JP2012161314A - Hpv detection and quantification by real time multiplex amplification - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide primers and detection probes, which are useful for the detection of human papillomaviruses (HPV), and more particularly of HPV, which can be oncogenic for the mucosal epithelia; and to provide a template sequence suitable for constructing such primer and probe.SOLUTION: The amplification and detection systems are group-targeted systems, namely A5-, A6-, A7-, and A9-targeted systems. The amplification and detection systems allow for an amplification of HPV in multiplex as well as for a real-time detection, whereby at least the thirteen HR HPV can be detected in a single-tube assay. The invention further allows for a reliable quantitation of HPV viral loads in real-time multiplex amplification.

Description

  The present invention relates to the detection of human papillomavirus (HPV), more specifically HPV having tropism for mucosal epithelium (mucosal HPV), more specifically HPV that may be carcinogenic to mucosal epithelium. The present invention provides amplification primers and detection probes useful for that purpose, as well as reference template sequences suitable for designing and constructing such primers and probes.

Human papillomavirus (HPV) contains an approximately 7900 bp circular double-stranded DNA genome and is organized into three main regions:
An early coding region comprising the genes E1, E2, E4, E5, E6 and E7 involved in viral replication and neoplastic transformation,
A late coding region comprising the genes L1 and L2 encoding the viral capsid protein,
-Non-coding control region called LRC (Long Control Region) and located between E gene and L gene.

  HPV constitutes a group of viruses and is involved in benign and malignant lesions of the skin or mucosal epithelium. To date, over 100 different HPV types have been identified.

Over 40 HPV types belonging to the mucosa group are detected in the anal mucosa.
HPV is a major risk factor in the development of lesions in the squamous epithelium (SILs) and is classified as low grade (LSIL) or high grade (HSIL) depending on severity.

  HPV can cause cervical epithelial neoplasia (CIN) from benign lesions (CIN1), such as warts, to precancerous lesions (CIN2-CIN3), in situ and invasive cancers.

  HPV is currently known to be directly involved in cervical cancer. Detecting HPV is essential for the prognosis of CIN and cervical cancer. Early and accurate detection of HPV is a key factor for recovery from cervical cancer.

  It has also been shown that increasing the HPV viral load in cervical smears increases the risk of CIN3 and cervical cancer.

  Many oncogenic HPV genotypes that infect the anus are classified as potentially high-risk HPV genotypes (HR HPV) based on their incidence or morbidity in cervical cancer. The presence, persistence and / or recurrence of HR HPV is a poor prognostic indicator. To date, 13 HPVs have been designated HR HPVs, ie HPVs 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18. The HR HPVs with the highest morbidity are HPV types 33, 31, 16, 45 and 18.

  Other oncogenic HPVs are considered to be low risk HPV (LR HPV), for example HPV2, HPV3, HPV6, HPV11, HPV13, HPV32, HPV40, HPV42, HPV43, HPV44, HPV57.

  The clinical classification of HPV types into HR or LR groups has evolved and varies slightly from person to person. The classification of a given HPV into the LR group only means that this HPV type is not found to be associated with cervical cancer.

  For example, HPV53 and HPV66 are now thought to be probably HR HPV (van Ham et al. 2005, J. Clin. Microbiol. Vol. 43, n6, p. 2662-2667). The first 13 HR HPV groups can be further expanded to at least 15 HPV types.

  Other HPVs have been described as oncogenic HPVs, but there is no clear determination as to their HR or LR status issues, as is the case with HPV67, HPV82, HPV85, for example. Appropriate detection methods are required to detect their carcinogenicity.

New or unidentified types of mucosal carcinogenic HPV may also arise.
In addition, HPV polyinfection involving several HPV types is a common situation: polyinfection is believed to explain the case of about 20% HPV infection. In the case of HPV polyinfection, all may be oncogenic HPV, or may include HPV types comprising at least one oncogenic HPV and at least one non-oncogenic HPV. In the case of HPV polyinfection, all may be mucosal HPV types or may include HPV types including at least one mucosal type and at least one skin type.

Co-infection can also occur, including at least one HPV and at least one virus other than HPV, such as co-infection of at least one HPV and at least one HIV.
In the case of such multiple infections and / or co-infections, accurate HPV detection becomes much more difficult.

  HPV primers and probes are suitable for detection of mucosal carcinogenic HPV and have been described in the prior art.

  The first technology developed includes type-specific probes, eg, designed to detect oncogenic HPV by direct hybridization of type-specific probes with Southern or dot blotting and an unamplified HPV genome. Has been.

  Signal amplification tests have been developed, such as the hybrid capture test (HC2®) of Digene Corporation, Gaithersburg, MD, USA. The HC2® test is approved by the FDA and is currently a reference test for clinical diagnosis.

  The HC2® system is a liquid phase microplate system using a DNA / RNA hybridization assay and does not involve target amplification: viral DNA hybridizes with RNA probes targeting 13HR HPV in the liquid phase; The formed hybrid is detected by anti-DNA / RNA antibody and visualized by chemiluminescence.

  The HC2® test is a sensitive analysis. However, it is only a qualitative value. Viral load assessed by the HC2® test does not increase with increasing grade of SIL and is not fully reliable in the case of multi-HPV infection. Therefore, the HC2® test is not a quantitative analysis.

  Since the HC2® test does not reflect the viral load initially contained in the sample being analyzed, classical cells are used to distinguish cases with high grade lesions from cases without high grade lesions. It is recommended to combine with diagnosis.

  Amplification methods have since progressed, the HPV target is amplified with at least one primer pair, and the amplicon produced is detected with this (labeled) primer pair or probe.

  Such prior art primers were initially designed as general consensus primers, some HPVs, 13 HR HPVs and some other HPVs (carcinogenic LRs and sometimes non-carcinogenic HPVs). Is intended to amplify.

  Such consensus primers are also referred to as “universal” primers. These consensus primers are conserved regions in the HPV L1 gene (eg, MY09 / MY11 / HMB01 primer, GP5 + / GP6 + primer, PGMY09 / PGMY11 primer, and SPF1 / SPF2 or SPF10 primer) or E1 ORF region (eg, Tieben et al. 1993, J. Virol. Methods 42: 265-279).

  To provide a consensus PCR applicable to clinical diagnosis, HPV probes have been developed that detect and classify HPV amplicons produced by consensus primer pairs. Detection of HPV amplicons produced by consensus primers is often performed by a reverse hybridization line blot assay or a colorimetric microtiter plate-based enzyme immunoassay.

  Examples of such consensus PCR methods are the INNO-LiPA HPV test (Innogenetics, Gent, Belgium) and the Amplicor HPV test (Roche Molecular Systems, Branchburg, NJ, USA).

  The INNO-LiPA HPV test is a reverse hybridization line probe assay whose prototype research versions are Kleter et al., 1999 (Journal of Clinical Microbiology, vol. 37, n8, p. 2508-2517) and Kleter et al 1998 (American Journal of Pathology, vol. 153, n6, p. 1731-1739).

  Briefly, the PCR primer set is used to produce a 65 bp short PCR fragment (SPF PCR) derived from the open reading frame of L1. Prototype research INNO-LiPA primer set consists of 10 biotin-labeled primers (referred to as SPF10 primer set), ie 6 primers of the SPF1 / 2 system (described in Kleter et al. 1998) and 4 additional Primer (MY09 / 11 and GP5 + / 6 +).

  The SPF10 amplimer is denatured and incubated with poly (dT) -tailed specific oligonucleotide probes immobilized as parallel lines on nitrocellulose membrane strips under hybridization conditions. The probe strip is then washed for detection of retained hybrids.

  The INNO-LiPA HPV test allows detection of at least 25 HPV genotypes (13 HR HPVs, ie HPV 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45, 18, and other HPVs such as HPV 6, 11, 34, 40, 42, 43, 44, 53, 66, 70, and 74). It is a genotyping line probe assay and is a qualitative value. The INNO-LiPA HPV test is not a quantitative analysis.

  The Amplicor HPV test uses amplification of target HPV DNA by PCR followed by nucleic acid hybridization for detection of 13 HR HPVs. The Amplicor HPV test amplifies an approximately 165 bp sequence within the L1 region. The primer set consists of 12 primers and is designed as a general consensus primer to amplify the first group of 13 HR HPVs. After amplification and denaturation, the amplified HPV sequences are distributed in microwell plates, incubated with L1 capture probes, and the hybrid is detected and visualized by a colorimetric enzyme immunoassay (avidin-horseradish peroxidase conjugate). . The Amplicor HPV test has been reported to have high analytical specificity compared to the HC2® test (fewer false negative results; Poljak et al. 2005, Acta Dermatoven APA, vol. 14, n4 , p. 147-152).

The Amplicor HPV test is sensitive, but its HPV spectrum is limited to 13 HPVs that were initially considered HR HPV. For example, the Amplicor HPV test does not detect HPV66 and HPV53, which are currently considered to be HR HPV. In other words, the Amplicor HPV test is not designed to adapt to changes or evolution in HPV classification or information.
Furthermore, the Amplicor HPV test is not a quantitative analysis.

  These line blot or microwell based prior art uses and selects consensus HPV primers, ie, sequence alignments of a pre-determined set of selected oncogenic HPVs and primers resulting from the determination of these consensus sequences It has sufficient similarity or identity to all the HPVs that are made and hybridizes with all of them. Therefore, consensus primers are designed to amplify a predetermined subset of oncogenic HPV and do not succeed in amplifying other oncogenic HPVs (newly HRed or non-HR oncogenic HPVs). .

  Such a consensus approach is limited by the ability to determine primer sequences and can hybridize well to the desired target that has grown and evolved so far.

  Such prior art consensus primers can give false negative results when one or several new oncogenic HPV strains are generated.

  Also, while neither prior art line blots or microwell-based techniques have quantitative properties, recent discoveries have explained that HPV copy number explains the phase and / or severity of the disease and / or cancer It has a diagnostic and / or prognostic value in the field of oncogeny.

  The lack of quantitative nature limits the spectrum of clinical applicability, as information on actual cancer risk levels or actual cancer grades cannot be given.

  Furthermore, according to these prior art consensus line blot or microwell based techniques, the detection step is an additional and long step, which must be performed as a separate step after amplification has occurred.

Real-time PCR amplification techniques have recently been developed for the detection of HPV16 or HPV18 (Hesselink et al. 2005, Journal of Clinical Microbiology, vol. 43, n9, p. 4868-4871; Gravitt et al. 2003, Cancer Epidemiology , Biomarkers & Prevention, vol. 12, p. 477-484).
These real-time PCRs are based on FRET (Light Cycler) or use TaqMan probes (Applied Biosystems).

  Compared to prior art line blot or microwell based techniques, such real-time PCR has the advantage that amplification and detection are combined in a single step, opening the way to quantification.

  For example, van Duin et al. 2002 (Int. J. Cancer, vol. 98, n4, p. 590-595) describes quantitative real-time PCR analysis for the detection of HPV16.

  However, the prior art real-time PCR protocol is limited to the detection of only one HPV per amplification run, in particular the detection of HPV16 or HPV18 alone. Therefore, it is a valuable research tool, but its clinical applicability is very limited.

  Attempts have been made to develop multiplex real-time PCR amplification of HPV. However, these attempts are limited to double or triple real-time PCR for the detection of HPV16, HPV18, HPV45. For example, Szuhai et al. 2001 (American Journal of Pathology, 159 (5): 1651-1660) discloses seven type-specific molecular beacons, so-called type-specific molecular beacons. Yes, ie 5 HR HPV molecular beacons (HPV 16, 18, 31, 33, 45) and 2 LR HPV molecular beacons (HPV 6, 11); see Table 1 of Szuhai et al. These molecular beacons are stated to be useful for the detection of amplicons produced by CPI / CPIIG “universal” primers. A combined approach is disclosed in Szuhai et al., But is limited to double or triple analysis (HPV16, HPV18, HPV45). The author clarifies that “the molecular beacon PCR multiplex capacity is higher than 3 and is unlikely to approach the number of different HPV genotypes” (page 1656, right column, second paragraph). See). For this reason, the authors have found that type-specific molecular beacons are not able to solve HPV clinical diagnostic problems by themselves, and in order to arrive at a two-step HPV detection and genotyping method they are generally (See, for example, FIG. 6 of Szuhai et al.), Where the type-specific HPV molecular beacon PCR is the generality of SybrGreen. It is disclosed to be used in combination with simple primer PCR prescreening.

  Therefore, to the best of the inventor's knowledge, the prior art does not describe or present real-time amplification techniques that can be performed in a complex manner, while in a single step (amplification + Detection) The required HPV detection specificity that can cover at least 13 HR HPVs is retained. Furthermore, to the best of the inventors' knowledge, the prior art describes that at least 5 most common HR HPVs (ie HPV 16, 18, 45, 31 and 33), preferably at least 13 in a single step (amplification + detection). HR HPV, more preferably at least 13 HR HPVs as well as 5 other oncogenic HPVs, and any quantitative real-time that is quantitative even when performed in combination No HPV amplification technique is disclosed.

  The present invention relates to detection of HPV by amplification, more specifically to detection of mucosal HPV, and more specifically to detection of HPV that may be carcinogenic to mucosal epithelium.

  The present invention relates to at least 5 most common HR HPVs (HPV 16, 18, 45, 31, 33), preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs as well as at least 2 other HR HPV, advantageously at least 2 other HR HPVs belonging to the group of A6 and / or A5 (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs (HPV 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45, 18), most preferably at least 13 HR HPV and 5 other oncogenic HPVs (HPV 66, 53, 82, 67, 85).

  The present invention relates to an amplification primer system and a detection probe system, and to an amplification-detection system (ie, a real-time amplification system) generated by at least one amplification primer system of the present invention and at least one detection probe system of the present invention.

  The present invention relates to a reference template HPV sequence suitable for the generation of the amplification primers and detection probes of the present invention, and the amplification of HPV nucleic acids and optionally the detection of at least one of the present invention using at least one amplification primer system of the present invention. It also relates to an amplicon obtained by detection using a probe system.

  The invention further relates to their biological and pharmaceutical applications, in particular diagnostic and prognostic applications, in particular in the field of CIN and cervical cancer.

  The HPV amplification method of the present invention is based on the HPV tropic and carcinogenic approach and is completely different from the prior art approaches and is completely innovative. Contrary to the global consensus approach or type-specific approach that prior art methods follow to date, we have designed and built an approach based on the HPV group (FIG. 1 built by the inventors). (See the phylogenetic tree shown below). According to our HPV group-based approach, an amplification primer system and a detection probe system are used for each HPV group comprising at least one HPV type that can be carcinogenic to mucosal epithelium, ie at least Provided for groups A6, A5, A9 and A7.

  In fact, we have selected appropriate targets suitable for making primers and probes from each of the HPV groups, and at least 5 of the most common HR HPVs (ie HPV 16, 18, 45, 31 and 33), preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, advantageously at least 2 other members belonging to the group of A6 and / or A5 HR HPV (eg, HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and 5 other oncogenic HPVs (HPVs 66, 53, 82, 67, 85) are covered in a single step (amplification + detection).

  The selected target of the present invention is a reference template sequence that allows the design and construction of primers (which hybridize to one end of the selected target or its complementary sequence), as well as amplicon annealing probes. Makes it possible to cover the HPV in a single step (amplification + detection).

  The amplification primer system of the present invention is intended to target A6 or A5 or A9 or A7 HPV groups and amplify as many HPV types belonging to these groups as possible.

  The detection probe system of the present invention makes it possible to detect one or several of the amplicons obtained by amplification of HPV provided by the amplification system of the present invention. They target the group of A6 and / or A5 and / or A9 and / or A7 and are particularly adapted for real-time execution using the amplification primer system.

The detection probe system of the present invention comprises a probe that allows general detection of at least one HPV belonging to the HPV set formed by the group of A6 and A5 and A9 and A7, as well as more accurate detection. : For example,
Detection of at least one HPV belonging to the group A6 or A5 or A9 or A7, or detection of at least one HPV belonging to the A6HPV group or A5HPV group or A9HPV group or a subset of the A7HPV group, or HPV type detection.

  Therefore, the present invention provides an excellent adaptability of the level of accuracy for the detection of HPV. Such adaptability has not been obtained so far as the inventors know.

  The present invention further provides a system targeting A6 and / or A5 and / or A9 and / or A7, wherein the combination of at least one amplification primer system of the present invention and at least one detection probe system of the present invention. As a result.

  The invention particularly provides a system targeting A6 or A5 or A9 or A7, comprising at least one amplification primer system of the invention and at least one detection probe system of the invention, The amplification primer system and the at least one detection probe system target the same group, namely A6 or A5 or A9 or A7.

  Most of the amplification primers and / or detection probe systems of the present invention comprise more than two primers and / or more than one probe. Therefore, most of the amplification primer and / or detection probe systems of the present invention, and in particular systems that target A9, and systems that target A7 are already multiplex systems themselves.

  According to a very advantageous feature of the present invention, systems targeting the group of the present invention are suitable for use together in single tube amplification, i.e. the present invention targets at least one A6. System, and a system targeting at least one A5, and a system targeting at least one A9 and a system targeting at least one A7 can be performed together in a single tube assay, and therefore , May be referred to as multi-multiplex, or “megaplex” amplification and / or detection: For example, in the following examples, the “megaplex” described includes 17 primers and 12 probes 17 carcinogenesis in a single tube assay with no significant loss in gender and no significant loss in reactivity Mucosal HPV can be amplified and detected.

  Therefore, the amplification primer system and detection probe system are specifically applied to real-time multiplex amplification.

  To the inventors' knowledge, at least 5 most common HR HPVs, preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently A6 and / or Or prior art enabling real-time multiplex amplification of at least two other HR HPVs belonging to the group of A5 (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs There is no.

  Conveniently, the present invention allows the detection of at least 18 oncogenic mucosal HPVs, ie 13 HR HPVs as well as 5 other oncogenic HPVs (HPV 66, 53, 82, 67, 85) in a single tube assay. To.

  A further beneficial aspect of the invention is that it applies in particular to HPV viral load quantification. The HPV method of the present invention can be carried out in a specific and quantitative manner even when carried out in a single tube multiplex.

  Amplification primer systems and detection probe systems apply in particular to real-time quantitative multiplex amplification, the ability to target at least one A6 target system, and at least one A5 target system, and at least Retained even when run together in a single tube assay in a “megaplex” mode comprising a system targeting one A9 and a system targeting at least one A7.

  To the best of the inventors' knowledge, said at least 5 most common HR HPVs, preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs as well as at least 2 other HR HPVs, conveniently At least two other HR HPVs belonging to the group of A6 and / or A5 (eg HPV56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPV, more preferably at least 13 HR There is no prior art that allows real-time quantitative multiplex amplification of HPV and 5 other oncogenic HPVs (HPV 66, 53, 82, 67, 85).

  The amplification primer system and detection probe system of the present invention are all designed and constructed according to an HPV carcinogenic group-based approach and have the special technical feature that they are suitable to run together in the same assay tube .

  More specifically, they are at least 5 of the most common HR HPV types, preferably at least 7 HR HPVs (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably 5 The most common HR HPV and at least two other HR HPVs, conveniently at least two other HR HPVs belonging to the group of A6 and / or A5 (eg HPV 56, 51, 33, 31, 16, 45, 18 ), More preferably at least 13 HR HPVs, more preferably at least 18 oncogenic mucosal HPVs (ie at least 13 HR HPVs, and 5 other oncogenic HPVs, eg HPV 66, 53, 82, 67, 85) enables real-time “megaplex” execution in a single tube assay However, there is no significant reduction in the qualitative accuracy of HPV detection.

  The amplification primer system and detection probe system of the present invention further exhibit a level of specificity, Ct and reactivity that is sufficiently homogeneous to allow real-time “megaplex” amplification, which is a quantitative value.

  The group based approach of the present invention further makes the amplification and / or detection system adaptable so that their unique design is suitable for the detection of oncogenic HPV “newcomers” that can arise by mutagenesis. give.

  The group-based approach of the present invention also provides applicability in clinical diagnostic use: depending on the choice of probe system made by the user, the level of accuracy in HPV detection is A6 and A5 and A9 and A7 It can range from a general reaction showing detection of at least one HPV belonging to the set formed by the group of to a very accurate reaction showing detection of at least one specific HPV type. To the best of the inventors' knowledge, no such adaptability has been obtained so far.

The group based approach of the present invention is further suitable for providing accuracy in the case of multiple infections and / or co-infections.
We believe that such achievement represents a technological advance compared to prior art HPV detection systems.

All sequences in the figure including the reverse primer are listed in 5 ′ to 3 ′ orientation. The starting and ending points in the reference HPV sequence are given in increasing value order. Therefore:
-For primers: start and end points are the start and end points of the reference HPV fragment to which the primer sequence corresponds (for forward primers), or the start and end points of the reference HPV target fragment to which the primer anneals (reverse) In the case of primers);
-Regarding the probe: The probe and its complementary sequence have an equivalent function, at least in simplex amplification, the starting and ending points being the sequence of the reference HPV fragment to which the probe sequence corresponds, or the reference to which the probe anneals HPV target fragment sequence.

Detailed Description of the Invention

  The present invention is completely different from the prior art and is based on a truly new approach. The present invention overcomes the shortcomings of the prior art and has numerous advantages, particularly in terms of clinical applicability, performance, reliability and adaptability.

As stated in the “Background” above, prior art primers are type-specific primers due to classical alignment of as many mucosal HPV sequences as necessary, desirable or as possible (eg, direct alignment of 13HR HPV). Or it is designed as a general consensus primer.
In contrast, the primers of the present invention are designed by the HPV group (= HPV genus).

In fact, the present inventor analyzed the phylogeny of HPV and created a phylogenetic tree with the results shown in FIG.
The inventor selected one HPV subfamily, subfamily A, involved in carcinogenesis of mucosal epithelium. They further selected a set of HPV types that are representative of HPV subfamily A. This representative set is composed of 35 different HPV types, 18 of which are mucosal HPVs that are at least potentially carcinogenic HPVs (ie, 13 HPVs known as 13 HR; 2 Two potential HR HPVs, HPV53 and HPV66; and three other HPVs thought to have carcinogenic potential, HPV82, HPV67 and HPV85), the remaining 17 other HPV types have so far Known as non-carcinogenic HPV (see FIG. 1).

Therefore, the inventor concluded that these HPVs that are tropic to the mucosal epithelium and at least potentially carcinogenic HPVs are classified into groups A6, A5, A9 and A7. (See FIG. 1). More precisely, the mucosal carcinogenic HPV is classified as follows:
-A6 group (HPV66, HPV56, HPV53);
-Group A5 (HPV51, HPV82);
-Group A9 (HPV58, HPV33, HPV67, HPV52, HPV35, HPV31, HPV16);
-Group A7 (HPV68, HPV39, HPV85, HPV59, HPV45, HPV18).

  “At least potentially carcinogenic HPV” is known as said HPV is carcinogenic (13 HPVs commonly referred to as 13HR HPV and other oncogenic HPVs such as HPV66, HPV53, and HPV82) Or has been described as potentially carcinogenic by at least some authors (eg HPV85), or is said to be associated with tumor mucosa in the future.

Group design is a special feature shared by all products of the present invention.
At least 5 most common HR HPV types, preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently in the group of A6 and / or A5 In addition to covering the single tube experiment with at least two other HR HPVs belonging to it (eg HPV56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPV types, according to the present invention The means provided may detect certain variants that the patient may have. The method of the present invention is therefore much safer than any prior art method.

  In the case of multiple HPV infections, several HPV types are present in the collected sample. A competing effect is then observed and one HPV type competes with another type for the same consensus primer. Even if the primer is initially designed to hybridize to both HPVs, the detection of competing HPVs can be hindered.

  The invention further has the advantage of allowing analysis in the case of multiple infections and / or co-infections without loss in specificity and sensitivity.

  The present invention relates to amplification primer systems and detection probe systems, and pharmaceutical compositions, biological compositions, and detection kits comprising at least one of the amplification systems and detection systems. The present invention also relates to a method of HPV detection, comprising amplifying at least one HPV nucleic acid fragment with at least one amplification primer system of the present invention, and optionally producing the amplicon produced at least according to the present invention. Detecting with one detection probe.

  The HPV detection method of the present invention is particularly useful for diagnosing HPV-related diseases or conditions, prognosis or risk assessment of such HPV-related diseases or conditions, and monitoring the progress of such HPV-related diseases or conditions. , Useful for monitoring the effects of anti-HPV drugs or treatments, such as anti-HPV vaccines or anti-HPV vaccine candidates (eg, anti-HPV 16 and / or anti-HPV 18 and / or anti-HPV 45 vaccines, or vaccine candidates).

  The disease or condition associated with HPV is any disease or condition associated with HPV, particularly a neoplasia associated with HPV (eg, cervical epithelial neoplasia) or a cancer such as cervical cancer.

  The present invention provides amplification primer systems and detection probe systems that target the oncogenic HPV of group A6, and / or the oncogenic HPV of A5, and / or the oncogenic HPV of A9, and / or the oncogenic HPV of A7. To do.

  The amplification and / or detection system of the present invention is a multiplex system and comprises three or more primers and / or two or more probes. This is particularly the case for systems targeting A9 and systems targeting A7.

  Each amplification primer system can be run with other groups of amplification primer systems in a single tube amplification assay without significant loss in specificity. Therefore, an amplification primer system that targets at least one A6 of the present invention, an amplification primer system that targets at least one A5 of the present invention, and an amplification primer system that targets at least one A9 of the present invention and the present invention Amplification primer systems targeting at least one of A7 can be used together in a single tube amplification assay without significant loss in specificity.

  For each amplification primer system, the present invention provides at least one detection probe system to form an amplification and detection system (ie, a real-time amplification system).

  Each detection probe system of the present invention can be run with a corresponding amplification primer system in a single tube assay without significant loss in specificity, allowing real-time HPV amplification and detection.

The present invention provides amplification and detection systems that target the following groups:
-Amplification and detection systems targeting several A6-Amplification and detection systems targeting several A5-Amplification and detection systems targeting several A9-Amplification and targeting several A7 Detection system.

  Each amplification and detection system can be performed with other groups of amplification and detection systems in a single tube assay without significant loss in specificity and has a tropism for mucosal epithelium and at least potentially carcinogenic It enables single tube multi-multiplex (or “megaplex”) real-time amplification and detection of HPV, a sex HPV.

  Therefore, an amplification system and detection system targeting at least one A6 of the present invention, and an amplification system and detection system targeting at least one A5 of the present invention, and at least one A9 of the present invention are targeted. Amplification and detection systems, and amplification and detection systems targeting at least one A7 of the present invention can be used together in a single tube amplification assay without significant loss in specificity.

  While the present invention provides a system that is particularly adapted to multiplex or multi-multiplex execution, the implementation of the system of the present invention in simplex mode is of course encompassed by the present invention.

  The amplification and detection systems of the present invention further have Ct and reactivity levels that are sufficiently homogeneous to allow quantitative HPV amplification and detection. The present invention therefore makes it possible to identify the presence of one or more mucosal HPVs in a single tube assay as well as to determine the viral HPV load. The quantitative nature of the present invention is retained even when run in “megaplex” mode.

The present invention relates to amplification and / or detection systems targeted to groups and their use for the detection of mucosal HPV, wherein the amplification and / or detection systems targeted to said groups are multiplexed (actually Multi-multiplex, or “megaplex”), with special technical features suitable for amplification and their real-time detection, hence these systems are
At least 5 of the most common HR HPVs (ie HPV 16, 18, 45, 31, 33),
Preferably at least 7 HR HPV,
More preferably, the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the group of A6 and / or A5 (eg HPV56, 51, 33, 31 16, 45, 18),
More preferably, at least 13 HPVs known as HR HPVs (HPVs 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18),
More preferably, at least 13 HPVs and at least one of HPVs 66, 82, 67, 85 and 53,
More preferably, at least 13 HPVs and at least 2 of HPVs 66, 82, 67, 85 and 53,
More preferably, at least 13 HPVs and at least 3 of HPVs 66, 82, 67, 85 and 53,
Most preferably, at least 13 HPVs and at least 4 of HPVs 66, 82, 67, 85 and 53, in particular at least 17 mucosal HPVs consisting of said 13 HR HPV and HPV types 66, 82, 67, 85,
Even more preferably, at least 13 HPVs and at least 5 HPV types 66, 82, 67, 85, and 53
Allows detection in single tube assays.

Amplification and / or detection systems targeting the group of the present invention further have special technical features that make it possible to make such real-time “megaplex” amplification quantitative.
As mentioned above, the amplification and detection systems of the present invention are based on a truly new group-based approach.

  Indeed, according to the prior art general consensus technique, the design of a primer (also called a “universal” primer) targets all the HPV sequences to be amplified, eg, the alignment of 13 HR HPVs, and as much as 13 HPVs By determining the consensus sequence. Therefore, such a consensus sequence is found in a conserved gene or region, such as the late coding region (eg, gene L1), and similar conserved genes or regions are found for the entire set of HPV being amplified. Selected.

  In contrast, the inventor made a design for each HPV group, ie they selected the appropriate target for each HPV group. Specifically, they selected genes in the early coding region, more specifically genes E1, E2, E6, E7. The inventor has designed a specific target for each desired HPV group.

  For example, primers designed for group A5 have their targets in genes E7, E1; primers designed for group A6 have their targets in genes E6, E7; Primers designed for group A7 have their targets in gene E1; primers designed for group A9 have their targets in genes E1, E2. Exemplary targets of the present invention are shown in FIGS. 2A (Groups A5 and A6) and 2B (Groups A7 and A9).

  Therefore, the inventor selected a reference template sequence for each of the group of A5, A6, A7 and A9, the A5 reference template sequence is in the region consisting of genes E7 and E1, and the A6 reference template sequence is Within the region consisting of genes E6 and E7, the A7 reference template sequence is within gene E1, and the A9 reference template sequence is within the region consisting of genes E1 and E2.

  Primers are designed and constructed to hybridize to one end of the target (or sequence complementary thereto) so that the primer pair anneals to each end of the target (or sequence complementary thereto).

  Probes are designed and constructed to anneal to one of the reference template sequences, so each probe anneals to at least one of the amplicons made by the primer system of the present invention.

The amplification primer system of the present invention comprises at least two primers.
The detection probe system of the present invention comprises at least one probe.
The amplification primer system of the present invention preferably amplifies HPV belonging to the group of A6 or A5 or A9 or A7, ie carcinogenic HPV.

  The inventor has further succeeded in creating an amplification primer system specific for the HPV set formed by the group of A5 and A6 and A7 and A9. These amplification primer systems of the present invention do not amplify any HPV belonging to groups other than A5, A6, A7, and A9. Indeed, most primer systems of the present invention are specific for the HPV set formed by the group of A6 and A5 and A9 and A7.

  Furthermore, most of the amplification primer systems of the present invention are specific to the group they target, ie most primer systems of the present invention are specific to the group of A6 or A5 or A9 or A7: Most primers of a given amplification system amplify one or more HPVs of the same HPV group without amplifying any HPV belonging to other HPV groups.

  The primer systems of the present invention that are not specific for the HPV set formed by A5 and A6 and A7 and A9 can amplify nucleic acids that are not derived from the group of HPVs, ie non-carcinogenic HPVs. However, in such cases, the primer systems of the invention show very low amplification efficiencies for these non-target amplicons (ie they are a group of A5 and / or A6 and / or A9 and / or A7) Leads to much lower PCR efficiencies than can be obtained for the HPV of HPV and is therefore not quantitative).

  When a primer system that targets the group of the present invention is combined with a probe system of the present invention that targets the same group, the resulting real-time amplification system targeting the group is A5 and A6 and A9 and A7. Specific to the set of HPVs formed by the group: Such real-time amplification systems do not detect HPVs that do not belong to A5 or A6 or A9 or A7. Furthermore, most of these real-time amplification systems are specific to the group they target.

The only real-time amplification of the present invention has group cross-reactivity: the real-time amplification primer system designed for group A9, referred to as system C in the examples below, is the 7 HPV type of group A9 And HPV53, an oncogenic HPV belonging to group A6 (HPV53 is potentially HR HPV); however, this group A9, line C, is any other HPV among the 42 HPVs tested. (Group A HPV other than HPV53; Group A5 HPV; Group A11 HPV; Group A7 HPV; Group A4 HPV; Group A3 HPV).
In either case, the real-time amplification system of the present invention detects a nucleic acid that can be a human nucleic acid.

  If it is desired to amplify any HPV belonging to the group A6, A5, A9, or A7, most of the amplification primer systems of the present invention actually contain more than two primers, ie at least three primers. It becomes.

  For example, an amplification primer system that targets group A6 or A5 requires only a primer pair to amplify HPV56 and optionally HPV66 (for group A6), or HPV51 and optionally HPV82 (for group A5). However, such an amplification primer system targeting the A9 or A7 group, if a complete coverage of the group HPV spectrum is desired, the A9 group 6 or 7 HPV type, or the A7 group 5 or 6 HPV type. Must be amplified. In such cases, an amplification system targeting A9 or A7 of the present invention may comprise, for example, at least 3 or 4 forward primers and 2, 3, 4, 5, or more reverse primers. Such amplification primer systems targeting A9 or A7 are therefore already multiplex systems themselves.

  Of course, a person skilled in the art who wishes to limit the range of HPV to be amplified may choose several forward and / or reverse primers depending on the type or strain of HPV he / she wishes to amplify.

  Similarly, if one wishes to detect any HPV belonging to the group A6, A5, A9, or A7, most of the detection probe systems of the present invention actually contain more than one probe, ie at least two probes. Become.

  For example, a detection probe system targeting A6 or A5 groups only requires a probe to detect HPV56 and optionally HPV66 (Group A6), or HPV51 and optionally HPV82 (Group A5). However, such detection probe systems that target the A9 or A7 groups are capable of detecting the HPV type or strain to be detected, particularly when complete coverage of the HPV group and simultaneous HPV group or type identification is desired. One probe per may be included. A detection probe system targeting A9 or A7 comprises at least 4 probes, such as 4, 5 or 6 probes.

  As mentioned above, all detection probe systems of the present invention are applicable to real-time detection and can be performed with the corresponding amplification primer system in the very same tube.

  In the examples below, amplification and / or detection systems targeting several A6, A5, A9 and A7 of the present invention are described.

In these examples, Tables 12 through 88 are shown:
Tables 12-35: These tables show the reference amplicon SEQ ID NOs and positions (the sequences of these reference template amplicons are also shown after the last table, ie before the “Claims”) Provide forward primer, reverse primer, probe, beacon probe of the system targeting the illustrative group of the present invention;
Tables 35-50: These tables show the number of nucleotide mismatches exhibited by the primers and probes of the present invention (50 HPV type alignments); empty boxes mean no matching sequence alignment Do;
Tables 51-68: Specificity of the detection system of the present invention;
Tables 69-82: system reactivity;
Tables 83-88: Specificity and reactivity of “megaplex”;
-Table 89: List of HPV genome sequences.

A reference genome is selected for each HPV group, ie:
-Group A5: The reference genome is the genome sequence of HPV51 available under accession number NC_001533.1.
-Group A6: The reference genome is the genome sequence of HPV56 available under accession number NC_001594.1.
-Group A7: The reference genome is the genome sequence of HPV18 available under accession number NC_001357.1.
-Group A9: Reference genome is the genome sequence of HPV16 available under accession number NC_001526.1.

In the following table, the term “address” means the position of a nucleotide in the reference genome. More precisely:
The forward primer with address X is an isolated oligonucleotide having a sequence of a fragment of the reference genome starting from position X in said reference genome or a sequence that is a variation of the sequence of such a fragment (see below) Refer to the number of mismatches in the table);
The reverse primer with address X is an isolated oligonucleotide and has a sequence complementary to a sequence of a fragment of the reference genome which ends at position X in said reference genome or a variation of the sequence of such a fragment ( See the mismatch table below);
The probe with address X is an isolated oligonucleotide, the sequence of which is the sequence of a fragment of the reference genome starting from position X in said reference genome, or complementary to the sequence of such a fragment Is a sequence (over the entire length of the sequence of this fragment) or a variation of the sequence of such a fragment or the sequence of such a complementary fragment (see table of mismatch numbers below).

  As a result, a primer pair selected from a given system to consist of a forward primer with address Xf and a reverse primer with address Xr was performed in its reference HPV genome under favorable conditions for nucleic acid amplification. In some cases, this primer pair amplifies from the HPV reference genome an amplicon consisting of sequences ranging from position Xf to position Xr in the reference HPV genome (including the start and end points).

  When performed on a given HPV genome that is not a reference HPV genome, but belongs to the same group as the reference HPV genome, under conditions favorable for nucleic acid amplification, the primer pair is a fragment of the given HPV genome fragment. The amplicon corresponding to the fragment from position Xf to position Xr in the reference HPV genome is amplified from the given HPV genome in accordance with the sequence and according to the sequence alignment.

  A fragment of a given HPV genome, and according to sequence alignment, in the case of fragment A corresponding to fragment B of the HPV reference genome, said fragment A has the same length as said fragment B, and within said given HPV genome The starting and ending points of the fragment A in the given HPV genome fragment have the same length as the fragment B, and the fragment A has a global alignment with the nucleic acid sequence of the fragment B. When determined, it means the fragment that gives the most identical score compared to the nucleotide sequence of the fragment B.

You can also understand:
The forward primer with address Xf and length Lf is an isolated oligonucleotide, the sequence of a fragment of the reference genome starting at position Xf in the reference genome and ending at position Xf + Lf-1 in the reference genome Or having a sequence that is a variation of the sequence of such a fragment (see alignment shown below);
The reverse primer having the address Xr and the length Lr is an isolated oligonucleotide, the sequence of a fragment of the reference genome starting from position Xr-Lr-1 in the reference genome and ending at position Xr or so Having a sequence that is complementary to a variation of the sequence of a simple fragment (see alignment below);
The probe with address Xp and length Lp is an isolated oligonucleotide, the sequence of which is a sequence of a fragment of the reference genome starting at position Xp and ending at position Xp + Lp-1 in the reference genome; Or a sequence complementary to the sequence of such a fragment, or a variation of the sequence of such a fragment or the sequence of such a complementary fragment (see the alignment shown below).

  The present invention relates to a method for nucleic acid amplification of at least one HPV target, said HPV being tropic to the mucosal epithelium and at least potentially carcinogenic, preferably at least one oncogenic anogenital HPV Target, most preferably at least one oncogenic cervical HPV. The amplification method of the present invention comprises the step of making at least one amplicon from said at least one HPV target using at least two primers.

  According to an advantageous embodiment of the present invention, the amplification method of the present invention may be a real-time multiplex amplification method, comprising at least one probe capable of annealing to an amplicon made with said at least two primers.

  The present invention is directed to mucosal epithelium and is at least potentially carcinogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV. It relates to a method for detecting at least one HPV in a sample. The detection method of the present invention comprises the detection of at least one nucleic acid HPV target amplified by the method of nucleic acid amplification of the present invention.

  The present invention comprises detecting whether at least one amplicon was made from said sample or its nucleic acid by being amplified with at least two amplification primers of the invention and / or with at least one amplification primer system of the invention. In a sample that is tropic for mucosal epithelium and is at least potentially carcinogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV To at least one HPV.

  Production of at least one amplicon is tropic for mucosal epithelium and is at least potentially carcinogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one Shows that carcinogenic cervical HPV is present in the sample.

  According to an advantageous embodiment of the invention, the determination of whether at least one amplicon is produced is preferably a real-time multiplex amplification together with at least one inventive probe and / or at least one inventive probe system. Can be done at.

The present invention is a sample that is tropic for mucosal epithelium and is at least potentially carcinogenic, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV A method for detecting at least one HPV therein comprising:
The sample or its nucleic acid material is at least one from the HPV under conditions suitable for production of at least one amplicon by the primer (ie if the at least one HPV to be detected is present in the sample); Contact with at least two amplification primers of the present invention and / or at least one primer system of the present invention under conditions that allow amplicons of the present invention to be made with said primers;
Determining whether at least one amplicon has been produced by said primer (eg using at least one detection probe, preferably at least one probe according to the invention and / or at least one detection according to the invention); Real-time amplification including probe system),
Production of at least one amplicon is tropic for mucosal epithelium and is at least potentially oncogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic 1 indicates that at least one HPV that is a cervical HPV is present in the sample.

  A “sample containing nucleic acid material” means a sample containing at least one nucleic acid, eg a cell culture, or a biological sample such as a sample collected from an animal or human, eg a female human, preferably the uterus. Means a sample collected from the neck.

  The sample may optionally be further processed and / or purified by techniques known to those skilled in the art to improve amplification efficiency and / or qualitative accuracy and / or quantitative accuracy. Said sample consists exclusively or essentially of nucleic acid and can be obtained by purification, isolation or chemical synthesis. Means are available to those skilled in the art who wish to isolate or purify nucleic acids such as DNA, for example DNA from cervical chips (eg QIAamp-DNA Mini-Kit; Qiagen, Hilden, Germany).

Therefore, the detection method of the present invention comprises:
At least 5 of the most common HR HPVs (ie HPV 16, 18, 45, 31, 33),
Preferably at least 7 HR HPV,
More preferably, the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the group of A6 and / or A5 (eg HPV 56, 51, 33, 31, 16, 45, 18),
More preferably, at least 13 HPVs known as HR HPVs (HPVs 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18),
More preferably, at least the 13 HPVs and at least one of HPV types 66, 82, 67, 85, and 53,
Even more preferably, at least the 13 HPVs and at least 2 of HPV types 66, 82, 67, 85, and 53,
Even more preferably, at least the 13 HPVs and at least 3 of HPV types 66, 82, 67, 85, and 53,
Most preferably, at least 17 of the 13 HPVs and at least 4 of HPV types 66, 82, 67, 85 and 53, in particular at least 17 mucosal HPVs consisting of the 13HR HPV and HPV types 66, 82, 67, 85,
Even more preferably, at least 13 HPVs and at least 5 HPV types 66, 82, 67, 85, and 53,
Real-time multiplex detection, preferably real-time quantitative multiplex detection, in a single tube assay.

  The invention also relates to the detection methods of the invention and / or all medical, biological and pharmaceutical applications of the primers and / or probes of the invention.

  The present invention relates to a method for the diagnosis or prevention of cervical neoplasia or cancer, the presence, occurrence of at least one HPV by performing the method of the present invention, for example a sample collected from a patient. Determination of persistence, or cellular spread, a positive determination is the presence of cervical neoplasia or cancer, or a generalized risk of such a condition or disease It shows that.

  The invention also relates to an anti-HPV 16 and / or 18 and / or 45 treatment, a drug, a candidate treatment or an anti-HPV treatment or drug such as a candidate drug, or a method for monitoring the effect of an anti-HPV candidate treatment or drug. Determining the treatment, drug, candidate treatment or candidate drug that leads to a decrease in non-recurrent, non-residual, extinction, or cellular spread of at least one HPV by the detection method of the present invention, comprising A positive determination by indicates that the treatment, drug, candidate treatment or candidate drug is an effective anti-HPV drug.

The present invention also relates to a method of producing an anti-HPV drug, the method comprising:
-Providing at least one anti-HPV candidate drug;
-Administering said at least one candidate anti-HPV drug to a cell culture or non-human animal, said cell culture or animal being or comprising at least one cervical neoplasia or cancer;
-Determining whether said candidate anti-HPV drug causes said at least one neoplasia or cancer regression or extinction by the HPV detection method of the present invention;
A positive determination thereby indicates that the candidate drug is an effective anti-HPV drug.

  As mentioned above, the present invention is an HPV amplification and detection method that can be performed in real time and multiplex, ie, combining target amplification and detection in a single operational step, resulting in significant loss in specificity. Instead, a method is provided that allows detection of mucosal HPV in a single operational step.

  Furthermore, the amplification and detection systems of the present invention have Ct and reactivity levels that are sufficiently homogeneous to allow real-time quantitative multiplex HPV detection.

According to the invention, the amplification primer may comprise:
-At least two primers intended to target the oncogenic HPV of group A6 (the primer targeting at least two A6 is an oligonucleotide, 14-30 nucleotides, preferably 15-29, more Preferably consisting of 16 to 28, most preferably 17 to 25 nucleotides, the sequence of which is at least one 90 to 390 nucleotide nucleic acid from the A6 targeting region consisting of the E6 and E7 genes of HPV56, preferably 95 Suitable for use as forward and reverse primers respectively in the amplification of nucleic acids of ~ 385 nucleotides, more preferably 100-379 nucleotides), and / or-intended to target oncogenic HPV of group A5 At least two primers ( Said at least two primers targeting A5 are oligonucleotides, consisting of 14-30 nucleotides, preferably 15-29, more preferably 16-28, most preferably 17-25 nucleotides, the sequence of which is: A forward primer in the amplification of at least one nucleic acid of at least 90 to 240 nucleotides, preferably 100 to 230 nucleotides, more preferably 106 to 225 nucleotides from the A5 target region consisting of E7 and E1 genes of HPV51 And / or suitable for use as a reverse primer), and / or-at least two primers intended to target the carcinogenic HPV of group A9 (the primer targeting said at least two A9 is an oligonucleotide) 14 to 30 nucleotides, preferably 15 to 29, more preferably 16 to 28, most preferably 17 to 25 nucleotides, the sequences of which are the E1 and E2 genes of each of the following group A9 HPVs: : HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16, preferably at least one 80-260 nucleotide nucleic acid from the region targeting A9 consisting of the E2 gene of each of the APVs of group A9, preferably 85- Is suitable for use as a forward primer and a reverse primer, respectively, in the amplification of nucleic acids of 250 nucleotides, more preferably 88-241 nucleotides), and / or-intended to target the oncogenic HPV of group A7 At least 2 primers (the primer targeting at least 2 A7 is an oligonucleotide and consists of 14 to 30 nucleotides, preferably 15 to 29, more preferably 16 to 28, most preferably 17 to 25 nucleotides; The sequence comprises at least one at least 100-220 nucleotide nucleic acid from the A7 targeting region consisting of the respective E1 genes of the following A7 groups of HPV: HPV68, HPV39, HPV59, HPV45, and HPV18, preferably 120 It is suitable for use as a forward primer and a reverse primer, respectively, in the amplification of nucleic acids of ˜215 nucleotides, more preferably 125 to 209 nucleotides.

  The nucleic acid amplified from the A6 or A5 or A9 or A7 target region corresponds to the nucleic acid sequence of the A6 or A5 or A9 or A7 reference template in the HPV, respectively. Therefore, these amplified nucleic acids usually have a high degree of identity with their respective reference template sequences, for example at least 80%, preferably at least 85% over the entire length of said respective reference template sequences. More preferably at least 90%, most preferably at least 95% identity.

Nucleic acid here preferably means DNA.
Preferably, at least two primers intended to target one HPV group are different from at least two primers intended to target three other groups.

  Are the at least two A6 targeted primers completely within each E6 gene of the A6 group HPV (ie HPV56) or completely within each E7 gene of the A6 group HPV? Or the E6 and E7 genes, for example, a forward primer that targets E6 and a reverse primer that targets E7, or vice versa. Preferably, the at least two primers targeting A6 target sequences overlapping with E6 and E7 genes, for example, forward primer targeting E6 and reverse primer targeting E7, or vice versa. .

  Are the at least two A5 targeted primers completely within each E7 gene of the A5 group HPV (ie HPV51) or completely within each E1 gene of the A5 group HPV? Or sequences overlapping the E7 and E1 genes may be targeted, for example, a forward primer targeting E7 and a reverse primer targeting E1 or vice versa.

  The at least two A9 targeting primers are either completely within the respective E1 genes of the A9 group of HPVs (ie, at least HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16), or completely the A9 group Sequences within each E2 gene of, or overlapping with, the E1 and E2 genes may be targeted, for example, a forward primer targeting E1 and a reverse primer targeting E2 or vice versa. In the examples below, all A9 amplification systems that target the E2 gene except system C have targets that overlap with the E1 and E2 genes.

  The at least two primers targeting A7 target sequences that are completely within each E1 gene of each of the A7 group HPVs (ie, at least within each E1 gene of HPV68, HPV39, HPV59, HPV45, HPV18). As good as

  According to the invention, said at least two primers targeting A6, A5, A9 and A7 are used in particular in the real-time (quantitative) multiplex detection of HPV which may be carcinogenic to mucosal epithelium. It has a special technical feature that it is suitable for.

“Consisting of 14-30 nucleotides” means “consisting of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides”. Means that.
The same applies mutatis mutandis to any range listed in this application.
The nucleotide lengths of the primers may be selected independently of each other.

  With respect to oligonucleotides or primers, at least one HPV or “sequence suitable for use in amplification” of a nucleic acid or sequence is a stringent, preferably high or very high, sequence of the oligonucleotide or primer. It means that it can hybridize with this HPV or nucleic acid or sequence under the conditions.

  The primers of the present invention may consist of 14-30 nt oligonucleotides (preferably 17-25 nt oligonucleotides), the sequence of which is the same length sequence contained in the group of reference template sequences, most preferably of said group. At least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 92% identity with a sequence of the same length contained at exactly 3 'or just 5' end of the reference template sequence Have.

  According to an advantageous embodiment of the invention, the determination of whether at least one amplicon has been made is targeted to at least one probe, preferably at least one A6 targeting probe and / or at least one A5 targeting. And / or a probe targeting at least one A9 and / or a probe targeting at least one A7 may be used in real-time amplification.

  Preferably, said at least two A6 targeting primers are used in the amplification of more than one A6 group of oncogenic HPV, ie at least HPV56 and at least one other oncogenic HPV (eg HPV66, HPV53). Suitable for doing. According to the present invention, said at least two A6 targeting primers anneal to each of the A6 group HPVs they target in the E6 and / E7 genes. Therefore, according to an advantageous embodiment of the invention, said at least two A6 targeting primers are oligonucleotides, each sequence of which consists of the respective E6 and E7 genes of the following group A6 HPVs: Suitable for use as forward and reverse primers in the amplification of at least one nucleic acid derived from: HPV56 and HPV66. HPV66 is not currently listed among 13HR HPVs, but some consider HPV66 to be HR HPV.

  Preferably, said at least two A5 targeting primers are in the amplification of two or more A5 groups of oncogenic HPV, ie at least HPV51 and at least one other oncogenic HPV of group A5 (eg HPV82). Suitable for use. According to the invention, said at least two primers targeting A5 anneal to each of the A5 group HPVs they target in the E7 and / or E1 genes. Therefore, according to an advantageous embodiment of the invention, said at least two A5 targeting primers are oligonucleotides, each sequence of which consists of the respective E7 and E1 genes of the following group A5 HPVs: Suitable for use as forward and reverse primers in the amplification of at least one nucleic acid from the region: HPV51 and HPV82.

  Preferably, said at least two A9 targeted primers are oncogenic HPV of group A9 above 7 or above, ie at least HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16, and at least one other group A9. Suitable for use in amplification of oncogenic HPV (eg HPV67). According to the present invention, said at least two primers targeting A9 anneal to each of the A9 group HPVs they target in the E1 and / or E2 genes. Therefore, according to an advantageous embodiment of the invention, said at least two A9 targeting primers are oligonucleotides, each sequence consisting of the respective E1 and E2 genes of the following group A9 HPVs: Suitable for use as forward and reverse primers in the amplification of at least one nucleic acid from the region: HPV58, HPV33, HPV67, HPV52, HPV35, HPV31, and HPV16.

  Primers targeting the group of the present invention may further target HPV not belonging to the same group (unless any group other than A6, A5, A7 or A9 is targeted), ie target A9 The primer pair may target HPV belonging to group A6 (for example, HPV53) in addition to targeting HPV of group A9 described above. Thus, each sequence of the at least two A9 targeting primers may be further suitable for use as forward and reverse primers in the amplification of at least one HPV53 nucleic acid.

  Preferably, said at least two A7 targeting primers are at least six A7 group carcinogenic HPVs as described above, ie at least HPV68, HPV39, HPV59, HPV45, and HPV18, and at least one other group A7 carcinogenesis. Suitable for use in the amplification of soluble HPV (eg HPV85). According to the invention, the at least two primers targeting A7 anneal to each of the A7 group HPVs they target in the E1 gene. Therefore, according to an advantageous embodiment of the invention, said at least two A7 targeting primers are oligonucleotides, each sequence of which is at least 1 derived from the respective E1 gene of the following group A7 HPV: Suitable for use as forward and reverse primers in the amplification of nucleic acids: HPV68, HPV39, HPV85, HPV59, HPV45, and HPV18.

  As far as the inventor is aware, prior art multiplex enabling detection of carcinogenic HPV in mucosa other than HPV56, HPV51, HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16, HPV68, HPV39, HPV59, HPV45, and HPV18 There is no way. Until recently, these 13 HPVs were considered to be 13HR HPVs (ie, 13 high-risk HPVs, ie, HPVs with the highest tumor prevalence). However, other HPVs are currently considered to belong to the HR HPV group, for example HPV66 and HPV53 (A6 group). Prior art, such as the HPVA Amplicor test, is based on a global consensus design and cannot include additional HPV. In contrast, the present invention covers more than 13 basic HR HPVs based on the design by group and is safer for patients, taking into account any carcinogenic A6, A5, A9 and A7 newcomers It has the special advantage of being advanced in the sense that it can be entered.

  Therefore, to the best of the inventors' knowledge, the present invention has a broader mucosal carcinogenic HPV spectrum than any other prior art and has greater power of adaptability to the evolution of the detected HPV spectrum. The present invention is therefore safer than any other prior art.

  The amplification primer system of the present invention preferentially amplifies HPV belonging to the group of A6 or A5 or A9 or A7, ie carcinogenic HPV.

  As mentioned above, most of the amplification primer systems of the present invention are specific for the HPV set formed by the group of A5 and A6 and A7 and A9, particularly specific for the targeted group, ie Most primer systems of the present invention are specific for the A6 or A5 or A9 or A7 groups (does not amplify any HPV in the A11 or A4 or A3 groups).

  Therefore, said at least two primers are derived from the carcinogenic HPV of groups A5 and A6 and A7 and A9, in particular A6 or A5 or A9 or A7, preferably A6 or A5 or A9 or A7. It may be advantageously specific for the HPV set to be formed.

  Therefore, according to a preferred embodiment of the present invention, said at least two primers are used as forward and reverse primers in the amplification of any nucleic acid derived from HPV not belonging to group A6, A5, A9 or A7. It may have an unsuitable sequence. According to a more preferred embodiment of the invention, each sequence of said at least two primers is therefore not carcinogenic, preferably not carcinogenic to mucosal epithelium, more preferably not an anogenital HPV. Most preferably not suitable for use as forward and reverse primers in the amplification of nucleic acids derived from HPV that are not cervical HPV.

  In other words, the at least two primers are preferably specific for oncogenic HPV compared to non-oncogenic HPV.

  The present invention may be performed in simplex, multi-tube simplex, multiplex, and multi-multiplex (megaplex). According to an advantageous embodiment of the invention, the amplification may be single tube multiplex amplification or single tube multiplex-multiplex amplification (“megaplex”).

  By “single tube multiplex amplification” or “multiplex amplification” herein is meant amplification of more than one target in the same tube, and optionally any amplification reaction that is directed to detection. For example, multiplex amplification includes double amplification (2 targets), triple amplification (3 targets), and more multiplex amplification. Multiplex amplification includes amplification reactions using more than one primer pair, eg, two primers. In this case, four different primers may be present, but two primer pairs may have one primer in common, for example a forward primer, and two different reverse primers. Multiplex amplification and detection includes amplification reactions using unique primer pairs, but does not include more than one probe.

  Therefore, according to the multiplex embodiment of the present invention, more than one primer pair is present in the amplification reaction mixture. As a very beneficial embodiment of the invention, at least 4, preferably at least 6, more preferably at least 8 primer pairs are present in the amplification reaction mixture. Indeed, the primers of the invention allow multiplex amplification without significant loss of specificity. Therefore, amplification assays are performed on samples to be tested with all reagents in the same tube, and mucosal carcinogenic HPV is detected in a single step method if present in the sample.

Preferably, said amplification primer comprises said at least two primers targeting A6 and at least two primers selected from:
A primer targeting said at least two A5s,
A primer targeting the at least two A9s, and a primer targeting the at least two A7s.

Preferably, said amplification primer comprises said at least two A5 targeting primers and at least two primers selected from the following:
A primer targeting the at least two A6, and / or a primer targeting the at least two A9, and / or a primer targeting the at least two A7.

Preferably, said amplification primer comprises said at least two primers targeting A9 and at least two primers selected from:
A primer targeting the at least two A5, and / or a primer targeting the at least two A6, and / or a primer targeting the at least two A7.

Preferably, said amplification primer comprises said at least two primers targeting A7 and at least two primers selected from:
A primer targeting the at least two A5, and / or a primer targeting the at least two A9, and / or a primer targeting the at least two A6.

Most preferably, the amplification primer comprises:
A primer targeting the at least two A6, and a primer targeting the at least two A5, and a primer targeting the at least two A9, and a primer targeting the at least two A7. .

  According to an advantageous embodiment of the invention, the determination of whether at least one amplicon has been made is made by at least one probe intended to anneal to said at least one amplicon, i.e. of the probe. The sequence is preferably such that the at least one amplicon (or their complementary sequence) is such that a probe can anneal to the at least one amplicon with high or very high stringency, preferably under mild conditions. Is sufficiently complementary to

The probes of the present invention may be implemented in any suitable format.
Preferably, the probes of the present invention are not immobilized on a solid support.
Most preferably, the probes of the present invention are used in real time amplification.

Therefore, according to an advantageous embodiment of the invention, the amplification may be real-time amplification.
According to an advantageous embodiment of the invention, said at least one probe is used in real-time amplification, i.e. said at least two primers and said at least two probes may both be present in an amplification reaction mixture, whereby At least one probe anneals in real time to the amplicon produced by the at least two primers. In other words, amplification and detection are performed in a single step, ie real time amplification.

  Real-time amplification is an amplification-based method that allows monitoring of emitted fluorescence during the reaction as an indicator of amplicon production during each amplification cycle, unlike endpoint detection by conventional amplification methods And we understand.

The present invention relates to probes intended to target amplicons obtained by amplification of mucosal carcinogenic HPV nucleic acids with primers targeting at least two A6 and / or A5 and / or A9 and / or A7. provide.
These probes have the special technical feature that they are suitable for use in real-time multiplex amplification.

  Some probes of the present invention make it possible to detect all HPVs in one group (ie they are in all amplicons obtained using primer pairs targeting the group of the present invention. Anneal). Other probes of the invention detect only one or several HPVs in a group. Thus, the present invention further provides different levels of detection: the response is present or absent of at least one mucosal carcinogenic HPV of group A6 and / or A5 and / or A9 and / or A7, or at least There may be a global detection or more accurate response of the presence or absence of at least one mucosal carcinogenic HPV, such as a more accurate response such as the presence or absence of one mucosal carcinogenic HPV type.

  Preferably, the determination of whether at least one amplicon has been made is made using a probe targeting at least one A6 and / or A5 and / or A9 and / or A7 in real-time amplification and its sequence Is suitable for use as a probe for detecting at least one amplicon made by said at least two primers targeting A6 and / or A5 and / or A9 and / or A7, respectively.

  According to an advantageous embodiment of the invention, the amplification may be a real-time multiplex amplification. According to a very advantageous embodiment of the invention, the amplification may be performed as real-time multiplex amplification. Therefore, the amplification reaction mixture may contain more than two primers and at least one probe without significant loss of specificity in the detection of HPV. To the best of the inventors' knowledge, this technique is the first to enable real-time multiplex amplification. Mucosal carcinogenic HPV is very beneficial in the sense that it is screened in a single tube assay with all reactants (primers and probes). In particular, the present invention provides primers and probes that target A6, A5, A9 and A7 and can all be present in the same reaction mixture without significant loss of specificity.

  Therefore, the present invention is much easier to handle and much faster than any prior art. Furthermore, it limits the possibility of experimental errors or contamination in sample analysis.

  To the best of the inventors' knowledge, this technology is the first to enable real-time multiplex amplification, with at least 5 most common HR HPVs (HPV 16, 18, 45, 31, 33), preferably at least 7 HR HPV, more preferably the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the group of A6 and / or A5 (eg HPV56, 51, 33 31, 16, 45, 18), more preferably at least 13 HR HPVs, and as described above, most preferably at least 18 oncogenic HPVs (ie at least 13 HR and 5 other oncogenic HPVs, ie HPV 66, 53, 82, 67, 85) can be covered.

According to an advantageous embodiment of the invention, the amplification may be quantitative real-time multiplex amplification.
According to a more advantageous embodiment of the invention, the amplification may be performed as quantitative real-time multiplex amplification. Indeed, the primers and probes of the present invention have sequences with no loss in specificity and no loss in quantitative accuracy, even when they are performed in real-time multiplex amplification.

  To the best of the inventors' knowledge, this technique is the first to enable quantitative real-time multiplex amplification, at least the 5 most common HR HPVs (HPV 16, 18, 45, 31, 33), preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to group A6 and / or A5 (eg HPV 56, 51 33, 31, 16, 45, 18), more preferably at least 13 HR HPV, and as described above, most preferably at least 18 oncogenic HPVs (ie at least 13 HR and 5 other oncogenic HPVs, ie HPV 66). 53, 82, 67, 85).

The present invention finds application not only in the field of diagnosis, but also in the field of therapeutic evaluation, such as monitoring the effects of anti-HPV treatments or evaluating the effects of anti-HPV drugs. As far as the inventor is aware, such treatment-related applications have not been achieved by any of the prior art.
The present invention provides a significant technological advance in the field of HPV monitoring.

  Thus, the amplification may be quantitative real-time multiplex amplification, allowing the detection of one or more HPVs that may be carcinogenic to mucosal epithelium to be performed with single tube amplification.

The present invention
At least 5 most common HPVs (HPV 16, 18, 45, 31, 33),
Preferably at least 7 HR HPV,
More preferably, the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the group of A6 and / or A5 (eg HPV 56, 51, 33, 31, 16, 45, 18),
More preferably, at least 13 HPVs known as HR HPVs (HPVs 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18),
More preferably, at least the 13 HPVs and at least one of HPV types 66, 82, 67, 85, and 53,
Even more preferably, at least the 13 HPVs and at least 2 of HPV types 66, 82, 67, 85, and 53,
Even more preferably, at least the 13 HPVs and at least 3 of HPV types 66, 82, 67, 85, and 53,
Most preferably, at least 17 of the 13 HPVs and at least 4 of HPV types 66, 82, 67, 85 and 53, in particular at least 17 mucosal HPVs consisting of the 13HR HPV and HPV types 66, 82, 67, 85,
Even more preferably, at least 13 HPVs and at least 5 HPV types 66, 82, 67, 85, and 53
Real-time multiplex detection, preferably real-time quantitative multiplex detection, in a single tube assay.

  Preferably, each sequence of the at least two A6 targeting primers is suitable for use in amplification of at least one reference template sequence, and the at least one reference template sequence is SEQ ID NO: 420 (reception A fragment consisting of positions 413 to 791 of the HPV56 sequence of SEQ ID NO: NC_001594.1) (SEQ ID NO: 337); or an HPV that may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPV ( HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently in groups A6 and / or A5 At least two other HR HPVs belonging to it (eg, HPV 56, 51, 33, 31, 16, 45, 18), More preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and at least 1, at least 2, at least 3, at least 4, or 5 HPVs 66, 53, 82, 67, 85 real-time multiplex detection possible Or a conservative sub-fragment thereof that retains the property of being a suitable reference template sequence to produce and produce a primer targeting A6; A sequence that is completely complementary to the fragment or subfragment over its entire length.

  More preferably, the sequence of each of the at least two primers targeting A6 is at least one reference template sequence (A6 reference template) comprising 1 of SEQ ID NOs: 25-29 and 334-338 as shown in Table 18. Or suitable for use in the specific amplification of sequences that are completely complementary to them over the entire length of the sequence of SEQ ID NO.

  Said reference template sequence is in particular an HPV which may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPV (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR. HPV, more preferably the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the A6 and / or A5 groups (eg HPV 56, 51, 33, 31 16, 45, 18), more preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and at least 1, at least 2, at least 3, at least 4, or 5 HPVs 66, 53, 82, 67, 85 Real-time multiplex detection and preferably such HPV The A6 which permits quantitative multiplex detection of-time with a special technical feature of being suitable references to configure and produce targeted primers.

  Since the reference template sequences are defined as consisting of the above-described SEQ ID NOs (not defined as comprising one of the above-mentioned SEQ ID NOs), the primer is not adjacent to these reference template sequences, but the amplicon Are present in the reference template sequence so that they constitute one of the listed SEQ ID NOs. Unless otherwise noted, it applies to any reference template sequence defined herein as consisting of a SEQ ID NO.

The at least two primers targeting A6 may be, for example, at least 1 (forward primer) of SEQ ID NOs: 30 to 34 and at least 1 (reverse primer) of SEQ ID NOs: 35 to 37.

  The X in the table indicates that the primers can be paired together.

  According to an advantageous embodiment of the invention, the determination of whether at least one amplicon has been produced by the primer system targeting said at least one A6 comprises, in real-time amplification, at least one probe, preferably at least one It may be performed using a probe targeting A6.

  Conveniently, the determination of whether at least one amplicon has been made is, in real-time amplification, SEQ ID NO: 38-40 or a sequence complementary thereto (ie completely complementary over the entire length of said sequence) At least one 5 'and / or 3' detection label and / or at least one beacon arm, or scorpion.RTM. ) It is intended to carry a quencher or reporter (eg a fluorophore) like two arms, preferably at least one 5 'and / or 3' arm, most preferably 5 'and 3' respectively. And at least one arm unrelated to HPV.

As shown in the following examples (see, eg, Table 23), preferred combinations of primer pairs and probes are shown below:

  Conveniently, the at least one A6 targeting probe is a beacon probe whose sequence is one of SEQ ID NOs: 41-45 or a sequence complementary thereto (ie, over the entire length of the sequence). Sequence of the same length that is completely complementary).

As shown in the examples below (see, eg, Table 23), the most preferred combinations of primer pairs and beacon probes are shown below:

  Preferably, each sequence of the at least two A5 targeting primers is suitable for use in amplification of at least one reference template sequence, and the at least one reference template sequence is SEQ ID NO: 421 (reception A fragment consisting of positions 678-902 of the HPV51 sequence of SEQ ID NO: NC_001533.1) (SEQ ID NO: 326); or an HPV that may be carcinogenic to mucosal epithelium, preferably at least 5 of the most common HPV ( HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently in groups A6 and / or A5 At least two other HR HPVs belonging to it (eg, HPV 56, 51, 33, 31, 16, 45, 18), More preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and at least 1, at least 2, at least 3, at least 4, or 5 HPVs 66, 53, 82, 67, 85 real-time multiplex detection possible Or a conservative sub-fragment thereof that retains the property of being a suitable reference template sequence to produce and produce a primer targeting A5; A sequence that is completely complementary to the fragment or subfragment over its entire length.

  More preferably, each sequence of said at least two A5 targeting primers is suitable for use in specific amplification of at least one reference template sequence, said at least one reference template sequence comprising: 12, it consists of one of SEQ ID NO: 1-5 and SEQ ID NO: 320-333 or is a completely complementary sequence over the entire length of the sequence of said SEQ ID NO.

  Said reference template sequence is HPV which may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPVs (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPV, More preferably the 5 most common HR HPVs and at least 2 other HR HPVs, advantageously at least 2 other HR HPVs belonging to the A6 and / or A5 groups (eg HPV56, 51, 33, 31, 16 45, 18), more preferably at least 13 HR HPV, most preferably at least 13 HR HPV and HPV 66, 53, 82, 67, 85 at least 1, at least 2, at least 3, at least 4, or 5 real time Multiplex detection, preferably such HPV real-time It allows for quantitative multiplex detection of A5 to build a targeted primers, have a special technical feature of being suitable references produced.

  The at least two primers targeting A5 may be, for example, at least 1 (forward primer) of SEQ ID NOs: 6 to 10 and at least 1 (reverse primer) of SEQ ID NOs: 11 to 15.

As described in the examples below (see, eg, Table 17), preferred combinations of forward and reverse primers are as follows:

  X in the table means primers that can be combined with each other as a pair.

  Conveniently, the determination of whether at least one amplicon is made is determined in real-time amplification by one of SEQ ID NOs 16-19, or a sequence complementary thereto (ie, completely over the entire length of said sequence). Probes that target at least one A5 consisting of one of the same length sequences), and optionally at least one detection label and / or at least one beacon arm, or a Scorpion® arm A quencher or reporter (eg a fluorophore), preferably as one such arm at 5 ′ and / or 3 ′, most preferably two such arms at each 5 ′ and 3 ′ This is done using at least one HPV-independent arm intended to carry.

As described in the examples below (see, eg, Table 17), preferred combinations of primer pairs and probes are as follows:

  Conveniently, the probe targeting the at least one A5 is a beacon probe, the sequence of which is one of SEQ ID NOs: 20-24 or a sequence complementary thereto (ie, the complete length of the sequence). One sequence of the same length that is complementary to).

As described in the following examples (see, eg, FIG. 17), the most preferred combinations of primer pairs and probes are as follows:

Preferably, each sequence of said at least two A9 targeting primers is suitable for use in amplification of at least one reference template sequence, said at least one reference template sequence comprising:
A fragment (SEQ ID NO: 122) consisting of positions 2707 to 2794 of the HPV16 sequence of SEQ ID NO: 422 (Accession number NC — 001526.1); or HPV, preferably at least 5 most likely to be carcinogenic to mucosal epithelium HPV (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently A6 and / or At least two other HR HPVs belonging to group A5 (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and HPVs 66, 53 82, 67, 85, at least 1, at least 2, at least 3, at least Conservative subfragments that retain the property of being a suitable reference template sequence to construct and generate a primer targeting A5 that allows real-time multiplex detection of 4 or 5 ); Or a sequence that is completely complementary to the fragment or subfragment over the entire length of the fragment or subfragment, or a fragment comprising positions 3600-3840 of the HPV16 sequence of SEQ ID NO: 422 (accession number NC_001526.1) (SEQ ID NO: 377); or an HPV that may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPVs (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPV More preferably the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently A6 and / or At least two other HR HPVs belonging to group A5 (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and HPVs 66, 53 82, 67, 85 are suitable reference template sequences that construct and produce A5 targeting primers that allow real-time multiplex detection of at least 1, at least 2, at least 3, at least 4, or 5 A conservative sub-fragment that retains properties; or a sequence that is completely complementary to the fragment or subfragment over the entire length of the fragment or subfragment.

  More preferably, each sequence of the at least two A9-targeting primers is at least one reference template sequence consisting of any one of SEQ ID NOS: 122-210 and 359-419 as shown in Table 30 or the sequence Suitable for use in the specific amplification of sequences that are completely complementary to them over the entire length of the sequence numbered.

  Said reference template sequence is in particular HPV which may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPV (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR. HPV, more preferably the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the A6 and / or A5 groups (eg HPV 56, 51, 33, 31 16, 45, 18), more preferably at least 13 HR HPV, most preferably at least 13 HR HPV and HPV 66, 53, 82, 67, 85 at least 1, at least 2, at least 3, at least 4, or 5 Real-time multiplex detection, preferably such HPV real-time The A9 which permits quantitative multiplex detection of beam constitutes a targeted primers, have a special technical feature of being suitable references produced.

  The primer that targets at least two A9s may be, for example, at least 1 (forward primer) of SEQ ID NOs: 211 to 239 and at least 1 (reverse primer) of SEQ ID NOs: 240 to 265.

As described in the following examples (see, eg, Table 35), preferred combinations of forward and reverse primers are as follows:
-A9 amplification system C: at least one of SEQ ID NO: 211-217 and at least one of SEQ ID NO: 240-241; preferably at least 3 of SEQ ID NO: 211-217 if amplification of all oncogenic HPV of group A9 is desired For example, both 212, 214 and 216, and SEQ ID NOs 240-241;
-A9 amplification system E1: at least one of SEQ ID NO: 218-220 and at least one of SEQ ID NO: 242-247; preferably at least 3 of SEQ ID NO: 218-220 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 242-247 (eg, SEQ ID NOs: 242-243, 245-247);
-A9 amplification system E2: at least 1 of SEQ ID NO: 221-223 and at least 1 of SEQ ID NO: 242-247; preferably at least 3 of SEQ ID NO: 221-223 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 242-247 (eg, SEQ ID NOs: 242-243, 245-247);
-A9 amplification system E3: at least one of SEQ ID NO: 221-223 and at least one of SEQ ID NO: 248-255; preferably at least 3 of SEQ ID NO: 221-223 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 248-255 (eg, SEQ ID NOs: 248-252);
A9 amplification system E4: at least one of SEQ ID NO: 224-226 and at least one of SEQ ID NO: 248-255; preferably at least 3 of SEQ ID NO: 224-226 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 248-255 (eg, SEQ ID NOs: 248-252);
-A9 amplification system E5: at least one of SEQ ID NO: 224-226 and at least one of SEQ ID NO: 242-247; preferably at least 3 of SEQ ID NO: 224-226 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 242-247 (eg, SEQ ID NOs: 242-243, 245-247);
-A9 amplification system E6: at least 1 of SEQ ID NO: 218-220 and at least 1 of SEQ ID NO: 248-255; preferably at least 3 of SEQ ID NO: 218-220 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 248-255 (eg, SEQ ID NOs: 248-252);
-A9 amplification system E1H Z7: at least one of SEQ ID NO: 218-220 and SEQ ID NO: 256-259; at least one of 261-265; At least 3 of -220 and at least 4 of SEQ ID NOs: 256-259; 261-265 (eg, SEQ ID NOs: 258; 261; 264; 265);
-A9 amplification system E1H Z8: at least one of SEQ ID NO: 218-220 and SEQ ID NO: 256-259; at least one of 261-265; At least 3 of -220 and at least 4 of SEQ ID NOs: 256-259; 261-265 (eg, SEQ ID NOs: 258; 261; 264; 265);
-A9 amplification system E2H Z7: at least one of SEQ ID NO: 221 to 223 and SEQ ID NO: 256 to 259; at least one of 261 to 265; At least 3 of -223 and at least 4 of SEQ ID NOs: 256-259; 261-265 (eg, SEQ ID NOs: 258; 261; 264; 265);
-A9 amplification system E2H Z8: same as A9 amplification system E2H Z7, ie at least one of SEQ ID NO: 221-223 and SEQ ID NO: 256-259; at least one of 261-265; Wherein at least 3 of SEQ ID NO: 221-223 and at least 4 of SEQ ID NO: 256-259; 261-265 (eg, SEQ ID NO: 258; 261; 264; 265);
-A9 amplification system E4H Z7: at least one of SEQ ID NO: 224-226 and SEQ ID NO: 256-259; at least one of 261-265; At least 3 of -226 and at least 4 of SEQ ID NOs: 256-259; 261-265 (eg, SEQ ID NOs: 258; 261; 264; 265);
-A9 amplification system E4H Z8: at least one of SEQ ID NO: 224-226 and SEQ ID NO: 256-259; at least one of 261-265; At least 3 of -226 and at least 4 of SEQ ID NOs: 256-259; 261-265 (eg, SEQ ID NOs: 258; 261; 264; 265);
-A9 amplification system F: at least one of SEQ ID NO: 227-230 and at least one of SEQ ID NO: 248-255; preferably at least 4 of SEQ ID NO: 227-230 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 248-255 (eg, SEQ ID NOs: 248-252);
-A9 amplification system FE: at least one of SEQ ID NO: 227-230 and at least one of SEQ ID NO: 242-247; preferably at least 4 of SEQ ID NO: 227-230 if amplification of all oncogenic HPV of group A9 is desired And at least 5 of SEQ ID NOs: 242-247 (eg, SEQ ID NOs: 242-243; 245-247);
-A9 amplification system FH Z7: at least one of SEQ ID NO: 227-230 and SEQ ID NO: 256-259; at least one of 261-265; At least 4 of -230 and at least 4 of SEQ ID NOs: 256-259; 261-265 (eg, SEQ ID NOs: 258; 261; 264; 265);
-A9 amplification system FH Z8: identical to A9 amplification system FH Z7, ie at least one of SEQ ID NO: 227-230 and SEQ ID NO: 256-259; at least one of 261-265; Wherein at least 3 of SEQ ID NO: 227-230 and at least 4 of SEQ ID NO: 256-259; 261-265 (eg, SEQ ID NO: 258; 261; 264; 265);
-A9 amplification system GZ7: at least one of SEQ ID NO: 227-230 and at least one of SEQ ID NO: 256-261; preferably at least one of SEQ ID NO: 227-230 if amplification of all oncogenic HPV of group A9 is desired 3 and at least 5 of SEQ ID NOs: 256-261 (eg, SEQ ID NOs: 257-261);
-A9 amplification system GZ8: Same as A9 amplification system GZ7, ie at least one of SEQ ID NO: 227-230 and at least one of SEQ ID NO: 256-261; preferably amplification of all oncogenic HPV of group A9 is desired Where at least 3 of SEQ ID NO: 227-230 and at least 5 of SEQ ID NO: 256-261 (eg, SEQ ID NO: 257-261);
-A9 amplification system H: at least one of SEQ ID NO: 231 to 239 and SEQ ID NO: 256 to 259; at least one of 261 to 265; preferably SEQ ID NO: 231- if amplification of all oncogenic HPV of group A9 is desired At least 3 of 239 (eg, SEQ ID NO: 232; 234; 235) and at least 4 of SEQ ID NO: 256-259; 261-265 (eg, SEQ ID NO: 258; 261; 264; 265).

  Conveniently, the determination of whether at least one amplicon has been made is determined in real-time amplification by one of SEQ ID NOs: 266-282 or a sequence complementary thereto (ie, completely complementary over the entire length of said sequence). A probe targeting at least one A9 consisting of one of the same length sequences), and optionally at least one detection label and / or at least one beacon arm, or Scorpion® arm, Carrying a quencher or reporter (eg a fluorophore), preferably as at least one such arm at 5 ′ and / or 3 ′, most preferably two such arms at 5 ′ and 3 ′ respectively. Is performed with at least one arm unrelated to the intended HPV.

As described in the examples below (see, eg, Table 35), preferred combinations of primer pairs and probes are as follows:

  Conveniently, the at least one A9-targeting probe is a beacon probe, the sequence of which is one of SEQ ID NOs: 283-319, or a sequence complementary thereto (ie, over the entire length of the sequence). One sequence of the same length that is completely complementary).

As described in the examples below (see, eg, Table 35), the most preferred primer pair and probe combinations are as follows:

  Some of the specific results of the probes described above are shown in Tables 60-68 (A9 specificity).

  In all tables, if the name of a probe differs from the name of another probe by the last character (eg, A9E1S10 and A9E1S10a), these probes have the same hybridizing segment and differ only in their beacon arms.

The gray box indicates that the probe tested detects amplicons.
For example, probe A9E1S11 of SEQ ID NO: 285 detects HPV31 and HPV35 and does not detect other HPVs.

For example, probe A9E1S10a of SEQ ID NO: 284 detects all carcinogenic HPVs of group A9 (HPV16, 31, 33, 35, 52, 58, 67) and one HPV of group A6 (HPV53), SEQ ID NO: 288 Probe A9E1S12a detects HPV31 and HPV35 and does not detect HPV53 ("ND"). Therefore, the combination of A9E1S10a and A9E1S12a allows for the specific detection of HPV16, 31, 33, 35, 52, 58, 67, 53.
Any combination that one skilled in the art can find suitable is expressly included herein.

Preferably, each sequence of said at least two A7 targeting primers is suitable for use in amplification of at least one reference template sequence, said at least one reference template sequence comprising:
A fragment (SEQ ID NO: 48) consisting of positions 1895 to 2103 of the HPV18 sequence of SEQ ID NO: 423 (accession number NC — 001357.1); HPV (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPVs, more preferably 5 most common HR HPVs and at least 2 other HR HPVs, conveniently A6 and / or At least two other HR HPVs belonging to group A5 (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and HPVs 66, 53 82, 67, 85, at least 1, at least 2, at least 3, at least Or a conservative sub-fragment that retains the property of being a suitable reference template sequence to produce and generate a primer targeting A7 that allows real-time multiplex detection of 5 Or a sequence that is completely complementary to the fragment or subfragment over the entire length of the fragment or subfragment, or a fragment comprising positions 916-1044 of the HPV18 sequence of SEQ ID NO: 423 (accession number NC_001357.1) ( SEQ ID NO: 65); or HPV, which may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPV (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR HPV, More preferably the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently the A6 and / or A5 groups At least two other HR HPVs belonging to (eg HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least 13 HR HPVs, most preferably at least 13 HR HPVs and at least 1, at least 2 The ability to construct and produce a primer targeting A5 that enables real-time multiplex detection of at least 3, at least 4, or 5 HPV 66, 53, 82, 67, 85. A conserved sub-fragment thereof; or a sequence that is completely complementary to the fragment or sub-fragment over the entire length of the fragment or sub-fragment.

  More preferably, the sequence of each of the at least two A7 targeting primers is at least one reference template sequence consisting of SEQ ID NOs: 46-67; 339-358, as shown in Table 24, or Suitable for use in specific amplification of sequences that are completely complementary to them over the entire length of the sequence.

  Said reference template sequence is in particular HPV which may be carcinogenic to mucosal epithelium, preferably at least 5 most common HPV (HPV 16, 18, 45, 31, 33), more preferably at least 7 HR. HPV, more preferably the 5 most common HR HPVs and at least 2 other HR HPVs, conveniently at least 2 other HR HPVs belonging to the A6 and / or A5 groups (eg HPV 56, 51, 33, 31 16, 45, 18), more preferably at least 13 HR HPV, most preferably at least 13 HR HPV and HPV 66, 53, 82, 67, 85 at least 1, at least 2, at least 3, at least 4, or 5 Real-time multiplex detection, preferably such HPV real-time The A7 which permits quantitative multiplex detection of beam constitutes a targeted primers, have a special technical feature of being suitable references produced.

  The primer targeting A7 of at least 2 may be, for example, at least 1 (forward primer) of SEQ ID NOs: 68 to 78 and at least 1 (reverse primer) of SEQ ID NOs: 79 to 87.

As illustrated in the examples below (see, for example, Table 29), preferred combinations of forward and reverse primers are as follows:
-A7 amplification system A: at least one of SEQ ID NO: 68-70 and at least one of SEQ ID NO: 79-81; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system A1: Same as A7 amplification system A, i.e. at least one of SEQ ID NO: 68-70 and at least one of SEQ ID NO: 79-81; preferably when amplification of all oncogenic HPV of group A7 is desired All of them;
-A7 amplification system A2: same as A7 amplification system A or A1, ie at least one of SEQ ID NO: 68-70 and at least one of SEQ ID NO: 79-81; preferably amplification of all oncogenic HPV of group A7 is desired All of them if
-A7 amplification system AB: at least one of SEQ ID NO: 68-70 and at least one of SEQ ID NO: 82-83; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system AC1: at least one of SEQ ID NO: 68-70 and at least one of SEQ ID NO: 84-85; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system AC2: same as A7 amplification system AC1, ie at least one of SEQ ID NO: 68-70 and at least one of SEQ ID NO: 84-85; preferably when amplification of all oncogenic HPV of group A7 is desired All of them;
-A7 amplification system AC3: same as A7 amplification system AC1 or Ac2, ie at least 1 of SEQ ID NO: 68-70 and at least 1 of SEQ ID NO: 84-85; preferably amplification of all oncogenic HPV of group A7 is desired All of them if
-A7 amplification system B: at least one of SEQ ID NO: 71-73 and at least one of SEQ ID NO: 82-83; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system BA1: at least one of SEQ ID NO: 71-73 and at least one of SEQ ID NO: 79-81; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system BA2: Same as A7 amplification system BA1, ie at least one of SEQ ID NO: 71-73 and at least one of SEQ ID NO: 79-81; preferably, amplification of all oncogenic HPV of group A7 is desired All of them;
-A7 amplification system BA3: same as A7 amplification system BA1 or BA2, ie at least 1 of SEQ ID NO: 71-73 and at least 1 of SEQ ID NO: 79-81; preferably amplification of all oncogenic HPV of group A7 is desired All of them if
-A7 amplification system BC1: at least one of SEQ ID NO: 71-73 and at least one of SEQ ID NO: 84-85; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system BC2: Same as A7 amplification system BC1, ie, at least one of SEQ ID NO: 71-73 and at least one of SEQ ID NO: 84-85; preferably, amplification of all oncogenic HPV of group A7 is desired All of them;
-A7 amplification system BC3: same as A7 amplification system BC1 or BC2, ie at least one of SEQ ID NO: 71-73 and at least one of SEQ ID NO: 84-85; preferably amplification of all oncogenic HPV of group A7 is desired All of them if
-A7 amplification system C: at least one of SEQ ID NO: 74-76 and at least one of SEQ ID NO: 84-85; preferably all of them when amplification of all oncogenic HPV of group A7 is desired;
-A7 amplification system C1: same as A7 amplification system C, ie, at least one of SEQ ID NOs: 74-76 and at least one of SEQ ID NOs: 84-85; preferably when amplification of all oncogenic HPV of group A7 is desired All of them;
-A7 amplification system CA1: same as A7 amplification system C1, ie, at least one of SEQ ID NOs: 74-76 and at least one of SEQ ID NOs: 79-81; preferably when amplification of all oncogenic HPV of group A7 is desired All of them;
-A7 amplification system CA2: same as A7 amplification system C1 or CA1, ie at least one of SEQ ID NO: 74-76 and at least one of SEQ ID NO: 79-81; preferably amplification of all oncogenic HPV of group A7 is desired All of them if
-A7 amplification system D: at least one of SEQ ID NO: 77-78 and at least one of SEQ ID NO: 86-87; preferably all of them when amplification of all oncogenic HPV of group A7 is desired.

  Conveniently, the determination of whether at least one amplicon has been made is determined in real-time amplification by one of SEQ ID NOs: 88-101 or a sequence complementary thereto (ie, completely complementary over the entire length of said sequence). A probe targeting at least one A7 consisting of one of the same length sequences), and optionally at least one detection label and / or at least one beacon arm, or Scorpion® arm, Carrying a quencher or reporter (eg a fluorophore), preferably as at least one such arm at 5 ′ and / or 3 ′, most preferably such two arms at 5 ′ and 3 ′ respectively. Is performed with at least one arm unrelated to the intended HPV.

As described in the examples below (see, eg, Table 29), preferred combinations of primer pairs and probes are as follows:

  Conveniently, the at least one A7-targeting probe is a beacon probe, the sequence of which is one of SEQ ID NOs 102-121 or a sequence complementary thereto (ie, the entire length of the sequence is complete). One sequence of the same length complementary to each other).

As described in the examples below (see, eg, Table 29), the most preferred combinations of primer pairs and probes are as follows:

  The amplification may be any nucleic acid amplification that has been found to be suitable for those skilled in the art, for example PCR (polymerase chain reaction), or eg TMA (transcription mediated amplification), NASBA (nucleic acid sequence based) amplification), isothermal amplification techniques such as 3SR (self sustained sequence replication) or strand displacement amplification. Said amplification is preferably PCR.

  In a preferred embodiment, the primers according to the invention are used in a final concentration range of 100 to 2000 nM. Typically, the primer may be used in a final concentration range of 200-1500 nM, preferably 250-1000 nM, more preferably 500-1000 nM, even more preferably 600-1000 nM.

  The probe concentration in the PCR reaction may typically be optimized by varying the final concentration from 50 nM to 1000 nM. In a preferred embodiment, the probe according to the invention is used in a final concentration range of 50-1000 nM, preferably 100-800 nM, more preferably 100-600 nM, even more preferably 200-600 nM.

  Appropriate amplification conditions are known to those skilled in the art. They include temperature conditions, particularly thermal cycle conditions, such as cycle temperature, duration, number, and heating rate. In a preferred embodiment, the temperature condition includes conditions suitable for PCR. In another preferred embodiment, the conditions include conditions suitable for Q-PCR.

  At least one real-time amplification system targeting A6 of the present invention and at least one real-time amplification system targeting A5 of the present invention and at least one real-time amplification system targeting A9 of the present invention and at least Megaplexes considered by those skilled in the art, ie multi-multiplex, comprising one real-time amplification system targeting one A7 of the present invention are encompassed by the present application.

  For example, system E targeting A5, and system A targeting A6, and system A targeting A7, and system H targeting A9 can be used together in a single tube assay, Form a megaplex (“megaplex EAAH”).

  For example, system E targeting A5, and system B targeting A6, and system A targeting A7, and system C targeting A9 can be used together in a single tube assay, Form a megaplex (“megaplex EBAC”).

The specificity and reactivity results of such megaplexes are shown in Tables 83-88 below.
From Tables 84 and 87 (“Megaplex EAAH”), such megaplexes are effective for oncogenic HPV, ie 13 HR HPV and 5 other oncogenic HPVs (HPV 66, 53, 82, 67, 85). This megaplex is sufficiently homogeneous to be quantitative for at least 13 HR HPVs and 4 other oncogenic HPVs (HPV 66, 53, 82, 85) as a result. Has reactivity and specificity (Ct).

  From Tables 86 and 88 (“Megaplex EBAC”), such a megaplex allows for efficient detection of at least 13 HR HPVs, resulting in at least 5 most common HR HPVs. It has sufficiently homogeneous reactivity and specificity (Ct) to be quantitative for (HPV 16, 18, 45, 31, 33).

Preferred megaplexes comprise in particular the EAAH and EBAC megaplexes mentioned above and the following megaplex systems:
-System E targeting A5, and System B targeting A6, and System C targeting A7, and System C targeting A9 can be used together in a single tube assay. Form a megaplex (“megaplex EBCC”);
-A combination of system E targeting A5 and system B targeting A6 and system B targeting A7 and system C targeting A9 can be used together in a single tube assay. Form a megaplex (“megaplex EBBC”);
-A combination of system E targeting A5 and system B targeting A6 and system D targeting A7 and system C targeting A9 can be used together in a single tube assay. Form a megaplex (“megaplex EBDC”);
The combination of system E targeting A5 and system B targeting A6 and system A targeting A7 and system H targeting A9 can be used together in a single tube assay. , Form a megaplex (“megaplex EBAH”).

  The present application relates to an HPV-containing sample containing at least one HPV from the group A6, A5, A9 or A7, for example HPV66 and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66. 46. Implementation of the method according to any one of claims 1 to 45 in a sample containing and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66 and / or HPV66 Also relates to any amplicon obtained by

The present invention is also directed to polynucleotides suitable for use as reference template sequences in the design of primers that can be used in a multiplex,
At least the five most common HR HPVs (HPV 16, 18, 45, 31, 33),
Preferably at least 7 HR HPV,
More preferably, the five most common HR HPVs and at least two other HR HPVs, conveniently at least two other HR HPVs belonging to the A6 and / or A5 groups (eg HPV 56, 51, 33, 31 16, 45, 18),
More preferably at least 13 HPVs known as HR HPVs (HPV types 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18),
More preferably, at least 13 HPVs and at least one of HPVs 66, 82, 67, 85, and 53,
Even more preferably, at least 13 HPVs and at least 2 of HPVs 66, 82, 67, 85, and 53,
Even more preferably, at least 13 HPVs and at least 3 of HPVs 66, 82, 67, 85, and 53,
Most preferably, at least 13 HPVs and at least 4 of HPVs 66, 82, 67, 85 and 53, in particular at least 17 mucosal HPVs consisting of said 13HR HPV and HPV types 66, 82, 67, 85,
Even more preferably, at least 13 HPVs and at least 5 HPV types 66, 82, 67, 85, and 53
Providing a real-time quantitative amplification of them in a single amplification.

  Of course, the polynucleotides according to the present invention are also suitable for further protocols including simplex protocols, multiplex protocols, endpoint protocols, qualitative protocols, quantitative protocols, combinations thereof and the like.

  A nucleotide is understood here to be a polymer of nucleotides, which may be ribonucleotides, deoxyribonucleotides, dideoxyribonucleotides, denatured nucleotides and the like. The nucleotide is preferably single-stranded, but may be double-stranded. The length of the polynucleotide may vary and is usually 500 nucleotides (nt) or less, preferably 50 to 400 nt, more preferably 100 to 300 nt, and even more preferably 80 to 260 nt.

The present application relates to the design of primers that can be used in a single tube multiplex for amplifying HPVs of groups A6, A5, A9 and A7, and in a single tube multiplex for real time detection of the amplified HPV. With respect to a polynucleotide suitable for use as a reference template sequence in the design of probes that can be used, said reference template polynucleotide is selected from:
-Group A6: a fragment consisting of positions 413 to 791 of the HPV56 sequence of SEQ ID NO: 420 (accession number NC_001594.1), or a conservative subfragment thereof, or the fragment or subfragment over the entire length of the fragment or subfragment A completely complementary sequence to
-Group A5: a fragment consisting of positions 678 to 902 of the HPV51 sequence of SEQ ID NO: 421 (accession number NC — 001533.1), or a conservative subfragment thereof, or the fragment or subfragment over the entire length of the fragment or subfragment A completely complementary sequence to
-Group A9: a fragment consisting of positions 2707 to 2794 of HPV16 sequence of SEQ ID NO: 422 (accession number NC — 001526.1), or a conservative subfragment thereof, or the fragment or subfragment over the entire length of the fragment or subfragment A completely complementary sequence; or a fragment consisting of positions 3600-3840 of the HPV16 sequence of SEQ ID NO: 422 (accession number NC_001526.1), or a conservative subfragment thereof, or the entire length of the fragment or subfragment Sequence completely complementary to said fragment or subfragment;
-Group A7: a fragment consisting of positions 1895 to 2103 of the HPV18 sequence of SEQ ID NO: 423 (accession number NC_001357.1), or a conservative subfragment thereof, or the fragment or subfragment over the entire length of the fragment or subfragment Or a fragment consisting of positions 916 to 1044 of the HPV18 sequence of SEQ ID NO: 423 (Accession No. NC — 001357.1), or a conservative subfragment thereof, or the total length of the fragment or subfragment A sequence completely complementary to said fragment or subfragment across;
The conservative fragment has the property that it is a suitable reference template sequence for constructing and producing primers targeting groups that allow real-time multiplex detection of HPV that may be carcinogenic to mucosal epithelium. keeping.

  The present application particularly relates to any reference template polynucleotide consisting of one of SEQ ID NOs: 25 to 29 and SEQ ID NOs: 334 to 338 (reference template polynucleotide targeting the group A6), or the full length of the sequence of the SEQ ID NO: Across sequences completely complementary to them.

  The present application particularly covers any reference template polynucleotide consisting of one of SEQ ID NOs: 1 to 5 and SEQ ID NOs: 320 to 333 (reference template sequence targeting group A5), or the entire length of the sequence of SEQ ID NO: And fully complementary to them.

  The present application particularly covers any reference template polynucleotide consisting of one of SEQ ID NOS: 122 to 210 and SEQ ID NOS: 359 to 419 (reference template sequence targeting the group A9), or the entire length of the sequence of the SEQ ID NO: And fully complementary to them.

  The present application particularly relates to any reference template polynucleotide (reference template sequence targeting group A7) consisting of one of SEQ ID NOs: 46 to 67; 339 to 358, or over the full length of the sequence of said SEQ ID NO. Relates to a completely complementary sequence.

  Conservative variations of the reference template polynucleotides of the invention are also encompassed by the present application. Conservative variations of a given parent reference template sequence include in particular from the parent reference template polynucleotide or sequences completely complementary thereto, deletion and / or substitution of at least one nucleotide and Targets A5 and / or A6 and / or A7 and / or A9 which allows amplification of at least one HPV that is any polynucleotide by // addition but may be carcinogenic to mucosal epithelium Polynucleotides that retain the ability to be reference template polynucleotides for the design and construction of primer pairs are included. Illustrative conservative variations are usually at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% with the parent reference template polynucleotide or a sequence completely complementary thereto. Polynucleotides having the same sequence (the identity value is calculated for the full-length or fully complementary sequence of the parent reference template polynucleotide). Illustrative conservative variations comprise those that do not differ ± 5 nucleotides from the parent sequence.

  The present application also relates to the primers and probes of the invention, ie individual oligonucleotide products.

  Conservative variations of the primers of the present invention are also encompassed by the present application. A conservative variation of a given parent primer is in particular any one by deletion and / or substitution and / or addition of at least one nucleotide derived from said parent primer or a sequence completely complementary thereto. Oligonucleotide but retains the ability to be a primer targeting A5 and / or A6 and / or A7 and / or A9 for amplification of at least one HPV that may be carcinogenic to mucosal epithelium Oligonucleotides are included. Illustrative conservative variations usually comprise an oligonucleotide having a sequence that is at least 80%, preferably at least 81%, more preferably at least 83%, and most preferably at least 85% identical to the parent primer (see above). Identity values are calculated for the full length or fully complementary sequence of the parent primer). Illustrative conservative variations comprise those that do not differ ± 5 nucleotides from the parent sequence.

  Conservative variations of the probe of the present invention are also encompassed by the present application. A conservative variation of a given parent probe is in particular derived from said parent probe or a sequence completely complementary thereto, and any oligo by deletion and / or substitution and / or addition of at least one nucleotide. Nucleotides but retains the ability to be a probe targeting A5 and / or A6 and / or A7 and / or A9 for amplification of at least one HPV that may be carcinogenic to mucosal epithelium Oligonucleotides are included. Illustrative conservative variations usually include sequences that are at least 90%, preferably at least 91%, more preferably at least 93%, most preferably at least 95% identical to the parent probe or a sequence completely complementary thereto. (The identity value is calculated for the total length of the parent probe). Illustrative conservative variations comprise those that do not differ ± 5 nucleotides from the parent sequence.

  The present application relates in particular to primers suitable for HPV amplification, and in particular applies to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups.

The primer is, for example,
A primer targeting A6 consisting of any one of SEQ ID NOs: 30 to 34 and SEQ ID NOs: 35 to 37; or a primer targeting A5 consisting of any one of SEQ ID NOs: 6 to 10 and SEQ ID NOs: 11 to 15 Or a primer targeting A9 consisting of any one of SEQ ID NO: 211-239 and SEQ ID NO: 240-265; or-targeting A7 consisting of any one of SEQ ID NO: 68-78 and SEQ ID NO: 79-87 Primer.

  The present application relates in particular to primer systems suitable for HPV amplification, and in particular applies to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups.

The primer system is, for example: a primer that targets at least one A6 consisting of one of SEQ ID NOS: 30 to 34 and a primer that targets at least one A6 consisting of one of SEQ ID NOS: 35 to 37; and / or a sequence A primer targeting at least one A5 consisting of one of the numbers 6 to 10 and a primer targeting at least one A5 consisting of one of the sequence numbers 11 to 15; and / or-consisting of one of the sequence numbers 211 to 239 A primer that targets at least one A9 and a primer that targets at least one A9 consisting of one of SEQ ID NOs: 240-265; and / or a target that targets at least one A7 consisting of one of SEQ ID NOs: 68-78 A primer targeting at least one A7 consisting of a primer and one of SEQ ID NOs: 79-87 You may be a rimer.

  This application relates in particular to probes suitable for HPV detection, and in particular applies to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups.

The probe is, for example,
A probe targeting A6 consisting of any one of SEQ ID NOs: 38-40, or a sequence that is completely complementary over the entire length of the sequence of SEQ ID NO :; or any of SEQ ID NOs: 16-19 Or a probe targeting A5 consisting of 1 or a sequence completely complementary to them over the entire length of the sequence of SEQ ID NO; or-targeting A9 consisting of any one of SEQ ID NOs: 266-282 Or a sequence completely complementary to them over the entire length of the sequence of SEQ ID NO; or a probe targeting A7 consisting of any one of SEQ ID NOs: 88 to 101, or of the sequence number It may be a sequence completely complementary to them over the entire length of the sequence.

  The probes are produced in a variety of formats including, for example, Taqman® probes (hydrolysis probes), molecular beacons (registered trademarks) (beacon probes or molecular beacon probes), and scorpion® probes. May be. One preferred format is the beacon format.

  Therefore, the present application relates in particular to beacon probes suitable for HPV detection, and in particular applies to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups.

The beacon probe is, for example,
A probe targeting A6, consisting of any one of SEQ ID NOs: 41 to 45 or a sequence completely complementary thereto over the entire length of the sequence of SEQ ID NOs; or A probe targeting A5 consisting of any one or a sequence completely complementary to them over the entire length of the sequence of SEQ ID NO; or any one of SEQ ID NOs: 283 to 319 or the sequence A probe targeting A9 consisting of a sequence completely complementary to them over the entire length of the number sequence; or-any one of SEQ ID NO: 102-121 or over the entire length of the sequence of SEQ ID NO: It may be a probe targeting A7 consisting of a sequence completely complementary to them.

  The beacon probe may further include a quencher and a reporter (eg, a fluorophore).

  Preferably, each probe has its own reporter so that each probe has a different reporter than that shown by the other probes, so that each probe can be easily distinguished from the other probes.

The present application relates in particular to primer and probe systems suitable for HPV amplification, and in particular applies to real-time multiplex amplification of HPV A6 and A5 and A9 and A7.
Said primer and probe system comprises at least one primer system according to the invention and at least one probe according to the invention.

  The application further relates to a group A6, A5, A9 or A7 HPV, for example HPV66 and / or HPV53 and / or HPV82 and / or HPV58 and / or HPV33 and / or by means of at least one primer system according to claim 53. Or any amplifier obtained by amplifying at least one nucleic acid from HPV67 and / or HPV52 and / or HPV35 and / or HPV31 and / or HPV68 and / or HPV39 and / or HPV85 and / or HPV59 and / or HPV45 Regarding recon.

Amplifying compositions comprising such amplicons are also encompassed by the present invention.
The present invention also relates to amplification compositions, pharmaceutical compositions, biological compositions comprising at least one primer or probe of the present invention.

The invention also relates to a kit for diagnosing or preventing cervical neoplasia or cancer comprising:
At least one primer system according to the invention, and / or at least one probe according to the invention,
-Optionally instructions for the use of them and / or nucleotides.

  Preferably, said kit comprises at least 2 primer systems according to the invention, more preferably at least 3 primer systems according to the invention, most preferably at least 4 primer systems according to the invention. The kit comprises more than one probe, for example at least 2, at least 3, at least 4, at least 5 different probes, particularly where the kit is intended to distinguish between different HPV types.

In the kit according to the invention, the oligonucleotides (primers, probes) may be kept separately, partially mixed or fully mixed.
The oligonucleotide may be provided in dry form or solubilized in a suitable solvent as determined by one skilled in the art. Suitable solvents include TE, PCR grade water, and the like.

In a preferred embodiment, the kit according to the invention may comprise further reagents suitable for the PCR step.
Such reagents are known to those skilled in the art and include nuclease-free water, RNase-free water, DNAse-free water, PCR-grade water; salts such as magnesium, potassium; Tris Buffers such as: Taq®, Vent®, Pfu®, enzymes including polymerases such as activatable polymerases; deoxynucleotides, dideoxynucleotides, dNTPs, dATP, dTTP, dCTP , DGTP, dUTP; nucleotides such as DTT and / or RNase inhibitors; and polynucleotides such as polyT, polydT, and other oligonucleotides such as primers.

  In another preferred embodiment, the kit according to the invention comprises a PCR control. Such controls are known in the art and include qualitative controls, positive controls, negative controls, internal standards, quantitative controls, internal quantitative controls, and calibration ranges. The internal standard for the PCR step may be a template independent of the target template in the PCR step. Such controls may include control primers and / or control probes. For example, in the case of HPV detection, it is possible to use, as an internal standard, a polynucleotide selected from genes whose presence has been eliminated in a sample derived from the human body (for example, a plant gene), and its size And the GC content is equivalent to that derived from the target sequence.

  In a preferred embodiment, the kit according to the invention comprises means for extracting and / or purifying nucleic acids from biological samples such as, for example, blood, serum, plasma. Such means are well known to those skilled in the art.

  In a preferred embodiment, the kits according to the invention comprise instructions for their use. The instructions may conveniently be a leaflet, a card or the like. The instructions may exist in two forms: in particular, if comprehensive information about the kit and its use is collected, including bibliographic data where possible: and in the form of a quick guide or A memo, for example in the form of a card in which essential information necessary for use is collected.

  In a preferred embodiment, the kit is a diagnostic kit, in particular an in vitro diagnostic kit, ie an HPV diagnostic kit.

The present invention also relates to the fields of diagnosis, prognosis, and drug / therapeutic effect monitoring, as described above.
The oligonucleotides according to the invention can be used for the diagnosis of HPV groups, types, subtypes or strains. In particular, the primers and probes according to the invention are used for in vitro typing, subtyping, and quantification of HPV nucleic acids present in in vitro samples, for example in patients cervical samples or in cell culture supernatants. obtain.

  The term “comprising”, which is synonymous with “comprising” or “comprising”, is open-ended and does not exclude additional, non-enumerated elements, components or method steps, while the term “consisting of” Is a closed term and excludes additional elements, steps or components not explicitly listed. The term “consisting essentially of” is a partially open term, and unless the additional element, step or ingredient substantially affects the basis and new characteristics of the invention, Do not exclude elements, steps, or ingredients not listed.

  Thus, the term “comprising” includes the term “consisting of” as well as the term “consisting essentially of”. Thus, the term “comprising” is understood to encompass the terms “consisting of” and “consisting essentially of” in the present application, in particular.

  In this application, the term “at least x” for a set or group of n elements (x is not zero and n is a number greater than x) specifically includes each value contained between x and n. . For example, for a group or set of 6 elements, the term “at least 1” refers to 1, 2, 3, 4, 5 and 6 of the element, and at least 2, at least 3, at least 4, at least 5 of the element. Include clearly.

  The relevant disclosures of all references cited herein are hereby incorporated by reference. The following examples are provided for purposes of illustration and are not intended to be limiting.

Definition:
The terms and names used in this application generally have their usual meanings in the field of HPV detection and in particular in the field of molecular biology.

  “Amplification” refers to PCR (polymerase chain reaction), or isothermal amplification techniques such as TMA (transcription mediated amplification), NASBA (nucleic acid sequence based amplification), 3SR (self sustained sequence replication) or strand displacement amplification, etc. It means any technique of nucleic acid amplification.

  Amplification methods, particularly PCR-based methods are known in the art (Molecular Cloning: A Laboratory Manual, Maniatis, Fritsch, and Sambrook, CSHL Press; Molecular Biology of the Cell, Alberts et al .; PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, CSHL Press; The Polymerase Chain Reaction, Mullis, Ferre, and Gibbs, Birkhauser Boston Press; Gene quantification, Ferre, Birkhauser Boston Press).

  A PCR or PCR reaction is here understood to be any PCR-based method. This includes standard PCR, qualitative, quantitative and semi-quantitative PCR, real-time PCR, reverse transcriptase PCR (RT-PCR), simplex and multiplex PCR, and the like.

  Real-time PCR can monitor fluorescence-like signals emitted during the reaction as an indicator of amplicon generation during each PCR cycle, as opposed to endpoint detection by conventional PCR methods A PCR-based method is understood here.

  Quantitative PCR is understood here as any PCR-based method that allows an estimation of the initial amount of a given PCR target in a given sample.

  Multiplex PCR is here understood to be any PCR reaction directed to the amplification of two or more targets. For example, multiplex PCR includes duplex PCR (2 targets), triple PCR (3 targets), and more multiplex PCR. Multiplex PCR includes PCR reactions using two or more primer pairs, eg, two primer pairs. In this case, there may be 4 different primers, but it is also possible for 2 primer pairs to have a common 1 primer, eg a forward primer, and 2 different reverse primers. Multiplex PCR uses a single primer pair but also includes PCR reactions using more than one probe.

  The term “megaplex” is often used herein: it has basically the same meaning as “multiplex” but targets at least two different groups (eg A5 and A6 and A7). And a system that targets A9) and a “multiplex” for systems that target a group of groups (eg, systems that target A7 or A9).

  Nucleic acid is understood here as any nucleic acid: synthetic or non-synthetic, recombinant or natural, linear or circular. This includes DNA and RNA. Nucleic acids may be single stranded or double stranded or triple stranded. It may be derived from various biological sources such as microorganisms (bacteria, yeast, etc.) or higher biological pairs such as mammalian cells. Said nucleic acid may be of viral origin, for example HPV nucleic acid. Nucleic acids may include total DNA, total RNA, genomic DNA, mitochondrial DNA, plasmid DNA, BAC DNA, and mixtures thereof. Furthermore, the nucleic acid can be assumed in various purity states.

  An oligonucleotide is understood here to be any short polymer of nucleotides, which may be ribonucleotides, deoxyribonucleotides, dideoxyribonucleotides, denatured nucleotides and the like. The oligonucleotide is preferably single stranded. The length of the oligonucleotide may vary and is usually 150 nucleotides (nt) or less, preferably 10 to 100 nt, more preferably 13 to 60 nt, and even more preferably 13 to 50 nt. The oligonucleotide may have chemical modifications such as labeling or marking such as radioactivity, fluorescence, biotinylation, dig labeling, and the like. The oligonucleotides according to the invention may be forward (sense) or reverse (antisense). In addition, it is clear that a given oligonucleotide has several functions and can be used in different methods according to the present invention, even though preferred functions are mentioned for some oligonucleotides according to the present invention. It should be emphasized. For example, oligonucleotides can be used as primers or probes. Also, if an oligonucleotide is stated to be useful as an amplicon targeting probe, those skilled in the art will understand that sequences complementary to this oligonucleotide are equally useful as probes targeting the same amplicon. Furthermore, it is clear that any primer suitable for a multiplex assay can be used in a simplex protocol within the scope of Honharu. The same applies within the scope of the present invention for primers suitable for the real-time protocol used in the endpoint assay framework.

  The oligonucleotides according to the invention include in particular PCR primers and probes. Unless otherwise indicated, nucleic acid sequences are given in the 5 'to 3' direction. The oligonucleotide may be in many forms, eg, dry form, desired solvent and desired concentration of solution / suspension. Those skilled in the art know what solvents, concentrations and storage conditions are suitable for the oligonucleotides of the invention. In particular, the person skilled in the art knows how to prepare said oligonucleotides as a stock solution. Oligonucleotides according to the present invention may have varying degrees of purity as determined by one skilled in the art, for example by HPLC chromatography.

  An oligonucleotide set or system is here understood to be any combination comprising at least one oligonucleotide, preferably at least 2, for example 2-10 oligonucleotides. The set may comprise one PCR primer, or a pair of PCR primers, or a probe, or a probe and primer pair. The oligonucleotides may be separately, partially mixed or fully mixed.

  The notion of primer or PCR primer is known to those skilled in the art. For example, any oligonucleotide that can anneal to the target template under appropriate stringent conditions is included to allow polymerase chain extension. The typical length of the primer is 13-30 nt, preferably 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nt.

  The terms “primer”, “amplification primer” or “nucleic acid primer” are used interchangeably herein. “Primer” means a short polynucleotide that occurs naturally in a purified restriction digest or is artificially made and under conditions that result in the synthesis of a primer extension product that is complementary to the nucleic acid strand, ie When present in the presence of inducers such as nucleotides and polymerases and at the appropriate temperature and pH, it can act as a starting point for synthesis. The primer should be long enough to give the desired extension product synthesis. The exact length of the primer depends on experimental factors, particularly temperature, primer origin and processing usage.

  The primer pair consists of a forward primer and a reverse primer, the forward primer being sufficiently complementary to hybridize to one HPV strand, and the reverse primer being sufficiently complementary to hybridize to another HPV strand.

  By stringency is meant hybridization conditions selected to optimize polynucleotide sequence binding with different degrees of complementarity. Stringency is affected by temperature, salt conditions, the presence of organic solvents in the hybridization mixture, the length and base composition of the hybridized sequences, and the degree of base mismatch, and the combination of parameters depends on any one of the factors Is more important than absolute measurements.

  Very high stringency: Very high stringency conditions include 5x SSC, 2% sodium dodecyl sulfate (SDS), 100 μg / ml single stranded DNA, 8 hours at 55-65 ° C, filter-bound DNA Means 30 minutes of washing at 60-65 ° C. in 0.1% SDS.

  High stringency: High stringency conditions include hybridization to filter-bound DNA and 5 x SSC, 2% sodium dodecyl sulfate (SDS), 100 μg / ml single stranded DNA at 55-65 ° C for 8 hours. Mean 30 minutes wash at 60-65 ° C. in 0.2 × SSC and 0.2% SDS.

  Medium stringency: The medium stringency condition is 5 × SSC, 2% sodium dodecyl sulfate (SDS), 100 μg / ml single-stranded DNA, 8 hours at 55-65 ° C., filter-bound DNA Hybridization to and wash for 30 minutes at 50-55 ° C. in 0.2 × SSC and 0.2% SDS.

  The concept of a probe is also known to those skilled in the art. For example, any oligonucleotide that can anneal to the target template under the desired hybridization conditions is included. The typical length of the probe is 15 to 60 nt, preferably 16 to 50 nt, more preferably 17 to 40 nt, more preferably 17 to 35 nt, and more preferably 20 to 30 nt. Preferably, the probe is fluorescently labeled. However, it will be apparent to those skilled in the art that primers can be used as probes under certain conditions and vice versa. Furthermore, the products according to the invention, in particular the oligonucleotides, are not limited to the intended use mentioned here, but are interpreted broadly regardless of the intended purpose. For example, a claim to a product (oligonucleotide) for a particular use should be construed as meaning a product (oligonucleotide) suitable for the actually stated use. It is therefore clear that oligonucleotides suitable for use as primers in a multiplex protocol are also applicable to simplex protocols within the scope of the present invention.

  The probe generally consists of a hybridizing segment. By “hybridizing segment” or “annealing segment” of a probe is meant a nucleotide sequence that is intended to anneal to an HPV target.

  Alternatively, the probe may include at least one detection moiety, such as at least one detection label (eg, a radioactive element or a fluorophore). This detection label may be attached to the hybridizing segment of the probe via a short HPV-independent oligonucleotide arm known to those skilled in the art as a beacon arm or a Scorpion® arm. A probe comprising at least one 5 ′ and / or 3 ′ detection label, or at least one 5 ′ and / or 3 ′ beacon arm, comprises a hybridizing segment and at least one 5 ′ and / or 3 ′ label or It consists of a beacon arm.

  Various types (types) of probes are known in the art, including Taqman® probes (hydrolysis probes), molecular beacons® (beacon probes or molecular beacon probes), and scorpion® probes. is there.

  In a preferred embodiment, all probes according to the invention are synthesized and used in a molecular beacon format.

  The structure of the molecular beacon is as follows. A short nucleotide sequence unrelated to the target sequence (a so-called beacon arm) is covalently bound to both ends of the probe. A short unrelated arm binds to the 5 'of the probe and is labeled with a fluorescent moiety (ie, a fluorescent dye or fluorescent marker). Another unrelated arm binds to the 3 'end of the probe and is labeled with a fluorescence quenching moiety. Therefore, molecular beacons have a fluorophore and quencher at opposite ends. The 5 'short arm is totally complementary to that in 3' so that it can anneal together and may have a hairpin structure if it does not hybridize to the target in solution. In this hairpin structure, the quencher and the fluorescent dye are close enough to each other to allow efficient quenching of the fluorophore. However, when the probe encounters the target molecule, annealing is advantageous with respect to the hairpin structure when the values of the beacon arm Tm and the probe Tm are appropriately selected (theoretically, probe Tm> beacon arm Tm> primer) Tm and Tm are respective melting temperatures). The fluorophore and quencher can be remote from each other and can fluoresce when illuminated by appropriate photoexcitation. As PCR progresses, amplification products accumulate and the amount of fluorescence in a given cycle depends on the amount of amplification product present at that time (eg, Sanjay Tyagi and Fred Russell Kramer, Nature Biotechnology 1996, volume 14, pages 303-308; Nature Biotechnology 1998, volume 16, pages 49-53).

(Note: the fluorophore can be attached to the 3 'end and the quencher can be attached to the 5' end).

Schematically, the probe has the following configuration (molecular beacon format):
5 'fluorophore-(arm 1)-probe-(arm 2)-quencher 3'
5 'quencher- (arm 1) -probe- (arm 2) -fluorophore 3'
Here, arm 1 and arm 2 may be, for example, a short nucleotide sequence of 3 to 10 nucleotides, preferably 5, 6, or 7 nucleotides, and can form a hairpin structure under appropriate stringency conditions. That is, arm 1 and arm 2 are fully complementary to the anneal under the desired stringency conditions (standard PCR stringency conditions include, for example, 55-65 ° C. Annealing temperature and 4-8 mM Mg concentration included). However, arm 1 and arm 2 are independent of the target sequence of the probe, ie the hairpin structure that results from annealing between arm 1 and arm 2 is essentially possible only if it does not hybridize. Secondary structure for the probe. Those skilled in the art know how to select such an arm for a given probe.

A schematic beacon format includes the following:
TGCGC- (probe sequence) -GCGCA
GCGCA- (probe sequence) -TGCGC
AGCGC- (probe sequence) -GCGCT
GCGCT- (probe sequence) -AGCGC
CGCGA- (probe sequence) -TCGCG
CGCGC- (probe sequence) -GCGCG.

  A fluorophore is understood here as any fluorescent marker / dye known in the art. Examples of such suitable fluorescent markers include Fam, Hex, Tet, Joe, Rox, Tamra, Max, Edans ), Cy dyes such as Cy5, fluorescein, coumarin, eosin, rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow and Texas Red (all of which are registered trademarks), ATTO dyes The family is included.

  A quencher is here understood to be any quencher known in the art. Examples of such quenchers include Dabcyl, Dark Quencher, Eclipse Dark Quencher, Elle Quencher, Tamura, BHQ and QSY (all of these Registered trademark).

  One skilled in the art knows which dye / quencher combination is appropriate when designing a probe.

  In a preferred embodiment of the present invention, the spectral characteristics of the probes are selected so as not to interfere with each other. In particular, if the probes are used in multiplex, each single probe has a fluorophore that is spectrally significantly different from each other, ie, the absorption / emission spectra are essentially non-overlapping. This advantageously allows low noise multiplex detection for all single probes and ensures that the individual signals do not interfere with each other in the detection. Examples of dyes that can be used together in a multiplex include Fam and Tamra, Fam and Tamra and Texas Red. The selection of the appropriate dye to use together may also depend on the filter included in the amplification device.

  According to the invention, all given oligonucleotides may be separated, partially mixed or fully mixed.

  The oligonucleotide may be solubilized in a dry form or in a suitable solvent as determined by one skilled in the art. Suitable solvents include TE, PCR grade water, and the like.

  The term “significantly” is used herein in the normal sense in the field of statistics (eg, t-test, z-test, chi-square value, or F ratio), ie, one value is compared to another value. Compare and determine if these values differ from each other. Thus, the term “significantly” encompasses the fact that one skilled in the art takes into account the standard deviation (if any) that measures the amount of data spread in the frequency distribution. The desired p-value is usually set to 5% alpha level or 1% more severe alpha level.

  In the examples below, amplification and / or detection targeting several A6, A5, A9 and A7 of the present invention is described.

Tables 12-35 : These tables show the SEQ ID NOs and positions of reference amplicons, forward primers, reverse primers, probes, beacon probes for systems targeting groups of examples of the present invention.

Table 12: Reference amplicons for systems targeting A5 (derived from HPV51 genome)
Table 13: Forward primer for systems targeting A5 Table 14: Reverse primer for systems targeting A5 Table 15: Probes for systems targeting A5 Table 16: Beacon probes for systems targeting A5 Table 17: Systems targeting A5 Table 18: Reference amplicons of systems targeting A6 (derived from HPV56 genome)
Table 19: Forward primer of the system targeting A6 Table 20: Reverse primer of the system targeting A6 Table 21: Probe of the system targeting A6 Table 22: Beacon probe of the system targeting A6 Table 23: Systems targeting A6 Table 24: Reference amplicons of systems targeting A7 (derived from HPV18 genome)
Table 25: Forward primer for systems targeting A7 Table 26: Reverse primer for systems targeting A7 Table 27: Probes for systems targeting A7 Table 28: Beacon probes for systems targeting A7 Table 29: Systems targeting A7 Table 30: Reference amplicons for systems targeting A9 (derived from HPV16 genome)
Table 31: Forward primer for systems targeting A9 Table 32: Reverse primer for systems targeting A9 Table 33: Probes for systems targeting A9 Table 34: Beacon probes for systems targeting A9 Table 35: Systems targeting A9 Tables 36-50: These tables show the number of nucleotide mismatches exhibited by the primers and probes of the present invention (alignment of 50 HPV type sequences); empty boxes are aligned sequences Indicates no alignment; gray box indicates that the number of mismatches is 0, 1, 2, or 3.

Table 36: Number of mismatches shown by primers and probes of systems targeting A5 of the present invention (systems AC)
Table 37: Number of mismatches indicated by primers and probes of the system targeting A5 of the present invention (systems DE)
Table 38: Number of mismatches shown by primers and probes of the system targeting A6 of the present invention (systems AC)
Table 39: Number of mismatches shown by primers and probes of systems targeting A6 of the present invention (systems DE)
Table 40: Number of mismatches shown by primers and probes of the system targeting A7 of the present invention (systems AB)
Table 41: Number of mismatches shown by primers and probes of the system targeting A7 of the present invention (systems CD)
Table 42: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system C)
Table 43: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system E1)
Table 44: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system E2)
Table 45: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system E3)
Table 46: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system E4)
Table 47: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system F)
Table 48: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system GZ7)
Table 49: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system GZ8)
Table 50: Number of mismatches indicated by primers and probes of the system targeting A9 of the present invention (system H)
Tables 51-68: Specificity of the detection system of the invention The amplification systems described in Tables 36-50 were used to test the specificity of the probes of the invention.

Table 51: List of examples of HPV plasmids that can be used to test the HPV specificity of the detection system of the invention Table 52: To test the specificity of detection targeting A5 and A6 of the invention Example PCR materials and method conditions that can be used Table 53: Specificity results of probes targeting A5 (box “other HPV” = all but HPV in the list given in Table 51)
Table 54: Specificity results for probes targeting A6 (box “other HPV” = all but HPV in the list given in Table 51)
Table 55: Illustrative PCR materials and method conditions that can be used to test the specificity of detection targeting A7 of the present invention Table 56-59: Specificity results of probes targeting A7 (box) “Other HPV” = all except HPV in the list given in Table 51)
Table 56: Amplification system A targeting A7 and amplification system A probes targeting A7 (1 probe per PCR)
Table 57: Amplification system B targeting A7 and amplification system B probes targeting A7 (1 probe per PCR)
Table 58: Amplification system C targeting A7 and amplification system C probes targeting A7 (1 probe per PCR)
Table 59: Amplification system D targeting A7 and Amplification system D probes targeting A7 (1 probe per PCR)
Table 60: Illustrative PCR substances and method conditions that can be used to test the specificity of detection systems targeting A9 of the present invention Tables 61-68: Specificity results of probes targeting A9 ( Box “other HPV” = all except HPV in the list given in Table 51)
Table 61: Amplification system C targeting A9 and amplification system C probes targeting A9 (1 probe per PCR)
Table 62: Probes of amplification system E2 targeting A9 and amplification system E2 targeting A9 (one probe per PCR)
Table 63: Probes of amplification system E3 targeting A9 and amplification system E3 targeting A9 (one probe per PCR)
Table 64: Amplification system E4 targeting A9, and A9 targeting amplification system E4 probes (1 probe per PCR)
Table 65: Amplification system F targeting A9 and Amplification system F probes targeting A9 (1 probe per PCR)
Table 66: Probes of amplification system GZ7 targeting A9 and amplification system GZ7 targeting A9 (one probe per PCR)
Table 67: Amplification system GZ8 targeting A9 and amplification system GZ8 targeting A9 (one probe per PCR)
Table 68: Amplification system H targeting A9 and Amplification system H probes targeting A9 (1 probe per PCR)
The amplification and detection systems used for the specificity test are: Table 17 (system targeting A5); Table 23 (system targeting A6); Table 29 (system targeting A7); 35 (system targeting A9).

  For systems targeting A9, the primers shown in parentheses in Table 35 are not used as extra, and in fact, the primers not shown in parentheses are sufficient to amplify all of the A9HPV group. Therefore, in Table 35, the primer targeting A9, shown in parentheses, is any and / or equivalent and / or alternative primer if it is desired to amplify all HPV of the A9 group.

Tables 69-82: System reactivity The reactivity of the system of the present invention was tested under the same experimental conditions as the specificity test (see Tables 52, 55, 60).

Table 69: Reactivity of systems targeting A5 (Systems A, B, C, D and E)
Table 70: Reactivity of systems targeting A6 (Systems A, B, C, D and E)
Tables 71-74: Reactivity of systems targeting A7 Table 71: Reactivity of system A targeting A7 Table 72: Reactivity of system B targeting A7 Table 73: System C targeting A7 Table 74: Reactivity of system D targeting A7 Table 75-82: Reactivity of system targeting A9 Table 75: Reactivity of system C targeting A9 Table 76: Targeting A9 Table 77: Reactivity of system E3 targeting A9 Table 78: Reactivity of system E4 targeting A9 Table 79: Reactivity of system F targeting A9 Table 80: Reactivity of A9 Reactivity of target system GZ7 Table 81: Reactivity of system GZ8 targeting A9 Table 82: Reactivity of system H targeting A9
Tables 83-88: “Megaplex” specificity and reactive PCR targets 1 A5 targeting system, 1 A6 targeting system, 1 A7 targeting system, 1 A9 targeting Is performed in a single tube assay.

  Because the system targeting A7 and A9 is already a multiplex system (ie, each having more than 2 primers), a mixture of systems targeting 4 groups is referred to herein as a “megaplex”.

  Megaplex PCR was tested for reactivity (Ct; RFU) and specificity (Ct; RFU) using the plasmids listed in Table 51.

Tables 83-86: Results of proficiency for Megaplex EAAH and EBAC Tables 83-84: Specificities of Megaplex EAAH Table 83: System E targeting A5, System A targeting A6, Targeting A7 Illustrative megaplex materials and process conditions that can be used for a mixture of system H targeting system A and A9 (ie, megaplex EAAH); these experimental conditions are shown in Table 84 Table 84: Specificity results of EAAH megaplex Table 85-86: Specificity of megaplex EBAC Table 85: System E targeting A5, System B targeting A6, Targeting A7 Illustrative megaplex that can be used for a mixture of system C targeting system A and A9 (ie, megaplex EBAC) These experimental conditions were used for the results shown in Table 86. Table 86: EBAC Megaplex Specificity Results Table 87-88: Megaplex EAAH and EBAC Reactivity Results Table 87: Megaplex EAAH reactivity results Table 88: Megaplex EBAC reactivity results Table 89: List of HPV genomic sequences After these tables, the sequences of the reference templates are shown.

DKFZ is derived from Deusches Kresbsorschungszentrum; Tumorvirologie; Im Neuenheimer Feld 242; DE-Heidelberg; Germany;
CNCM is from Collection Nationale de Cultures de Microorganisme; Institut Pasteur; 25, rue du Docteur Roux; F-75724 Paris Cedex 15; France;
ATCC is American Type Culture Collection; 10801 University Blvd; Manassas, Virginia 20110-2209; USA
All HPV strains are available from DKFZ.

Reference template sequence:
<SEQ25; DNA; human papillomavirus>
tggaccgggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgt
<SEQ334; DNA; human papillomavirus>
tggaccgggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga
cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc
tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt
tgtggtgcag t
<SEQ26; DNA; human papillomavirus>
ctaatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgt
<SEQ335; DNA; human papillomavirus>
ctaatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga
cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc
tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt
tgtggtgcag t
<SEQ27; DNA; human papillomavirus>
aaggtgctacagatgtca aagtccgtta actccggagg aaaagcaatt gcattgtgac agaaaaagac
gatttcatct aatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat
ctagagaacc
<SEQ336; DNA; human papillomavirus>
aaggtgctacagatgtca aagtccgtta actccggagg aaaagcaatt gcattgtgac agaaaaagac
gatttcatct aatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgt
<SEQ337; DNA; human papillomavirus>
aaggtgctacagatgtca aagtccgtta actccggagg aaaagcaatt gcattgtgac agaaaaagac
gatttcatct aatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga
cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc
tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt
tgtggtgcag t
<SEQ28; DNA; human papillomavirus>
gttggaccgggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgt
<SEQ338; DNA; human papillomavirus>
gttggaccg ggtcatgttt ggggtgctgg agacaaacat
ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga
cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga
cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc
tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt
tgtggtgcag t
<SEQ29; DNA; human papillomavirus>
tcagaggatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc
tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt
tgtggtgcag t
<SEQ1; DNA; human papillomavirus>
ggcagtggaaagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg
<SEQ320; DNA; human papillomavirus>
ggcagtggaaagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact
<SEQ321; DNA; human papillomavirus>
ggcagtggaaagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag
gg
<SEQ2; DNA; human papillomavirus>
agctccgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact
<SEQ322; DNA; human papillomavirus>
agctccgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg
<SEQ323; DNA; human papillomavirus>
agctccgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag
gg
<SEQ3; DNA; human papillomavirus>
atatgcgtgacca gctaccagaa agacgggctg gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gaca
<SEQ324; DNA; human papillomavirus>
atatgcgtgacca gctaccagaa agacgggctg gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg
<SEQ325; DNA; human papillomavirus>
atatgcgtgacca gctaccagaa agacgggctg gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact
<SEQ326; DNA; human papillomavirus>
atatgcgtgacca gctaccagaa agacgggctg gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag
gg
<SEQ327; DNA; human papillomavirus>
atatgcgtgacca gctaccagaa agacgggctg gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcga
<SEQ4; DNA; human papillomavirus>
gacaggctacgtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag
gg
<SEQ328; DNA; human papillomavirus>
gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg
<SEQ329; DNA; human papillomavirus>
gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact
<SEQ330; DNA; human papillomavirus>
gacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcga
<SEQ5; DNA; human papillomavirus>
cgggctggacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcga
<SEQ331; DNA; human papillomavirus>
cgggctggacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg
<SEQ332; DNA; human papillomavirus>
cgggctggacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact
<SEQ333; DNA; human papillomavirus>
cgggctggacaggctac
gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag
gg
<SEQ122; DNA; human papillomavirus>
ggacgtggtccaga ttaagtttgc acgaggacga ggacaaggaa aacgatggag
actctttgcc aacgtttaaa tgtgtgtcag gaca
<SEQ123; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ124; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ125; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ126; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ127; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ128; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ129; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ130; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ131; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ132; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ133; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ134; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ135; DNA; human papillomavirus>
tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ136; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ137; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ138; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ139; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ140; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ141; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ142; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ143; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ144; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ145; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ146; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ147; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ359; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ360; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ361; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ362; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ363; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ364; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ365; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ366; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ367; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ144; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ368; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ369; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ370; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ371; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ372; DNA; human papillomavirus>
t
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ373; DNA; human papillomavirus>
t
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ374; DNA; human papillomavirus>
t
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ375; DNA; human papillomavirus>
t
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ376; DNA; human papillomavirus>
t
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ377; DNA; human papillomavirus>
t
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ378; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ379; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ380; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ381; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ382; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ383; DNA; human papillomavirus>
agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ384; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ385; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ386; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ387; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ388; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ389; DNA; human papillomavirus>
actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ390; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ391; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ392; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ393; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ394; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ395; DNA; human papillomavirus>
tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ396; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ397; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ398; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ399; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ400; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ401; DNA; human papillomavirus>
acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ148; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ149; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ150; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ151; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ152; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ153; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ154; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgacca
<SEQ155; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat tt
<SEQ156; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat
<SEQ402; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ403; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ404; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ405; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ406; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ407; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ408; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ409; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ410; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat t
<SEQ411; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttt
<SEQ412; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttg
<SEQ413; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtc
<SEQ163; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ162; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ164; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ414; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ415; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ161; DNA; human papillomavirus>
acatttaaaa ggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ167; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ166; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ168; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ416; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ417; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ165; DNA; human papillomavirus>
ttaaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ159; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ158; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ160; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ418; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ419; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ157; DNA; human papillomavirus>
taaaaggtgatgcta atactttaaa atgtttaaga
tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ169; DNA; human papillomavirus>
gtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ170; DNA; human papillomavirus>
gtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ171; DNA; human papillomavirus>
gtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ172; DNA; human papillomavirus>
gtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ173; DNA; human papillomavirus>
gtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ174; DNA; human papillomavirus>
gtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ175; DNA; human papillomavirus>
actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ176; DNA; human papillomavirus>
actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ177; DNA; human papillomavirus>
actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ178; DNA; human papillomavirus>
actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ179; DNA; human papillomavirus>
actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ180; DNA; human papillomavirus>
actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ181; DNA; human papillomavirus>
tgcagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ182; DNA; human papillomavirus>
tgcagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ183; DNA; human papillomavirus>
tgcagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ184; DNA; human papillomavirus>
tgcagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ185; DNA; human papillomavirus>
tgcagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ186; DNA; human papillomavirus>
tgcagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ187; DNA; human papillomavirus>
agtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ188; DNA; human papillomavirus>
agtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ189; DNA; human papillomavirus>
agtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ190; DNA; human papillomavirus>
agtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ191; DNA; human papillomavirus>
agtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ192; DNA; human papillomavirus>
agtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ193; DNA; human papillomavirus>
cagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ194; DNA; human papillomavirus>
cagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ195; DNA; human papillomavirus>
cagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ196; DNA; human papillomavirus>
cagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ197; DNA; human papillomavirus>
cagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ198; DNA; human papillomavirus>
cagtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ199; DNA; human papillomavirus>
tgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ200; DNA; human papillomavirus>
tgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ201; DNA; human papillomavirus>
tgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ202; DNA; human papillomavirus>
tgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ203; DNA; human papillomavirus>
tgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ204; DNA; human papillomavirus>
tgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ205; DNA; human papillomavirus>
gtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
<SEQ206; DNA; human papillomavirus>
gtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
<SEQ207; DNA; human papillomavirus>
gtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ208; DNA; human papillomavirus>
gtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
<SEQ209; DNA; human papillomavirus>
gtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt
<SEQ210; DNA; human papillomavirus>
gtgtcgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga
<SEQ46; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ47; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ48; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ49; DNA; human papillomavirus>
gaacaggaatatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ50; DNA; human papillomavirus>
gaacaggaatatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ51; DNA; human papillomavirus>
gaacaggaatatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ52; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg ca
<SEQ53; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg cattt
<SEQ339; DNA; human papillomavirus>
gaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg ca
<SEQ340; DNA; human papillomavirus>
gaacaggaatatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg cattt
<SEQ341; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ342; DNA; human papillomavirus>
gaacaggaatatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ54; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg ca
<SEQ55; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg cattt
<SEQ56; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg ca
<SEQ57; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg cattt
<SEQ343; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
acagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ344; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ345; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ346; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ347; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ348; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ349; DNA; human papillomavirus>
tggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ350; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ345; DNA; human papillomavirus>
ggtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ351; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ352; DNA; human papillomavirus>
gtatagaacaggaa tatcaaatat
tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ58; DNA; human papillomavirus>
tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ59; DNA; human papillomavirus>
tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ60; DNA; human papillomavirus>
gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ61; DNA; human papillomavirus>
gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ62; DNA; human papillomavirus>
ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
<SEQ63; DNA; human papillomavirus>
ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ353; DNA; human papillomavirus>
ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ354; DNA; human papillomavirus>
ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ355; DNA; human papillomavirus>
tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ356; DNA; human papillomavirus>
tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ59; DNA; human papillomavirus>
tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
agc
<SEQ357; DNA; human papillomavirus>
gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg
<SEQ358; DNA; human papillomavirus>
gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag
<SEQ64; DNA; human papillomavirus>
ggctgatccagaagg tacagacggg gagggcacgg gttgtaacgg
ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga
ggacgaaaat gc
<SEQ65; DNA; human papillomavirus>
ggctgatccagaagg tacagacggg gagggcacgg gttgtaacgg
ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga
ggacgaaaat gcaacagaca cagg
<SEQ66; DNA; human papillomavirus>
gatccagaagg tacagacggg gagggcacgg gttgtaacgg
ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga
ggacgaaaat gc
<SEQ67; DNA; human papillomavirus>
gatccagaagg tacagacggg gagggcacgg gttgtaacgg
ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga
ggacgaaaat gcaacagaca cagg

The phylogenetic tree of the present invention. Schematic diagram of amplification targets for HPV groups A6 (HPV56) and A5 (HPV51). And schematic diagram of amplification targets for groups A9 (HPV16) and A7 (HPV18). A copy of NCBI — 001594.1, the sequence of HPV56 (reference HPV for group A6); SEQ ID NO: 420. A copy of NCBI — 001594.1, the sequence of HPV56 (reference HPV for group A6); SEQ ID NO: 420. A copy of NCBI — 001594.1, the sequence of HPV56 (reference HPV for group A6); SEQ ID NO: 420. A copy of NCBI — 001594.1, the sequence of HPV56 (reference HPV for group A6); SEQ ID NO: 420. A copy of NCBI — 001594.1, the sequence of HPV56 (reference HPV for group A6); SEQ ID NO: 420. A copy of NCBI_001533.1, sequence of HPV51 (reference HPV for group A5); SEQ ID NO: 421. A copy of NCBI_001533.1, sequence of HPV51 (reference HPV for group A5); SEQ ID NO: 421. A copy of NCBI_001533.1, sequence of HPV51 (reference HPV for group A5); SEQ ID NO: 421. A copy of NCBI_001533.1, sequence of HPV51 (reference HPV for group A5); SEQ ID NO: 421. A copy of NCBI_001533.1, sequence of HPV51 (reference HPV for group A5); SEQ ID NO: 421. A copy of NCBI — 001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO: 422. A copy of NCBI — 001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO: 422. A copy of NCBI — 001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO: 422. A copy of NCBI — 001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO: 422. A copy of NCBI — 001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO: 422. A copy of NCBI — 001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO: 422. A copy of NCBI — 001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO: 423. A copy of NCBI — 001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO: 423. A copy of NCBI — 001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO: 423. A copy of NCBI — 001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO: 423. A copy of NCBI — 001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO: 423. A copy of NCBI — 001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO: 423. Legend of locations shown in this specification.

Claims (49)

A method for detecting in a sample at least one HPV that may be carcinogenic to mucosal epithelium, wherein the detection comprises at least one amplicon amplified by means of an amplification primer, said sample or their nucleic acids. Determining whether it was made from a substance, wherein the production of at least one amplicon indicates that there is at least one HPV in the sample that may be carcinogenic to mucosal epithelium; Amplification primers are
-At least two primers intended to target the oncogenic HPV of group A6;
Here, the primer targeting at least 2 A6 is an oligonucleotide consisting of 14 to 30 nucleotides, and the sequence is used as a forward primer and a reverse primer in the amplification of at least one A6 reference template sequence, respectively. The at least one A6 reference template sequence is a fragment (SEQ ID NO: 337) consisting of positions 413 to 791 of the HPV56 sequence of SEQ ID NO: 420 (Accession No. NC_001594.1), or mucosal epithelium Conservative subfragments that comprise a primer targeting A6 that enables real-time multiplex detection of HPV, which may be carcinogenic, and retain the property of being a suitable reference template sequence to produce And / or-intended to target the oncogenic HPV of group A5 At least two primers made;
Here, the primer targeting at least 2 A5 is an oligonucleotide consisting of 14 to 30 nucleotides, and the sequence is used as a forward primer and a reverse primer in the amplification of at least one A5 reference template sequence, respectively. The at least one A5 reference template sequence is a fragment (SEQ ID NO: 326) consisting of positions 678 to 902 of the HPV51 sequence of SEQ ID NO: 421 (Accession No. NC_001533.1), or mucosal epithelium Conservative subfragments that retain the property of being a suitable reference template sequence to construct and produce a primer targeting A5 that enables real-time multiplex detection of HPV that may be carcinogenic to And / or-intended to target the oncogenic HPV of group A9 At least two primers made;
Here, the at least two primers targeting A9 are oligonucleotides consisting of 14 to 30 nucleotides, and the sequences are used as forward primers and reverse primers, respectively, in the amplification of at least one A9 reference template sequence. The at least one A9 reference template sequence is a fragment (SEQ ID NO: 122) consisting of positions 2707 to 2794 of the HPV16 sequence of SEQ ID NO: 422 (Accession No. NC — 001526.1), or mucosal epithelium Conservative subfragments that comprise a primer targeting A9 that enables real-time multiplex detection of HPV that may be carcinogenic to and retain the property of being a suitable reference template sequence to produce Or HPV1 of SEQ ID NO: 422 (reception number NC_001526.1) A primer targeting A9 that enables real-time multiplex detection of HPV, which is a fragment consisting of positions 6600-3840 of 6 sequences (SEQ ID NO: 377) or may be carcinogenic to mucosal epithelium A conservative subfragment that retains the property of being a suitable reference template sequence to produce and / or-at least two primers intended to target the oncogenic HPV of group A7;
Here, the at least two A7 target primers are oligonucleotides consisting of 14 to 30 nucleotides, and the sequences are used as forward and reverse primers, respectively, in the amplification of at least one A7 reference template sequence. The at least one A7 reference template sequence is a fragment (SEQ ID NO: 48) consisting of positions 1895 to 2103 of the HPV18 sequence of SEQ ID NO: 423 (Accession No. NC — 001357.1), or mucosal epithelium Conservative subfragments that comprise a primer targeting A7 that enables real-time multiplex detection of HPV that may be carcinogenic to and retain the property of being a suitable reference template sequence to produce Or HPV18 of SEQ ID NO: 423 (Accession No. NC_001357.1) Constructing a primer targeting A7 that allows real-time multiplex detection of HPV, which is a fragment consisting of positions 916-1044 of the sequence (SEQ ID NO: 65) or may be carcinogenic to mucosal epithelium; Comprising a conservative subfragment that retains the property of being a suitable reference template sequence to produce:
Wherein said A6, A5, A9 and A7 reference template sequences are at least 5 most common HPV (HPV 16, 18, 45, 31, 33), preferably at least 7 HR HPV, more preferably 5 most General HR HPV and at least two other HR HPVs, advantageously at least two other HR HPVs belonging to the group of A6 and / or A5 (eg HPV 56, 51, 33, 31, 16, 45, 18) , More preferably at least 13 HR HPV (HPV56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18) real-time multiplex amplification, in particular such HPV real-time Primer and amplicon annealing probe for quantitative multiplex amplification The suitable for construction and production, with a special technical feature of being reference template sequence-based groups.   2. The method of detecting HPV of claim 1, wherein the at least one A6 reference template sequence is one of SEQ ID NOs: 25-29 and 334-338, wherein the A6 reference template sequence is against mucosal epithelium. A method characterized in that it has the special technical feature of being a suitable reference for the construction and production of primers targeting A6 enabling real-time multiplex amplification of HPV that may be carcinogenic.   3. The HPV detection method according to claim 1 or 2, wherein the at least one A5 reference template sequence is one of SEQ ID NOs: 1 to 5 and 320 to 333, and the A5 reference template sequence is present in mucosal epithelium. A method characterized in that it has the special technical feature of being a suitable reference for the construction and production of primers targeting A5, which allows real-time multiplex amplification of HPV which may be oncogenic.   The HPV detection method according to any one of claims 1 to 3, wherein the at least one A9 reference template sequence is one of SEQ ID NOS: 122-210 and 359-419, and the A9 reference template sequence Has the special technical feature of being a suitable reference for the construction and production of primers targeting A9 that enable real-time multiplex amplification of HPV that may be carcinogenic to mucosal epithelium. Feature method.   5. The HPV detection method according to any one of claims 1 to 4, wherein the at least one A7 reference template sequence is one of SEQ ID NOs: 46 to 67 and 339 to 358, and the A7 reference template sequence. Has the special technical feature that it is a suitable reference for constructing and producing primers targeting A7 that allow real-time multiplex amplification of HPV that may be carcinogenic to mucosal epithelium. Feature method. The HPV detection method according to any one of claims 1 to 5,
The at least two primers targeting A9 are oligonucleotides consisting of 14 to 30 nucleotides, the sequences of which are derived from the following A9 group HPV: HPV58, HPV33, HPV52, HPV35, HPV31 And at least 80 to 260 nucleotides, preferably 85 to 250 nucleotides, more preferably 88 to 241 nucleotides of at least one nucleic acid derived from the A9 target region consisting of the E2 gene and E2 gene, respectively. And / or the primer targeting the at least two A7 is an oligonucleotide consisting of 14-30 nucleotides, the sequence comprising HPV of the following group A7; HPV 68, in the amplification of at least one nucleic acid of at least 100 to 220 nucleotides, preferably 120 to 215 nucleotides, more preferably 125 to 209 nucleotides derived from the A7 target region consisting of the E1 gene derived from each of 68, HPV39, HPV59, HPV45 And a sequence suitable for use as a forward primer and a reverse primer, respectively. The HPV detection method according to claim 6,
The primer targeting at least 2 A6 is further at least 90-390 nucleotides, preferably 95-385 nucleotides, more preferably 100, derived from the A6 target region consisting of the E6 and E7 genes of HPV66 and / or HPV53 Suitable for use as a forward primer and a reverse primer, respectively, in the amplification of at least one nucleic acid of ˜379 nucleotides, and / or the primer targeting the at least two A5 further comprises E7 and HPV82 In the amplification of at least one nucleic acid of at least 90-240 nucleotides, preferably 100-230 nucleotides, more preferably 106-225 nucleotides, derived from an A5 target region consisting of the E1 gene; Suitable for use as forward and reverse primers, respectively, and / or the at least two primers targeting A9 are further derived from at least an A9 target region consisting of the E1 and E2 genes of HPV67 Suitable for use as a forward primer and a reverse primer, respectively, in the amplification of at least one nucleic acid of 80-260 nucleotides, preferably 85-250 nucleotides, more preferably 88-241 nucleotides, and / or-said at least The primer targeting A2 of 2 is further at least 100 to 220 nucleotides, preferably 120 to 215 nucleotides, more preferably derived from the A7 target region consisting of E1 and E2 genes of HPV85. In at least one amplification of nucleic acids properly is 125 to 209 nucleotides, wherein the suitable for use as forward and reverse primers, respectively.   The HPV detection method according to claim 1, wherein the at least two primers comprise 17 to 25 nucleotides.   The HPV detection method according to any one of claims 1 to 8, wherein the HPV that can be carcinogenic to the at least one mucosal epithelium is a carcinogenic anogenital HPV. Method.   The HPV detection method according to any one of claims 1 to 9, wherein the HPV that can be carcinogenic to the at least one mucosal epithelium is a carcinogenic cervical HPV. how to.   11. The HPV detection method according to any one of claims 1 to 10, wherein the at least two primers are specific to the A6 group, the A5 group, the A9 group, or the A7 group.   The HPV detection method according to claim 1, wherein the amplification is single tube multiplex amplification. 13. The HPV detection method according to claim 1, wherein the amplification primer comprises at least two primers targeting A6 and at least two primers selected from the following. Method characterized by:
A primer targeting the at least two A5, and / or a primer targeting the at least two A9, and / or a primer targeting the at least two A7. 14. The HPV detection method according to claim 1, wherein the amplification primer comprises at least two primers targeting A5 and at least two primers selected from the following. Method characterized by:
A primer targeting the at least two A6, and / or a primer targeting the at least two A9, and / or a primer targeting the at least two A7. The HPV detection method according to claim 1, wherein the amplification primer comprises at least two primers targeting A9 and at least two primers selected from the following. Method characterized by:
A primer targeting the at least two A5, and / or a primer targeting the at least two A6, and / or a primer targeting the at least two A7. The HPV detection method according to any one of claims 1 to 15, wherein the amplification primer comprises at least two primers targeting A7 and at least two primers selected from the following. Method characterized by:
A primer targeting the at least two A5, and / or a primer targeting the at least two A9, and / or a primer targeting the at least two A6. The HPV detection method according to any one of claims 1 to 16, wherein the amplification primer comprises:
A primer targeting the at least two A6, and a primer targeting the at least two A5, and a primer targeting the at least two A9, and a primer targeting the at least two A7. A method comprising the steps of:   18. HPV detection method according to any one of the preceding claims, wherein the determination of whether the at least one amplicon has been produced is at least intended to anneal to the at least one amplicon. A method characterized by being performed using one probe.   The HPV detection method according to claim 1, wherein the amplification is real-time amplification.   20. HPV detection method according to any one of the preceding claims, wherein the determination of whether the at least one amplicon has been produced is in real time amplification with at least one A6 and / or A5 and / or Carried out by using a probe targeting A9 and / or A7, the sequence of which is produced at least by the at least two primers targeting A6 and / or A5 and / or A9 and / or A7, respectively. A method characterized in that it is suitable for use as a probe for the detection of a single amplicon.   21. The HPV detection method according to any one of claims 1 to 20, wherein the amplification is real-time multiplex amplification.   The HPV detection method according to any one of claims 1 to 21, wherein the amplification is quantitative real-time multiplex amplification.   The HPV detection method according to any one of claims 1 to 22, wherein the at least two primers targeting A6 are at least one of SEQ ID NOs: 30 to 34 (forward primer) and SEQ ID NOs: 35 to 37. And at least 1 (reverse primer).   24. The method of detecting HPV according to any one of claims 1 to 23, wherein the determination of whether the at least one amplicon has been produced is performed in real time amplification by one or more of SEQ ID NOs: 38-40. At least one probe intended to carry at least one A6 consisting of one of the complementary sequences and optionally at least one 5 'and / or 3' detection label and / or quencher or reporter The method is performed using an arm independent of HPV.   25. The HPV detection method according to claim 24, wherein the at least one probe targeting A6 is a beacon probe, and the sequence thereof is one of SEQ ID NOs: 41 to 45 or one of sequences complementary thereto. A method characterized by being one.   The HPV detection method according to any one of claims 1 to 25, wherein the at least two A5 targeting primers are at least 1 (forward primer) of SEQ ID NOs: 6 to 10 and SEQ ID NOs: 11 to 15 And at least 1 (reverse primer).   27. The HPV detection method according to any one of claims 1 to 26, wherein the determination of whether or not the at least one amplicon has been produced is based on one or more of SEQ ID NOs: 16-19 in real time amplification. A probe targeting at least one A5 consisting of one of the complementary sequences and optionally at least one detection label and / or at least one HPV-independent arm intended to carry a quencher or reporter A method characterized by being performed using   28. The HPV detection method according to claim 27, wherein the probe targeting at least one A5 is a beacon probe, and the sequence thereof is one of SEQ ID NOs: 20 to 24 or one of sequences complementary thereto. A method characterized by being one.   The HPV detection method according to any one of claims 1 to 28, wherein the at least two A9 targeting primers are at least one of SEQ ID NOs: 211 to 239 (forward primer) and SEQ ID NOs: 240 to 265. And at least 1 (reverse primer).   30. The HPV detection method according to any one of claims 1 to 29, wherein the determination of whether the at least one amplicon has been produced is based on one or more of SEQ ID NOs: 266-282 in real time amplification. Independent of at least one HPV intended to carry a probe targeting at least one A9 consisting of one of the complementary sequences and optionally at least one detection label and / or quencher or reporter A method characterized by being performed using an arm.   31. The HPV detection method according to claim 30, wherein the at least one probe targeting A9 is a beacon probe, and the sequence thereof is one of SEQ ID NOs: 283 to 319 or one of sequences complementary thereto. A method characterized by being one.   The HPV detection method according to any one of claims 1 to 31, wherein the at least two primers targeting A7 are at least one of SEQ ID NOs: 68 to 78 (forward primer) and SEQ ID NOs: 79 to 87. And at least 1 (reverse primer).   33. The HPV detection method according to any one of claims 1 to 32, wherein the determination of whether the at least one amplicon has been produced is based on one or more of SEQ ID NOs: 88 to 101 in real time amplification. Independent of at least one HPV intended to carry at least one A7 probe consisting of one of the complementary sequences and optionally at least one detection label and / or quencher or reporter A method characterized by being performed using an arm.   34. The HPV detection method according to claim 33, wherein the at least one probe targeting A7 is a beacon probe, and the sequence thereof is one of SEQ ID NOs: 102 to 121 or one of sequences complementary thereto. A method characterized by being one.   The HPV detection method according to any one of claims 1 to 34, wherein the amplification is PCR.   36. An amplicon obtained by carrying out the method according to any one of claims 1 to 35 in an HPV-containing sample containing at least one HPV from the group A6, A5, A9 or A7. Used in the design of primers that can be used in a single tube multiplex to amplify HPV of A6, A5, A9 and A7 groups, and in the single tube multiplex for real-time detection of the amplified HPV A polynucleotide suitable for use as a reference template sequence in the design of a probe, wherein the reference template polynucleotide comprises:
-Regarding group A6: a fragment (SEQ ID NO: 337) consisting of positions 413 to 791 of the HPV56 sequence of SEQ ID NO: 420 (accession number NC_001594.1), or a conservative subfragment thereof, or the entire length of the fragment or subfragment A sequence that is completely complementary to said fragment or subfragment;
-Group A5: a fragment (SEQ ID NO: 326) consisting of positions 678 to 902 of the HPV51 sequence of SEQ ID NO: 421 (accession number NC_001533.1), or a conservative subfragment thereof, or the entire length of the fragment or subfragment A sequence that is completely complementary to said fragment or subfragment;
-Regarding group A9: a fragment (SEQ ID NO: 122) consisting of positions 2707 to 2794 of the HPV16 sequence of SEQ ID NO: 422 (accession number NC_001526.1), or a conservative subfragment thereof, or the entire length of the fragment or subfragment A sequence that is completely complementary to the fragment or subfragment; or a fragment (SEQ ID NO: 377) consisting of positions 3600 to 3840 of the HPV16 sequence of SEQ ID NO: 422 (Accession No. NC_001526.1), or a conservative subsequence thereof A fragment, or a sequence that is completely complementary to the fragment or subfragment over the entire length of the fragment or subfragment;
-Regarding Group A7: a fragment (SEQ ID NO: 48) consisting of positions 1895 to 2103 of the HPV18 sequence of SEQ ID NO: 423 (accession number NC_001357.1), or a conservative subfragment thereof, or the entire length of the fragment or subfragment Or a fragment (SEQ ID NO: 65) consisting of positions 916 to 1044 of the HPV18 sequence of SEQ ID NO: 423 (Accession No. NC_001357.1), or a conservative cell Selected from a fragment, or a sequence that is completely complementary to the fragment or subfragment over the entire length of the fragment or subfragment, wherein the conserved fragment is a real-time HPV that may be carcinogenic to mucosal epithelium Construct primers that target groups that allow multiplex detection and retain the property of being an appropriate reference template sequence for production. Nucleotide possessed.   38. A reference template polynucleotide according to claim 37, wherein the reference template sequence targets A6 and is completely intact over one of SEQ ID NOs: 25-29 and 334-338, or over the entire length of the sequence of SEQ ID NO: A reference template polynucleotide characterized by comprising a sequence that is complementary to.   38. A reference template polynucleotide according to claim 37, which is a reference template sequence targeting A5, which is completely over one of SEQ ID NOs: 1-5 and 320-333, or over the entire length of the sequence of SEQ ID NO: A reference template polynucleotide characterized by comprising a sequence that is complementary to.   38. A reference template polynucleotide according to claim 37, which is a reference template sequence targeting A9, which is completely intact over one of SEQ ID NOS: 122-210 and 359-419, or over the entire length of the sequence of SEQ ID NO: A reference template polynucleotide characterized by comprising a sequence that is complementary to.   38. A reference template polynucleotide according to claim 37, which is a reference template sequence targeting A7, which is completely over one of SEQ ID NOs: 46-67 and 339-358, or over the entire length of the sequence of SEQ ID NO: A reference template polynucleotide characterized by comprising a sequence that is complementary to. The following primers suitable for HPV amplification, particularly applied to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups:
-A primer targeting A6, consisting of any one of SEQ ID NOs: 30 to 34 and SEQ ID NOs: 35 to 37; or-A5 consisting of any one of SEQ ID NOs: 6 to 10 and SEQ ID NOs: 11 to 15 A primer that targets A9, consisting of any one of SEQ ID NOs: 211-239 and SEQ ID NOs: 240-265, or: consisting of any one of SEQ ID NOs: 68-78 and SEQ ID NOs: 79-87, Primer targeting A7. A primer system suitable for HPV amplification, particularly applied to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups,
-A primer targeting at least one A6 consisting of one of SEQ ID NOS: 30-34 and a primer targeting at least one A6 consisting of one of SEQ ID NO: 35-37; and / or-SEQ ID NOs: 6-10 A primer targeting at least one A5 consisting of one of the following and a primer targeting at least one A5 consisting of one of SEQ ID NOs: 11-15; and / or at least consisting of one of SEQ ID NOs: 211-239 A primer targeting one A9 and a primer targeting at least one A9 consisting of one of SEQ ID NOs: 240-265; and / or-targeting at least one A7 consisting of one of SEQ ID NOs: 68-78 And a primer targeting at least one A7 consisting of one of SEQ ID NOs: 79 to 87 Nde become primer system. The following probes suitable for HPV detection, particularly applied to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups:
A probe targeting A6, consisting of any one of SEQ ID NOs: 38 to 40 or a sequence completely complementary thereto over the entire length of the sequence of SEQ ID NO; or any one of SEQ ID NOs: 16 to 19 or A probe targeting A5 consisting of a sequence perfectly complementary to them over the entire length of the sequence of SEQ ID NO: or any one of SEQ ID NO: 266-282 or completely complementary to them over the entire length of the sequence of SEQ ID NO: A probe targeting A9 consisting of a specific sequence; or a probe targeting A7 consisting of any one of SEQ ID NOs: 88 to 101 or a sequence completely complementary to them over the entire length of the sequence of SEQ ID NO: . The following beacon probes suitable for HPV detection, particularly applied to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups:
A probe targeting A6 consisting of any one of SEQ ID NOs: 41 to 45 or a sequence completely complementary thereto over the entire length of the sequence of SEQ ID NO; or any one of SEQ ID NOs: 20 to 24 or A probe targeting A5, consisting of a sequence completely complementary to them over the entire length of the sequence of SEQ ID NO: or any one of SEQ ID NO: 283-319 or completely complementary to them over the entire length of the sequence of SEQ ID NO: A probe targeting A9 consisting of a specific sequence; or a probe targeting A7 consisting of any one of SEQ ID NOS: 102 to 121 or a sequence completely complementary thereto over the entire length of the sequence of SEQ ID NO: .   54. A primer and probe system suitable for HPV amplification, particularly applied to real-time multiplex amplification of HPV A6 and A5 and A9 and A7 groups, comprising at least one primer according to claim 53 and claim 54 or 55. A primer and probe system comprising at least one probe according to 1.   44. An amplicon obtained by amplifying at least one nucleic acid from group A6, A5, A9 or A7 of HPV using at least one primer system according to claim 43.   48. An amplification composition comprising at least one amplicon according to claim 36 or 47. Kit for diagnosis or prognosis of cervical neoplasia or cervical cancer comprising:
-At least one primer system according to claim 43; and / or-at least one probe according to claim 44 or 45;
-Optionally instructions for their use and / or nucleotides.

Images