JP2012213382A - New polypeptide and polynucleotide encoding the polypeptide, and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new polypeptide having high affinity with high mannose type sugar chain, a polynucleotide encoding the polypeptide and typical uses thereof.SOLUTION: This polypeptide binds to a high mannose type sugar chain derived from edible red alga Meristotheca papulosa, which is an antiviral agent comprising: (a) an amino acid sequence with a specific sequence; or (b) the amino acid sequence with the specific sequence where one or several amino acids are substituted, deleted, inserted or added.

Description

  The present invention relates to a novel polypeptide having a high affinity for a high mannose sugar chain, a polynucleotide encoding the polypeptide, and typical uses thereof.

  Human immunodeficiency virus (hereinafter “HIV”), influenza virus, hepatitis C virus (hereinafter “HCV”), Ebola virus, human herpesvirus 6 (hereinafter “HHV-6”), severe acute respiratory syndrome (hereinafter “SARS”) ) Viruses such as viruses often cause serious symptoms on the human body, and the spread of infection has become a social problem, so the development of drugs that effectively inhibit infection is desired. These viruses are known to have a high mannose sugar chain on the surface, which plays an important role in infecting a host (for example, Non-Patent Document 1). Therefore, it is expected that substances having the ability to bind to high mannose sugar chains provided in these viruses function as infection inhibitors against the viruses.

  So far, many types of lectins have been isolated from seaweeds or algae (freshwater cyanobacteria) and their biochemical properties have been elucidated. It is known that a part of the lectin specifically binds to the above-described viruses such as HIV and influenza virus (Non-Patent Documents 2 to 12).

  In addition, as an invention relating to the binding of lectin and HIV, for example, a microparticle carrier comprising a hydrophobic substrate to which a lectin such as ConA is bound contains microparticles obtained by capturing HIV or a part of the protein or peptide thereof. AIDS vaccine (Patent Document 1), a method of reducing blood particles and lectin-binding fragments thereof in the blood of an individual infected with a virus by passing blood through a porous hollow fiber membrane fixed with a lectin such as GNA (Patent Document 2) ), An invention using a composition containing a mannan-binding lectin oligomer containing a mannan-binding lectin subunit and the like (Patent Document 3), succinyl-concanavalin, in the manufacture of a medicament for the prevention and / or treatment of infectious diseases in cancer patients Use a lectin such as A as a binding component and do not contain virus particles A method of increasing the viral titer of the sample (Patent Document 4) is known.

JP 2001-335510 A (published on December 4, 2001) Special table 2007-525232 gazette (announced September 6, 2007) Special table 2008-535872 gazette (announced September 4, 2008) Special table 2004-500831 publication (announced on January 15, 2004)

New England Journal of Medicine, 348, 2228-2238, 2003. Boyd, M.R. et al., Antimicrob.Agents Chemother.41, 1521-1530, 1997. O’Keefe, B. R. et al., Antimicrob. Agents Chemother. 47, 2518-2525, 2003. Helle, F., .et al., J. Biol. Chem. 281, 25177-25183, 2006. Barrientos, L. G., et al., Antiviral. Res. 58, 47-56, 2003. Dey, B., et al., J. Virol. 74, 4562-4569, 2000. O’Keefe, B. R. et al., J. Virol. 84, 2511-2521, 2010. Hori, K. et al., Glycobiology, 17, 479-491, 2007. Sato, Y., Okuyama, S., and Hori, K., J. Biol. Chem. 282, 11021-11029, 2007. Sato, Y., Morimoto, K., Hirayama, M., and Hori, K. Biochem. Biophys. Res. Commun. 405, 291-296, 2011. Yuichiro Sato, Makoto Hirayama, Yoshifumi Fujiwara, Kinjiro Morimoto, Kanji Hori (2010) Abstract of the 13th Annual Meeting of the Marine Biotechnology Society (2010. 5.29 presentation) Sato, Y., Hirayama, M., Morimoto, K., Yamamoto, N., Okuyama, S., and Hori, K. J. Biol. Chem. 286, No. 22, 19446-19458, 2011.

  However, at the present time, it is said that substances that specifically bind to high mannose sugar chains on the surface of HIV virus, influenza virus, etc. and effectively inhibit infection of the virus are still well known. Since the number is limited, it is not in a situation where the above substances can be supplied sufficiently. Therefore, it is necessary to find more new substances mentioned above and to clarify their properties.

  The present invention has been made in view of such problems, and an object of the present invention is to provide a novel polypeptide having high affinity with a high mannose sugar chain, a polynucleotide encoding the polypeptide, and their To provide a representative use.

  In order to solve the above problems, the present inventor has focused on lectins, particularly lectins derived from Meristotheca papulosa (Montagne) J. Agardh, and specifically binds to high mannose sugar chains provided on the surface of HIV viruses and the like. We searched for possible lectins. As a result, the inventors have found a polypeptide according to the present invention that has a very low homology of amino acid sequence with a conventionally known lectin.

  That is, the polypeptide according to the present invention is a polypeptide that binds to a high mannose-type sugar chain in order to solve the above-described problem, and (a) the amino acid sequence represented by SEQ ID NO: 2; or (b) SEQ ID NO: 2 In the amino acid sequence shown in (1), the amino acid sequence consists of an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added.

  The polynucleotide according to the present invention is characterized in that it encodes the polypeptide according to the present invention in order to solve the above problems.

  In order to solve the above problems, the polynucleotide according to the present invention is a polynucleotide that is either of the following (a) or (b): (a) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1; Or (b) a polynucleotide that hybridizes with any of the following (i) or (ii) under stringent conditions: (i) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1; or (ii) SEQ ID NO: A polynucleotide comprising a base sequence complementary to the base sequence shown in FIG.

  The antiviral agent according to the present invention is characterized by targeting a virus containing the polypeptide according to the present invention and having a high mannose-type sugar chain in order to solve the above problems.

  In the antiviral agent according to the present invention, in order to solve the above problems, the target virus of the antiviral agent is AIDS virus, influenza virus, hepatitis C virus, Ebola virus, human herpesvirus 6 and severe acute respiratory disease. It may be a virus selected from the group consisting of syndrome viruses.

  The virus removal membrane according to the present invention is characterized in that the polypeptide according to the present invention is fixed to solve the above problems.

  The vector according to the present invention includes the polynucleotide according to the present invention to solve the above-mentioned problems.

  The method for producing a polypeptide according to the present invention is characterized by using the vector according to the present invention to solve the above-mentioned problems.

  The transformant according to the present invention is characterized in that the polynucleotide according to the present invention is introduced in order to solve the above problems.

  The method for producing a polypeptide according to the present invention is characterized by using the transformant according to the present invention to solve the above-mentioned problems.

  As described above, the polypeptide according to the present invention is a polypeptide that binds to a high mannose sugar chain, and is (a) the amino acid sequence shown in SEQ ID NO: 2; or (b) the amino acid shown in SEQ ID NO: 2. The sequence is composed of an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, or added. The amino acid sequence has a very low homology with conventionally known lectins.

  Therefore, it is possible to efficiently bind to high mannose sugar chains provided on the surface of HIV, influenza virus, etc., and to effectively inhibit infection of these viruses.

  The polynucleotide according to the present invention encodes the polypeptide according to the present invention. Therefore, by using the polynucleotide according to the present invention, the vector containing the polynucleotide, and the transformant introduced with the polynucleotide, the polypeptide according to the present invention can be prepared easily and in large quantities. . As a result, the virus infection can be effectively inhibited.

It is a figure which shows the full length base sequence of cDNA of MPL, and its deduced amino acid sequence. FIG. 2A is a sensorgram of the interaction between immobilized gp120 and MPL, and FIG. 2B is a diagram showing the affinity constant between gp120 and MPL. It is a figure which shows the result of having used MPL for SDS-PAGE (10% gel). It is a figure which shows the result of having used the 20-60% saturated ammonium sulfate salting-out precipitation fraction for the anion exchange chromatography (stepwise elution) using a HiPrep QXL 16/10 column. It is a figure which shows the result of having used the crude lectin fraction for the anion exchange chromatography (gradient elution) using a HiPrep QXL 16/10 column. As a result of subjecting the crude lectin fraction to anion exchange chromatography (gradient elution) using a HiPrep QXL 16/10 column, the fraction obtained from the eluate was subjected to SDS-PAGE (10% gel). FIG. It is a figure which shows the result of having used MPL for the anion exchange chromatography using a TSKgel DEAE-5PW column. It is a figure which shows the result of having used four peaks obtained by using MPL for the anion exchange chromatography by a TSKgel DEAE-5PW column to SDS-PAGE (10% gel). It is a figure which shows the molecular weight measurement result of MPL-1 and MPL-2. It is a figure which shows the PVDF membrane which blotted MPL fraction and dye | stained CBB. This shows the structure of 27 types of pyridylaminated sugar chains used in the centrifugal ultrafiltration-HPLC method and the binding activity of MPL-1 to the sugar chains.

  Hereinafter, an embodiment of the present invention will be described as follows. Note that the present invention is not limited to this. In the present specification, “A to B” indicating a range represents A or more and B or less. Moreover, the patent document and nonpatent literature described in this specification are used as reference in this specification.

(1) Polypeptide The present inventor confirmed that a novel polypeptide (hereinafter referred to as “MPL”) isolated from edible red algae, Meristotheca papulosa (Montagne) J. Agardh, binds to a high mannose sugar chain. It has been found that it has specificity, and the present invention has been completed. As will be described later, the amino acid sequence of the MPL has a very low homology with a conventionally known lectin such as a banana Musa acuminata lectin and a red alga Griffithsia sp.-derived lectin Griffithsin (GRFT) at a maximum of 33%. It was.

  As used herein, the term “polypeptide” is used interchangeably with “peptide” or “protein”. The polypeptides according to the invention may also be isolated from natural sources or chemically synthesized.

  The term “isolated” polypeptide or protein is intended to be a polypeptide or protein that has been removed from its natural environment. For example, recombinantly produced polypeptides and proteins expressed in a host cell can be isolated in the same manner as natural or recombinant polypeptides and proteins that have been substantially purified by any suitable technique. It is thought that there is.

  Polypeptides according to the present invention include natural purified products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (eg, bacterial cells, yeast cells, higher plant cells, insect cells, and mammalian cells). ) From recombinantly produced products. Depending on the host used in the recombinant production procedure, the polypeptides according to the invention may be glycosylated or non-glycosylated. Furthermore, the polypeptides according to the invention may also comprise an initiating modified methionine residue in some cases as a result of a host-mediated process.

  The present invention provides a polypeptide according to the present invention. In one embodiment, the polypeptide according to the present invention is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 or a variant of the polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 and the polypeptide according to the present invention. It is a peptide. The polypeptide is characterized by being a novel polypeptide having very low homology with the amino acid sequence of a conventionally known lectin.

  Variants include deletions, insertions, inversions, repeats, and type substitutions (eg, replacement of a hydrophilic residue with another residue, but usually a strongly hydrophilic residue to a strongly hydrophobic residue Are not substituted). In particular, “neutral” amino acid substitutions in a polypeptide generally have little effect on the activity of the polypeptide.

  It is well known in the art that some amino acids in the amino acid sequence of a polypeptide can be easily modified without significantly affecting the structure or function of the polypeptide. Furthermore, it is also well known that there are variants in natural proteins that do not significantly alter the structure or function of the protein, not only artificially modified.

  One skilled in the art can readily mutate one or several amino acids in the amino acid sequence of a polypeptide using well-known techniques. For example, according to a known point mutation introduction method, an arbitrary base of a polynucleotide encoding a polypeptide can be mutated. In addition, a deletion mutant or an addition mutant can be prepared by designing a primer corresponding to an arbitrary site of a polynucleotide encoding a polypeptide. Furthermore, if the method described in this specification is used, it can be easily determined whether the produced mutant is the desired mutant concerning this invention.

The polypeptide according to this embodiment is a polypeptide that binds to a high-mannose sugar chain,
(A) an amino acid sequence shown in SEQ ID NO: 2; or (b) an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 2,
Preferably it consists of.

  The above “one or more amino acids are substituted, deleted, inserted, or added” means substitution, deletion, insertion, or the like by a known mutant polypeptide production method such as site-directed mutagenesis. Number of amino acids that can be added (preferably 1 to 10, more preferably 1 to 7, more preferably 1 to 5, particularly preferably 1 to 3) amino acids are substituted, deleted, inserted or added. Means that As described above, such a mutant polypeptide is not limited to a polypeptide having a mutation artificially introduced by a known mutant polypeptide production method, and a naturally occurring polypeptide is isolated and purified. It may be what you did.

  The polypeptide according to the present invention may be any polypeptide in which amino acids are peptide-bonded, but is not limited thereto, and may be a complex polypeptide including a structure other than the polypeptide. As used herein, examples of the “structure other than the polypeptide” include sugar chains and isoprenoid groups, but are not particularly limited.

  The polypeptide according to the present invention may include an additional polypeptide. Examples of the additional polypeptide include epitope-tagged polypeptides such as His, Myc, and Flag.

  In addition, the polypeptide according to the present invention is a state in which a polynucleotide according to the present invention (a gene encoding the polypeptide according to the present invention) described later is introduced into a host cell and the polypeptide is expressed in the cell. It may also be a case where it is isolated and purified from cells, tissues or the like. The polypeptide according to the present invention may be chemically synthesized.

  In other embodiments, the polypeptides of the invention can be recombinantly expressed in a modified form such as a fusion protein. For example, additional amino acids, particularly charged amino acid regions, of the polypeptides according to the invention may be used in host cells to improve stability and persistence during purification or subsequent manipulation and storage. It can be added to the N-terminus of the polypeptide.

  In another embodiment, the polypeptides according to the invention may be produced recombinantly or chemically synthesized as detailed below.

  Recombinant production can be performed using methods well known in the art, for example using vectors and cells as detailed below.

  Synthetic peptides can be synthesized using known methods of chemical synthesis. For example, Houghten is prepared in less than 4 weeks for the synthesis of a large number of peptides, such as 10-20 mg of 248 different 13-residue peptides that represent a single amino acid variant of the characterized HA1 polypeptide segment. (Houghten, RA, Proc. Natl. Acad. Sci. USA, 82: 5131-5135 (1985)).

  This “Simultaneous Multiple Peptide Synthesis (SMPS)” process is further described in US Pat. No. 4,631,211 of Houghten et al. (1986). In this procedure, individual resins for solid phase synthesis of various peptides are contained in separate solvent permeable packets, allowing optimal use of many identical iteration steps associated with solid phase methods. A complete manual procedure allows 500 to 1000+ syntheses to be performed simultaneously (Houghten et al., Supra, 5134). These documents are incorporated herein by reference.

  The present inventor has found that the polypeptide according to the present invention specifically binds to a high mannose sugar chain. Here, the “sugar chain” means a linear or branched oligosaccharide or polysaccharide. The sugar chain includes an N-glycoside-linked sugar chain that binds to asparagine (hereinafter referred to as “N-type sugar chain”) and an O-glycoside-linked sugar chain that binds to serine, threonine, etc. N-type sugar chains include high mannose-type sugar chains, complex-type sugar chains, and hybrid sugar chains.

  The oligosaccharide refers to a monosaccharide or a derivative obtained by dehydrating 2 to 10 monosaccharide substituted derivatives. Furthermore, a saccharide to which a large number of monosaccharides are bonded is called a polysaccharide. Although polysaccharides differ depending on the types of constituent sugars, carbohydrates containing a large amount of uronic acid and ester sulfate are referred to as acidic polysaccharides, and those containing only neutral sugars are referred to as neutral polysaccharides. Among the polysaccharides, a group of polysaccharides called mucopolysaccharides are mostly bound to proteins and are called proteoglycans. A monosaccharide is a basic substance that becomes a structural unit of a sugar chain and does not become a simpler molecule by hydrolysis.

  Furthermore, monosaccharides are roughly classified into three types: acidic sugars having an acidic side chain such as a carboxyl group, amino sugars having hydroxyl groups substituted with amino groups, and other neutral sugars. As monosaccharides present in the living body, acidic sugars include sialic acids such as N-acetylneuraminic acid and N-glycolylneuraminic acid (hereinafter referred to as “Neu5Gc”), uronic acid, and the like. N-acetylglucosamine (hereinafter referred to as “GlcNAc”), N-acetylgalactosamine, and the like, and examples of neutral sugars include glucose, mannose, galactose, and fucose.

  All N-type sugar chains have a common mother nucleus structure consisting of [Manα1-6 (Manα1-3) Manβ1-4GlcNAcβ1-4GlcNAc] called “trimannosyl core”. The high mannose type sugar chain contains only an α-mannose residue in the branched structure portion in addition to the trimannosyl core. This sugar chain contains a heptasaccharide [Manα1-6 (Manα1-3) Manα1-6 (Manα1-3) Manβ1-4GlcNAcβ1-4GlcNAc] as a common mother nucleus. The hybrid sugar chain is so called because it has the characteristics of both complex type and high mannose type. One or two α-mannosyl groups bind to the Manα1-6 arm of the trimannosyl core as in the case of the high mannose type, and the same side chain of the complex type sugar chain is attached to the Manα1-3 arm of the core. Are connected.

  The presence or absence of fucose binding to the C-6 position of GlcNAc located at the reducing end of the trimannosyl core, and the presence or absence of β-GlcNAc binding to the C-4 position of β-mannosyl residue (called bisecting GlcNAc) Contributes to the diversity of structures of complex and hybrid sugar chains. Among the three N-type sugar chains, the complex type contains the most diverse structures.

  This diversity is created primarily by two elements, with 1 to 5 side chains attached to the trimannosyl core at different binding positions, and one, two, three, four, or five side chains. A sugar chain is formed. Two isomers containing either [GlcNAcβ1-4 (GlcNAcβ1-2) Manα1-3] or [GlcNAcβ1-6 (GlcNAcβ1-2) Manα1-6] were found in the complex sugar chain of three side chains ing.

  In the above trimannosyl core, the end of the sugar chain that binds to asparagine, that is, the end on the GlcNAc side is referred to as the reducing end, and the opposite end, that is, the end on the Man side is referred to as the non-reducing end.

  Whether or not a polypeptide binds to a sugar chain is determined by, for example, passing a polypeptide to be tested through a column to which a target sugar chain or a glycoprotein to which a sugar chain is bound is immobilized, and the polypeptide to the column. Can be evaluated by the amount of polypeptide contained in the flow-through or the amount of polypeptide eluted from the column with a specific eluent. Western blotting (forensic practice and research, 37, 155, which detects glycoproteins bound to target sugar chains on membranes, etc.) and detects them using polypeptides labeled with biotin, fluorescein isothiocyanate, peroxidase, etc. 1994), dot blot method (Analytical Biochemistry, 204 (1), 198, 1992).

Further, the affinity between a target sugar chain or a chip on which a glycoprotein to which a sugar chain is bound and a polypeptide to be tested can be measured using a surface plasmon resonance method (SPR method). According to the said method, since it can measure not only the presence or absence of the affinity but the intensity | strength, it can be said that it is a preferable method. The binding constant (affinity constant) (K _A ) obtained at this time is 10 (M ⁻¹ ) or more, more preferably 10 ³ (M ⁻¹ ) or more, and most preferably 10 ⁴ (M ⁻¹ ) or more. It can be determined that the polypeptide and the sugar chain are bound.

  It should be noted that the polypeptide according to the present invention includes a polypeptide comprising the amino acid sequence shown in the above (a) or (b) and an arbitrary amino acid sequence having a specific function (for example, tag). is there. Moreover, the amino acid sequence shown in the above (a) or (b) and the arbitrary amino acid sequence may be linked with an appropriate linker peptide so as not to inhibit the respective functions.

  That is, an object of the present invention is to provide a polypeptide according to the present invention, and does not exist in a polypeptide production method or the like specifically described in the present specification. Therefore, it should be noted that the polypeptides according to the present invention obtained by methods other than the above methods also belong to the technical scope of the present invention.

(2) Polynucleotide The present invention provides a polynucleotide encoding the above-described polypeptide according to the present invention. As used herein, the term “polynucleotide” is used interchangeably with “nucleic acid” or “nucleic acid molecule” and is intended to be a polymer of nucleotides. As used herein, the term “base sequence” is used interchangeably with “nucleic acid sequence” or “nucleotide sequence” and refers to the sequence of deoxyribonucleotides (abbreviated A, G, C, and T). As shown.

  The polynucleotide according to the present invention may exist in the form of RNA (eg, mRNA) or in the form of DNA (eg, cDNA or genomic DNA). DNA can be double-stranded or single-stranded. Single-stranded DNA or RNA can be the coding strand (also known as the sense strand) or it can be the non-coding strand (also known as the antisense strand).

  As used herein, the term “oligonucleotide” is intended to be a combination of several to several tens of nucleotides, and is used interchangeably with “polynucleotide”. Oligonucleotides are called dinucleotides (dimers) and trinucleotides (trimers) as short ones, and are represented by the number of nucleotides polymerized such as 30 mers or 100 mers as long ones. Oligonucleotides can be produced as fragments of longer polynucleotides or chemically synthesized.

  A fragment of a polynucleotide according to the invention is a fragment of a length of at least 12 nt (nucleotide), preferably about 15 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably at least about 40 nt. Is intended. By a fragment having a length of at least 20 nt, for example, a fragment comprising 20 or more consecutive bases from the base sequence shown in SEQ ID NO: 1 is contemplated. By referring to the present specification, the base sequence shown in SEQ ID NO: 1 is provided, so that those skilled in the art can easily prepare a DNA fragment based on SEQ ID NO: 1.

  For example, restriction endonuclease cleavage or ultrasonic shearing can be readily used to create fragments of various sizes. Alternatively, such fragments can be made synthetically. Appropriate fragments (oligonucleotides) are synthesized by Applied Biosystems Incorporated (ABI, 850 Lincoln Center Dr., Foster City, CA 94404) 392 synthesizer and the like.

  Examples of the synthetically produced fragment include a synthetic polynucleotide whose sequence is optimized with respect to the codon of the host. Such a synthetic polynucleotide can be used when various expression systems are used.

  The polynucleotide according to the present invention can be fused to the polynucleotide encoding the tag tag (tag sequence or marker sequence) described above on the 5 'side or 3' side.

  The present invention further relates to a variant of the polynucleotide encoding the polypeptide according to the present invention. Variants can occur naturally, such as a natural allelic variant. By “allelic variant” is intended one of several interchangeable forms of a gene occupying a given locus on the chromosome of an organism. Non-naturally occurring variants can be generated, for example, using mutagenesis techniques well known in the art.

  Examples of such mutants include mutants in which one or several bases have been deleted, substituted, or added in the base sequence of the polynucleotide encoding the polypeptide according to the present invention. Variants can be mutated in coding or non-coding regions, or both. Mutations in the coding region can generate conservative or non-conservative amino acid deletions, substitutions, or additions.

  The present invention further provides an isolated polynucleotide comprising a polynucleotide encoding a polypeptide according to the present invention or a polynucleotide that hybridizes to the polynucleotide under stringent hybridization conditions.

In one embodiment, the polynucleotide according to the present invention is a polynucleotide encoding the polypeptide according to the present invention, and
(A) the amino acid sequence shown in SEQ ID NO: 2; or (b) the amino acid sequence shown in SEQ ID NO: 2, wherein one or several amino acids are substituted, deleted, inserted, or added. A polynucleotide encoding the polypeptide,
It is preferable that it is either.

In another embodiment, the polynucleotide according to the present invention is a polynucleotide encoding the polypeptide according to the present invention, and the following (a) or (b):
(A) a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 1; or (b) a polynucleotide that hybridizes with any of the following (i) or (ii) under stringent conditions:
(I) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1; or (ii) a polynucleotide comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1,
It is preferable that it is either.

  The above “stringent conditions” means that hybridization occurs only when at least 90% identity, preferably at least 95% identity, most preferably 97% identity exists between sequences. Means what happens.

  The hybridization can be performed by a known method such as the method described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory (1989). Usually, the higher the temperature and the lower the salt concentration, the higher the stringency (harder to hybridize), and a more homologous polynucleotide can be obtained.

  As hybridization conditions, conventionally known conditions can be preferably used, and are not particularly limited. For example, 42 ° C., 6 × SSPE, 50% formamide, 1% SDS, 100 μg / ml salmon sperm DNA, 5 × Denhardt's solution (however, 1 × SSPE; 0.18M sodium chloride, 10 mM sodium phosphate, pH 7.7, 1 mM EDTA. 5 × Denhardt's solution; 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% Polyvinylpyrrolidone).

  The polynucleotide or oligonucleotide according to the present invention includes not only double-stranded DNA but also single-stranded DNA and RNA such as sense strand and antisense strand constituting the same. The DNA includes, for example, cDNA and genomic DNA obtained by cloning, chemical synthesis techniques, or a combination thereof. Furthermore, the polynucleotide or oligonucleotide according to the present invention may contain a sequence such as an untranslated region (UTR) sequence or a vector sequence (including an expression vector sequence).

  Examples of a method for obtaining the polynucleotide or oligonucleotide according to the present invention include a method for isolating and cloning a DNA fragment containing the polynucleotide or oligonucleotide according to the present invention by a known technique. For example, a probe that specifically hybridizes with a part of the base sequence of the polynucleotide in the present invention may be prepared and a genomic DNA library or cDNA library may be screened. Such a probe may be of any sequence and / or length as long as it specifically hybridizes to at least part of the nucleotide sequence of the polynucleotide according to the present invention or its complementary sequence. Good.

  Alternatively, examples of the method for obtaining the polynucleotide according to the present invention include a method using an amplification means such as PCR. For example, in the polynucleotide cDNA of the present invention, primers are prepared from the 5 ′ side and 3 ′ side sequences (or their complementary sequences), and genomic DNA (or cDNA) or the like is used as a template using these primers. By performing PCR or the like and amplifying the DNA region sandwiched between both primers, a large amount of DNA fragments containing the polynucleotide according to the present invention can be obtained.

  Although it does not specifically limit as a supply source for acquiring the polynucleotide concerning this invention, It is preferable that it is the biological material containing the desired polynucleotide. Particularly preferred is Meristotheca papulosa (Montagne) J. Agardh, which is the origin of the polypeptide according to the present invention. However, it is not limited to this.

  It is to be noted that an object of the present invention is to provide a polynucleotide encoding the polypeptide according to the present invention and an oligonucleotide that hybridizes with the polynucleotide, and the polynucleotide specifically described in the present specification. It does not exist in methods for producing nucleotides and oligonucleotides. Therefore, it should be noted that a polynucleotide encoding a polypeptide according to the present invention obtained by a method other than the above methods also belongs to the technical scope of the present invention.

(3) Use of polypeptide and / or polynucleotide according to the present invention (3-1) Antiviral agent The antiviral agent according to the present invention contains the polypeptide according to the present invention, and contains a high-mannose sugar chain. Target the virus you have. The said virus will not be specifically limited if it is a virus provided with a high mannose type sugar chain, HIV, influenza virus, HCV, Ebola virus, HHV-6, SARS virus etc. can be mentioned.

  Some viruses infect a host by binding a high mannose sugar chain provided on the surface to a surface receptor of the host cell. For example, HIV has a glycoprotein called gp120 on its surface, and the high mannose-type sugar chain of gp120 infects the host by recognizing CD4 which is a host lymphocyte surface receptor.

  On the other hand, the polypeptide according to the present invention contained in the antiviral agent can specifically bind to a high mannose sugar chain. Therefore, the use of the antiviral agent can effectively inhibit the virus infection.

  Moreover, the infection of the virus to the host is not due to the direct binding between the high mannose sugar chain of the virus surface glycoprotein and the receptor of the high mannose sugar chain on the host side as in the relationship between gp120 and CD4. In some cases. For example, a virus having a high mannose type sugar chain, but the high mannose type sugar chain does not bind directly to the host receptor, but binds to the receptor by glycoprotein can be mentioned. Examples of such viruses include influenza viruses.

  The polypeptide according to the present invention contained in the antiviral agent can specifically bind to a high mannose sugar chain. Thus, an allosteric effect on glycoprotein is obtained, and it is considered that virus infection can be prevented even when a high mannose sugar chain is not directly involved in binding to a receptor. Therefore, the antiviral agent can also effectively inhibit infection with influenza virus or the like.

  The type of virus is not particularly limited. For example, HIV may be type 1 or type 2, and influenza virus may be any of A type, B type, and C type.

  “Equipped with a high mannose sugar chain” means that a high mannose sugar chain is present on the surface of the virus. For example, the state where the high mannose type sugar chain is exposed to the outside of the capsid and the case where it exists as a constituent component of the surface glycoprotein of the virus can be mentioned.

  As described above, the high mannose-type sugar chain may be one that directly binds to a host cell receptor, or one that does not directly bind to a host cell receptor. As described above, the antiviral agent according to the present invention can effectively inhibit infection even if it is a virus having any high mannose type sugar chain.

  The antiviral agent according to the present invention may be either an oral preparation or a parenteral preparation. The dosage form is not particularly limited, and can be formulated into tablets, granules, powders, capsules, elixirs, syrups, microcapsules, suspensions, and the like according to conventional methods.

  In the case of parenteral administration, for example, the solution containing the polypeptide of the present invention can be sprayed nasally or administered as an injection. When administered orally, it may be administered before, after, or between meals.

  The antiviral agent according to the present invention contains materials such as a carrier, an excipient, a binder, a swelling agent, a lubricant, a sweetener, a flavoring agent, a preservative, a stabilizer, and a coating agent as necessary. Can do.

  In the antiviral agent according to the present invention, for example, specific components that can be contained in tablets, capsules and the like include binders such as tragacanth, gum arabic, corn starch and gelatin; microcrystalline cellulose, crystalline cellulose Excipients such as corn starch, pregelatinized starch, alginic acid, dextrins; lubricants such as magnesium stearate; fluidity improvers such as finely divided silicon dioxide; lubricants such as glycerin fatty acid esters Agents; sweeteners such as sucrose, lactose and aspartame; flavoring agents such as peppermint, vanilla flavoring and cherry.

When the dispensing unit form is a capsule, a liquid carrier such as fats and oils can be further contained in the above type of material.

  Various other materials can also be included as coatings or to change the physical form of the dispensing unit. Examples of tablet coating agents include shellac, sugar, or both. A syrup or elixir may contain, for example, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and cherry or orange flavor. In addition, various vitamins and various amino acids may be contained.

  The application target of the antiviral agent according to the present invention is human, non-human animals [eg, non-human mammals (domestic animals such as pigs, cows, horses, dogs, etc.), birds (poultry such as chickens, etc.), etc.] There may be. By applying to livestock, poultry, etc., those economic losses can be reduced. Moreover, since they are often used for food, it is important from the viewpoint of preventing infection in humans.

  What is necessary is just to set the dosage of the antiviral agent concerning this invention so that the quantity which an application object requires can be ensured, it can formulate and use, can mix | blend with food-drinks and can use the said antiviral agent. .

(3-2) Virus removal membrane The virus removal membrane according to the present invention is obtained by immobilizing the polypeptide according to the present invention. The virus removal membrane can be produced, for example, by immobilizing the polypeptide on a conventionally known ultrafiltration membrane.

  Examples of the ultrafiltration membrane include membranes formed of conventionally known polymers such as polysulfone, polyethersulfone, polyamides, polyimides, cellulose acetate, polyacrylamide, etc. Alternatively, a porous hollow fiber membrane type may be used.

  In order to bind the polypeptide to the ultrafiltration membrane, the polymer of the ultrafiltration membrane is first activated by using a conventionally known process so as to easily bind to the protein chemically. A plurality of different polymers may be used as the polymer.

  After activating the polymer, the polypeptide according to the present invention is attached directly or using a linker to form an affinity matrix. Preferred linkers include, but are not limited to, avidin, streptavidin, biotin, protein A, protein G and the like.

  The polypeptide may be bound directly or indirectly to the ultrafiltration membrane polymer using a coupling agent such as a divalent reagent. In order to form an affinity matrix, it is preferable to use MPL covalently linked to agarose, but it is not limited thereto.

  When a virus particle having a high mannose-type sugar chain such as HIV and / or blood containing a fragment thereof is applied to the virus removal membrane, the polypeptide according to the present invention fixed to the virus removal membrane is Because the virus particles and / or fragments thereof bind to the high mannose sugar chains, blood passes through the pores, and the virus particles and / or fragments thereof are trapped and cannot pass through the pores. Therefore, a virus having a high mannose sugar chain can be removed from blood or the like.

(3-3) Vector The present invention provides a vector used for producing the polypeptide according to the present invention. The vector according to the present invention may be a vector used for in vitro translation or a vector used for recombinant expression.

  The vector according to the present invention is not particularly limited as long as it contains the above-described polynucleotide according to the present invention. For example, a recombinant expression vector into which cDNA of a polynucleotide encoding the polypeptide according to the present invention is inserted may be mentioned. A method for producing a recombinant expression vector includes, but is not limited to, a method using a plasmid, phage, cosmid or the like.

  The specific type of the vector is not particularly limited, and a vector that can be expressed in the host cell may be appropriately selected. That is, according to the type of the host cell, a promoter sequence is appropriately selected in order to reliably express the polynucleotide according to the present invention, and a vector in which this and the polynucleotide according to the present invention are incorporated into various plasmids is used as an expression vector. Use it.

  The expression vector preferably includes at least one selectable marker. Such markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, and E. coli. Examples of culture in E. coli and other bacteria include a tetracycline resistance gene or an ampicillin resistance gene.

  By using the above selectable marker, it can be confirmed whether or not the polynucleotide according to the present invention has been introduced into the host cell, and whether or not it is reliably expressed in the host cell. Alternatively, the polypeptide according to the present invention may be expressed as a fusion polypeptide. For example, the green fluorescence polypeptide GFP (Green Fluorescent Protein) derived from Aequorea jellyfish is used as a marker, and the polypeptide according to the present invention is used as a GFP fusion polypeptide. It may be expressed as

  The host cell is not particularly limited, and various conventionally known cells can be suitably used. Specifically, for example, bacteria such as Escherichia coli, yeasts (budding yeast Saccharomyces cerevisiae, fission yeast Schizosaccharomyces pombe), nematodes (Caenorhabditis elegans), Xenopus laevis oocytes, etc. However, it is not particularly limited. Appropriate culture media and conditions for the above-described host cells are well known in the art.

  A method for introducing the expression vector into a host cell, that is, a transformation method is not particularly limited, and a conventionally known method such as an electroporation method, a calcium phosphate method, a liposome method, or a DEAE dextran method can be suitably used. . For example, when the polypeptide according to the present invention is transferred and expressed in insects, an expression system using baculovirus may be used.

  Thus, it can be said that the vector according to the present invention should include at least a polynucleotide encoding the polypeptide according to the present invention. That is, it should be noted that vectors other than expression vectors are also included in the technical scope of the present invention.

  That is, an object of the present invention is to provide a vector containing a polynucleotide encoding the polypeptide according to the present invention, and each vector species and cell species specifically described in the present specification. As well as vector production methods and cell introduction methods. Therefore, it should be noted that vectors obtained using vector species and vector production methods other than those described above also belong to the technical scope of the present invention.

(3-4) Transformant or cell The present invention provides a transformant or cell into which a polynucleotide encoding the polypeptide according to the present invention described above is introduced. Here, the “transformant” means not only a tissue or an organ but also an individual organism.

  The method for producing a transformant or cell (production method) is not particularly limited, and examples thereof include a method for transformation by introducing the above-described recombinant vector into a host. In addition, the organism to be transformed is not particularly limited, and examples thereof include various microorganisms, plants and animals exemplified in the host cell.

  The transformant or cell according to the present invention is preferably a seaweed or a progeny thereof, or a tissue derived therefrom, and particularly preferably Meristotheca papulosa (Montagne) J. Agardh.

  A transformant containing a polynucleotide encoding the polypeptide according to the present invention can be obtained by introducing a recombinant vector containing the polynucleotide into a host cell so that the gene can be expressed.

  Thus, it can be said that the transformant or cell according to the present invention only needs to be introduced with at least a polynucleotide encoding the polypeptide according to the present invention. That is, it should be noted that transformants or cells produced by means other than recombinant expression vectors are also included in the technical scope of the present invention.

  An object of the present invention is to provide a transformant or a cell in which a polynucleotide encoding the polypeptide according to the present invention is introduced, and is specifically described in the present specification. It does not reside in the particular vector species and method of introduction described. Therefore, it should be noted that vector species and cell types other than those described above, and transformants or cells obtained using vector production methods and cell introduction methods also belong to the technical scope of the present invention.

(3-5) Polypeptide Production Method The present invention provides a method for producing a polypeptide according to the present invention.

  In one embodiment, the method for producing a polypeptide according to the present invention is characterized by using a vector comprising a polynucleotide encoding the polypeptide according to the present invention.

  In one aspect of this embodiment, the polypeptide production method according to this embodiment preferably uses the vector in a cell-free protein synthesis system. When using a cell-free protein synthesis system, various commercially available kits may be used. Preferably, the method for producing a polypeptide according to this embodiment includes a step of incubating the vector and a cell-free protein synthesis solution.

  In another aspect of the present embodiment, the polypeptide production method according to the present embodiment preferably uses a recombinant expression system. When a recombinant expression system is used, the polynucleotide according to the present invention is incorporated into a recombinant expression vector, then introduced into a host capable of expression by a known method, and the polypeptide obtained by translation in the host is purified. Such a method can be adopted. The recombinant expression vector may or may not be a plasmid, as long as the target polynucleotide can be introduced into the host. Preferably, the method for producing a polypeptide according to this embodiment includes a step of introducing the vector into a host.

  Thus, when introducing a foreign polynucleotide into a host, the expression vector preferably incorporates a promoter that functions in the host so as to express the foreign polynucleotide. The method for purifying a recombinantly produced polypeptide differs depending on the host used and the nature of the polypeptide, but the target polypeptide can be purified relatively easily by using a tag or the like.

  It is preferable that the method for producing a polypeptide according to this embodiment further includes a step of purifying the polypeptide from an extract of cells or tissues containing the polypeptide according to the present invention.

  The step of purifying a polypeptide is to prepare a cell extract from cells or tissues by a well-known method (for example, a method in which a cell or tissue is disrupted and then centrifuged to collect a soluble fraction). Known methods (eg ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography) The step of purifying by a) is preferred, but not limited thereto. Most preferably, high performance liquid chromatography (“HPLC”) is used for purification.

  In another embodiment, the method for producing a polypeptide according to the present invention is characterized in that the polypeptide is purified from cells or tissues that naturally express the polypeptide according to the present invention. The method for producing a polypeptide according to this embodiment preferably includes a step of identifying a cell or tissue that naturally expresses the polypeptide according to the present invention using the oligonucleotide described above. Moreover, it is preferable that the method for producing a polypeptide according to this embodiment further includes a step of purifying the above-described polypeptide.

  In still another embodiment, the method for producing a polypeptide according to the present invention is characterized by chemically synthesizing the polypeptide according to the present invention. Those skilled in the art will readily understand that the polypeptide according to the present invention can be chemically synthesized by applying a well-known chemical synthesis technique based on the amino acid sequence of the polypeptide according to the present invention described herein. .

  As described above, the polypeptide obtained by the method for producing a polypeptide according to the present invention may be a naturally occurring mutant polypeptide or an artificially prepared mutant polypeptide.

  The method for producing the mutant polypeptide is not particularly limited. For example, a site-directed mutagenesis method (see, for example, Hashimoto-Gotoh, Gene, 152, 271-275 (1995)), a method of introducing a point mutation into a base sequence using a PCR method, and producing a mutant polypeptide, Alternatively, the mutant polypeptide can be prepared by using a well-known mutant polypeptide production method such as a mutant strain production method by transposon insertion. A commercially available kit may be used for the production of the mutant polypeptide.

  As described above, the polypeptide production method according to the present invention can be carried out using known and common techniques based on at least the amino acid sequence of the polypeptide according to the present invention or the nucleotide sequence of the polynucleotide encoding the polypeptide according to the present invention. I can say that.

  That is, an object of the present invention is to provide a method for producing a polypeptide according to the present invention, and a production method including steps other than the various steps described above also belongs to the technical scope of the present invention. You must keep in mind.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail based on an Example, this invention is not limited to a following example.

[Example 1: Isolation of polypeptide (MPL) from Tokasori]
(Preparation of extract and ammonium sulfate precipitation)
500 g of frozen alga bodies collected from the western coast of Kyushu (Meristotheca papulosa (Montagne) J. Agardh) were powdered under liquid nitrogen. To this, 500 ml of 20 mM PBSA (Phosphate-buffered saline sodium azide; 20 mM PBS containing 0.02% sodium azide; pH 7.0) was added and stirred overnight at 4 ° C., followed by centrifugation to obtain the primary extract. Obtained. The residue was similarly extracted with 700 ml of 20 mM PBSA to obtain a secondary extract. Both extracts were combined and the UV 280 nm absorption and aggregation activity was measured.

  To the above extract, ammonium sulfate powder was added while stirring little by little so as to become 20% saturation, and this mixture was allowed to stand at 4 ° C. overnight. The precipitate obtained by centrifugation (8500 rpm, 30 minutes) was dissolved in PBSA, and then sufficiently dialyzed against the same solvent. After completion of dialysis, the internal solution was centrifuged, and the resulting supernatant was used as a 20% saturated ammonium sulfate salting out fraction. On the other hand, to the supernatant obtained by 20% saturated ammonium sulfate salting-out treatment, ammonium sulfate powder was added so as to be 60% saturated and treated in the same manner to obtain a 20 to 60% saturated ammonium sulfate salting out precipitate fraction. The fraction was measured for UV 280 nm absorption and aggregation activity.

(Hydrophobic chromatography)
Of 106 ml of the 20-60% saturated ammonium sulfate salting out precipitate fraction, 10 ml was dialyzed against 20 mM Tris-HCl buffer (pH 7.0) to obtain 6 ml of an internal solution. The obtained internal solution was centrifuged (10,000 rpm, 10 minutes), and the supernatant was collected. 5 ml of the obtained supernatant was injected into a HiPrep Phenyl FF column (16 × 100 mm, Vt = 20 ml) equilibrated with the same buffer, 20 mM Tris-HCl buffer, pH 7.0 (solvent A) and distilled water. Elution was performed by a concentration gradient method using two solutions of (solvent B). Concentration gradient [solvent B 100% (10 minutes), solvent: B 0% -solvent A 100% (10-60 minutes), solvent A 100% (60-110 minutes)] is a gradient programmer (CCP controller, manufactured by Tosoh Corporation). The flow rate was 4 ml / min. The eluate was collected in 5 ml portions, the absorbance at UV 280 nm was measured, and the aggregation activity was measured.

(Gel filtration)
The active fractions separated by hydrophobic chromatography were combined and concentrated to 5 ml by ultrafiltration. 1 ml of the solution was applied to a TSKgel G3SWxL gel filtration column (Tosoh Corporation, 7.8 × 300 mm, Vt = 14.7 ml) equilibrated with 20 mM PB (pH 7.0) containing 0.3 M NaCl. Elution was performed using 20 mM Tris-HCl buffer (pH 7.0) at a flow rate of 1 ml / min. The eluate was fractionated by 1 ml, and the UV 280 nm absorbance and aggregation activity of each fraction were measured.

(Examination of aggregation activity)
Hemagglutination activity was measured using a microtiter method. 25 μl each of 2-fold serial dilutions of each purified fraction solution prepared with physiological saline were prepared on a microtiter plate. To each diluted solution, 25 μl of 2% erythrocyte suspension was added and stirred gently. After allowing to stand at room temperature for 1.5 hours, the agglutination ability was observed. Aggregation ability was judged with the naked eye, and a case where 50% or more of erythrocytes had aggregated was regarded as positive. The agglutination activity is defined as the hemagglutination activity (titer), ie, the reciprocal of the dilution factor of the largest dilution exhibiting the agglutination activity, and the aggregation factor (titer), ie, the protein concentration of the maximum dilution exhibiting the agglutination activity (minimum aggregation Concentration).

  In this example, trypsin-treated rabbit erythrocytes (TRBC) were used as erythrocytes. The erythrocyte suspension was prepared as follows. First, 2 ml of blood was collected from the ears of rabbits raised in the laboratory, washed 3 times with about 50 ml of physiological saline, and then added with 50 ml of physiological saline to prepare a 2% rabbit erythrocyte suspension. . 1/10 volume of 0.5% trypsin-saline was added thereto, and the mixture was allowed to stand at 37 ° C. for 1.5 hours. The trypsin-treated erythrocytes were washed three times with physiological saline, and 45 ml of physiological saline was added to obtain a trypsin-treated 2% rabbit erythrocyte suspension (TRBC).

  As a result of examining the aggregating active components for trypsin-treated rabbit erythrocytes (TRBC), as shown in Table 1, the extract, the 20-60% saturated ammonium sulfate precipitation precipitate fraction, and the fraction obtained by the hydrophobic chromatography were used. , And a strong hemagglutination activity was detected in the fraction obtained by gel filtration.

In Table 1, “protein concentration” was calculated from A ₂₈₀ (1 mg / ml) = 1.0 by measuring absorption at ₂₈₀ nm (A ₂₈₀ ) for those marked with “a”. For those denoted by "b" measures the absorption (A ₂₈₀₎ of UV280nm, from _{A 280 (1mg / ml) =} 0.97 using the molecular extinction coefficient obtained from the amino acid sequence of a polypeptide according to the present invention Calculated.

(SDS-PAGE)
The fraction having aggregating activity (purified fraction) obtained by the gel filtration was subjected to SDS-PAGE (10% gel). The results are shown in FIG. Lane 1 is a molecular weight marker, lane 2 is a 20-60% saturated ammonium sulfate salting out precipitate fraction (under non-reduction), lane 3 is a 20-60% saturated ammonium sulfate salting out precipitation fraction (under reduction), and lane 4 is the above purification. Fraction (under non-reduction), lane 5 shows the purified fraction (under reduction). The protein staining was CBB (Coomassie brilliant blue R-250) staining.

  As a result of SDS-PAGE, it was confirmed that the purified fraction gave a single band of 14 kDa under reduction and 26 kDa under non-reduction, so that the same subunit (14 kDa) was disulfide bonded (S It is presumed to be composed of a dimer having a —S bond. As described above, 0.4 mg of a purified fraction was finally obtained by a purification process in which the extract was subjected to ammonium sulfate salting out, hydrophobic chromatography, and gel filtration. The yield of 6 mg shown in Table 1 is a value converted per 500 g (wet weight) of algal bodies. The inventors named the purified fraction “MPL”.

  The present inventor has also confirmed that the MPL can be effectively prepared by subjecting the 20 to 60% saturated ammonium sulfate salting out precipitate fraction to anion exchange chromatography. Another lectin (referred to as MPA) contained in Tokakanori can be effectively separated from the MPL by anion exchange chromatography.

  The conditions for the anion exchange chromatography are shown below.

  In order to purify both MPA and MPL lectins at the same time, the previously prepared 20-60% saturated ammonium sulfate precipitation fraction was subjected to HiPrep QXL 16/10 column (φ1.6 × 10 cm, Vt = 20). ml, GE Healthcare).

  That is, the column was equilibrated with 0.02 M Tris-HCl buffer (pH 8.0), and 5 ml of a 20-60% saturated ammonium sulfate salting out precipitation fraction was added. The column was thoroughly washed with the buffer, and then eluted with a concentration gradient of 0M to 1M NaCl in the buffer. The flow rate was 5 ml / min. The washing solution was 10 ml each, and the concentration gradient eluate was 5 ml each.

  For each fraction, A280 absorbance and hemagglutination activity were measured. The fraction in which hemagglutination activity was observed was subjected to SDS-PAGE under reduction. From the result, each fraction was divided into five fractions. Each fraction was subjected to protein content measurement and hemagglutination activity test by the Folin-Lowry method.

  As a result, both lectins were adsorbed on the column, and MPA was eluted as an active peak at around 0.37 M NaCl, and MPL was eluted at around 0.57 M NaCl. Thus, by using anion chromatography, it is possible to separate two types of lectins, MPA (29 kDa) and MPL (26 kDa), which are mixed in a 20 to 60% saturated ammonium sulfate salting out precipitate fraction.

[Example 2: Cloning of MPL cDNA]
As shown below, the 23 N-terminal amino acid sequence of the 14 kDa subunit of the purified fraction “MPL” obtained in Example 1 was determined as GVVDQLIVTYSDGTRVSHGQPGS (SEQ ID NO: 12) using a protein sequencer (Procise 492HT, Applied Biosystems). did. A degenerate primer was designed with reference to the sequence information. By using Rapid Amplification of cDNA Ends (RACE) method using separately prepared Tosakanori-derived 1st strand cDNA solution as a template, the full-length nucleotide sequence of 949 bp of MPL cDNA was revealed.

  First, MPL_d_R1 and MPL_d_R2 primers were prepared with reference to the amino acid sequence at the 23N terminal of MPL.

  The base sequence of MPL_d_R1 is CCRTGISWIACICKIGTICCRTC (SEQ ID NO: 3), and the base sequence of MPL_d_R2 is TAIGTIACDATIARYTGRTC (SEQ ID NO: 4). Here, D is G, A or T, I is inosine, K is G or T, R is A or G, Y is C or T, and W is IUB code indicating A or T.

  Extraction of total RNA from Tosakori alga body stored in RNAlater at −20 ° C. using Plant RNA Isolation Reagent (Life Technologies Corp.), followed by purification of mRNA with NucleoTrap mRNA (Macherey-Nagel), and GeneRacer Kit (Life Technologies Corp.) prepared full-length cDNA.

  Next, PCR was performed using GeneRacer_5′_Primer and MPL_d_R1 primer pairs using the full-length cDNA as a template. The base sequence of GeneRacer — 5′_Primer is CGACTGGAGCACGAGGACACTGA (SEQ ID NO: 5).

  Nested PCR was performed using GeneRacer_5′_Nested_Primer and a primer pair of MPL_d_R2 using a 100-fold diluted solution of the product obtained by the PCR as a template. The base sequence of GeneRacer_5′_Nested_Primer is GGACACTGACATGGACTGAAGGAGTA (SEQ ID NO: 6).

  The resulting Nested PCR product is purified by low melting point agarose, then subcloned using pGEM-T Easy Vector System (manufactured by PROMEGA), the purified plasmid is recovered from the obtained clone, and the nucleotide sequence is obtained by the dideoxy method. Made a decision (more than 5'RACE).

  Primer MPL_F1 was newly prepared based on the obtained base sequence. The base sequence of MPL_F1 is TGTAGCAGCCATGTCTTTGC (SEQ ID NO: 7).

  PCR was performed using the full length cDNA as a template and a primer pair of MPL_F1 and GeneRacer_3'_Primer. The obtained amplification product is purified by low melting point agarose, then subcloned using pGEM-T Easy Vector System (PROMEGA), the purified plasmid is recovered from the obtained clone, and the base sequence is determined by the dideoxy method (3'RACE).

  The base sequence of GeneRacer_3'_Primer is GCTGTCAACGATACGCTACGTAACG (SEQ ID NO: 8).

  Perform PCR using the MPL_5'_End_F and MPL_3'_End_R primer pairs prepared from the 5 'and 3' end sequences of the MPL cDNA revealed from the 5'RACE and 3'RACE, and a high-accuracy DNA polymerase. By determining the base sequence of the amplified product, the full-length base sequence of MPL cDNA was confirmed.

  The base sequence of the MPL_5′_End_F primer is AATCCACATTCAACTGCACTG (SEQ ID NO: 9), and the base sequence of the MPL_3′_End_R primer is AAATCGACGCACACAGAAGTC (SEQ ID NO: 10).

  The full-length nucleotide sequence of the MPL cDNA and its deduced amino acid sequence are shown in FIG. In FIG. 1, the asterisk indicates the stop codon, the broken line indicates the signal peptide (predicted using SignalP 3.0), and the solid line indicates the 23 N-terminal sequence of the 14 kDa subunit of the purified fraction “MPL” obtained in Example 1.

  Analysis of the deduced amino acid sequence revealed that the cDNA shown in FIG. 1 encodes a total of 198 residues including 22 residues (1-22) of the signal peptide region. On the other hand, from the analysis of deduced amino acid sequences, the cDNA shown in FIG. 1 was thought to encode the propeptide region 74 residues (23-96) and the mature protein region 102 residues (97-198). Further examination in Example 6 revealed that the mature protein region was the 146th amino acid residue at positions 53-198.

[Example 3: Sugar binding specificity of MPL]
The sugar binding specificity of MPL was revealed by the hemagglutination inhibition test. In this hemagglutination inhibition test, 20-60% saturated ammonium sulfate precipitation precipitate prepared in Example 1 and MPL prepared in Example 1 were tested, and their hemagglutination activity (titer 4) was inhibited. We searched for sugar compounds.

  The hemagglutination inhibition test was performed as follows. First, 25 μl each of a 2-fold serial dilution of a sugar solution prepared with physiological saline was prepared on a microtiter plate. The concentration of the saccharide stock solution used was 100 mM for monosaccharides and disaccharides, and 2 mg / ml for glycoproteins. To this was added 25 μl each of the saturated ammonium sulfate salting-out precipitation fraction solution and MPL solution each adjusted to an agglomeration titer (titer) of 4, and the mixture was lightly stirred and allowed to stand at room temperature for 1.5 hours. 25 μl of TRBC was added thereto, and the mixture was allowed to stand at room temperature for 2 hours.

  The presence or absence of agglutination-inhibiting ability was judged with the naked eye. The aggregation inhibitory activity (aggregation inhibitory activity) was expressed as the minimum inhibitory concentration, ie, the minimum concentration (mM or μg / ml) exhibiting the aggregation inhibitory ability. The results are shown in Table 2. In Table 2, the “minimum aggregation inhibitory concentration” represents the minimum concentration of the sugar compound that inhibits the hemagglutination activity of the test solution having the titer of 4 described above, and “NT” represents that it has not been measured.

  As shown in Table 2, in this hemagglutination inhibition test, monosaccharides and disaccharides are represented by D-glucose (shown as Glc in the table. Hereinafter, the abbreviations shown in Table 2 are shown in parentheses following the name of the sugar. D-mannose (Man), D-galactose (Gal), N-acetyl-D-glucosamine (GlcNAc), N-acetyl-D-galactosamine (GalNAc), N-acetylneuraminic acid (NeuAc) L-fucose (Fuc), D-xylose (Xyl), L-rhamnose (Rha), and lactose were used.

  As glycoproteins, transferrin and asialotransferrin were used as those containing complex sugar chains. In addition, yeast mannan was used as a glycoprotein containing a high mannose type sugar chain, and porcine thyroglobulin and asialogbutyroglobin were used as glycoproteins containing a complex type sugar chain and a high mannose type sugar chain.

As is apparent from Table 2, the hemagglutination activity of MPL is not inhibited by the monosaccharides and disaccharides tested, and glycoproteins containing high mannose sugar chains, complex sugar chains and high mannose sugar chains It was blocked only by the containing glycoprotein. Thus, it was shown that MPL has a very low sequence homology with conventionally known lectins and a high affinity for high mannose sugar chains.
[Example 4: Interaction between AIDS virus surface glycoprotein gp120 and MPL]
Infection of an HIV host is established by the interaction of gp120, a surface glycoprotein of HIV, with the surface receptor CD4 of the host lymphocyte. The high mannose sugar chain of gp120 is indispensable for the interaction. Therefore, lectins that specifically bind to high mannose sugar chains can be potent inhibitors of HIV infection.

  Therefore, the surface plasmon resonance (SPR) method was used for the interaction between MPL and commercially available recombinant sugar-added HIV-1 IIIB gp120 (baculovirus; 15 high-mannose sugar chains per molecule; manufactured by ImmunoDiagnostics). Quantitative analysis. BIAcore2000 (GE Healthcare) was used for the SPR method, recombinant sugar-added HIV-1 IIIB gp120 was immobilized on a CM5 sensor chip (GE Healthcare), and the MPL solution was used as an analyte according to the manual. Measurement and analysis.

  The immobilization was performed according to the manual. Specifically, immobilization was performed using an amine coupling method. The immobilization amount was adjusted by a manual injection method so as to be in the range of 300 to 400 RU.

  In the SPR method, a specific interaction between biomolecules can be quantitatively measured in a short amount of time without labeling the biomolecules. In this method, when a ligand is immobilized on the surface of a sensor chip and a solution containing a substance (analyte) acting on the ligand is added, a small amount of mass change caused by molecular binding / dissociation is detected as a change in SPR signal. .

The change in mass is expressed in resonance units (RU), and 1000 RU corresponds to a change in reflection angle of 0.1 ° due to resonance, which means that the analyte bound to the ligand at 1 ng / mm ² . Dextran is coated on the gold thin film on the surface of the sensor chip, and the ligand is immobilized mainly through carboxyl groups introduced into the dextran.

Prior to the affinity analysis of MPL and the above recombinant gp120 by the SPR method, the analysis method was examined in a preliminary experiment, and the kinetics analysis by the nonlinear least square method was judged to be appropriate. Therefore, to calculate the approximate _{K D} values from the resulting sensorgram, the 0.1~10K _D [M] as a measure of concentration, to prepare 2-fold dilution series in five steps or more analytes (MPL) solution .

  To create an analysis program, use the “Customaized Application” according to the manual. Of the four flow cells in the sensor chip, the flow cell 1 with nothing fixed is used as a control, and the subtraction function from the flow cell with the recombinant gp120 fixed is used. used. Under this analysis program, an analyte (MPL) solution was allowed to flow on the sensor chip at a flow rate of 30 μl / min for 3 minutes, and then the buffer was allowed to flow for 3 minutes to measure the amount of lectin binding / dissociation. The amount of increase in RU from 5 seconds after the start of addition of analyte to 5 seconds before the end of addition was defined as the binding amount, and the amount of RU decrease from 10 seconds after the start of buffer addition to 10 seconds before the end of addition was defined as the dissociation amount.

Next, the sensor chip was washed and regenerated with 100 mM HCl and 100 mM NaOH. The obtained sensorgram, the bonding phase and dissociation phase was curve fitting simultaneously, association rate constant ka, dissociation rate constants kd, were calculated affinity constant K _A, and a dissociation constant K _D.

The results are shown in FIG. 2A is a sensorgram of the interaction between immobilized gp120 and MPL, and FIG. 2B shows the affinity constant between gp120 and MPL. FIG. 2B shows the association rate constant Ka (M ⁻¹ s ⁻¹ ), dissociation rate constant Kd (s ⁻¹ ), affinity constant K _A (M ⁻¹ ), and dissociation constant K _D (M). It was. The affinity constant means that the larger the value, the higher the affinity (the stronger the binding force).

As shown in FIG. 2, MPL was found to have a strong affinity for gp120 (K _D = 4.50 × 10 ⁻⁹ M). From this, it can be said that MPL has a very low sequence homology with conventionally known lectins and can sufficiently inhibit the interaction between HIV gp120 and host lymphocyte CD4. Therefore, MPL is promising as a new anti-HIV agent.

  Moreover, as shown in Example 3, MPL has high affinity for high mannose sugar chains. Therefore, MPL is promising as an anti-HIV agent. In addition, it can be an effective infection inhibitor against viruses that infect glycoproteins having high mannose-type sugar chains by binding to host receptors.

Example 5: Further purification of MPL
(Example 5-1: Purification of Tosacano lectin by anion exchange chromatography)
As described in Example 1, since it was found that anion exchange chromatography is useful for the separation of MPA and MPL, further refinement of the purification by anion exchange chromatography was performed and the purification method was improved.

  HiPrep QXL equilibrated with 20 mM Tris-HCl buffer solution (pH 8.0) (hereinafter referred to as “TB”) from 20 to 60% saturated ammonium sulfate salting out fraction prepared in Example 1 The column was added to a 16/10 column (φ1.6 × 10 cm, Vt = 20 ml, GE Healthcare), and the column was sufficiently washed with TB, and then eluted stepwise with 0.2M and 1M NaCl in TB (step by step). Stepwise elution). As a result, the active ingredient was found in the 0.2M NaCl elution fraction.

  FIG. 4 is a diagram showing the results of subjecting a 20 to 60% saturated ammonium sulfate salting out precipitate fraction to anion exchange chromatography (stepwise elution) using a HiPrep QXL 16/10 column.

  In FIG. 4, the horizontal axis represents the fraction number, the vertical axis represents the absorbance at 280 nm, and the right side represents the hemagglutination activity (titer). In the figure, the absorbance measurement results are indicated by circles, and the measurement results of hemagglutination activity (titer) are indicated by triangles.

  The number 1 in parentheses indicates the position at which elution of the adsorbed component was started with 0.2 M NaCl in TB after adding the 20-60% saturated ammonium sulfate salting-out precipitation fraction to the column and washing the non-adsorbed component. . The number 2 in parentheses indicates the position where cleaning of other adsorbed components was started with 1M NaCl in TB after the elution.

  As shown in FIG. 4, hemagglutination active components were observed in the 0.2M NaCl elution fraction. 70 ml of this hemagglutination active component (crude lectin fraction) was added to a HiPrep QXL 16/10 column equilibrated with TB, and the column was washed with TB, followed by a NaCl concentration gradient (0 to 0.2 M) in TB. Elution (gradient elution method).

  The eluate was monitored for absorbance at 280 nm, and 2 ml was collected, and the hemagglutination activity of each fraction was measured. FIG. 5 shows the results of subjecting the crude lectin fraction to anion exchange chromatography (gradient elution) using a HiPrep QXL 16/10 column. As shown by the solid line in FIG. 5, the eluate was separated into three protein peaks showing aggregation activity.

  In FIG. 5, the horizontal axis is the fraction number. The left vertical axis represents the absorbance at 280 nm, and the measurement result of the absorbance is indicated by a solid line. On the right vertical axis, “HA” represents hemagglutination activity (titer), and the measurement result of hemagglutination activity (titer) is indicated by a triangle. In the right vertical axis, “NaCl in TB” indicates a concentration gradient of NaCl (in TB), and the concentration gradient is indicated by a dotted line in the figure.

  The eluate was fractionated into four fractions (I to IV) shown in FIG. 5, and each fraction was subjected to SDS-PAGE (10% gel) in an amount corresponding to 20 μg of protein. The results are shown in FIG. The protein staining was CBB (Coomassie brilliant blue R-250) staining.

  FIG. 6A shows the result of electrophoresis under non-reduction, and FIG. 6B shows the result of electrophoresis under reduction. M is a molecular weight marker, lane 1 is a 20-60% saturated ammonium sulfate precipitation precipitate fraction, lane 2 is a hemagglutination active component (0.2M NaCl elution fraction) obtained with a HiPrep QXL 16/10 column (stepwise elution). ), Lane 3 represents fraction I, lane 4 represents fraction II, lane 5 represents fraction III, and lane 6 represents fraction IV. The hemagglutination active component is also referred to as “crude lectin fraction”.

  Fractions I and II were confirmed to give a nearly single band of 29 kDa under reduction as shown in FIG. 6B. Therefore, Fraction I was named MPA-1 and Fraction II was named MPA-2, and used as the final purified lectin.

  Although details are not shown, MPA-1 and MPA-2 were found to be MPA (29 kDa) isoforms described in Example 1 from the results of molecular weight measurement, N-terminal amino acid sequence analysis and cDNA cloning.

  The MPL described in Example 1 eluted in fraction IV. Fraction IV gave two band components of 26 kDa and 55 kDa under non-reduction (FIG. 6A), and gave a main band component of 14 kDa and a minor band component of 8 kDa and 5 kDa under reduction. In addition, since fraction III gives band components of 29 kDa and 14 kDa under reduction, it is considered that MPL and MPA are mixed.

(Example 5-2: Isolation of MPL-1 and MPL-2 by anion exchange chromatography)
5 ml of the above MPL fraction (fraction IV) was added to a TSKgel DEAE-5PW column (7.5 × 75 mm, Tosoh Corp.) equilibrated with TB, and a gradient of NaCl concentration in TB (0-0.2M) was added. Elution was performed. During the operation, peaks were collected while monitoring the absorbance at 280 nm.

  FIG. 7 shows the results of purification by anion exchange chromatography using a MPL TSKgel DEAE-5PW column. In the figure, the horizontal axis represents the elution time, the left vertical axis represents the absorbance at 280 nm, and the right vertical axis represents the concentration of NaCl. The solid line indicates the measurement result of absorbance at 280 nm, and the dotted line indicates the concentration of NaCl. (1) to (4) are peak numbers.

  As a result of anion exchange chromatography using a TSKgel DEAE-5PW column, MPL was separated into four peaks (peaks (1) to (4)) as shown in FIG. Therefore, next, after each of the peaks (1) to (4) was collected, an amount corresponding to 20 μg of protein was subjected to SDS-PAGE (10% gel). The results are shown in FIG.

  In the figure, “non-reduction” indicates the migration result under non-reduction, and “reduction” indicates the migration result under reduction. M represents a molecular weight marker, S represents MPL, and lanes 1 to 4 represent the results of electrophoresis of peaks (1) to (4), respectively.

  Under reduction, a nearly single band of 14 kDa was observed at peaks (1) and (3). Peaks (1) and (3) gave a proteinaceous band around 26 kDa under non-reduction.

  For peaks (2) and (4), the presence of peptides of 8 kDa and 5 kDa was confirmed in addition to 55 kDa under non-reduction and 14 kDa under reduction. The presence of a proteinaceous band was observed at 26 kDa and 55 kDa under non-reduction conditions in common to all peaks, but the 26 kDa component was mainly observed in peaks (1) and (3), and the 55 kDa component was mainly present in peaks (2) and (4). It turned out to be an ingredient.

  Therefore, the peak (1) was named MPL-1 and the peak (3) was named MPL-2, and used as the final purified sample. For MPL-1 and MPL-2, the molecular weight was measured by ESI-MS using LTQ Orbitrap XL (Thermo Fisher Scientific). FIG. 9 shows the molecular weight measurement results of MPL-1 and MPL-2.

  9A and 9B, it was found that the molecular weights of MPL-1 and MPL-2 were 31,104.1 Da and 31,132.0 Da, respectively.

  With respect to MPL-1 and MPL-2, a hemagglutination inhibition test was performed in the same manner as in Example 3. The results are shown in Table 3.

  In Table 3, although described as “monosaccharide and disaccharide”, as in Example 3, the monosaccharide is D-glucose (Glc), D-mannose (Man), D-galactose (Gal). N-acetyl-D-glucosamine (GlcNAc), N-acetyl-D-galactosamine (GalNAc), N-acetylneuraminic acid (NeuAc), L-fucose (Fuc), D-xylose (Xyl) or L-rhamnose (Rha) is used at 100 mM each, and 100 mM of lactose (Lac) is used as a disaccharide.

  As the glycoprotein containing a complex type sugar chain, the glycoprotein containing a high mannose type sugar chain, and the glycoprotein containing a complex type sugar chain and a high mannose type sugar chain, the same ones as in Example 3 were used. . In addition, fetuin and asialofetin are used as glycoproteins containing N-type sugar chains (complex type) and O-type sugar chains, and bovine submandibular mucin and asiaroux submandibular mucin are used as glycoproteins containing O-type sugar chains. Using.

  As is clear from Table 3, the hemagglutination activity of MPL-1 and MPL-2 is similar to that of MPL shown in Example 3, including glycoproteins containing high mannose sugar chains, complex sugar chains and high It was blocked only by glycoproteins containing mannose-type sugar chains. Thus, it was shown that MPL-1 and MPL-2 have high affinity for high mannose type sugar chains, similarly to MPL.

[Example 6: Structural analysis of MPL]
(Example 6-1: Blotting of MPL fraction)
The MPL fraction (26 kDa) obtained in Example 1 was subjected to 12% tris-tricine SDS-PAGE under non-reduction and reduction (addition of 2-mercaptoethanol), and a polyvinylidene difluoride (PVDF) membrane (Immobilon- P (registered trademark), Millipore).

  Transfer to the PVDF membrane was conducted for 1 hour at a constant current of 144 mA in a blotting buffer (CAPS buffer: methanol: ultrapure water = 1: 1: 8) using a semi-drive blotting device (AE-6677: ATTO CORPORATION). Went by.

  CAPS buffer is prepared by dissolving 11.1 g of CAPS (3-Cyclohexylaminopropane sulfonic acid, Wako Pure Chemical Industries) in 450 ml of ultrapure water, adjusting the pH to 11.0 using NaOH, and then increasing the volume to 550 ml with ultrapure water. We used what we did. After the transfer, the PVDF membrane was stained with CBB, air-dried overnight, the target 14 kDa component and the 8 kDa component were cut out, and the N-terminal amino acid sequence was obtained using Procise (registered trademark) 492HT in the same manner as in Example 2. Analyzed.

  FIG. 10 is a diagram showing a PVDF membrane that is blotted and CBB stained for the MPL fraction. In FIG. 10, M represents a molecular weight marker, “non-reduced” represents a band obtained under non-reduction, and “reduction” represents a band obtained under reduction.

(Example 6-2: Analysis of N-terminal amino acid sequence and determination of amino acid sequence of MPL-1)
The N-terminal amino acid sequence of the 8 kDa component shown in FIG. 10 was determined as GVVDQLI (SEQ ID NO: 14). This sequence coincided with the N-terminus of the amino acid sequence shown in SEQ ID NO: 12 determined in Example 2.

  On the other hand, for the 14 kDa component, the sequence could not be analyzed, and it was assumed that the N-terminus was blocked. Therefore, N-terminal blocking by a pyroglutamyl group was predicted, and depyroglutamylation was attempted.

  That is, the PVDF membrane to which the 14 kDa component was transferred was washed twice with 1 ml of 60% methanol and once with 1 ml of 90% methanol, and this was washed with 100 mM containing 0.5% (w / v) polyvinylpyrrolidone (PVP) -55. It was immersed in 500 μl of acetic acid and allowed to stand at 37 ° C. for 30 minutes. Next, the membrane was washed 10 times or more with distilled water, the membrane was moistened with methanol, and enzyme digestion was performed.

  For enzymatic digestion, 2 mU of Pfu Pyroglutamate Aminopeptitase (TAKARA) was dissolved in 200 μl of enzyme reaction buffer (10 mM dithiothreitol (DTT), 1 mM EDTA and 10 mM PB (pH 7.0)), and the membrane was dissolved in this solution. After immersion, the reaction was performed at 50 ° C. for 5 hours. After removing the pyroglutamyl group by this reaction, the membrane was washed 3 times with distilled water and analyzed using Procise (registered trademark) 492 HT.

  As a result, the sequence after 2 residues was determined as TGSCNTFQRS (SEQ ID NO: 15). From these results, it was found that the N-terminal of the 14 kDa component was blocked by glutarylation of glutamine, and the N-terminal amino acid sequence was QTGSCNTFQRS (SEQ ID NO: 16).

  As shown in FIG. 1, this sequence is the 53rd of the region (23-96) predicted to be a propeptide in Example 2 in the deduced amino acid sequence of MPL cDNA revealed by cDNA cloning in Example 2. Found after the residue. In FIG. 1, the N-terminal amino acid sequence of the 14 kDa component determined this time is indicated by a box.

  The calculated molecular weight of the region consisting of 53-198 residues in the deduced amino acid sequence of MPL cDNA is 15,553.3 Da, but the measured molecular weights of MPL-1 and MPL-2 by ESI-MS were determined in Example 5-2. As such, they are 31,104.1 Da and 31,132.0 Da, respectively. From the results of SDS-PAGE (FIGS. 6 and 8), it is considered that MPL is a homodimer due to S—S bonds, and therefore a component consisting of 53 to 198 residues forms a dimer by one S—S bond. Assuming that the calculated molecular weight is 31,104.6, it matches the measured molecular weight of MPL-1.

  From these results, it was found that the cDNA obtained in Example 2 encodes MPL-1, and that MPL-1 is a dimer by a disulfide bond of a 15.6 kDa subunit.

  That is, the full length base sequence of the cDNA of the MPL-1 subunit (the above 15.6 kDa subunit) is the sequence shown in SEQ ID NO: 11, and the deduced amino acid sequence of the base sequence is the sequence shown in SEQ ID NO: 13. . The base sequence encoding the mature protein of the MPL-1 subunit is shown in SEQ ID NO: 1, and the deduced amino acid sequence is shown in SEQ ID NO: 2.

  Accordingly, MPL-1 is a polypeptide that binds to a high mannose sugar chain, and is (a) an amino acid sequence represented by SEQ ID NO: 2; or (b) an amino acid sequence represented by SEQ ID NO: 2; It can be said that it is a dimer of a polypeptide consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, inserted or added.

  And the antiviral agent containing the said dimer can also be used as an antiviral agent which targets the virus provided with a high mannose type sugar chain. A membrane in which the dimer is fixed to, for example, an ultrafiltration membrane can also be used as a virus removal membrane.

  In addition, it was found that the N-terminal amino acid sequence (SEQ ID NO: 12) of MPL obtained in Example 2 was an 8 kDa component. It is clear that this 8 kDa component is derived from the 15.6 kDa component, but further analysis is necessary as to whether it is a degradation product of the 15.6 kDa component or functions as a component of MPL.

  Although there was a difference between the measured molecular weight by ESI-MS and the estimated molecular weight on SDS-PAGE, protein mobility by SDS-PAGE depends on the nature of the components (charge, hydrophobicity, structure, etc.). And a deviation of several kDa may occur.

  Therefore, regarding the component on SDS-PAGE, for example, it is considered that there is no problem in that there is a difference between 14 kDa which is the estimated molecular weight on SDS-PAGE and the 15.6 kDa component which is the measured molecular weight by ESI-MS. .

  When MPL-1 was subjected to intramolecular domain search by the Pfam program, MPL-1 contained a Jacalin-like lectin domain and sequence homology with the red alga Griffithsia sp.-derived lectin Griffithsin (GRFT) and banana Musa acuminata lectin ( The same rate) was 33% and 27%, which were very low.

  When a homologous sequence search was performed using the Basic Local Alignment Search Tool (BLAST) for the mature protein region, some of them had a Jacalin-like lectin domain containing the above two lectins, many of which were hypothetical proteins. There was a hypothetical protein (35%) derived from the bacterium Brevibacillus laterosporus.

  Thus, it was shown that MPL-1 has a motif partially similar to the motif of the known lectin, but the sequence homology with the conventionally known lectin is very low. It turned out to be a protein.

[Example 7: Sugar chain binding specificity of MPL-1]
(Example 7-1: Centrifugal ultrafiltration-HPLC method)
The sugar chain binding specificity of MPL-1 purified as described above was examined. That is, first, 90 μl (45 pmol) of a 500 nM MPL-1 solution in 50 mM Tris-HCl buffer (pH 7.0) and 10 μl (3 pmol) of a 300 nM pyridylaminated (PA) sugar chain aqueous solution were lightly mixed, and then at room temperature for 60 minutes. Keep warm.

  This reaction solution is subjected to centrifugal filtration (10,000 × g, 30 seconds) using a microcentrifuge ultrafilter (Nanosep 10K Omega, PALL), 20 μl of the filtrate is subjected to HPLC, and the amount of PA sugar chain to be eluted is determined. The amount of free sugar chain was measured.

  Next, 90 ml of 50 mM Tris-HCl buffer (pH 7.0) and 10 μl of PA sugar chain aqueous solution were mixed and treated in the same manner, and 20 μl of the filtrate was subjected to HPLC, and the amount of PA sugar chain to be eluted Was measured as the amount of added sugar chain.

  The amount of bound sugar chains was calculated as a value obtained by subtracting the amount of free sugar chains in the reaction solution from the amount of added sugar chains. The sugar chain binding activity of the lectin was expressed as the binding rate, that is, the ratio (%) of the amount of the linked sugar chain to the added sugar chain. The binding test was performed twice for each sugar chain, and the binding rate was calculated as an average value.

  Separation and quantification of PA sugar chains were performed using reverse phase HPLC. That is, the test solution was injected into a TSKgel ODS-80 ™ column (4.6 × 150 mm) in a column oven at 40 ° C. and eluted with 0.1 M ammonium acetate-15% methanol. The flow rate was 1.0 ml / min, the eluate was monitored at an excitation wavelength of 320 nm and a fluorescence wavelength of 400 nm, and the peak area of each sugar chain was analyzed and quantified with EZChrom Elite (Agilent Technology).

  27 types of PA sugar chains as test sugar chains: 6 types of N-glycoside type sugar chains (PA-Sugar Chain 001, 002, 004, 009, 010, 023, TAKARA), 11 types of high mannose type (PA -Sugar Chain 017, 018, 019, 020, 051, 052, 053, 054, 055, 056, 058, TAKARA), one common core structure (PA-Sugar Chain 016, TAKARA), one common core related sugar chain (PA-042, Masuda Chemical Industries), 3 glycolipid sugar chains (PA-Sugar Chain 027, 028, 038, TAKARA) and 5 oligomannoses were used. Among these, a commercial item (TAKARA) was used except for PA-oligomannose.

  PA-oligomannose was prepared as follows using a PA-forming apparatus (PALSTATION, TAKARA).

  That is, each 50 nmol of Manα1-2Man, Manα1-3Man, Manα1-6Man, Manα1-6 (Manα1-3) Man, Manα1-6 (Manα1-3) Manα1-6 (Manα1-3) Man (DextraLaboratories, Funakoshi) After lyophilization, 20 μl of a coupling reagent (2-aminopyridine / acetic acid solution, Pyridylamination Reagent Kit, TAKARA) was added and reacted at 90 ° C. for 60 minutes. To this, 20 μl of a reducing reagent (borane-dimethylamine / acetic acid solution) was added and reacted at 80 ° C. for 60 minutes. After adding 20 μl of triethylamine-methanol to this reaction solution and stirring well, 40 μl of toluene was added and stirred, and the mixture was dried under reduced pressure at 60 ° C. for 10 minutes under nitrogen flow.

  To this, 20 μl of methanol and 40 μl of toluene were added and stirred. Similarly, after drying under reduced pressure, 50 μl of toluene was added and again dried under reduced pressure. Excess reagent was removed by normal phase HPLC.

That is, after the above PA product was dissolved in 25 μl of ultrapure water, a TSKgel NH ₂ -60 column equilibrated with 50 mM acetic acid-triethylamine (pH 7.3) / acetonitrile (25/75) in a 40 ° C. column oven ( 4.6 × 250 mm), 50 mM acetic acid-triethylamine (pH 7.3) / acetonitrile (25/75) (solvent A) and 50 mM acetic acid-triethylamine (pH 7.3) / acetonitrile (50/50) (solvent B) Was eluted at a flow rate of 1.0 ml / min using a concentration gradient of 2 solutions of [solvent A 100% (0-5 minutes), solvent A 0% -solvent B 100% (5-55 minutes)]. The eluate was monitored at an excitation wavelength of 310 nm and a fluorescence wavelength of 380 nm, and a PA sugar chain (oligomannose) peak was fractionated.

  The obtained PA-oligomannose was quantified as follows. That is, 50 μl of each of the above oligomannose fractions was dried under reduced pressure, and then subjected to gas-phase acid hydrolysis in 4N HCl / 4M TFA (1/1 (v / v)) at 100 ° C. for 4 hours.

  This hydrolyzate was dissolved in 50 μl of ultrapure water, and 10 μl thereof was injected into a TSKgel ODS-80TM column (4.6 × 150 mm) in a column oven at 40 ° C., and 0.1 M ammonium acetate-10% methanol was used. Eluted. The flow rate was 1.0 ml / min, and the eluate was monitored at an excitation wavelength of 320 nm and a fluorescence wavelength of 400 mm.

  Thereby, the peak area of PA-mannose liberated by hydrolysis from PA-oligomannose was measured. This PA-mannose was quantified by comparing it with the elution peak area from the same column of 10 pmol of standard PA-mannose (TAKARA) to obtain the amount of PA-oligomannose.

(Example 7-2: Sugar chain binding specificity test result)
The binding properties of MPL-1 to 27 types of pyridylaminated (PA-modified) sugar chains were examined by centrifugal ultrafiltration-HPLC. FIG. 11 shows the structure of 27 types of PA sugar chains and the binding activity of MPL-1 to the sugar chains. In the figure, those with a binding activity (unit%, amount of bound sugar chain / added sugar chain amount × 100) of 10% or less are indicated by hyphens.

  As shown in FIG. 11, it was found that MPL-1 specifically binds only to a high mannose type sugar chain among N-glycoside type sugar chains in the tested sugar chain. Since this complex did not bind to the complex type (1-6 shown in FIG. 11) and the common core structure (23-24 shown in FIG. 11), this lectin has a branch composed of oligomannose having a high mannose sugar chain structure. It was found to recognize the sugar chain part. More interestingly, with regard to the binding to high mannose sugar chains (7-17 shown in FIG. 11), a clear difference was observed in the binding activity due to the difference in the oligomannose structure of the branched sugar chain portion.

  Here, the non-reducing end of the high mannose-type sugar chain is the Man (α1-3) arm (D1 arm) of trimannose core, and the Man (α1-3) arm branched from the Man (α1-6) arm of the same core. (D2 arm) and Man (α1-6) arm (D3 arm) branched from the Man (α1-6) arm.

  MPL-1 showed high binding activity only with those having α1-2Man at the non-reducing end of the D3 arm (9, 10, 13, 15 shown in FIG. 11), and the binding rate was 96% or more. On the other hand, MPL-1 against high mannose type sugar chains (7, 8, 11, 12, 14, 16, 17 shown in FIG. 11) and oligomannose (18-22 shown in FIG. 11) not containing the same Man residue. The binding activity was 10% or less excluding the sugar chain 12 shown in FIG. Sugar chain 12 is an M7 sugar chain that does not contain α1-2Man in the D3 arm and has Man (α1-2) Man (α1-2) at the non-reducing end of the D1 arm, but an M8 sugar chain having a similar structure. (14 shown in FIG. 11), since no binding is observed, it is considered that it is not the main recognition sugar chain structure of MPL-1.

  From these results, it is considered that MPL-1 binds only to a high-mannose sugar chain having an α1-2Man residue at the non-reducing end of the D3 arm. Those that do not bind to monosaccharides (including mannose) and have such strict high mannose sugar chain recognition have not been found in known lectins. Isolectin MPL-2, which showed a profile similar to that of MPL-1 in the hemagglutination inhibition test with a sugar compound (Table 3), is also expected to have the same sugar chain binding specificity.

  The present invention is not limited to the above-described embodiments, and various modifications are possible within the scope shown in the claims, and embodiments obtained by appropriately combining technical means disclosed in different embodiments. Is also included in the technical scope of the present invention.

  The polypeptide according to the present invention is a novel polypeptide capable of specifically binding to high mannose type sugar chains provided in viruses such as HIV, and can be applied to antiviral agents, virus removal membranes and the like. Therefore, it can be widely used in the medical industry, the pharmaceutical industry, and the like.

Claims (10)

A polypeptide that binds to a high mannose sugar chain,
(A) an amino acid sequence shown in SEQ ID NO: 2; or (b) an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 2,
A polypeptide characterized by comprising:   A polynucleotide encoding the polypeptide of claim 1. The polynucleotide according to claim 2, which is any one of the following (a) and (b):
(A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1; or (b) a polynucleotide that hybridizes with any of the following (i) or (ii) under stringent conditions:
(I) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1; or (ii) a polynucleotide comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1.   An antiviral agent comprising the polypeptide according to claim 1 and targeting a virus having a high mannose sugar chain.   The antivirus according to claim 4, wherein the virus is a virus selected from the group consisting of AIDS virus, influenza virus, hepatitis C virus, Ebola virus, human herpesvirus 6 and severe acute respiratory syndrome virus. Agent.   A virus removal membrane, wherein the polypeptide according to claim 1 is immobilized.   A vector comprising the polynucleotide according to claim 2 or 3.   A method for producing the polypeptide according to claim 1, wherein the vector according to claim 7 is used.   A transformant in which the polynucleotide according to claim 2 or 3 is introduced.   A method for producing the polypeptide according to claim 1, wherein the transformant according to claim 9 is used.