place to be treated. Administration is topical (including ophthalmic and mucosal delivery including vagina and rectum), pulmonary, eg by inhalation or insufflation of powders or aerosols, including by nebulizer, intratracheal, intranasal, epithelial and transdermal ), Oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, eg intrathecal or intraventricular administration. Oligonucleotides with at least one 2′-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, solutions, powders or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves, etc. may also be useful.

  The pharmaceutical formulations of the present invention, which can conveniently be present in unit dosage form, can be prepared by conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredient with the pharmaceutical carrier (s) or excipient (s). In general, the formulations are prepared by associating the active ingredient with a homogeneous and essentially liquid carrier or finely divided solid carrier or both, and then, if necessary, shaping the product.

  The compositions of the present invention may be formulated into any of a number of possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories and enemas. The compositions of the invention can also be formulated as aqueous suspensions, non-aqueous or mixed media. Aqueous suspensions can further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers.

  The pharmaceutical composition of the present invention includes, but is not limited to, liquids, emulsions, foams and liposome-containing preparations. The pharmaceutical compositions and formulations of the present invention may contain one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.

  Typically, an emulsion is a heterogeneous system in which one solution is dispersed in the form of droplets that are usually larger than 0.1 μm in diameter. Emulsions can contain additional components in addition to the dispersed phase, and the active agent can be present as a solution in the aqueous phase, in the oil phase or in the separate phase as such. Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in US Pat. No. 6,287,860.

  The preparation of the present invention includes a liposome preparation. The term “liposome” as used in the present invention means a vesicle composed of amphiphilic lipids arranged in one or more bilayers of spheres. Liposomes are unilamellar or multilamellar vehicles that have a membrane formed from an aqueous interior containing the lipophilic substance and the composition to be delivered. Cationic liposomes are positively charged liposomes that are thought to interact with negatively charged DNA molecules to form stable complexes. Liposomes that are pH sensitive or negatively charged are believed to trap DNA rather than complex. Both cationic and non-cationic liposomes have been used to deliver DNA to cells.

  Liposomes also include “sterically stabilized” liposomes, and the term as used herein means liposomes that contain one or more specialized lipids. When incorporated into liposomes, these specialized lipids give rise to liposomes that have an enhanced circulation lifetime compared to liposomes that lack such specialized lipids. Examples of sterically stabilized liposomes include one or more hydrophilic polymers, such as a portion of the liposome's vehicle-forming lipid portion comprising one or more glycolipids, or a polyethylene glycol (PEG) moiety. It has been derivatized with. Liposomes and their uses are further described in US Pat. No. 6,287,860.

  The pharmaceutical formulations and compositions of the present invention may further comprise a surfactant. The use of surfactants in pharmaceutical products, formulations and emulsions is well known in the art. Surfactants and their use are further described in US Pat. No. 6,287,860, incorporated herein by reference.

  In one embodiment, the present invention uses various penetration enhancers to provide efficient delivery of nucleic acids, specifically oligonucleotides. In addition to assisting diffusion of non-lipophilic drugs across the cell membrane, penetration enhancers also promote the permeability of lipophilic drugs. Penetration enhancers can be classified as belonging to one of five broad classes: surfactants, fatty acids, bile salts, chelating agents and non-chelating non-surfactants. Penetration enhancers and their uses are further described in US Pat. No. 6,287,860, which is incorporated herein by reference.

  One skilled in the art understands that formulations are routinely designed according to their intended use, ie, route of administration.

  Preferred formulations for topical administration include those in which the oligonucleotides of the invention are mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelators and surfactants. Preferred lipids and liposomes are neutral (e.g. dioleoyl-phosphatidyl DOPE ethanolamine, dimyristoyl phosphatidylcholine DMPC, distearoyl phosphatidylcholine) negative (e.g. dimyristoyl phosphatidylglycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoyl- Phosphatidylethanolamine DOTMA).

  For topical or other administration, the oligonucleotides of the invention can be included in liposomes or can be complexed with them, specifically cationic liposomes. Alternatively, the oligonucleotide can be complexed in a lipid, in particular a cationic lipid. Preferred fatty acids and esters, pharmaceutically acceptable salts thereof and their uses are further described in US Pat. No. 6,287,860.

  Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in aqueous or non-aqueous solutions, capsules, gel capsules, sachets, tablets or mini-tablets. Including. Thickeners, flavoring agents, diluents, emulsifiers, dispersion aids or binders may be desirable. A preferred oral formulation is one in which the oligonucleotide of the invention is administered with one or more penetration enhancing surfactants and chelating agents. Preferred surfactants include fatty acids and / or esters or salts thereof, bile acids and / or salts thereof. Preferred bile acids / salts and fatty acids and their uses are further described in US Pat. No. 6,287,860, which is incorporated herein by reference. Likewise preferred are penetration enhancer combinations, for example fatty acids / salts in combination with bile acids / salts. A particularly preferred combination is lauric acid sodium salt, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Oligonucleotides of the invention can be delivered orally conjugated to form granular forms or micro- or nanoparticles containing spray-dried particles. Oligonucleotide conjugates and their uses are further described in US Pat. No. 6,287,860, which is incorporated herein by reference.

  Compositions and formulations for parenteral, intrathecal or intracerebroventricular administration include buffers, diluents and other suitable additives, including but not limited to penetration enhancers, carrier compounds and other pharmaceutically acceptable A sterile aqueous solution, which may also contain carriers or excipients).

Certain embodiments of the invention provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents that act by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, maphosphamide, ifosfamide, cytosine arabinoside, bischloroethyl-nitrosourea, Busulfan, Mitomycin C, Actinomycin D, Mitromycin, Prednisone, Hydroxypregesterone, Testosterone, Tamoxifen, Dacarbacin, Procarbazine, Hexamethylmelamine, Pentamethylmelamine, Mitoxantrone, Amsacrine, Chlorambucil, Methylcyclohexylnitrosourea, Nitrogen mustard , Melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-aza Thidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclo-phosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine And cancer chemotherapeutic agents such as etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbesterol (DES). When used with the compounds of the invention, such chemotherapeutic agents are individually (e.g., 5-FU and oligonucleotides), sequentially (e.g., for a period of time, 5-FU and oligonucleotide followed by MTX and Oligonucleotides), or in combination with one or more other such chemotherapeutic agents (eg, 5-FU, MTX and oligonucleotide or 5-FU, radiation therapy and oligonucleotide). Compositions of the invention also include anti-inflammatory agents including but not limited to non-steroidal anti-inflammatory agents and corticosteroids, and anti-viral agents including but not limited to ribibivirin, vidarabine, acyclovir and ganciclovir. Can be combined. Combinations of antisense compounds and other non-antisense agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

  In other related embodiments, the composition of the invention comprises one or more antisense compounds targeted to a first nucleic acid, particularly an oligonucleotide, and one or more targeted to a second nucleic acid target. Additional antisense compounds can be included. For example, the first target can be a specific antisense sequence of sirtuin 1 (SIRT1) and the second target can be a region derived from other nucleotide sequences. Alternatively, the compositions of the invention can contain two or more antisense compounds targeted to different regions of the same sirtuin 1 (SIRT1) nucleic acid target. Many examples of antisense compounds are exemplified herein and others can be selected from among suitable compounds well known in the art. Two or more combined compounds may be used together or sequentially.

Dosing The formulation of therapeutic compositions and their subsequent administration (dosing) is considered to be within the skill of the artisan. Dosing will depend on the severity and responsiveness of the condition being treated in the course of treatment, which lasts for days to months or until treatment is effective or a reduction in condition is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimal dosages may vary depending on the relative potency of the individual oligonucleotides and can generally be estimated based on the EC50 found to be effective in in vitro and in vivo animal models. In general, dosage is 0.01 μg to 100 g per kg of body weight, and may be daily, weekly, monthly or once or several times a year or even once every 2 to 20 years . One of ordinary skill in the art can readily estimate repetition rates for dosing based on measured residence times and drug concentrations in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient receive maintenance therapy to prevent recurrence of the condition, where the oligonucleotide is 0.01 μg to 100 g per kg body weight, once a day or It is administered in the range of multiple doses once every 20 years.

  While various embodiments of the present invention have been described above, it should be understood that it is represented by way of example only and not limitation. Numerous modifications to the disclosed embodiments can be made according to the disclosure herein without departing from the spirit and scope of the invention. Accordingly, the breadth and scope of the present invention should not be limited by any of the above-described embodiments.

  All documents described herein are hereby incorporated by reference. All publications and patent documents cited in this application are hereby incorporated by reference for all purposes to the same extent as if each individual publication or patent document was individually described. By citation of various references in this document, Applicants do not admit any particular reference is "prior art" to Applicants' invention. Embodiments of the inventive compositions and methods are illustrated in the following examples.

(Example)
The following non-limiting examples can be used to illustrate selected embodiments of the present invention. Variations in component proportions shown and substitutions in the components will be apparent to those skilled in the art and are understood to be within the scope of embodiments of the present invention.

(Example 1)
Design of antisense oligonucleotides specific for antisense strands and / or sense strand nucleic acid molecules of sirtuin 1 (SIRT1) polynucleotides As indicated above, the terms "oligonucleotide specific for" or "oligonucleotide target" are ( By i) an oligonucleotide having a sequence capable of forming a stable complex with a portion of the target gene, or (ii) a sequence capable of forming a stable duplex with a portion of the mRNA transcript of the target gene.

  Selection of appropriate oligonucleotides is facilitated by using computer programs that automatically compare nucleic acid sequences and show regions of identity or homology. Such a program is used to compare nucleic acid sequences obtained by searching databases such as Genbank or by sequencing PCR products. Comparison of nucleic acid sequences from different species allows for the selection of nucleic acid sequences that exhibit an appropriate degree of identity between the species. For genes that have not been sequenced, Southern blots are performed to allow determination of the degree of identity between genes in the target species and other species. By performing Southern blots with varying degrees of stringency, it is possible to obtain approximate measures of identity, as is well known in the art. These procedures allow for the selection of oligonucleotides that exhibit a high degree of complementarity to the target nucleic acid sequence in the subject being controlled and a low degree of complementarity to the corresponding nucleic acid sequence in other species. Those skilled in the art will appreciate that there is considerable tolerance in selecting the appropriate region of a gene for use in the present invention.

  Antisense compounds are those where binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid resulting in modulation of function and / or activity and under conditions where specific binding is desired (i.e., in vivo assays or therapeutics). A degree sufficient to avoid non-specific binding of antisense compounds to non-target nucleic acid sequences under physiological conditions in the case of treatment and conditions under which the assay is performed in the case of in vitro assays). “Can specifically hybridize” when there is complementarity.

  The hybridization properties of the oligonucleotides described herein can be determined by one or more in vitro assays well known in the art. For example, the properties of the oligonucleotides described herein can be obtained by measuring the binding strength between the target natural antisense and the potential drug molecule using a melting curve assay.

  The strength of binding between a target natural antisense and a potential drug molecule (`` molecule '') can be estimated using any established method for measuring the strength of intermolecular interactions, such as a melting curve assay. it can.

  Melting curve assays determine the temperature at which a rapid transition from double-stranded conformation to single-stranded conformation occurs with respect to the natural antisense / “molecular” complex. This temperature is widely accepted as a reliable measure of the interaction strength between two molecules.

  Melting curve assays can be performed using cDNA copies of actual natural antisense RNA molecules or synthetic DNA or RNA nucleotides corresponding to the binding site of the “molecule”. Multiple kits containing all the reagents necessary to perform this assay are available (eg, Applied Biosystems Inc. MeltDoctor kit). These kits include a suitable buffer containing one of the double stranded DNA (dsDNA) binding dyes (ABI HRM dyes, SYBR Green, SYTO, etc.). The properties of dsDNA dyes are those that emit little fluorescence in the free form, but are highly fluorescent when bound to dsDNA.

  To perform the assay, the cDNA or corresponding oligonucleotide is mixed with the “molecule” at a concentration determined by the detailed manufacturer's protocol. The mixture is heated to 95 ° C. to dissociate all previously formed dsDNA complexes and then slowly cooled to room temperature or other low temperature as determined by the kit manufacturer to anneal the DNA molecules. The newly formed complex is then slowly heated to 95 ° C. simultaneously while continuously collecting data on the amount of fluorescence produced by the reaction. The fluorescence intensity is inversely proportional to the amount of dsDNA present in the reaction. Data can be collected using a real-time PCR instrument that fits the kit (eg, ABI's StepOne Plus Real Time PCR System or LightTyper instrument, Roche Diagnostics, Lewes, UK).

  Melting peaks are measured using the appropriate software (e.g., LightTyper (Roche) or SDS Dissociation Curve, ABI) and the negative derivative of fluorescence with respect to temperature (-d (fluorescence) / dT) y-axis) over temperature (x Plot by plotting against (axis). Data is analyzed to identify the temperature of rapid transition from dsDNA complexes to single-stranded molecules. This temperature is called Tm and is directly proportional to the strength of the interaction between the two molecules. Typically Tm is above 40 ° C.

(Example 2)
Sirtuin 1 (SIRT1) polynucleotide regulatory materials and methods Treatment of HepG2 cells with antisense oligonucleotides
Growth medium (MEM / EBSS (Hyclone cat # SH30024 or Mediatech cat # MT-10-010-CV) + 10% FBS (Mediatech cat # MT35-011-CV) from ATCC (cat # HB-8065) + Growed in penicillin / streptomycin (Mediatech cat # MT30-002-CI)) at 37 ° C., 5% CO ₂ . The day before the experiment, cells were replated in 6-well plates at a density of 0.5 × 10 ⁵ cells per ml and incubated at 37 ° C., 5% CO ₂ . On the day of the experiment, the medium in the 6-well plate was replaced with 1.5 ml / well fresh growth medium. All antisense oligonucleotides were diluted to a concentration of 20 μM. 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco cat # 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen cat # 11668019) for 20 minutes at room temperature and added to each well of a 6-well plate containing HepG2 cells. A similar mixture containing 2 μl of water instead of the oligonucleotide solution was used for mock transfection controls. After 3-18 hours incubation at 37 ° C., 5% CO ₂ , the medium was replaced with fresh growth medium. 72 hours after addition of antisense oligonucleotide, cells were re-administered as described above. Forty-eight hours after addition of the antisense oligonucleotide, the medium is removed and the RNA is removed from the cells using Promega's SV Total RNA Isolation System (cat # Z3105) or Qiagen's RNeasy Total RNA Isolation kit (cat # 74181). Extracted using according to the procedure. 600 ng RNA was added to a reverse transcription reaction performed using a Verso cDNA kit from Thermo Scientific (cat # AB1453B) as described in the manufacturer's protocol. CDNA from this reverse transcription reaction was used to monitor gene expression by real-time PCR using the ABI Taqman gene Expression Mix (cat # 4369510) and primers / probes designed by ABI. The following PCR cycles were used: 2 cycles at 50 ° C, 10 minutes at 95 ° C, 40 cycles (95 ° C for 15 seconds, 60 ° C for 1 minute), StepOne Plus Real Time PCR Machine (Applied Biosystems Biosystems Taqman Gene Expression) Assay: Hs00202021_m1 by Applied Biosystems Inc., Foster City CA). Fold changes in gene expression after treatment with antisense oligonucleotides were calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.

result:
Real-time PCR results show that the level of SIRT1 mRNA in HepG2 cells was significantly increased 48 hours after treatment with several antisense oligonucleotides against SIRT1 antisense CV396200 (FIGS. 2, 3A).

  Real-time PCR results indicate that the level of SIRT1 mRNA in HepG2 cells was significantly increased in one of the oligonucleotides designed for SIRT1 antisense CV396200. The bars labeled CUR-1230, CUR-1231, CUR-1232 and CUR-1230 correspond to SEQ ID NOs: 32-35 (FIG. 6).

  Real-time PCR results indicate that the level of SIRT1 mRNA in HepG2 cells was significantly increased in two of the oligonucleotides designed for SIRT1 antisense CV428275. The bars labeled CUR-1302, CUR-1304, CUR-1303 and CUR-1305 correspond to SEQ ID NOs: 36-39 (FIG. 7).

  The results show a significant increase in the level of SIRT1 mRNA in HepG2 cells 48 hours after treatment with one of the oligonucleotides designed against SIRT antisense BE717453. The bars labeled CUR-1264, CUR1265 and CUR-1266 correspond to SEQ ID NOs 40-42, respectively (FIG. 8).

  The results show that the level of SIRT1 mRNA in HepG2 cells was significantly increased after 48 hours of treatment with 3 of the oligonucleotides designed against SIRT1 antisense AV718812. The bars labeled CUR-1294, CUR-1297, CUR-1295, CUR-1296 and CUR-1298 correspond to SEQ ID NOs 43-47, respectively (FIG. 9).

Treatment of antisense oligonucleotide Vero76 cells
ATCC (cat # CRL-1587) -derived Vero76 cells in growth medium (MEM / EBSS (Hyclone cat # SH30024 or Mediatech cat # MT-10-010-CV) + 10% FBS (Mediatech cat # MT35-011-CV) + Growed in penicillin / streptomycin (Mediatech cat # MT30-002-CI)) at 37 ° C., 5% CO ₂ . The day before the experiment, cells were replated at a density of 1.5 × 10 ⁵ per ml in 6-well plates and incubated at 37 ° C., 5% CO ₂ . On the day of the experiment, the medium in the 6-well plate was replaced with fresh growth medium. All antisense oligonucleotides were diluted with water to a concentration of 20 μM. 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco cat # 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen cat # 11668019) for 20 minutes at room temperature and added to each well of a 6-well plate containing Vero76 cells. A similar mixture containing 2 μl of water instead of the oligonucleotide solution was used for mock transfection controls. After 3-18 hours incubation at 37 ° C., 5% CO ₂ , the medium was replaced with fresh growth medium. Forty-eight hours after addition of the antisense oligonucleotide, the medium is removed and the RNA is removed from the cells using Promega's SV Total RNA Isolation System (cat # Z3105) or Qiagen's RNeasy Total RNA Isolation kit (cat # 74181). Extracted using according to the procedure. 600 ng RNA was added to a reverse transcription reaction performed using a Verso cDNA kit from Thermo Scientific (cat # AB1453B) as described in the manufacturer's protocol. Real-time cDNA from this reverse transcription reaction using primers / probes designed by ABI Taqman Gene Expression Mix (cat # 4369510) and ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00202021_m1, Applied Biosystems Inc., Foster City CA) Used to monitor gene expression by PCR. The following PCR cycles were used: 2 cycles at 50 ° C, 10 minutes at 95 ° C, 40 cycles (95 ° C for 15 seconds, 60 ° C for 1 minute), using StepOne Plus Real Time PCR Machine (Applied Biosystems). The following PCR cycles were used: 2 cycles at 50 ° C, 10 minutes at 95 ° C, 40 cycles (95 ° C for 15 seconds, 60 ° C for 1 minute), using the Mx4000 thermal cycler (Stratagene). Fold changes in gene expression after treatment with antisense oligonucleotides were calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.

result:
Real-time PCR results indicate that the level of SIRT1 mRNA in Vero cells is significantly increased 48 hours after treatment with antisense oligonucleotide to SIRT1 antisense CV396200 (FIG. 3B).

(Example 3)
Regulation of SIRT1 gene expression Materials and methods Treatment of HepG2 cells with naked antisense oligonucleotides
HepG2 cells from ATCC (cat # HB-8065) in growth medium (MEM / EBSS (Hyclone cat # SH30024 or Mediatech cat # MT-10-010-CV) + 10% FBS (Mediatech cat # MT35-011-CV) + Grown in penicillin / streptomycin (Mediatech cat # MT30-002-CI)) at 37 ° C., 5% CO ₂ . The day before the experiment, the cells were replated at a density of 0.5 × 10 ⁵ per ml in 6-well plates and incubated at 37 ° C., 5% CO ₂ . On the day of the experiment, the medium in the 6-well plate was replaced with 1.5 ml / well fresh growth medium. All antisense oligonucleotides were diluted with water to a concentration of 20 μM. 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco cat # 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen cat # 11668019) for 20 minutes at room temperature and added to each well of a 6-well plate containing HepG2 cells. A similar mixture containing 2 μl of water instead of the oligonucleotide solution was used for mock transfection controls. After 3-18 hours incubation at 37 ° C., 5% CO ₂ , the medium was changed to fresh growth medium. Cells were re-dosed as described above 72 hours after addition of antisense oligonucleotide. Media was removed 48 hours after the second dose of antisense oligonucleotide and RNA was removed from cells using Promega's SV Total RNA Isolation System (cat # Z3105) or Qiagen's RNeasy Total RNA Isolation kit (cat # 74181). Extracted using according to manufacturer's instructions. 600 ng RNA was added to a reverse transcription reaction performed using a Verso cDNA kit from Thermo Scientific (cat # AB1453B) as described in the manufacturer's protocol. CDNA from this reverse transcription reaction is used with primers / probes designed by ABI Taqman Gene Expression Mix (cat # 4369510) and ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00202021_m1, Applied Biosystems Inc., Foster City CA) Used to monitor gene expression by real-time PCR. The following PCR cycles were used: 2 cycles at 50 ° C, 10 minutes at 95 ° C, 40 cycles (95 ° C for 15 seconds, 60 ° C for 1 minute), using StepOne Plus Real Time PCR Machine (Applied Biosystems). Fold changes in gene expression after treatment with antisense oligonucleotides were calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.

SIRT1 Natural Antisense CV396200 Exon 4: Primer and Probe Forward Primer Sequence CCATCAGACGACATCCCTTAACAAA (SEQ ID NO: 49) Custom Designed for AACTGGAGCTGGGGTGTCTGTTTCA (SEQ ID NO: 48)
Reverse primer sequence ACATTATATCATAGCTCCTAAAGGAGATGCA (SEQ ID NO: 50)
Reporter sequence CAGAGTTTCAATTCCC (SEQ ID NO: 51)
result:
The results show that the level of SIRT1 mRNA in HepG2 cells is significantly increased after 48 hours of treatment with one of the siRNAs designed for sirtas (sirtas_5, P = 0.01). The level of sirtas RNA in the same sample was significantly reduced after treatment with sirtas_5, but had no effect on the level of SIRT1 mRNA (FIG. 1B) and did not change after treatment with sirtas_6 and sirtas_7 . sirtas_5, sirtas_6 and sirtas_7 correspond to SEQ ID NOs: 29, 30 and 31, respectively.

Treatment of primary monkey hepatocytes Primary monkey hepatocytes were introduced into cultures by RxGen Inc. and seeded in 6-well plates. They were treated with oligonucleotides as follows. Medium in 6-well plates supplemented with 5% FBS, 50 U / ml penicillin and 50 ug / ml streptomycin, 4 ug / ml insulin, 1 uM dexamethasone, 10 ug / ml fundin (InVivogen, San Diego CA) William's Medium The fresh growth medium consisting of E (Sigma cat # W4128) was replaced. All antisense oligonucleotides were diluted to a concentration of 20 μM. 2 μl of this solution was incubated with 400 μl of Opti-MEM medium (Gibco cat # 31985-070) and 4 μl of Lipofectamine 2000 (Invitrogen cat # 11668019) for 20 minutes at room temperature and added to each well of a 6-well plate containing cells. A similar mixture containing 2 μl of water instead of the oligonucleotide solution was used for mock transfection controls. After 3-18 hours incubation at 37 ° C., 5% CO ₂ , the medium was replaced with fresh growth medium. Forty-eight hours after addition of the antisense oligonucleotide, the medium is removed and the RNA is removed from the cells using Promega's SV Total RNA Isolation System (cat # Z3105) or RNeasy Total RNA Isolation kit (cat # 74181) from Qiagen. Extracted using according to the procedure. 600 ng RNA was added to a reverse transcription reaction performed using a Verso cDNA kit from Thermo Scientific (cat # AB1453B) as described in the manufacturer's protocol. Real-time cDNA from this reverse transcription reaction using primers / probes designed by ABI Taqman Gene Expression Mix (cat # 4369510) and ABI (Applied Biosystems Taqman Gene Expression Assay: Hs00978340_m1, Applied Biosystems Inc., Foster City CA) Used to monitor gene expression by PCR. The following PCR cycles were used: 2 cycles at 50 ° C, 10 minutes at 95 ° C, 40 cycles (95 ° C for 15 seconds, 60 ° C for 1 minute), using the Mx4000 thermal cycler (Stratagene). Fold changes in gene expression after treatment with antisense oligonucleotides were calculated based on the difference in 18S-normalized dCt values between treated and mock-transfected samples.

result:
The results are shown in FIG. Real-time PCR results show increased levels of SIRT1 mRNA after treatment with oligonucleotides against SIRT1 antisense.

(Example 4)
Study of effect and duration of action of CUR 963 in African green monkeys The purpose of this study was to investigate the effect of antisense knockdown of a discordant non-coding antisense sequence that controls the SIRT1 gene in a non-human primate model Followed by evaluation and comparison. An antisense oligonucleotide test substance designed to suppress the SIRT1 regulatory sequence is referred to as CUR 963.
CUR 963: + G ^* + T ^* C ^* T ^* G ^* A ^* T ^* G ^* G ^* + A ^* + G ^* + A (SEQ ID NO: 25)
CUR-962 (control): + G ^* + C ^* T ^* A ^* G ^* T ^* C ^* T ^* G ^* + T ^* + T ^* + G (SEQ ID NO: 52)

Controlled laboratory guidelines This study is based on approved toxicological principles and is a Harmonized Tripartite Guidelines (International Conference of Harmonization) (ICH). The timing of nonclinical trials was designed according to ICH M3 (m), September 2000) and accepted procedures for testing for therapeutics.

Test substance and control conditions Test substance identity and preparation Test substance CUR-963 is a chemically stabilized antisense oligonucleotide. The vehicle for intravenous delivery is phosphate buffered saline (PBS).

Vehicle characterization
PBS vehicle, composition, batch number, expiration date and storage conditions (temperature and light / dark) were obtained from the supplier.

Test Article Storage and Handling Test substances and vehicles were stored according to standard storage conditions provided by sponsors and manufacturers.

Analysis of the test substance preparation Samples of the test substance preparation are stored frozen for analysis of concentration, stability and homogeneity of the test substance preparation.

Test System Principles Primates are suitable non-rodent species that are acceptable to regulators as an indicator of potential danger and for which detailed background data are available. Specifically, African green monkeys are highly clinically relevant models for a number of human physiological states and conditions.

  Intravenous route administration represents a possible human therapeutic route. The dose of the test substance was based on the results of a dose determination test of a similar compound conducted in advance in African green monkeys.

  African green monkeys were selected as the optimal primate because the target sequence of the test substance is 100% homologous in primates and conserved across species. In addition, the test substance is a synthetic oligonucleotide. As a result, primate dosing allows an excellent assessment of the effectiveness of these compounds that are more likely to reflect the uptake that would be observed in humans than any other species.

Animal Species Green monkey (Chlorocebus sabaeus), non-human primate breed Native to African green monkey St. Kitts

Supply source
RxGen, Lower Bourryeau, St. Kitts, West Indies

Estimated age Experimental animals were adults.

Estimated body weight Approximately 3-4 kg of monkeys. The actual range may vary but will be noted in the data.

Sex Experimental animals were adult females.

Number of animals Ten animals were selected to ensure the identification of 8 animals suitable for enrollment in the study.

Number of examinations Female: 8

Validity of the number of tests This study is the smallest possible number that is compatible with the main objective of assessing the therapeutic effect of the test substance in African green monkeys and the prior study of systemic administration of this type of oligonucleotide in this species. Designed using animals.

Animal specifications Ten adult African green monkeys with a body weight range of 3-4 kg were used in the study. Monkeys are non-drug-treated adult animals that have been humanely captured from wild populations on the island. Captured monkeys were treated with anthelmintic drugs to eliminate any possible intestinal parasite burden and were observed in quarantine for a minimum of 4 weeks prior to screening for study registration. The age of captive monkeys was estimated by size and tooth shape, excluding older animals from the study. Prior to study enrollment, each monkey was subjected to a clinical test including assessment of locomotor activity and agility. Blood samples were collected and sent to Antech Diagnostics (Memphis, TN) for comprehensive clinical chemistry and complete blood counts and lipid profiles (see section 9.2 and 319567928 for details). Monkeys that were determined to have abnormal laboratory values compared to normal values established for monkeys from St. Kitts colonies were excluded from the study. In order to identify 8 monkeys that meet this criterion, 10 monkeys were selected with additional animal selection as needed. Prior to study initiation, selected monkeys are transferred to individual cages to acclimate to individual housing for a week. Only animals deemed suitable for the experiment are enrolled in the study. The actual (or estimated) age and weight range at the beginning of the study is detailed in the raw data and final report.

Animal Health and Welfare Following the highest standards of animal welfare, the guidelines set by the St. Kitts Department of Agriculture and the US Department of Health and Human Services were followed. All studies will be conducted in accordance with these requirements and all behavioral standards that apply with regard to laboratory animal care and containment. All applicable standards for veterinary medicine, surgery and testing as included in the NIH guidelines for animal management and use. The St. Kitts facility has an animal testing committee that examines the procedures and audits the facility as set forth in the guidelines. The Foundation has approved the guarantees filed with the Laboratory Animal Welfare Department as set forth in Guideline # A4384-01 (Axion Research Foundation / St. Kitts Biomedical Foundation). There are no special non-human primate veterinary management issues and biohazard issues arising from research specific to this study.

Housing and Environmental Animals were individually housed before surgery and until sacrifice after surgery to allow detection of any clinical symptoms associated with treatment. The primate building where the individual cages were located was entirely illuminated with indirect lighting, 17 ° N latitude, and a light-dark cycle of approximately 12 hours: 12 hours as recommended by the USDHHS guidelines. The RxGen primate building was well ventilated outside. Additional airflow was ensured by the ceiling fan to maintain a constant target temperature of 23-35 ° C typical of St. Kitts throughout the year. The extreme values at 24 hours of temperature and relative humidity (also not controlled) were measured daily. During the study, cages were cleaned regularly.

Diet and Water Each animal received approximately 90 grams of standard monkey chow diet (TekLad, Madison, WI) per day. The detailed nutritional composition of the diet was recorded. Water was analyzed periodically for microbiological purity. Criteria for acceptable levels of contaminants in stored feed and feed water were within analytical specifications established by the feed manufacturer and periodic facility water assessment, respectively. Water met all the criteria required for proof that it was acceptable for human consumption.

Experimental Design Animal Identification and Randomization Assignment was done by means of stratified randomization based on body weight and plasma cholesterol profile. Before and after group assignment, each animal was identified by abdominal tattoo. Tattooing is performed as a means of identification for all animals in the colony during the routine health checkup. Cage diagrams were created to identify the individual housed, and individual monkeys were further identified by label tags attached to their respective cages.

Group size, dose and identification number Animals were assigned to 2 treatment groups consisting of 4 monkeys in each group. A specific animal identification number was assigned to each monkey according to the facility numbering system. This system uniquely identifies each monkey by a three digit number following the letter, for example Y032.

Route and frequency of administration Animals were dosed intravenously by manual infusion over approximately 10 minutes once a day on days 1, 3 and 5. The infusion rate is 24 mL / kg / hour. Animals were sedated with ketamine and xylazine before and during the dosing procedure. A venous catheter (Terumo mini vein infusion set, 20 gauge needle, or similar appropriate infusion set) was inserted into the saphenous vessel. Dosing in each monkey was performed between 8 am and 10 am immediately after the animal woke up and before feeding. Blood samples were taken immediately prior to each infusion to assess plasma cholesterol and other lipid levels as described in the blood chemistry section below. Blood sampling preceded feeding at both sampling intervals to minimize the effects of feeding on cholesterol measurements.

Clinical observations All obvious signs of response to treatment were recorded on each dosing day. In addition, animals were examined at least once a week for physical characteristics such as appearance and general condition.

Body weight Body weight was recorded weekly during treatment and late in treatment.

Food consumption Individual food consumption was not quantified. However, the manner of feeding was monitored and significant changes were recorded.

Mortality and morbidity Record mortality and morbidity. Any decision regarding early slaughter will be made after consultation between the study director and the sponsoring monitoring scientist, if possible. Animals that are found to be prematurely dead or killed are subject to autopsy with collection of liver, kidney, heart and spleen lung tissue for histopathology. For early sacrifice events, blood samples are taken (if possible) and parameters are measured. Animals found dead after normal working hours are frozen overnight and necropsied at the beginning of the next working hour. If the animal's condition requires early sacrifice, it is euthanized by intravenous overdose of pentobarbital sodium. All investigations are governed by the principles of animal use. The law stipulates that RxGen follows US Department of Social Health and Welfare standards for primate facilities that indicate the level of severity that the procedures in this study identified as mild must comply with.

Clinical laboratory study Fat biopsy Subcutaneous fat biopsy was performed on the 26th day of study on all study monkeys except Y775 with tissue extract by 1 cm midline incision below the navel. The biopsy was immediately immersed in a labeled cryotube containing 2 ml of RNAlater (Qiagen) and incubated overnight at 4 ° C., after which the RNAlater was aspirated and the sample tube was snap frozen in liquid nitrogen. After transfer into liquid nitrogen, total RNA was isolated for real-time PCR of the target gene.

result:
Real-time PCR results were dosed with CUR-962 (SEQ ID NO: 52), an oligonucleotide (designed against ApoA1 antisense DA327409, data not shown) that had no effect on SIRT1 expression in vitro. FIG. 6 shows increased levels of SIRT1 mRNA in fat biopsies from monkeys dosed with CUR-963, an oligonucleotide designed against SIRT1 antisense CV396200.1, as compared to simian monkeys. mRNA levels were determined by real-time PCR (Figure 4).

  While the invention has been illustrated and described with respect to one or more implementations, one of ordinary skill in the art will appreciate equivalent changes and modifications upon interpretation and understanding of this specification and the accompanying drawings. In addition, certain features of the invention may be disclosed in connection with only one of several implementations, but such features may be related to one or more other features of other implementations. Can be combined as may be desired and advantageous for any given or specific application.

  The disclosure summary prompts the reader to quickly identify the nature of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the following claims.

Claims (34)

A method of modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in a patient cell or tissue in vivo or in vitro comprising:
Comprising nucleotides 1 to 1028 of SEQ ID NO: 2 or nucleotides 1 to 429 of SEQ ID NO: 3 or nucleotides 1 to 156 of SEQ ID NO: 4 or nucleotides 1 to 593 of SEQ ID NO: 5 (Figure 11) Contacting said cell or tissue with an antisense oligonucleotide of 5-30 nucleotides in length having at least 50% sequence identity to the reverse complement of the polynucleotide; thereby causing the patient's cell or tissue in vivo or in vitro Modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in. A method of modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in a patient cell or tissue in vivo or in vitro comprising:
Contacting said cell or tissue with an antisense oligonucleotide of 5-30 nucleotides in length having at least 50% sequence identity to the antisense reverse complement of a sirtuin 1 (SIRT1) polynucleotide; thereby in vivo or modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in a patient cell or tissue in vitro. A method of modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in a patient cell or tissue in vivo or in vitro comprising:
Contacting said cell or tissue with an antisense oligonucleotide of 5-30 nucleotides in length having at least 50% sequence identity to an antisense oligonucleotide of a sirtuin 1 (SIRT1) polynucleotide; thereby in vivo or in vitro Modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in a patient cell or tissue. A method of modulating the function and / or expression of a sirtuin 1 (SIRT1) polynucleotide in a patient cell or tissue in vivo or in vitro comprising:
Contacting said cell or tissue with an antisense oligonucleotide that targets a natural antisense region of a sirtuin 1 (SIRT1) polynucleotide; thereby sirtuin 1 (SIRT1) in a patient cell or tissue in vivo or in vitro A method comprising the step of modulating the function and / or expression of a polynucleotide.   5. The method of claim 4, wherein the expression and / or function of sirtuin 1 (SIRT1) is increased in vivo or in vitro compared to a control.   5. The method of claim 4, wherein the antisense oligonucleotide targets the natural antisense sequence of a sirtuin 1 (SIRT1) polynucleotide.   5. The method of claim 4, wherein the antisense oligonucleotide targets a nucleic acid sequence comprising a coding and / or non-coding nucleic acid sequence of a sirtuin 1 (SIRT1) polynucleotide.   5. The method of claim 4, wherein the antisense oligonucleotide targets an overlapping and / or non-overlapping sequence of a sirtuin 1 (SIRT1) polynucleotide.   5. The method of claim 4, wherein the antisense oligonucleotide comprises one or more modifications comprising a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and / or combinations thereof.   10. The method of claim 9, wherein the modified sugar moiety comprises a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety or a bicyclic sugar moiety. .   Modified internucleoside linkage is phosphorothioate, 2'-O-methoxyethyl (MOE), 2'fluoro, alkylphosphonate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamic acid, carbonic acid, phosphate triester 10. The method of claim 9, comprising acetoamidate, carboxymethyl ester and / or combinations thereof.   The oligonucleotide optionally has at least one modified nucleotide comprising a peptide nucleic acid, a locked nucleic acid (LNA) molecule, an arabino-nucleic acid (FANA), a peptide nucleic acid (PNA), analogs or derivatives thereof. The method described in 1.   The method of claim 1, wherein the oligonucleotide comprises at least one oligonucleotide sequence set forth in SEQ ID NOs: 6-47. A method of modulating the expression and / or function of a sirtuin 1 (SIRT1) gene in a mammalian cell or tissue in vivo or in vitro comprising:
An antisense polynucleotide of a sirtuin 1 (SIRT1) polynucleotide having at least 50% sequence identity to the complementary sequence of at least about 5 consecutive nucleic acids of the antisense and / or sense nucleic acid molecule of the sirtuin 1 (SIRT1) polynucleotide Contacting said cell or tissue with a small interfering RNA (siRNA) oligonucleotide 5-30 nucleotides in length specific for the nucleotide; and sirtuin 1 (SIRT1 in mammalian cells or tissue in vivo or in vitro) ) A method comprising modulating the expression and / or function of a gene.   15.The oligonucleotide of claim 14, wherein the oligonucleotide has at least 80% sequence identity to the complementary sequence of at least about 5 contiguous nucleic acids of an antisense and / or sense nucleic acid molecule of a sirtuin 1 (SIRT1) polynucleotide. Method. A method of modulating the expression and / or function of a sirtuin 1 (SIRT1) gene in a mammalian cell or tissue in vivo or in vitro comprising:
Non-coding and / or non-coding of the sense and / or natural antisense strand of a sirtuin 1 (SIRT1) molecule having at least 50% sequence identity to at least one nucleic acid sequence set forth in SEQ ID NOs: 1-5 Contacting said cell or tissue with an antisense oligonucleotide 5-30 nucleotides in length specific for the coding sequence; and expression of a sirtuin 1 (SIRT1) gene in a mammalian cell or tissue in vivo or in vitro And / or adjusting the function.   A synthetic modified oligonucleotide comprising at least one modification, wherein the modification is alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamic acid, carbonic acid, phosphate triester, acetamidate, carboxy Expression of sirtuin 1 (SIRT1) molecule in vivo or in vitro compared to a normal control, comprising at least one internucleotide linkage of methyl ester or a combination thereof, hybridizing to sirtuin 1 (SIRT1) molecule And / or oligonucleotides that are antisense compounds that modulate function.   Modifications are from phosphorothioate internucleotide linkages and alkylphosphonates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, carbamic acids, carbonic acids, phosphate triesters, acetamidates, carboxymethyl esters and / or combinations thereof 18. The oligonucleotide of claim 17, comprising a combination with at least one internucleotide linkage selected from the group consisting of.   18. The oligonucleotide of claim 17, comprising at least one phosphorothioate internucleotide linkage.   18. The oligonucleotide of claim 17, comprising a phosphorothioate internucleotide linkage backbone.   18. The oligonucleotide of claim 17, optionally comprising at least one modified nucleotide comprising a peptide nucleic acid, locked nucleic acid (LNA) molecule, analog, derivative and / or combination thereof.   18. The modified sugar moiety of claim 17 comprising a 2'-O-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety or a bicyclic sugar moiety. Oligonucleotide.   An antisense oligonucleotide of at least 5 to 30 nucleotides in length that hybridizes to the antisense strand and / or sense strand of a sirtuin 1 (SIRT1) polynucleotide and that antisense and / or sense of a sirtuin 1 (SIRT1) polynucleotide 18. The oligonucleotide of claim 17, having at least about 20% sequence identity to the complementary sequence of at least about 5 consecutive nucleic acids of the coding and / or non-coding nucleic acid sequences.   18.The sequence and / or sense coding and / or non-coding nucleic acid sequence of a sirtuin 1 (SIRT1) polynucleotide is at least about 80% sequence identical to a complementary sequence of at least about 5 consecutive nucleic acids. Oligonucleotides.   Hybridizing to at least one sirtuin 1 (SIRT1) polynucleotide and modulating the expression and / or function of at least one sirtuin 1 (SIRT1) polynucleotide in vivo or in vitro compared to a normal control. 18. The oligonucleotide according to 17.   18. The oligonucleotide of claim 17, comprising the sequence of SEQ ID NOs: 6-47.   A composition comprising one or more oligonucleotides specific for a sirtuin 1 (SIRT1) polynucleotide comprising an antisense sequence, complementary sequence, allele, homologue, isoform, variant, derivative, variant or fragment thereof .   28. The composition of claim 27, wherein the oligonucleotide comprises at least about 40% nucleotide sequence identity compared to any one of the nucleotide sequences set forth in SEQ ID NOs: 6-47.   28. The composition of claim 27, wherein the oligonucleotide comprises the nucleotide sequence set forth in SEQ ID NOs: 1-47.   28. The composition of claim 27, wherein the oligonucleotides set forth in SEQ ID NOs: 6-47 comprise one or more modified or substituted nucleotides.   28. The composition of claim 27, wherein the modified nucleotide comprises a modified base comprising a phosphorothioate, methylphosphonate, peptide nucleic acid, locked nucleic acid (LNA) molecule. A method for preventing or treating a disease associated with a sirtuin 1 (SIRT1) polynucleotide and / or a product encoded thereby, comprising:
Administering to the patient a therapeutically effective amount of at least one antisense oligonucleotide that binds to a natural antisense sequence of a sirtuin 1 (SIRT1) polynucleotide and modulates the expression of said sirtuin 1 (SIRT1) polynucleotide; A method comprising preventing or treating a disease associated with a 1 (SIRT1) polynucleotide and / or a product encoded thereby.   Diseases associated with Sirtuin 1 (SIRT1) polynucleotides include cancer (e.g., breast cancer, colorectal cancer, CCL, CML, prostate cancer), neurodegenerative diseases (e.g., Alzheimer, Huntington, Parkinson, amyotrophic lateral sclerosis) , Disorders caused by multiple sclerosis and polyglutamine aggregation); skeletal muscle diseases (e.g. Duchenne muscular dystrophy, skeletal muscle atrophy, Becker muscular dystrophy or myotonic dystrophy); metabolic diseases (e.g. insulin resistance, diabetes, obesity) Impaired glucose tolerance, high blood cholesterol, hyperglycemia, dyslipidemia and hyperlipidemia); adult-onset diabetes, diabetic nephropathy, neuropathy (e.g. sensory neuropathy, autonomic neuropathy, motor neuropathy, Retinopathy); bone disease (e.g. osteoporosis), blood disease (e.g. leukemia); liver disease (e.g. alcohol abuse) Obesity; bone resorption, age-related macular degeneration, AIDS-related dementia, ALS, Bell's palsy, atherosclerosis, heart disease (e.g., arrhythmia, chronic congestive heart failure, ischemic stroke, coronary artery) Disease and cardiomyopathy), chronic degenerative diseases (e.g. myocardial disease), chronic renal failure, type 2 diabetes, ulcers, cataracts, presbyopia, glomerulonephritis, Guillain-Barre syndrome, hemorrhagic stroke, rheumatoid arthritis, inflammatory bowel Diseases, SLE, Crohn's disease, osteoarthritis, osteoporosis, chronic obstructive pulmonary disease (COPD), pneumonia, skin aging and urinary incontinence, other examples include diseases and disorders related to neuronal cell death, aging or preferably 35. The method of claim 32, comprising other conditions characterized by no cell loss.   A method of identifying and selecting an oligonucleotide for in vivo administration, comprising selecting a target polynucleotide associated with a disease state; at least five complementary or antisense orientations to the identified polynucleotide Identifying oligonucleotides containing consecutive nucleotides; measuring the thermal melting point of the binding between the antisense oligonucleotide and the target polynucleotide under stringent hybridization conditions; and oligos for in vivo administration A method comprising identifying and selecting nucleotides.