JP2012136439A - Diazaspiroalkane derivative - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new therapeutic agent for diabetes.SOLUTION: A diazaspiroalkane derivative which is a GPR 119 agonist, represented by general formula (II) (in the formula, R, Rand Reach represent a hydrogen atom, a halogen atom, a Calkyl group, a Calkoxy group, a Calkyl group substituted with 1-3 halogen atoms, a Calkylsulfonyl group, or the like, T, U, Vand Weach represent Calkylene which may have a bond or a substituent, Brepresents Calkylene which may have C(=O) or a substituent, or the like, Yand Zeach represent Calkylene which may have a substituent, and R represents a hydrogen atom, a Calkyl group, or the like) or a pharmaceutically acceptable salt thereof is used as a therapeutic agent for diabetes.

Description

The present invention relates to GPR119 agonists.

Diabetes mellitus, a lifestyle-related disease, has an increasing number of patients worldwide. Treatment methods for diabetes can be divided into diet therapy, exercise therapy, and drug therapy (insulin injection, oral diabetes drug). In Japan, α-glucosidase inhibitors (acarbose, voglibose), insulin resistance improvers (pioglitazone hydrochloride), biguanide preparations (metformin hydrochloride), sulfonylurea preparations (glibenclamide, glimepiride), rapid-acting type Insulin secretion promoters (mitiglinide calcium hydrate) and the like are on the market.
On the other hand, in the United States and Europe, incretin preparations (exenatide) and DPP IV inhibitors (sitagliptin), which are gastrointestinal hormones that enhance insulin secretion, are on the market, and development of SGLT inhibitors is also underway .
By the way, GPR119 is a G protein-coupled receptor (GPCR) having N-Oleoylanolamide as an endogenous ligand, and has been reported as a receptor that enhances insulin secretion from pancreatic β cells. (Non-Patent Document 1)
GPR119 agonists have been found to increase the plasma concentration of Glucagon like peptide-1 (GLP-1), which is one of the incretins, in an in vivo action (Non-patent Document 2). May also contribute to increased insulin secretion. Furthermore, an effect of suppressing weight gain under a high-fat diet has been reported (Non-patent Document 1), and the possibility of being involved in energy metabolism is also suggested. For these reasons, GPR119 agonists are expected to be applied not only to the possibility of treating diabetes, but also to lifestyle-related diseases such as obesity and metabolic syndrome.
As a GPR119 agonist, for example, Patent Document 1 describes the following compound (A) and the like,

Patent Document 2 describes the following compound (B) and the like,

Patent Document 3 describes the following compound (C) and the like,

Patent Document 4 describes the following compound (D) and the like,

Patent Document 5 describes the following compound (E) and the like,

Patent Document 6 describes the following compound (F) and the like.

  On the other hand, compounds (G) and (H) having a diazaspiroalkane structure are described in Patent Documents 7 and 8.

The compounds described in Patent Documents 7 and 8 mainly have an action as a Ca channel blocker, and there is also a description of GPR119 agonist action as well as action on TRPV1. However, in these documents, there is no specific description that the above compounds (G) and (H) have GPR119 agonist activity, while compounds having the description of the same action are compounds of the present invention. In the diazaspiroalkane derivative represented by the general formula (I), those corresponding to the nitrogen-containing heterocyclic moiety consisting of X, Z, N and Y are limited to the benzene ring, and their action strength is weak It is.
The following compound (J) and the like are described in Non-Patent Document 3.

Although compound (J) is described as a synthetic intermediate of Melanostatin analog, there is no description that this compound is used as a GPR119 agonist.

WO 2004/076413 WO 2004/065380 WO 2005/007647 WO 2007/003960 WO 2008/025798 WO 2008/008887 WO 2008/033460 WO 2008/033465

Overton HA et al., Cell Metab. 2006, 3, 167-75. Chu ZL et al., Endocrinology, 2008, 149, 2038-47. J. et al. Org. Chem. , 2006, 71, 7721-7730

An object of the present invention is to provide a diazaspiroalkane derivative represented by the following general formula (I) or (II) or a pharmaceutically acceptable salt thereof, and a therapeutic agent for diabetes containing these as active ingredients. is there.

  That is, the present invention relates to a diazaspiroalkane derivative represented by the following general formula (I) or a pharmaceutically acceptable salt thereof.

(In the formula, A is a halogen atom, nitro group, cyano group, hydroxy group, C _1-8 alkyl group, C _1-8 alkoxy group or C _1-8 substituted with 1 to 3 halogen atoms as a substituent. An alkyl group, a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, a phenyloxy group, an alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), a carboxyl group, a carbamoyl group, an acyl group (an alkyl group) 1-8), alkylaminocarbonyl group (alkyl having 1-8 carbon atoms), dialkylaminocarbonyl group (alkyl having 2-12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy having 1 carbon atom) 8) alkylsulfonyl radical (carbon number of alkyl is 1 to 8), an amino _{group, C 1-8} alkylamino _{group, C 2-12} dialkyl Amino _{group, C 1-8} alkylsulfonylamino group, (1-8 carbon atoms in the _alkyl) acylamino _{group, C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a sulfamoyl _{group, C 1-8} alkylamino Represents a phenyl group or a 5- or 6-membered heteroaryl group optionally having a sulfonyl group, a phenylsulfonyl group and a 5- or 6-membered heteroaryl group;
T, U, V and W have the same or different bond or a substituent a C _1-8 alkyl group, those selected from 1-3 C _1-8 alkyl group substituted with a halogen atom C _1-5 alkylene which may be _optionally represented.
However, the nitrogen-containing heterocycle consisting of T, nitrogen atom, U and carbon atom, and the nitrogen-containing heterocycle consisting of V, carbon atom, W and nitrogen atom are each independently a 4 to 7-membered ring,
B is selected from a bond, C (═O), C (═O) CR ¹ R ² or a C _1-8 alkyl group as a substituent, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. _{Represents a} C _1-5 alkylene which may have
Here, R ¹ and R ² are the same or different and each represents a hydrogen atom, a C _1-8 alkyl group, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. X represents N or CR ³ ,
Here, R ³ represents a hydrogen atom, a C _1-8 alkyl group, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms.
However, when X is N, B is not a bond or methylene,
Y and Z may be the same or different as a substituent, a halogen atom, a cyano group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a carboxyl group, or a C _1-8 alkyl substituted with 1 to 3 halogen atoms. Represents a C _1-3 alkylene which may have a group or a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms.
However, when X is N, both Y and Z are not methylene,
G is C (O) OR ⁴ , C (O) R ⁵ , SO ₂ R ⁶ , C (O) NR ⁷ R ⁸ , CH ₂ C (O) NR ⁹ R ¹⁰ , or a 5- or 6-membered ring. Represents a heteroaryl group,
Here, R ^{4 to} R ¹⁰ are a hydrogen atom, a C _1-8 alkyl group, a 3- to 7-membered cycloalkyl group, a C _1-4 alkyl group substituted with an aryl group, or 1 to 3 halogen atoms. Represents a substituted C _1-8 alkyl group,
The heteroaryl group is bonded to the nitrogen atom of the nitrogen-containing heterocyclic ring consisting of Y, X, Z and N via the carbon atoms constituting the ring, and is a halogen atom, a nitro group, a cyano group, a hydroxy group, From a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, and a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms It may have a selected substituent. )

The present invention also relates to a diazaspiroalkane derivative represented by the following general formula (II) or a pharmaceutically acceptable salt thereof.

(In the formula, R ¹¹ , R ¹² and R ¹³ are the same or different and each represents a hydrogen atom, a halogen atom, a nitro group, a cyano group, a hydroxy group, a C _1-8 alkyl group, a C _1-8 alkoxy group, 1 to 3 C _1-8 alkyl group substituted with a halogen atom, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl Group, carbamoyl group, acyl group (alkyl having 1 to 8 carbon atoms), alkylaminocarbonyl group (alkyl having 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl having 2 to 12 carbon atoms), alkoxycarbonyl methylcarbonyl group (number of carbon atoms in the alkoxy 1-8) alkylsulfonyl radical (carbon number of alkyl is 1 to 8), an amino _{group, C 1-8} Alkylamino _{group, C 2-12} dialkylamino _{group, C 1-8} alkylsulfonylamino group, an acylamino group (carbon number of alkyl is 1 to _{8), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a sulfamoyl A group, a C _1-8 alkylaminosulfonyl group, a phenylsulfonyl group or a 5- or 6-membered heteroaryl group;
T ¹ , U ¹ , V ¹ and W ¹ are the same or different and are selected from a C _1-8 alkyl group as a bond or substituent, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. C _1-5 alkylene which may have a thing is represented.
However, the nitrogen-containing heterocyclic ring consisting of T ¹ , nitrogen atom, U ¹ and carbon atom, and the nitrogen-containing heterocyclic ring consisting of V ¹ , carbon atom, W ¹ and nitrogen atom are each independently a 4 to 7-membered ring,
B ¹ is a bond, C (═O), C (═O) CR ¹⁴ R ¹⁵ or a C _1-8 alkyl group as a substituent, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. _Represents C _1-5 alkylene optionally having a selected one,
Here, R ¹⁴ and R ¹⁵ are the same or different and each represents a hydrogen atom, a C _1-8 alkyl group, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. Y ¹ and Z ¹ are the same or Unlike a substituent, a halogen atom, a cyano group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a carboxyl group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 Represents C _1-3 alkylene which may have one selected from C _1-8 alkoxy groups substituted by halogen atoms,
R is a hydrogen atom, a C _1-8 alkyl group, a 3-7 membered cycloalkyl group, a C _1-4 alkyl group substituted with an aryl group, or C ₁ substituted with 1 to 3 halogen atoms. _-8 represents an alkyl group. )

The present invention also relates to a therapeutic agent for diabetes containing the diazaspiroalkane derivative represented by the above general formula (I) or (II) or a pharmaceutically acceptable salt thereof as an active ingredient.
Furthermore, this invention relates to the GPR119 agonist which contains the diaza spiro alkane derivative represented by the said general formula (I) or (II), or its pharmaceutically acceptable salt as an active ingredient.

Next, the present invention will be described in detail.
Of the diazaspiroalkane derivatives represented by the general formula (I), the following are preferable.
(1)
A is a halogen atom, nitro group, cyano group, hydroxy group, C _1-8 alkyl group, C _1-8 alkoxy group, C _1-8 alkyl group substituted with 1 to 3 halogen atoms as a substituent, _C1-8 alkoxy group substituted with 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl group, carbamoyl group, acyl group (alkyl has 1 carbon atom) -8), alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy has 1 to 8 carbon atoms), alkylsulfonyl methyl group (1-8 carbon atoms in the alkyl), amino _{group, C 1-8} alkylamino _{group, C 2-12} dialkylamino , _{C 1-8} alkylsulfonylamino group, an acylamino group (carbon number of alkyl is 1 to _{8), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a sulfamoyl _{group, C 1-8} alkylaminosulfonyl group , A diazaspiroalkane derivative of the above general formula (I), which may have a phenylsulfonyl group and a 5- or 6-membered heteroaryl group, or a pharmaceutically acceptable salt thereof Salt.
(2)
A halogen atom as a substituent, a cyano _{group, a C 1-8} alkyl _{group, C 1-8} alkoxy groups, one to three _{C 1-8} alkyl group substituted with a halogen _{atom, C 1-8} alkylsulfonyl group And a diazaspiro as described in the above general formula (I), which is a phenyl group or a 5- or 6-membered heteroaryl group optionally having a sulfamoyl group and a 5- or 6-membered heteroaryl group Alkane derivatives, or pharmaceutically acceptable salts thereof.
(3)
A diazaspiroalkane derivative according to the above general formula (I), wherein A is a phenyl group having at least one C _1-8 alkylsulfonyl group as a substituent or a 5- or 6-membered heteroaryl group, or a pharmaceutically acceptable salt thereof Acceptable salt.
(4)
T, U, diaza spiro alkane derivative, or a pharmaceutically acceptable salt thereof according to any one of the general formulas V and W are all CH ₂ (I) or the above (1) to (3).
(5)
The diazaspiroalkane derivative according to the above general formula (I) or any one of the above (1) to (3), wherein T, U and V are CH ₂ and W is CH ₂ CH ₂ , or pharmaceutically Acceptable salt.
(6)
T and U are CH _2, V in a bond, diaza spiro alkane derivative according to any one of the above general formula wherein W is _{CH 2 CH 2 CH 2 (I} ) or the above (1) to (3) Or a pharmaceutically acceptable salt thereof.
(7)
All of T, U, V and W are CH ₂ CH ₂ , or the diazaspiroalkane derivative according to any one of (1) to (3) above, or a pharmaceutically acceptable product thereof. Salt.
(8)
The diazaspiroalkane derivative according to the above general formula (I) or any one of the above (1) to (7), wherein B is C _1-2 alkylene which may be substituted with a C _1-3 alkyl group, or Its pharmaceutically acceptable salt.
(9)
Diaza-spiro alkane derivative according to any one of the above general formula B is CH ₂ (I) or the above (1) to (7), or a pharmaceutically acceptable salt thereof.
(10)
The diazaspiroalkane derivative according to any one of the above general formula (I) or the above (1) to (7), wherein B is C (= O), or a pharmaceutically acceptable salt thereof.
(11)
The diazaspiroalkane derivative according to any one of the above general formula (I) or the above (1) to (10), wherein X is CH, or a pharmaceutically acceptable salt thereof.
(12)
The diazaspiroalkane derivative according to the above general formula (I) or any one of the above (1) to (11), or a pharmaceutically acceptable salt thereof, wherein Y and Z are both CH ₂ CH ₂ .
(13)
G is C (O) OR ⁴ , C (O) R ⁵ , or a 5- or 6-membered heteroaryl group, and the dia described in any one of the above general formulas (I) and (1) to (12) A zaspiroalkane derivative or a pharmaceutically acceptable salt thereof.
(14)
The diazaspiroalkane derivative according to the above general formula (I) or any one of the above (1) to (12), or a pharmaceutically acceptable salt thereof, wherein G is C (O) OR ⁴ .
(15)
The diazaspiroalkane derivative according to the above (14), wherein R ⁴ is C _1-8 alkyl, or a pharmaceutically acceptable salt thereof.
(16)
A substituent in which the heteroaryl group of G is selected from a halogen atom, a C _1-8 alkyl group, a 3- to 7-membered cycloalkyl group, and a C _1-8 alkyl group substituted with 1 to 3 halogen atoms; The diazaspiroalkane derivative according to any one of the above general formula (I) or the above (1) to (12) which is a pyrimidine which may have, or a pharmaceutically acceptable salt thereof.
(17)
A substituent in which the heteroaryl group of G is selected from a halogen atom, a C _1-8 alkyl group, a 3- to 7-membered cycloalkyl group, and a C _1-8 alkyl group substituted with 1 to 3 halogen atoms; The diazaspiroalkane derivative according to any one of the above general formula (I) or the above (1) to (12), which is an oxadiazole which may have, or a pharmaceutically acceptable salt thereof.

Of the diazaspiroalkane derivatives represented by the general formula (II), the following are preferable.
(18)
R ^{11, R 12} and ^{R 13} are identical or different hydrogen atom, a halogen atom, a cyano _{group, C 1-8 alkyl, C 1-8} alkoxy, _{C 1-8} substituted with 1 to 3 halogen atoms A diazaspiroalkane derivative according to the above general formula (II) which is an alkyl group, a C _1-8 alkylsulfonyl group, a sulfamoyl group or a 5- or 6-membered heteroaryl group, or a pharmaceutically acceptable salt thereof.
(19)
The diaza spiro alkane derivative of the said general formula (II) whose one of R <^11> , R < ¹² > and R < ¹³ _> is a _C1-8 alkylsulfonyl group, or its pharmaceutically acceptable salt.
(20)
T ¹ , U ¹ , V ¹ and W ¹ are all CH ₂ , or the diazaspiroalkane derivative according to any one of (18) or (19) above or pharmaceutically acceptable Salt.
(21)
The diazaspiroalkane derivative according to the above general formula (II) or any one of the above (18) or (19), wherein T ¹ , U ¹ and V ¹ are CH ₂ and W ¹ is CH ₂ CH ₂ , or Its pharmaceutically acceptable salt.
(22)
The dia of any one of the above general formula (II) or the above (18) or (19), wherein T ¹ and U ¹ are CH ₂ , V ¹ is a bond, and W ¹ is CH ₂ CH ₂ CH _2. A zaspiroalkane derivative or a pharmaceutically acceptable salt thereof.
(23)
The diazaspiroalkane derivative according to the general formula (II) or any one of the above (18) or (19), wherein T ¹ , U ¹ , V ¹ and W ¹ are all CH ₂ CH ₂ , or a pharmacy thereof Acceptable salt.
(24)
The diazaspiroalkane derivative according to any one of the above general formula (II) or the above (18) to (23), wherein B ¹ is C _1-2 alkylene which may be substituted with a C _1-3 alkyl group, Or a pharmaceutically acceptable salt thereof.
(25)
The diazaspiroalkane derivative according to any one of the above general formula (II) or the above (18) to (23), wherein B ¹ is CH ₂ , or a pharmaceutically acceptable salt thereof.
(26)
The diazaspiroalkane derivative according to the above general formula (II) or any one of the above (18) to (23), or a pharmaceutically acceptable salt thereof, wherein B ¹ is C (═O).
(27)
The diazaspiroalkane derivative according to any one of the general formula (II) or the above (18) to (26), wherein Y ¹ and Z ¹ are both CH ₂ CH ₂ , or a pharmaceutically acceptable salt thereof.
(28)
The diaza spiro alkane derivative according to any one of the above general formula (II) or the above (18) to (27), or a pharmaceutically acceptable salt thereof, wherein R is C _1-8 alkyl.
(29)
The diazaspiroalkane derivative according to (28), wherein R is a t-butyl group, or a pharmaceutically acceptable salt thereof.

In the diazaspiroalkane derivative represented by the above general formula (I) or (II), examples of the halogen atom include a fluorine atom, a chlorine atom, or a bromine atom, and the C _1-8 alkyl group includes a methyl group. , Ethyl group, propyl group, i-propyl group, butyl group, t-butyl group, pentyl group, neopentyl group or hexyl group.
Examples of the 3- to 7-membered cycloalkyl group include a cyclopropyl group, a cyclopentyl group, and a cyclohexyl group.
Examples of the C _1-8 alkoxy group include a methoxy group, an ethoxy group, and a propoxy group. Examples of the C _1-8 alkyl group substituted with 1 to 3 halogen atoms include a chloromethyl group and a fluoromethyl group. Group, 2-fluoroethyl group or trifluoromethyl group, and the C _1-8 alkoxy group substituted with 1 to 3 halogen atoms includes a fluoromethoxy group or a trifluoromethoxy group.
Further, examples of the alkoxycarbonyl group (the alkoxy has 1 to 8 carbon atoms) include a methoxycarbonyl group or an ethoxycarbonyl group, and the acyl group (the alkyl has 1 to 8 carbon atoms) includes an acetyl group and the like. Examples of the alkylaminocarbonyl group (wherein the alkyl has 1 to 8 carbon atoms) include a methylaminocarbonyl group or an ethylaminocarbonyl group, and the dialkylaminocarbonyl group (wherein the alkyl has 2 to 12 carbon atoms) Examples thereof include a dimethylaminocarbonyl group or a diethylaminocarbonyl group, and examples of the alkoxycarbonylmethylcarbonyl group (wherein alkoxy has 1 to 8 carbon atoms) include a methoxycarbonylmethylcarbonyl group and an ethoxycarbonylmethylcarbonyl group.
Examples of the alkylsulfonylmethyl group (wherein the alkyl has 1 to 8 carbon atoms) include a methanesulfonylmethyl group or an ethanesulfonylmethyl group, and the _C1-8 alkylamino group includes a methylamino group or an ethylamino group. _{Examples of} the C _2-12 dialkylamino group include a dimethylamino group and a diethylamino group. Examples of the C _1-8 alkylsulfonylamino group include a methanesulfonylamino group and an ethanesulfonylamino group. An acylamino group (wherein the alkyl has 1 to 8 carbon atoms) includes an acetylamino group.
As the C _1-8 alkylsulfinyl group, and the like methylsulfinyl group or ethylsulfinyl group. Examples of the C _1-8 alkylsulfonyl group, such as a methanesulfonyl group or an ethanesulfonyl group and the like, C _1-8 Examples of the alkylaminosulfonyl group include a methylaminosulfonyl group and an ethylaminosulfonyl group.
Moreover, a benzyl group etc. are mentioned as _C1-4 alkyl group substituted by the aryl group.

In addition, examples of the 5- or 6-membered heteroaryl group which may have the substituent of A in the general formula (I) include a pyridyl group.
In the general formula (I), examples of the 5- or 6-membered heteroaryl group of G include a pyrimidyl group and an oxadiazolyl group.
The heteroaryl group of G is a halogen atom such as a fluorine atom, a C _1-8 alkyl group such as a methyl group, an ethyl group, a propyl group, or an i-propyl group, a cyclopropyl group, a cyclopentyl group, a cyclohexyl group, or the like It may have a substituent such as a C _1-8 alkyl group substituted with 1 to 3 halogen atoms such as a membered cycloalkyl group or trifluoromethyl group.
In the general formula (I), the phenyl group of A or the 5- or 6-membered heteroaryl group of the substituent which the 5- or 6-membered heteroaryl group may have may be 1, 2, 4 -A triazolyl group, a tetrazolyl group, etc. are mentioned.
In the above general formula (I), the number of substituents A may have is 1 to 5, preferably 1 to 3 in the case of a phenyl group, and 1 to 4 in the case of pyridine, preferably One or two.

In the general formula (II), examples of the 5- or 6-membered heteroaryl group represented by R ¹¹ , R ¹² and R ¹³ include a 1,2,4-triazolyl group and a tetrazolyl group.

In the diazaspiroalkane derivative represented by the above general formula (I) or (II), pharmaceutically acceptable salts include organic acids or inorganic acids such as hydrochloride, sulfate, fumaric acid, oxalate, etc. And the salt.
In the present invention, the diazaspiroalkane derivatives represented by the above general formula (I) or (II) include racemates and optically active substances.
In the present invention, the diazaspiroalkane derivative represented by the above general formula (I) or (II) includes these hydrates and solvates.

Next, the manufacturing method of the diaza spiro alkane derivative represented by the said general formula (I) or (II), or its pharmaceutically acceptable salt is shown next.

The diazaspiroalkane derivative represented by the above general formula (I) in which B is alkylene can be produced by the following method A or method B.

<Method A> B = alkylene

(In the formula, PG represents a protecting group such as tert-butoxycarbonyl group, benzyloxycarbonyl group, benzyl group, and LG represents a halogen atom such as chlorine, bromine, iodine, or the like, or trifluoromethanesulfonyloxy group, methanesulfonyloxy group. R ⁰ represents a hydrogen atom or a C _1-8 alkyl group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, and B ² represents C ₁ as a substituent. _-8 alkyl group, C _1-5 alkylene which may have a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, A, G, T, U, V, W, X , Y and Z are the same as above.)

1) The starting material (a) can be synthesized by a known method (J. Burkhard et. Al., Org. Lett., 2008, 10, 3526, etc.) and a method analogous thereto.

2) Conversion to the compound of the general formula (c) by the reaction of the first step starting material (a) and the starting material (b) is carried out by using sodium tert-butoxide, cesium carbonate in a solvent not involved in the reaction such as toluene and dioxane. In the presence of a base such as tris (dibenzylideneacetone) palladium and a ligand such as 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl. In this case, the reaction temperature is from room temperature to 110 ° C.

3) Second Step The elimination of the protecting group (PG) of the amino group of the compound of the general formula (c) can be carried out by a usual method. For example, when the protecting group is a tert-butoxycarbonyl group, the compound of the general formula (d) can be obtained by a method using trifluoroacetic acid or the like in a solvent such as dichloromethane or without solvent. In addition, when the protecting group is a benzyl group, palladium-carbon in a solvent that does not participate in the reaction such as 1,2-dichloroethane, a method using 1-chloroethyl chloroformate, or a solvent that does not participate in the reaction such as methanol or ethanol. The compound of the general formula (d) can be obtained by a method of catalytic hydrogenation using, as a catalyst.

4) Step 3 Conversion of the compound of the general formula (d) to the compound of the general formula (f) is carried out in the presence of a catalyst such as acetic acid and p-toluenesulfonic acid in a solvent such as methanol and toluene. ) After condensation with the compound of (2), it can be obtained by reduction using sodium borohydride, sodium triacetoxyborohydride or the like.

The compound of the general formula (f) can also be produced by the following method B.

<Method B>

(In the formula, LG, A, B ² , G, T, U, V, W, X, Y and Z are the same as above.)

1) Step 1 Conversion of the compound of the general formula (d) into the compound of the general formula (f) is carried out in the presence of a base such as triethylamine or diisopropylethylamine in a solvent that does not participate in the reaction such as toluene or tetrahydrofuran or without solvent. Or it can carry out by making it react with the compound of general formula (g) in absence. In this case, the reaction temperature is from room temperature to 150 ° C.

Further, the diazaspiroalkane derivative represented by the above general formula (I) in which B is a bond can be produced by the following method C.

<Method C> B = joint

(In the formula, A, G, T, U, V, W, X, Y and Z are the same as above.)

1) First Step The condensation and reduction method of the compound of the general formula (d) and the compound of the general formula (h) can be carried out in the same manner as described in the method A.

Further, the diazaspiroalkane derivative represented by the above general formula (I) in which B is C (═O) or C (═O) CR ¹ R ² can be produced by the following method D.

<Method D> B = C (═O) or C (═O) CR ¹ R ²

(In the formula, D represents a bond or CR ¹ R ² , and A, R ¹ , R ² , G, T, U, V, W, X, Y and Z are the same as above.)

1) Step 1 Conversion of the compound of the general formula (d) to the compound of the general formula (k) can be carried out by using N, N-dimethylformamide, dichloromethane, etc. in a solvent not involved in the reaction, such as N-methylmorpholine, triethylamine, etc. Carboxylic acid represented by general formula (j) in the presence of a base, a condensing agent such as 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (WSC.HCl), 1-hydroxybenzotriazole and the like It can be obtained by condensation.

In addition, the diaza spiro alkane derivative represented by general formula (I) or (II) can also be manufactured with reference to the manufacturing method of the said patent documents 1-8 and nonpatent literature 3.

Examples of representative compounds of the present invention are shown below.
(General Formula A)

(1) In the general formula A, T and U are CH ₂ , X is CH, Y and Z are CH ₂ CH ₂ , and R ²¹ , R ²² , V, W, B, Q and R ²³ is as shown in Table 1.

(2) In the formula of the general formula A, Y and Z are CH ₂ CH ₂ , and R ²¹ , R ²² , T, U, V, W, B, X, Q, and R ²³ are as shown in Table 2.

(3) In the general formula A, R ²² is H, U and V are CH ₂ CH ₂ , X is CH, Z is CH ₂ , and R ²¹ , T, W, B, Y, Q and R ²³ are as shown in Table 3.

(4) In the general formula A, V and W are CH ₂ , X is CH, Y and Z are CH ₂ CH ₂ , Q is C (O) O, and R ²¹ , R ²² , T , U, B and R ²³ are as shown in Table 4.

(5) In the formula of the general formula A, T, V, W and B are CH ₂ , X is CH, Y and Z are CH ₂ CH ₂ , and R ²¹ , R ²² , U, Q and R ²³ is as shown in Table 5.

In the Q column of Table 5, Q1 is

Q2 is

Represents.
(6) In the above general formula A, T and B are CH ₂ , X is CH, Y and Z are CH ₂ CH ₂ , and R ²¹ , R ²² , U, V, W, Q and R ²³ is shown in Table 6.

In the column Q of Table 6, Q2 is the same as Q2 of Table 5, Q3 is

Represents.
(General formula B)

(7) In the formula of the general formula B, B is CH ₂ , Q is C (O) O, and Ar, T, U, V, W, and R ²³ are as shown in Table 7.

(8) In the formula of the general formula B, T and U are CH ₂ , and Ar, V, W, B, Q, and R ²³ are as shown in Table 8.

In the column Q of Table 8, Q2 is the same as Q2 of Table 5, and Q3 is the same as Q3 of Table 6.

Next, pharmacological tests are described.
The GPR119 agonist action was examined by measuring the effect of increasing the intracellular cAMP level of the test compound in cells into which human GPR119 was introduced. The test method is shown below.
(1) Construction of human GPR119 constant expression cells The human GPR119 gene (NM_178471) was purchased from ATCC (ATCC No. 10807349), and PCR amplification was performed so that a BamHI site was formed on the 5 ′ side and an Apa I site was formed on the 3 ′ side. (Primers: tcctggatccatggaatcatctttctcatt (SEQ ID NO: 1), tcctgggccccttagcccatcaactctgagc (SEQ ID NO: 2)). PCR conditions are as follows. Single-stranded DNA in which double-stranded DNA was heat-denatured at 98 ° C. for 10 seconds per cycle using DNA polymerase (KOD-Plus-Ver.2; TOYOBO # KOD-211) and primers were denatured at 55 ° C. for 30 seconds. Followed by DNA extension reaction at 68 ° C. for 1 minute 15 seconds. This was repeated for 35 cycles. The PCR product was inserted as an insert into plasmid pcDNA5 / FRT / TO (Invitrogen # V6520-20), and the resulting plasmid was introduced into Flp-in T-Rex-293 cells (invitrogen # R78007). The introduction method was performed according to the product protocol.

(2) Intracellular cAMP measurement method Human GPR119 constant expression cells prepared by the above method were seeded in a 96-well plate to a concentration of 2500 cells / well (the medium contains 10% fetal bovine serum (FBS), Dulbecco's Modified Eagle Medium (DMEM) medium was used). 24 hours after seeding the cells, tetracyclin (invitrogen # Q10019) (final concentration 20 ng / mL) was added to induce the expression of hGPR119. After 24 hours, the medium was discarded, and stimulation was performed at 37 ° C. for 30 minutes with assay buffer (0.5 mM IBMX PBS (−)) containing the test compound. The amount of intracellular cAMP was measured using a commercially available kit (HitHunter ^™ cAMP XS + Assay (GE Healthcare # 90007503)) and a measuring machine (FLUOstar Optima: BMG LABTECH). The test compound was dissolved in 100% DMSO and added at a final concentration of 1%.

(3) Test Results As will be apparent from Table 9 of Example 8 described later, the compound described in Example 5 exhibited an excellent GPR119 agonistic action.

Accordingly, the diazaspiroalkane derivative of the above general formula (I) or (II) or a pharmaceutically acceptable salt thereof is expected as a therapeutic agent for diabetes because it has a GPR119 agonistic action, and further obesity, metabolic Adaptation to lifestyle-related diseases such as syndrome is also expected.
The diazaspiroalkane derivative of the above general formula (I) or (II), or a pharmaceutically acceptable salt thereof, can also be used in combination with known antidiabetic drugs.

The diazaspiroalkane derivative of the above general formula (I) or (II) or a pharmaceutically acceptable salt thereof should be administered to humans by an appropriate administration method such as oral administration or parenteral administration. Can do. It can also be used in combination with other therapeutic agents for diabetes.
For formulation, it can be produced into a dosage form such as a tablet, granule, powder, capsule, suspension, injection, suppository and the like by a conventional method in the technical field of formulation.
For these preparations, for example, in the case of tablets, usual excipients, disintegrants, binders, lubricants, pigments and the like are used. Here, as the excipient, lactose, D-mannitol, crystalline cellulose, glucose and the like, as the disintegrant, starch, carboxymethylcellulose calcium (CMC-Ca), etc., as the lubricant, magnesium stearate, Examples of binders include talc and the like, and hydroxypropylcellulose (HPC), gelatin, polyvinylpyrrolidone (PVP), and the like. Solvents, stabilizers, solubilizers, suspending agents, emulsifiers, soothing agents, buffers, preservatives and the like are used for the preparation of injections.

The dosage is usually about 0.01 mg to about 0.01 mg / day of the diazaspiroalkane derivative of the above general formula (I) or (II), or a pharmaceutically acceptable salt thereof, which is an active ingredient in an injection for an adult. 100 mg, 1 mg to 2000 mg per day by oral administration, but may be increased or decreased depending on age, symptoms, etc.

EXAMPLES Next, although an Example is given and this invention is demonstrated further in detail, this invention is not limited to these.

4- [2- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-yl] ethyl] piperidine-1-carboxylate t-butyl

(1) 6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane-2-carboxylic acid under t-butyl nitrogen atmosphere, 4-bromophenylmethylsulfone (100 mg, 0.425 mmol), T-butyl 2,6-diazaspiro [3.3] heptane-2-carboxylate 1/2 oxalate (113 mg, 0.468 mmol), tris (dibenzylideneacetone) dipalladium (8 mg, 8.51 μmol), and 2,2′-bis (diphenylphosphino) -1,1′-binaphthyl (16 mg, 25.5 μmol) was dissolved in anhydrous toluene (2 mL), triethylamine (33 μL, 0.234 mmol) and cesium carbonate (416 mg, 1 .28 mmol) was added. The mixture was stirred overnight at 110 ° C., allowed to cool to room temperature, poured into water, and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 3: 2 → 1: 1) to give the title compound (149 mg, yield 99%).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.45 (9H, s),
2.99 (3H, s),
4.09 (4H, s),
4.12 (4H, s),
6.43 (2H, d, J = 9 Hz),
7.73 (2H, d, J = 9 Hz).

(2) 2- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane 6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane- obtained above T-butyl 2-carboxylate (149 mg, 0.423 mmol) was dissolved in dichloromethane (1.5 mL), trifluoroacetic acid (1.5 mL) was added, and the mixture was stirred at room temperature for 5 hours. The reaction mixture was concentrated under reduced pressure, dissolved in chloroform, and neutralized with saturated multistory water. The mixture was extracted twice with chloroform and twice with chloroform-methanol (9: 1, (v / v), dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure to give the title compound (103 mg, yield 96%). Got.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
2.99 (3H, s),
3.87 (4H, s),
4.09 (4H, s),
6.42 (2H, d, J = 9 Hz),
7.72 (2H, d, J = 9 Hz).

(3) t-butyl 4- [2- [6- (4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-yl] ethyl] piperidine-1-carboxylate obtained above 2- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane (49 mg, 0.194 mmol) and t-butyl 4- (2-oxoethyl) piperidine-1-carboxylate (88 mg, 0. 0). 388 mmol) was dissolved in methanol (2 mL), acetic acid (1 drop) was added, and the mixture was stirred at room temperature for 4 days. Subsequently, sodium borohydride (22 mg, 0.582 mmol) was added and stirred at room temperature for 2 hours. The reaction mixture was poured into saturated multistory water, extracted with chloroform, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 1 → chloroform: methanol = 99: 1 → 97: 3) to give the title compound (42 mg, yield 46%) as light brown crystals. Got as.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.0-1.2 (2H, m),
1.2-1.4 (2H, m),
1.4-1.5 (1H, m),
1.45 (9H, s),
1.6-1.7 (2H, m),
2.44 (2H, t, J = 8 Hz),
2.6-2.8 (2H, m),
2.99 (3H, s),
3.36 (4H, s),
4.0-4.2 (2H, m),
4.04 (4H, s),
6.41 (2H, d, J = 9 Hz),
7.71 (2H, d, J = 9 Hz).
IR (KBr, cm ⁻¹ ): 2925, 1693, 1595, 1512, 1473, 1421, 1388, 1365, 1292, 1236, 1174, 1147, 1088, 1003, 964, 868, 814, 777, 575, 534.

4- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-ylmethyl] piperidine-1-carboxylate t-butyl

(1) 4- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-ylmethyl] piperidine-1-carboxylate t-butyl obtained in Example 1 (2) Using 2- (4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane (102 mg, 0.404 mmol) and t-butyl 4-formylpiperidine-1-carboxylate (172 mg, 0.808 mmol) The title compound (41 mg, yield 23%) was obtained as white crystals in the same manner as in Example 1 (3).

m. p. 179-183 ° C
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.0-1.2 (2H, m),
1.4-1.6 (1H, m),
1.45 (9H, s),
1.5-1.7 (2H, m),
2.2-2.4 (2H, m),
2.6-2.8 (2H, m),
2.99 (3H, s),
3.38 (4H, br s),
4.0-4.2 (2H, m),
4.04 (4H, s),
6.41 (2H, d, J = 9 Hz),
7.71 (2H, d, J = 9 Hz).
IR (KBr, cm ⁻¹ ): 2935, 2843, 1684, 1595, 1469, 1429, 1390, 1367, 1333, 1317, 1300, 1248, 1234, 1144, 1090, 958, 864, 829, 775, 596, 532 486.

4- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane-2-carbonyl] piperidine-1-carboxylate t-butyl

(1) 4- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane-2-carbonyl] piperidine-1-carboxylate under nitrogen atmosphere in Example 1 (2 ) 2- (4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane (30 mg, 0.119 mmol), 1-t-butoxycarbonylpiperidine-4-carboxylic acid (27 mg, 0. 0). 119 mmol), and 1-hydroxybenzotriazole monohydrate (20 mg, 0.131 mmol) were dissolved in dichloromethane (1 mL), and N-methylmorpholine (14 μL, 0.131 mmol), 1- (3 -Dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (25 mg, 0.131 mmol) was added. After stirring for 0.5 hours under ice cooling and overnight at room temperature, the reaction mixture was poured into saturated multistory water, extracted with chloroform, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform: methanol = 99: 1 → 98: 2) to give the title compound (42 mg, yield 77%) as white crystals.

m. p. : 222-223 ° C
¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.46 (9H, s),
1.6-1.8 (4H, m),
2.2-2.4 (1H, m),
2.7-2.9 (2H, m),
2.99 (3H, s),
4.0-4.2 (2H, m),
4.13 (4H, s),
4.19 (2H, s),
4.37 (2H, s),
6.45 (2H, d, J = 9 Hz),
7.74 (2H, d, J = 9 Hz).
IR (KBr, cm ⁻¹ ): 2935, 1685, 1635, 1593, 1506, 1471, 1446, 1421, 1383, 1360, 1333, 1317, 1300, 1236, 1146, 1092, 1066, 1003, 974, 945, 866 , 827, 773, 731, 577, 536, 459.

4- [1- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-yl] ethyl] piperidine-1-carboxylate t-butyl

(1) 4- [1- [6- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-yl] ethyl] piperidine-1-carboxylate in a t-butyl nitrogen atmosphere, 2- (4-Methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane (62 mg, 0.246 mmol), t-butyl 4-acetylpiperidine-1-carboxylate obtained in Example 1 (2) (56 mg, 0.246 mmol) and molecular sieves 3A (200 mg) were suspended in benzene (3 mL) and heated to reflux overnight. After cooling to room temperature, insolubles were filtered off through Celite, and the solvent was distilled off under reduced pressure. The obtained residue was dissolved in dichloromethane (3 mL), sodium triacetoxyborohydride (104 mg, 0.491 mmol) was added, and the mixture was stirred at room temperature for 4 hr. The reaction mixture was poured into saturated multistory water, extracted with chloroform, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (chloroform: methanol = 99: 1 → 97: 3) to give the title compound (39 mg, yield 34%) as pale-brown crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
0.83 (3H, d, J = 6Hz),
1.1-1.3 (2H, m),
1.3-1.8 (3H, m),
1.45 (9H, s),
2.11 (1H, br s),
2.5-2.7 (2H, m),
2.99 (3H, s),
3.35 (4H, br s),
4.04 (4H, s),
4.0-4.3 (2H, m),
6.41 (2H, d, J = 9 Hz),
7.72 (2H, d, J = 9 Hz).
IR (KBr, cm ⁻¹ ): 2931, 1691, 1597, 1523, 1458, 1415, 1367, 1333, 1288, 1230, 1144, 1086, 947, 864, 818, 773, 741, 598, 526, 488.

4- [6- (2-Fluoro-4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-ylmethyl] piperidine-1-carboxylate t-butyl

(1) 6- (2-Fluoro-4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane-2-carboxylate t-butyl (4-bromo-3-fluorophenyl) methylsulfone (83 mg , 0.329 mmol), and the title compound (98 mg, 81% yield) was obtained in the same manner as in Example 1 (1).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.45 (9H, s),
3.00 (3H, s),
4.11 (4H, s),
4.22 (4H, d, J = 2 Hz),
6.45 (1H, t, J = 8 Hz),
7.48 (1H, dd, J = 2, 11 Hz),
7.55 (1H, dd, J = 2, 8 Hz).

(2) 2- (2-Fluoro-4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane 6- (2-Fluoro-4-methanesulfonylphenyl) -2,6- The title compound (56 mg, 78% yield) was obtained in the same manner as in Example 1 (2) using diazaspiro [3.3] heptane-2-carboxylate t-butyl (98 mg, 0.265 mmol).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
3.02 (3H, s),
3.85 (4H, s),
4.23 (4H, d, J = 2 Hz),
6.48 (1H, t, J = 8 Hz),
7.45 (1H, dd, J = 2, 11 Hz),
7.52 (1H, dd, J = 2, 8 Hz).

(3) t-butyl 4- [6- (2-fluoro-4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptan-2-ylmethyl] piperidine-1-carboxylate 2 obtained above The title compound (48 mg, 48 mg, 2- (4-fluoro-4-methanesulfonylphenyl) -2,6-diazaspiro [3.3] heptane (56 mg, 0.207 mmol) was used in the same manner as in Example 1 (3). Yield 50%) was obtained as fine brown crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.0-1.2 (2H, m),
1.4-1.6 (1H, m),
1.45 (9H, s),
1.5-1.7 (2H, m),
2.2-2.4 (2H, m),
2.6-2.8 (2H, m),
3.00 (3H, s),
3.36 (4H, br s),
4.0-4.2 (2H, m),
4.18 (4H, d, J = 2Hz),
6.43 (1H, t, J = 8 Hz),
7.46 (1H, dd, J = 2, 11 Hz),
7.53 (1H, dd, J = 2, 8 Hz).
IR (KBr, cm ⁻¹ ): 2937, 2853, 1685, 1605, 1517, 1476, 1419, 1383, 1368, 1327, 1303, 1248, 1209, 1153, 1134, 1072, 1027, 971, 957, 866, 815 762,616,592,536,493.

4- [9- (4-Methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecan-3-ylmethyl] piperidine-1-carboxylate t-butyl

(1) 9- (4-Methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecane-3-carboxylic acid in a t-butyl nitrogen atmosphere, 4-bromophenylmethylsulfone (208 mg, 0.818 mmol), 3,9-diazaspiro [5.5] undecane-3-carboxylate t-butyl (231 mg, 0.983 mmol), bis (dibenzylideneacetone) palladium (14 mg, 24.3 μmol), pentaphenyl (di-t-butylphosphine) Fino) ferrocene (35 mg, 49.2 μmol) and t-butoxy sodium (236 mg, 2.46 mmol) were dissolved in anhydrous 1,4-dioxane (15 mL). After heating to reflux overnight, the mixture was allowed to cool to room temperature, and the insoluble material was filtered off through celite. The filtrate was poured into water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (hexane: ethyl acetate = 1: 1) to give the title compound (115 mg, yield 34%) as white crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.47 (9H, s),
1.4-1.6 (4H, m),
1.64 (4H, t, J = 6 Hz),
3.00 (3H, s),
3.36 (4H, t, J = 6Hz),
3.42 (4H, t, J = 6Hz),
6.91 (2H, d, J = 9 Hz),
7.74 (2H, d, J = 9 Hz).

(2) t-butyl 4- [9- (4-methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecan-3-ylmethyl] piperidine-1-carboxylate 9- (4- Methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecane-3-carboxylate t-butyl (58 mg, 0.142 mmol) was dissolved in dichloromethane (2.0 mL) and trifluoroacetic acid (2.0 mL). And stirred at room temperature for 3 hours. The reaction mixture was concentrated under reduced pressure, anhydrous toluene (5 ml) and p-toluenesulfonic acid (catalytic amount) were added, and the mixture was heated to reflux for 2 days using a Dean-Stark trap. After the solvent was distilled off under reduced pressure, the obtained residue was dissolved in anhydrous dichloromethane (5 mL), sodium triacetoxyborohydride (60 mg, 0.283 mmol) was added, and the mixture was stirred at room temperature for 5 hours. The reaction mixture was poured into saturated multistory water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The obtained residue was purified by silica gel column chromatography (ethyl acetate: acetic acid: water = 3: 1: 1) and recrystallization (hexane / ethyl acetate) to give the title compound (8.5 mg, yield 12%). Obtained as white crystals.

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.0-1.2 (2H, m),
1.45 (9H, s),
1.5-1.8 (11H, m),
2.1-2.3 (2H, m),
2.2-2.5 (4H, br s),
2.6-2.8 (2H, m),
3.00 (3H, s),
3.34 (4H, t, J = 6 Hz),
4.0-4.2 (2H, br s),
6.90 (2H, d, J = 9 Hz),
7.73 (2H, d, J = 9 Hz).

4- [9- (4-Methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecan-3-yl] piperidine-1-carboxylate t-butyl

(1) 4- [9- (4-Methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecan-3-yl] piperidine-1-carboxylic acid t-butyl 1- (t-butoxycarbonyl)- 4-piperidone (71 mg, 0.356 mmol) and t-butyl 9- (4-methanesulfonylphenyl) -3,9-diazaspiro [5.5] undecane-3-carboxylate obtained in Example 6 (1) ( The title compound (1.6 mg, yield 2%) was obtained as a white powder in the same manner as in Example 6 (2) using 73 mg, 0.179 mmol).

¹ H NMR (CDCl ₃ , 400 MHz): δ =
1.26 (4H, s),
1.45 (9H, s),
1.4-1.7 (8H, m),
1.7-1.9 (2H, m),
2.3-2.5 (1H, m),
2.55 (2H, br s),
2.6-2.8 (2H, m),
3.00 (3H, s),
3.34 (4H, t, J = 5 Hz),
4.0-4.3 (2H, m),
6.90 (2H, d, J = 9 Hz),
7.74 (2H, d, J = 9 Hz).

Pharmacological experiment (1) Construction of human GPR119 constant expression cell The human GPR119 gene (NM_178471) was purchased from ATCC (ATCC No. 10807349), and PCR amplification was performed so that a BamHI site was formed on the 5 ′ side and an ApaI site was formed on the 3 ′ side. (Primers: TCCTGGATCCatgacatcattctctcatt, TCCTGGGCCCttagcccatcaactctgagc). PCR conditions are as follows. Single-stranded DNA in which double-stranded DNA was heat-denatured at 98 ° C. for 10 seconds per cycle using DNA polymerase (KOD-Plus-Ver.2; TOYOBO # KOD-211) and primers were denatured at 55 ° C. for 30 seconds. Followed by DNA extension reaction at 68 ° C. for 1 minute 15 seconds. This was repeated for 35 cycles. The PCR product was inserted as an insert into plasmid pcDNA5 / FRT / TO (Invitrogen # V6520-20), and the resulting plasmid was introduced into Flp-in T-Rex-293 cells (invitrogen # R78007). The introduction method was performed according to the product protocol.

(2) Intracellular cAMP measurement method Human GPR119 constant expression cells prepared by the above method were seeded in a 96-well plate to a concentration of 2500 cells / well (the medium contains 10% fetal bovine serum (FBS), Dulbecco's Modified Eagle Medium (DMEM) medium was used). 24 hours after seeding the cells, tetracyclin (invitrogen # Q10019) (final concentration 20 ng / mL) was added to induce the expression of hGPR119. After 24 hours, the medium was discarded, and stimulation was performed at 37 ° C. for 30 minutes with assay buffer (0.5 mM IBMX PBS (−)) containing the test compound. The amount of intracellular cAMP was measured using a commercially available kit (HitHunter ^™ cAMP XS + Assay (GE Healthcare # 90007503)) and a measuring machine (FLUOstar Optima: BMG LABTECH). The test compound was dissolved in 100% DMSO and added at a final concentration of 1%.

(3) Experimental results Table 9 shows the test results.

  As is clear from Table 9, the compound described in Example 5 exhibited an excellent GPR119 agonistic action.

Claims (33)

The diaza spiro alkane derivative represented by the following general formula (I), or a pharmaceutically acceptable salt thereof.

(In the formula, A is a halogen atom, nitro group, cyano group, hydroxy group, C _1-8 alkyl group, C _1-8 alkoxy group or C _1-8 substituted with 1 to 3 halogen atoms as a substituent. An alkyl group, a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, a phenyloxy group, an alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), a carboxyl group, a carbamoyl group, an acyl group (an alkyl group) 1-8), alkylaminocarbonyl group (alkyl having 1-8 carbon atoms), dialkylaminocarbonyl group (alkyl having 2-12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy having 1 carbon atom) 8) alkylsulfonyl radical (carbon number of alkyl is 1 to 8), an amino _{group, C 1-8} alkylamino _{group, C 2-12} dialkyl Amino _{group, C 1-8} alkylsulfonylamino group, (1-8 carbon atoms in the _alkyl) acylamino _{group, C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a sulfamoyl _{group, C 1-8} alkylamino Represents a phenyl group or a 5- or 6-membered heteroaryl group optionally having a sulfonyl group, a phenylsulfonyl group and a 5- or 6-membered heteroaryl group;
T, U, V and W have the same or different bond or a substituent a C _1-8 alkyl group, those selected from 1-3 C _1-8 alkyl group substituted with a halogen atom C _1-5 alkylene which may be _optionally represented.
However, the nitrogen-containing heterocycle consisting of T, nitrogen atom, U and carbon atom, and the nitrogen-containing heterocycle consisting of V, carbon atom, W and nitrogen atom are each independently a 4 to 7-membered ring,
B is selected from a bond, C (═O), C (═O) CR ¹ R ² or a C _1-8 alkyl group as a substituent, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. _{Represents a} C _1-5 alkylene which may have
Here, R ¹ and R ² are the same or different and each represents a hydrogen atom, a C _1-8 alkyl group, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. X represents N or CR ³ ,
Here, R ³ represents a hydrogen atom, a C _1-8 alkyl group, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms.
However, when X is N, B is not a bond or methylene,
Y and Z may be the same or different as a substituent, a halogen atom, a cyano group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a carboxyl group, or a C _1-8 alkyl substituted with 1 to 3 halogen atoms. Represents a C _1-3 alkylene which may have a group or a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms.
However, when X is N, both Y and Z are not methylene,
G is C (O) OR ⁴ , C (O) R ⁵ , SO ₂ R ⁶ , C (O) NR ⁷ R ⁸ , CH ₂ C (O) NR ⁹ R ¹⁰ , or a 5- or 6-membered ring. Represents a heteroaryl group,
Here, R ^{4 to} R ¹⁰ are a hydrogen atom, a C _1-8 alkyl group, a 3- to 7-membered cycloalkyl group, a C _1-4 alkyl group substituted with an aryl group, or 1 to 3 halogen atoms. Represents a substituted C _1-8 alkyl group,
The heteroaryl group is bonded to the nitrogen atom of the nitrogen-containing heterocyclic ring consisting of Y, X, Z and N via the carbon atoms constituting the ring, and is a halogen atom, a nitro group, a cyano group, a hydroxy group, From a C _1-8 alkyl group, a C _1-8 alkoxy group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, and a C _1-8 alkoxy group substituted with 1 to 3 halogen atoms It may have a selected substituent. ) A is a halogen atom, nitro group, cyano group, hydroxy group, C _1-8 alkyl group, C _1-8 alkoxy group, C _1-8 alkyl group substituted with 1 to 3 halogen atoms as a substituent, _C1-8 alkoxy group substituted with 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl group, carbamoyl group, acyl group (alkyl has 1 carbon atom) -8), alkylaminocarbonyl group (alkyl has 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl has 2 to 12 carbon atoms), alkoxycarbonylmethylcarbonyl group (alkoxy has 1 to 8 carbon atoms), alkylsulfonyl methyl group (1-8 carbon atoms in the alkyl), amino _{group, C 1-8} alkylamino _{group, C 2-12} dialkylamino , _{C 1-8} alkylsulfonylamino group, an acylamino group (carbon number of alkyl is 1 to _{8), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a sulfamoyl _{group, C 1-8} alkylaminosulfonyl group A diazaspiroalkane derivative or a pharmaceutically acceptable salt thereof according to claim 1, which is a phenyl group optionally having a phenylsulfonyl group and a 5- or 6-membered heteroaryl group. . A halogen atom as a substituent, a cyano _{group, a C 1-8} alkyl _{group, C 1-8} alkoxy groups, one to three _{C 1-8} alkyl group substituted with a halogen _{atom, C 1-8} alkylsulfonyl group A diazaspiroalkane derivative according to claim 1, which is a phenyl group or a 5- or 6-membered heteroaryl group optionally having a sulfamoyl group and a 5- or 6-membered heteroaryl group; Or a pharmaceutically acceptable salt thereof. The diazaspiroalkane derivative according to claim 1, wherein A is a phenyl group having at least one C _1-8 alkylsulfonyl group as a substituent or a 5- or 6-membered heteroaryl group, or a pharmaceutically acceptable derivative thereof salt. T, U, V, and W are all CH _2. The diazaspiroalkane derivative according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof. The diazaspiroalkane derivative or the pharmaceutically acceptable salt thereof according to any one of claims 1 to 4, wherein T, U and V are CH ₂ and W is CH ₂ CH ₂ . T and U are CH _2, V in a bond, W is diaza spiro alkane derivative according to any one of claims 1 to 4 is _{CH 2 CH} 2 _CH 2, or a pharmaceutically tolerated Salt. T, U, diaza spiro alkane derivative according to any one of claims 1 to 4 all V and W are CH ₂ CH _2, or a pharmaceutically acceptable salt thereof. The diazaspiroalkane derivative according to any one of claims 1 to 8, or a pharmaceutically acceptable salt thereof, wherein B is C _1-2 alkylene optionally substituted with a C _1-3 alkyl group. . Diaza-spiro alkane derivative according to any one of claims 1 to 8 B is CH _2, or a pharmaceutically acceptable salt thereof. B is C (= O), The diaza spiro alkane derivative as described in any one of Claims 1-8, or its pharmaceutically acceptable salt. X is CH, The diaza spiro alkane derivative as described in any one of Claims 1-11, or its pharmaceutically acceptable salt. Diaza-spiro alkane derivative according to any one of claims 1 to 12 Y and Z are both CH ₂ CH _2, or a pharmaceutically acceptable salt thereof. G is C (O) OR < ⁴ >, C (O) R < ⁵ >, or a 5- or 6-membered heteroaryl group, The diaza spiro alkane derivative as described in any one of Claims 1-13, or its pharmaceutical Acceptable salt. Diaza-spiro alkane derivative according to any one of claims 1 to 13 G is C (O) OR ^4, or a pharmaceutically acceptable salt thereof. The diazaspiroalkane derivative according to claim 15, or a pharmaceutically acceptable salt thereof, wherein R ⁴ is C _1-8 alkyl. A substituent in which the heteroaryl group of G is selected from a halogen atom, a C _1-8 alkyl group, a 3- to 7-membered cycloalkyl group, and a C _1-8 alkyl group substituted with 1 to 3 halogen atoms; The diazaspiroalkane derivative or the pharmaceutically acceptable salt thereof according to any one of claims 1 to 13, which is a pyrimidine which may be contained. A substituent in which the heteroaryl group of G is selected from a halogen atom, a C _1-8 alkyl group, a 3- to 7-membered cycloalkyl group, and a C _1-8 alkyl group substituted with 1 to 3 halogen atoms; The diazaspiroalkane derivative or the pharmaceutically acceptable salt thereof according to any one of claims 1 to 13, which is an oxadiazole which may be contained. The diaza spiro alkane derivative represented by the following general formula (II), or a pharmaceutically acceptable salt thereof.

(In the formula, R ¹¹ , R ¹² and R ¹³ are the same or different and each represents a hydrogen atom, a halogen atom, a nitro group, a cyano group, a hydroxy group, a C _1-8 alkyl group, a C _1-8 alkoxy group, 1 to 3 C _1-8 alkyl group substituted with a halogen atom, C _1-8 alkoxy group substituted with 1 to 3 halogen atoms, phenyloxy group, alkoxycarbonyl group (alkoxy has 1 to 8 carbon atoms), carboxyl Group, carbamoyl group, acyl group (alkyl having 1 to 8 carbon atoms), alkylaminocarbonyl group (alkyl having 1 to 8 carbon atoms), dialkylaminocarbonyl group (alkyl having 2 to 12 carbon atoms), alkoxycarbonyl methylcarbonyl group (number of carbon atoms in the alkoxy 1-8) alkylsulfonyl radical (carbon number of alkyl is 1 to 8), an amino _{group, C 1-8} Alkylamino _{group, C 2-12} dialkylamino _{group, C 1-8} alkylsulfonylamino group, an acylamino group (carbon number of alkyl is 1 to _{8), C 1-8} alkylsulfinyl _{group, C 1-8} alkylsulfonyl group, a sulfamoyl A group, a C _1-8 alkylaminosulfonyl group, a phenylsulfonyl group or a 5- or 6-membered heteroaryl group;
T ¹ , U ¹ , V ¹ and W ¹ are the same or different and are selected from a C _1-8 alkyl group as a bond or substituent, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. C _1-5 alkylene which may have a thing is represented.
However, the nitrogen-containing heterocyclic ring consisting of T ¹ , nitrogen atom, U ¹ and carbon atom, and the nitrogen-containing heterocyclic ring consisting of V ¹ , carbon atom, W ¹ and nitrogen atom are each independently a 4 to 7-membered ring,
B ¹ is a bond, C (═O), C (═O) CR ¹⁴ R ¹⁵ or a C _1-8 alkyl group as a substituent, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. _Represents C _1-5 alkylene optionally having a selected one,
Here, R ¹⁴ and R ¹⁵ are the same or different and each represents a hydrogen atom, a C _1-8 alkyl group, or a C _1-8 alkyl group substituted with 1 to 3 halogen atoms. Y ¹ and Z ¹ are the same or Unlike a substituent, a halogen atom, a cyano group, a C _1-8 alkyl group, a C _1-8 alkoxy group, a carboxyl group, a C _1-8 alkyl group substituted with 1 to 3 halogen atoms, or 1 to 3 Represents C _1-3 alkylene which may have one selected from C _1-8 alkoxy groups substituted by halogen atoms,
R is a hydrogen atom, a C _1-8 alkyl group, a 3-7 membered cycloalkyl group, a C _1-4 alkyl group substituted with an aryl group, or C ₁ substituted with 1 to 3 halogen atoms. _-8 represents an alkyl group. ) R ^{11, R 12} and ^{R 13} are identical or different hydrogen atom, a halogen atom, a cyano _{group, C 1-8 alkyl, C 1-8} alkoxy, _{C 1-8} substituted with 1 to 3 halogen atoms The diazaspiroalkane derivative according to claim 19, or a pharmaceutically acceptable salt thereof, which is an alkyl group, a C _1-8 alkylsulfonyl group, a sulfamoyl group, or a 5- or 6-membered heteroaryl group. The diazaspiroalkane derivative according to claim 19, or a pharmaceutically acceptable salt thereof, wherein any one of R ¹¹ , R ¹² and R ¹³ is a C _1-8 alkylsulfonyl group. The diazaspiroalkane derivative according to any one of claims 19 to 21, or a pharmaceutically acceptable salt thereof, wherein T ¹ , U ¹ , V ¹ and W ¹ are all CH ₂ . In T ^{1, U 1} and ^{V 1} is CH _2, diaza spiro alkane derivative according to any one of claims 19 to 21 ^{W 1} is _CH 2 CH _2, or a pharmaceutically acceptable salt thereof . The diazaspiroalkane derivative according to any one of claims 19 to 21, or a pharmaceutical thereof, wherein T ¹ and U ¹ are CH ₂ , V ¹ is a bond, and W ¹ is CH ₂ CH ₂ CH _2. Acceptable salt. The diazaspiroalkane derivative according to any one of claims 19 to 21, or a pharmaceutically acceptable salt thereof, wherein all of T ¹ , U ¹ , V ¹ and W ¹ are CH ₂ CH ₂ . The diazaspiroalkane derivative according to any one of claims 19 to 25, or a pharmaceutically acceptable salt thereof, wherein B ¹ is C _1-2 alkylene which may be substituted with a C _1-3 alkyl group. salt. Diaza-spiro alkane derivative according to any one of claims 19 to 25 B ¹ is CH _2, or a pharmaceutically acceptable salt thereof. Diaza-spiro alkane derivative according to any one of claims 19 to 25 B ¹ is C (= O), or a pharmaceutically acceptable salt thereof. The diazaspiroalkane derivative according to any one of claims 19 to 28, or a pharmaceutically acceptable salt thereof, wherein Y ¹ and Z ¹ are both CH ₂ CH ₂ . 30. The diazaspiroalkane derivative or the pharmaceutically acceptable salt thereof according to any one of claims 19 to 29, wherein R is _C1-8 alkyl. 31. The diazaspiroalkane derivative according to claim 30, or a pharmaceutically acceptable salt thereof, wherein R is a t-butyl group. The diabetic therapeutic agent which contains the diaza spiro alkane derivative in any one of Claims 1-31, or its pharmaceutically acceptable salt as an active ingredient. A GPR119 agonist comprising the diazaspiroalkane derivative according to any one of claims 1 to 31 or a pharmaceutically acceptable salt thereof as an active ingredient.