JP2012105582A - Acetoin-producing cell, and method for producing acetoin by using the cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide cells capable of producing acetoin efficiently and simply, and a method for producing acetoin by using such cells.SOLUTION: This acetoin-producing cell includes features in which the function of acetoin dehydrogenase is missed or decreased, and an enzyme group managing the syntheses of acetolactic acid from pyruvic acid and the acetoin from the acetolactic acid are constitutionally expressed. The acetoin-producing cell has features in which the functions of 3 kinds of proteins of acetoin dehydrogenase, phosphate acetyltransferase and lactic acid dehydrogenase are missed or decreased. The method for producing the acetoin by using these acetoin-producing cells is also provided.

Description

  The present invention relates to an acetoin-producing cell and a method for producing acetoin using the cell.

  Acetoin (3-hydroxy-2-butanone) is a compound having a yogurt and butter-like fragrance, and is used as a food additive and a cosmetic raw material. Diacetyl (2,3-butanedione), which is a compound similar to acetoin, is used not only as a food additive but also in pharmaceutical production.

  Acetoin can be produced using cells such as microorganisms. In the cell, acetoin is produced, for example, by decarboxylation of acetolactate produced by dimerization of pyruvic acid generated in the citric acid cycle. However, since other metabolites such as acetic acid and lactic acid are produced in the cells, it is difficult to separate and purify acetoin, and the efficiency of acetoin production by the cells is poor and it is not economical.

  With respect to a method for producing acetoin using cells such as microorganisms, methods using lactic acid bacteria have been studied (Patent Documents 1 and 2). Patent Document 1 discloses a method for producing acetoins by culturing lactic acid bacteria in a medium to which iron porphyrin, metal salt, or the like is added. Patent Document 2 discloses that a lactic acid strain having a high ability to produce acetoins was obtained by inducing mutation using a drug.

  When Bacillus subtilis is originally cultured in a medium rich in carbohydrates, it produces acetoin and accumulates in the medium during cell growth (Non-patent Document 1), and when cell growth is stopped thereafter, acetoin in the medium is re-applied. It is known to decompose and get energy. Non-Patent Document 1 discloses that when culturing Bacillus subtilis, the production of acetoin is increased by changing culture conditions such as medium components. Moreover, it is known that Bacillus subtilis in which the bdhA gene encoding acetoin reductase is disrupted accumulates acetoin in the stationary phase (Non-patent Document 2).

  Enzymes that control the acetoin synthesis pathway of Bacillus subtilis form a single operon, and alsR is known as a regulator that regulates the expression of such operon (alsSD). It has been reported in Non-Patent Document 3 that the alsR gene is transcribed independently of the alsSD operon, and alsD was not expressed when the alsR gene was disrupted. In addition, Non-Patent Document 3 reports that an alsR mutant strain that promotes the expression of alsSD was obtained.

  So far, no example has been reported in which modification is performed not only for a single gene but also for a plurality of genes related to the metabolic system in order to efficiently produce acetoin using cells such as microorganisms.

Japanese Patent Laid-Open No. 3-219884 JP-A-4-99480

Appl Micorobiol Biotechonol 74 (1), 61-67 (2007) Appl Environ Microbiol 74 (22), 6832-6838 (2008) J Bacteriol 175 (12), 3863-3875 (1993)

  An object of the present invention is to provide a cell capable of efficiently and simply producing acetoin and a method for producing acetoin using the cell.

  In order to solve the above problems, the present inventors have intensively studied, and as a result, deleted the acetoin re-degradation system in Bacillus subtilis and modified the gene regulation so that the acetoin synthase group is constitutively expressed, and The inventors have found that cells capable of efficiently producing acetoin can be produced by modifying the metabolic system so as to increase the supply of raw materials for acetoin synthesis, and the present invention has been completed.

That is, this invention consists of the following.
1. An acetoin-producing cell in which the function of acetoin dehydrogenase is deficient or reduced, and an enzyme group that synthesizes acetolactic acid from pyruvate and acetoin is constitutively expressed.
2. 2. The acetoin-producing cell according to item 1 above, wherein the gene encoding the enzyme group forms a single operon.
3. The deficiency or reduction in the function of acetoin dehydrogenase is due to the artificial destruction of the gene encoding acetoin dehydrogenase, and the constitutive expression of the enzyme group is related to the operon expression control system. 3. The acetoin-producing cell according to item 2 above, which is caused by introducing a mutation that modifies the acetoin.
4). An acetoin-producing cell in which the functions of three proteins, acetoin dehydrogenase, phosphate acetyltransferase, and lactate dehydrogenase are deficient or reduced.
5. A gene that encodes acetoin dehydrogenase, a gene that encodes acetoin dehydrogenase, which is deficient or reduced in function of the three proteins of acetoin dehydrogenase, phosphate acetyltransferase, and lactate dehydrogenase, 5. The acetoin-producing cell according to item 4, wherein the acetoin-producing cell is obtained by artificially destroying three kinds of genes that encode lactate dehydrogenase.
6). 4. The acetoin-producing cell according to any one of items 1 to 3, wherein the function of at least one protein of phosphoric acetyltransferase and lactate dehydrogenase is deficient or reduced.
7). Among the genes encoding phosphoric acid acetyltransferase and lactate dehydrogenase, the loss or reduction of the function of at least one protein is a gene encoding phosphate acetyltransferase, and a gene encoding lactate dehydrogenase, 7. The acetoin-producing cell according to item 6 above, which is due to artificial destruction of at least one gene.
8). 8. The cell according to any one of 1 to 7 above, wherein the cell is a bacterium belonging to the genus Bacillus.
9. 9. The cell according to item 8 above, wherein the cell is a Bacillus subtilis mutant strain having an accession number FERM AP-22036 (reception date: October 28, 2010).
10. 10. A method for producing acetoin, comprising a step of culturing the cell according to any one of items 1 to 9 in the presence of glucose.
11. 10. A method for producing acetoin, comprising a step of culturing the cell according to any one of 1 to 3 and 6 to 9 in the presence of 1 to 10 w / v% glucose.
12 9. A method for producing acetoin, comprising a step of culturing the cell according to any one of items 4, 5, and 8 in the presence of 0.2 to 2 w / v% glucose.
13. 13. The acetoin production method according to any one of items 10 to 12, further comprising a step of isolating acetoin from the culture filtrate obtained in the culturing step.

  The cell of the present invention can produce acetoin at low cost and with a high efficiency of 90% (molar ratio) using saccharides such as glucose as a raw material. The cells of the present invention have the same cell growth amount and survival rate as wild-type cells, and therefore do not require special operations, special additives, or the like during culture. In addition, the acetoin production method of the present invention using such cells is simple because acetoin can be produced in one step.

It is a figure which shows the outline of the metabolic system of Bacillus subtilis. It is a figure which shows the acetoin production amount when the mutant 1 ((DELTA) lctE (DELTA) pta) is cultured in the culture medium containing glucose. (Reference Example 1) It is a figure which shows the acetoin production amount when the mutant 2 ((DELTA) acoA) is cultured in the culture medium containing glucose. (Reference Example 2) It is a figure which shows the amount of acetoin production when the acetoin production cell 1 ((DELTA) acoA (DELTA) lctE (DELTA) pta) is cultured in the culture medium containing 0.4 w / v% glucose. (Example 2) It is a figure which shows the acetoin production amount when the acetoin production cell 1 ((DELTA) acoA (DELTA) lctE (DELTA) pta) is cultured in the culture medium containing 4 w / v% glucose. (Example 2) It is a figure which shows the acetoin production amount when the mutant strain 3 ((DELTA) alsR1) is cultured in the culture medium containing glucose. (Reference Example 3) It is a figure which shows the amount of acetoin production when the acetoin production cell 2 (alsR1ΔacoA) is cultured in a medium containing 4 w / v% glucose. Example 4

  The present invention is directed to a cell capable of efficiently producing acetoin by modifying the intracellular metabolic system. In the present invention, a cell in which the function of a specific enzyme is deficient or reduced and / or a specific enzyme group is constitutively expressed can be obtained by modifying the intracellular metabolic system.

  In the present invention, "cells in which the enzyme function is deficient or reduced" means that the function of the target enzyme itself is reduced or lost compared to wild-type cells, the amount is reduced, Examples are cells that are not expressed. Specifically, the “cell in which the enzyme function is deficient or reduced” is exemplified by a cell in which a mutation is introduced into the gene encoding the target enzyme or the gene is destroyed. The cell of the present invention may be a naturally occurring cell or an artificially disrupted gene. The cell of the present invention is preferably prepared by artificially destroying a gene encoding an enzyme of interest.

  In the present invention, “constitutive” is used in the meaning generally used in the technical field to which the present invention belongs. In the present invention, the “cell in which the enzyme group is constitutively expressed” means a cell in which the target enzyme group is always expressed at a certain level without being regulated by environmental conditions. It means a cell in which the target enzyme group is constantly expressed even under environmental conditions in which the expression of the target enzyme group is suppressed in the cell.

  In the present invention, the “cell” may be any cell that has an acetoin metabolic enzyme and can efficiently produce acetoin as a result of rational modification of the intracellular metabolic system, such as microorganisms, animal cells, The type of plant cell is not limited. Preferably, a microorganism having an acetoin metabolic system can be used. The microorganism is preferably a bacterium, more preferably a Gram-positive bacterium. Gram-positive bacteria include Bacillus, Geobacillus, Lactobacillus, Lactococcus, Staphylococcus, Klebsiella, Streptococcus It is possible to use bacteria belonging to In particular, it is preferable to use bacteria belonging to the genus Bacillus, and it is more preferable to use Bacillus subtilis.

(Acetoin producing cells)
The acetoin-producing cell of the present invention has a deficient or reduced function of acetoin dehydrogenase, and constitutively expresses a group of enzymes that control synthesis of acetolactate from pyruvate and acetoin from acetolactate. Features.

  Acetoin dehydrogenase is an enzyme involved in a pathway for re-decomposing acetoin to produce acetyl-CoA. In the acetoin-producing cell of the present invention, the function of acetoin dehydrogenase is deficient or reduced, and the ability to consume acetoin accumulated outside the cell is deleted or reduced. Any means for deleting or reducing the function of acetoin dehydrogenase may be used, but means for destroying a gene encoding acetoin dehydrogenase is preferable. Specific examples of a gene encoding acetoin dehydrogenase include, for example, a gene consisting of the base sequence represented by SEQ ID NO: 1 (see acoA gene, NCBI-GI: 16077873, NC_000964.3) and a function equivalent to the gene. The gene which has is mentioned. As a gene having a function equivalent to the gene consisting of the base sequence represented by SEQ ID NO: 1, one or more (for example, 2 to 3) nucleotides in the base sequence represented by SEQ ID NO: 1 are substituted, deleted, A gene encoding a protein consisting of an inserted and / or added base sequence and having the activity of acetoin dehydrogenase can be mentioned.

  For example, in Bacillus subtilis, a series of genes called acoABCL operon is known as an acetoin re-degradation system that generates acetyl-CoA from acetoin when the carbon source is depleted (Fig. 1, Huang, M., Oppermann- Sanio, .FB., And Steinbuchel, A., J Bacteriol. 1999 Jun; 181 (12): 3837-3841). The acoABCL operon gene encodes each subunit constituting acetoin dehydrogenase. In Bacillus subtilis, any gene of the acoABCL operon may be disrupted to suppress the acetoin re-degradation system, but preferably a mutant strain in which the acoA gene is disrupted may be prepared. By suppressing the acetoin re-decomposition system, acetoin produced by acetoin-producing cells can be prevented from decreasing from the medium, and the amount of acetoin in the medium can be maintained.

  In the acetoin-producing cell of the present invention, in order to enhance the acetoin synthesis pathway itself, an enzyme group that synthesizes acetolactic acid from pyruvate and acetoin from acetolactic acid is constitutively expressed. The enzyme group that controls the synthesis of acetolactate from pyruvate and acetoin from acetolactate is an enzyme group including acetolactate synthase and acetolactate decarboxylase. These enzyme groups may be encoded by an operon, and examples of the operon include the alsSD operon. The means for constitutively expressing the enzyme group may be any means, but when the enzyme group is encoded by an operon, it is preferable to introduce a mutation that modifies the expression control system of the operon. The modification of the expression control system of the operon is exemplified by introducing a mutation into a control factor that controls the expression of the operon to make it a constitutively activated form. Preferably, the constitutively activated form of the control factor is It is introduced into the cell.

  As a specific example of a gene encoding a constitutively activated form of the regulatory factor, for example, in the base sequence represented by SEQ ID NO: 2 (see alsR gene, NC_000964.3), the 601st adenine (A) is guanine. (G) alsR1 gene having a base sequence replaced with (G) (ie, the alsR1 gene having a base sequence in which the 1028th thymine (T) in the base sequence of Non-Patent Document 3, FIG. 4 is replaced with cytosine (C)) ) And a gene having a function equivalent to that of the alsR1 gene. The gene having a function equivalent to that of the alsR1 gene comprises a nucleotide sequence in which one or more (for example, 2 to 3) nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence of SEQ ID NO: 2, Examples include a gene encoding a protein having a function as a constitutively activated form of an operon regulator. A specific example of a gene having a function equivalent to that of the alsR1 gene is the alsR8 gene. The alsR8 gene is a gene having a base sequence in which the 700th adenine (A) is replaced with cytosine (C) in the base sequence represented by SEQ ID NO: 2 (that is, the base sequence of Non-Patent Document 3, FIG. 4). AlsR8 gene having a base sequence in which the 929th thymine (T) is replaced with guanine (G).

  For example, in Bacillus subtilis, enzymes related to the acetoin synthesis pathway (acetolactic acid synthase and acetolactate decarboxylase) are expressed by the alsSD operon. Transcription of the alsSD operon is facilitated by binding of the regulator alsR to a specific sequence of the alsSD operon. alsR becomes activated by binding to a ligand, and acquires sequence-specific DNA binding ability. alsR becomes inactivated when binding to the ligand is released, and the expression of the alsSD operon stops. As a mutant protein of alsR, alsR1 (a protein encoded by the alsR1 gene, in which the threonine amino acid sequence (NCBI-GI: 16080655) is replaced with alanine at the 201st threonine) and alsR8 (alsR8 gene) And the like. These proteins are known as constitutively activated forms of alsR (Non-patent Document 3). . In order to constitutively express the alsSD operon in Bacillus subtilis, a constitutively activated regulator such as alsR1 or alsR8 may be introduced into the cell. A cell into which a constitutively activated regulator is introduced has an enhanced acetoin synthesis pathway, and therefore can produce acetoin with high efficiency.

  In the acetoin-producing cell characterized in that the function of acetoin dehydrogenase is deficient or reduced, and the enzyme group responsible for the synthesis of acetoin from pyruvate and acetolactate is constitutively expressed, While achieving a high acetoin conversion rate of 90% (molar ratio), even when cultured for a long time, the amount of acetoin in the medium continues to be maintained without re-degradation of acetoin. The glucose concentration in the medium for culturing such acetoin-producing cells is not particularly limited, but is high (2 to 10 w / v%, preferably 2 to 6 w / v%, more preferably 3 to 5 w / v%, Even when cultured in a medium containing glucose (preferably 4 w / v%), it has a high acetoin conversion rate. In a medium containing glucose at a high concentration, the cell viability itself may decrease due to an increase in osmotic pressure, but the acetoin-producing cells of the present invention can proliferate and survive.

  The present invention provides an acetoin characterized in that the function of acetoin dehydrogenase is deficient or reduced, and an enzyme group that synthesizes acetolactic acid from pyruvate and acetoin from acetolactic acid is constitutively expressed. The production cell further includes an acetoin production cell in which the function of at least one protein of phosphate acetyltransferase and lactate dehydrogenase is deficient or reduced.

  Phosphoryl acetyltransferase is an enzyme that catalyzes the reaction of synthesizing acetyl phosphate by transferring and adding a phosphate group from other molecules to acetyl CoA, and is an enzyme involved in acetic acid fermentation of acetyl CoA. In the acetoin producing cell of the present invention, the function of phosphotransferase is deficient or reduced. Any means may be used for deleting or reducing the function of phosphotransferase. However, a means for destroying a gene encoding phosphoacetyltransferase is preferable. Specific examples of a gene encoding a phosphoric acetyltransferase include a gene consisting of the nucleotide sequence represented by SEQ ID NO: 3 (see pta (phosphotransacetylase) gene, NCBI-GI: 16080818, NC_000964.3) and the gene Examples include genes having equivalent functions. As a gene having a function equivalent to the gene consisting of the base sequence represented by SEQ ID NO: 3, one or more (for example, 2 to 3) nucleotides in the base sequence represented by SEQ ID NO: 3 are substituted, deleted, Examples thereof include a gene encoding a protein consisting of an inserted and / or added base sequence and having an activity of phosphotransferase.

  Lactic acid dehydrogenase is an enzyme that catalyzes a reaction for synthesizing lactic acid from pyruvic acid, and is an enzyme involved in lactic acid fermentation of pyruvic acid. In the acetoin-producing cells of the present invention, the function of lactate dehydrogenase is deficient or reduced. Any means may be used for deleting or reducing the function of lactate dehydrogenase, but means for destroying a gene encoding lactate dehydrogenase is preferable. Specific examples of a gene encoding lactate dehydrogenase include, for example, a gene consisting of the nucleotide sequence represented by SEQ ID NO: 4 (see lct (L-lactate dehydrogenase) gene, NCBI-GI: 255767083, NC_000964.3) and A gene having a function equivalent to that of the gene can be mentioned. As a gene having a function equivalent to the gene consisting of the base sequence represented by SEQ ID NO: 4, one or more (for example, 2 to 3) nucleotides in the base sequence represented by SEQ ID NO: 4 are substituted, deleted, Examples thereof include a gene encoding a protein consisting of a base sequence inserted and / or added and having lactate dehydrogenase activity.

  Whether or not the target protein has activity as the above various enzymes and control factors, and whether or not the target gene encodes a protein having these activities, is a method known per se such as an enzymatic assay Can be confirmed.

  As an acetoin-producing cell of the present invention, specifically, the National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center (Tsukuba Center Chuo No. 6 1-1 Tsukuba, Ibaraki) The Bacillus subtilis mutant strain (named Bacillus subtilis MY05 strain) deposited at AP-22036 (Reception date: October 28, 2010) is exemplified.

  The present invention also includes an acetoin-producing cell characterized in that the functions of three proteins, acetoin dehydrogenase, phosphoacetyltransferase, and lactate dehydrogenase, are deficient or reduced.

  For example, in Bacillus subtilis, TCA cycle, lactic acid fermentation, acetoin fermentation, lactic acid fermentation, and the like are known as metabolic systems using saccharides such as glucose. For example, in a Bacillus subtilis mutant strain in which the lctE gene (a gene encoding lactate dehydrogenase) and / or the pta gene (a gene encoding phosphate acetyltransferase) is disrupted, lactic acid fermentation and / or acetate fermentation are suppressed. The supply of pyruvic acid as a raw material to acetoin synthesis is enhanced, and acetoin can be produced with high efficiency. In addition to the lctE gene and the pta gene, acetoin can be produced with high efficiency by using acetoin-producing cells in which the three genes of acetoin dehydrogenase (acoA gene) are disrupted. Acetoin continues to be maintained without decreasing.

  That is, 90% (molar ratio) of acetoin-producing cells characterized by lacking or reduced functions of three kinds of proteins, acetoin dehydrogenase, phosphoacetyltransferase, and lactate dehydrogenase While achieving a high acetoin conversion rate, even when cultured for a long time, the amount of acetoin in the medium is maintained without being re-degraded. The glucose concentration in the medium for culturing such acetoin-producing cells is not particularly limited, but is low (0.2 to 2 w / v%, preferably 0.2 to 1 w / v%, more preferably 0.4 w / v). (v%) is preferably cultured in a medium containing glucose.

(Method for producing acetoin-producing cells)
The acetoin-producing cell of the present invention can be prepared using a method for destroying a gene encoding a target enzyme and a method for introducing a gene encoding a target regulatory factor.

  Examples of the method for deleting or reducing the function of the target enzyme include a method for destroying a gene encoding the target enzyme, and a normal mutation method can be used. For example, in the physical and / or chemical mutagenesis treatment, in addition to physical mutation methods such as UV irradiation and radiation irradiation, nitrosoguanidine, ethyl methanesulfonate, nitrous acid, methyl methanesulfonate, acridine dye, benzopyrene, sulfuric acid Examples of the chemical mutation method include mixing of a mutation agent such as dimethyl. These mutation treatments are methods in which base insertions, deletions and / or substitutions are expected on genes. In the mutation treatment, as long as the gene is destroyed, one base may be inserted, deleted and / or substituted, and a plurality of bases may be inserted, deleted and / or substituted.

  Furthermore, as another artificial destruction method of the gene encoding the target enzyme, there is a method of inserting, deleting and / or replacing bases by homologous recombination. The homologous recombination method is a method in which a base sequence partially having the same sequence as that of a target gene artificially subjected to base insertion, deletion and / or substitution is introduced, and mutation is performed by homologous recombination. For example, nucleotide sequences inserted with drug resistance genes such as chloramphenicol resistance gene, kanamycin resistance gene, tetracycline resistance gene, erythromycin resistance gene, spectinomycin resistance gene, ampicillin resistance gene, hygromycin resistance gene, neomycin resistance gene And then selecting with a corresponding drug to obtain viable cells. Furthermore, it is possible to obtain a target cell by confirming that it has been inserted into a desired portion using a device such as PCR. In addition, “the function of the target enzyme or a gene encoding the target enzyme is artificially destroyed” means that the transcription of the gene is suppressed or the gene is encoded by, for example, introduction of mutation or homologous recombination. It means destroying the function of the protein.

  In the production of the cell of the present invention, in order to constitutively express the target protein, a method of introducing a gene encoding a regulatory factor that controls the expression of the target protein is exemplified. As a method for introducing a gene encoding the regulatory factor, a method known per se can be used.

  First, a gene encoding a target regulatory factor is obtained by introducing a mutation using a genomic DNA such as a microorganism as a template, or by synthesis. A method for obtaining a desired gene from genomic DNA such as a microorganism and a method for introducing a mutation into a gene are well known in the field of molecular biology. For example, when the gene sequence is known, a suitable genomic library can be prepared by restriction endonuclease digestion and screened using a probe complementary to the desired gene sequence. Once the sequence is isolated, the DNA can be amplified using standard amplification techniques such as the polymerase chain reaction (PCR) (US Pat. No. 4,683,202) to obtain a quantity suitable for transformation. In addition, methods such as preparation of genomic DNA library used for cloning, hybridization, PCR, preparation of plasmid DNA, DNA cleavage and ligation, transformation, etc. are described in Sambrook, J., Fritsch, EF, Maniatis, T., Molecular Cloning. , Cold Spring Harbor Laboratory Press, 1.21 (1989). The method for introducing a mutation into a gene is as described above.

  In the present invention, introduction of a gene encoding a target regulatory factor enhances the pathway for acetoin synthesis. Therefore, it is preferable to control the expression of a gene encoding a target regulatory factor with a strong promoter. For this purpose, for example, it is convenient to link a strong promoter or the like to a gene encoding a target regulatory factor. is there.

  Moreover, in order to select the strain | stump | stock in which the gene which codes the target regulatory factor was introduce | transduced, the gene used as a marker may be integrated in the vector. Examples of marker genes include genes related to auxotrophy such as amino acids and the above-mentioned drug resistance genes.

  A recombinant vector for producing the acetoin-producing cell of the present invention can be obtained by inserting the gene encoding the target regulatory factor into a vector replicable in the host cell. The vector to be used is not limited as long as it can replicate in the host cell. An E. coli or Bacillus subtilis shuttle vector is convenient.

  By introducing the recombinant vector of the present invention into a host cell, a transformant expressing the target regulatory factor can be obtained. The transformation method is not particularly limited, and examples thereof include an electric pulse method (Y. Kurusu et al., Agric. Biol. Chem. 54: 443-447 (1990)) and a method using calcium ions (Proc. Natl). Acad. Sci. USA, 69, 2110 (1972)), protoplast method (JP-A 63-2483942), electroporation method (Nucleic Acids Res., 16, 6127 (1988)), and the like. Electroporation is preferred.

  Cells into which a gene encoding the target regulatory factor has been introduced can also be prepared by a method by insertion into the genome using homologous recombination. The method by homologous recombination can be performed by inserting a gene encoding a target regulatory factor into a sequence homologous to the sequence on the genome and introducing this DNA fragment into the cell by electroporation to cause homologous recombination. . At the time of introduction into the genome, a strain having homologous recombination can be easily selected by using a DNA fragment linking a gene encoding a target regulatory factor and a drug resistance gene.

(Method for producing acetoin)
The present invention further includes a method for producing acetoin using the acetoin-producing cells of the present invention. The method for producing acetoin includes a step of culturing the acetoin-producing cells of the present invention in a medium containing a carbon source such as glucose. Furthermore, the method for producing acetoin of the present application preferably includes a step of removing cells from the culture filtrate obtained in the culturing step and a step of isolating acetoin from the culture filtrate from which the cells have been removed.

  The medium used in the present invention only needs to contain a carbon source that provides pyruvic acid via a glycolysis system, a hexose phosphate pathway, an Entner-Doudoroff pathway, and the like, and there is no particular limitation as long as the purpose is reached. Examples of the carbon source include saccharides and organic acids (glucose, malic acid, glycerol, sucrose, maltose, starch, etc.), preferably saccharides, and more preferably glucose. Further, the medium may be a medium containing a nitrogen source, an organic nutrient source, inorganic salts, etc. in addition to the carbon source, and either a synthetic medium or a natural medium can be used. The medium is preferably a culture solution (liquid medium).

  For example, it is preferable to use a culture medium formulated as follows. A saccharide (preferably glucose) is added as a carbon source in an amount of 0.1 w / v% to 10 w / v% with respect to the weight of the whole medium, and as a nitrogen source, soyton, casamino acid, peptone, tryptone, yeast extract, ammonium sulfate It is desirable to add 0.01 w / v% to 5.0 w / v%, preferably 0.5 w / v% to 2.0 w / v% of ammonium chloride, ammonium nitrate and / or urea.

  In addition, if necessary, inorganic salts capable of generating ions such as sodium, potassium, calcium, magnesium, cobalt, manganese, zinc, iron, copper, molybdenum, phosphoric acid and sulfuric acid can be added to the medium. . The amount of inorganic salt added can be arbitrarily determined by those skilled in the art.

  Although it is not necessary to adjust the hydrogen ion concentration in a culture medium, it can culture | cultivate by adjusting preferably to pH 5-10, more preferably pH 6-9.

  The culture conditions vary depending on the type of bacteria, but the culture temperature can be 12 to 45 ° C, preferably 15 to 37 ° C. In addition, the culture can be performed aerobically by shaking the medium (culture medium) or blowing air or oxygen gas into the medium (culture liquid). However, if the aeration rate is set too large, the amount of acetoin production may decrease, so it is desirable to limit the aeration rate to such an extent that growth does not decrease. The culture period may be performed until acetoin reaches a maximum or a necessary amount of accumulation, and is usually 1 to 7 days, preferably 1 to 2 days.

  The medium (culture liquid) after cell culture may contain not only acetoin but also other products (for example, 2,3-butanediol and the like). As a method for fractionating acetoin from the medium (culture solution), a method known per se or a method developed in the future can be applied. The fraction of acetoin may be purified according to the purpose, or may be fractionated as a mixture of acetoin and other desired products.

  For example, as a method for collecting acetoin from a medium, a general method for isolating and purifying a normal water-soluble neutral substance can be applied. That is, impurities other than acetoins can be almost removed by removing the cells from the medium and then treating the culture supernatant with activated carbon, ion exchange resin, or the like. Thereafter, the target substance can be isolated by using a method such as recrystallization.

Specifically, acetoin can be collected by the method of Examples described later. For example, a culture supernatant liquid in which acetoin is accumulated is used to remove a strongly acidic cation exchange resin such as duolite. Pass through a column packed with (registered trademark) C-20 (H ⁺ type) to collect the passing solution, then pass the deionized water through this column to wash and collect the washing solution, and combine the obtained passing solution and washing solution. To do. The solution thus obtained is passed through a column filled with a strongly basic anion exchange resin, for example, Duolite (registered trademark) A116 (OH ^- type), and the flow-through solution is collected. Thereafter, deionized water is passed through the column for washing. Then, the cleaning liquid is collected, and the obtained passing liquid and the cleaning liquid are combined to obtain an aqueous solution containing acetoins and almost no other impurities. When a suitable amount of ethanol is added to the concentrated solution of acetoin obtained by concentrating this aqueous solution and left overnight at room temperature or low temperature, pure acetoin crystals can be crystallized.

  Hereinafter, in order to deepen the understanding of the present invention, the contents of the invention will be specifically described with reference examples and examples, but it is needless to say that these do not limit the scope of the present invention.

(Reference Example 1) Production and culture of mutant strain 1 (ΔlctEΔpta) (1) As mutant strain 1 (ΔlctEΔpta), a strain having a genotype of lctE :: spec pta :: neo is produced stepwise as follows. did.
First, an lctE gene disruption strain was prepared. A pair of DNA primer lctE-F1 (5'-ttggagccaggtaaatgctt-3 '(SEQ ID NO: 5)) and lctE-R1 (5'-acaaaacccgctccgatta-3' (SEQ ID NO: 6)) using the chromosome of Bacillus subtilis 168 as a template, And about 500 bp DNA fragments by PCR amplification with lctE-F2 (5'-tcgcaggtatcactgagctg-3 '(SEQ ID NO: 7)) and lctE-R2 (5'-gcaatgctggaccgaataat-3' (SEQ ID NO: 8)) Two species were obtained. The former corresponds to the adjacent region upstream of the lctE gene, and the latter corresponds to the adjacent region downstream of the lctE gene. On the other hand, using the chromosome of FU341 strain (Yoshida, K., Fujita, Y., & Ehrlich, SD (1999)., J. Bacteriol. 181, 6081-6091) as a template, primer lctE-spec-F (5'- A DNA fragment containing a spectinomycin resistance gene was obtained by PCR amplification with a pair of taatcggagcgggttttgtcaataacgctattgggag-3 '(SEQ ID NO: 9) and lctE-spec-R (5'-cagctcagtgatacctgcgactatatgctccttctggc-3' (SEQ ID NO: 10)). When PCR amplification is performed using a mixture of the above three types of DNA fragments as a template and using a pair of primers lctE-F1 and lctE-R2, lctE-spec-F and lctE-spec-R each have lctE- A sequence complementary to R1 and lctE-F2 is added on the 5 ′ side, and a long DNA fragment in which three fragments are linked is obtained. 168 strains of Bacillus subtilis were transformed using this DNA fragment, and a mutant exhibiting resistance to 50 μg / ml spectinomycin was selected as an lctE gene disruption strain.

  Next, a pta gene disruption strain was prepared. A pair of DNA primers pta-F1 (5'-atccattgtgcggaaatcat-3 '(SEQ ID NO: 11)) and pta-R1 (5'-ccctatttatagacgctgtggctcgtctaagccttcagga-3' (SEQ ID NO: 12)) using the chromosome of Bacillus subtilis 168 as a template, DNA fragments of about 500 bp each by PCR amplification with a pair of pta-F2 (5'-gagccatcagcctaaagaagttcaagaggatgtaacgctgaa-3 '(SEQ ID NO: 13)) and pta-R2 (5'-gccttggcttgttcgtagag-3' (SEQ ID NO: 14)) Two species were obtained. The former corresponds to the adjacent region upstream of the pta gene, and the latter corresponds to the adjacent region downstream of the pta gene. On the other hand, primer pta-neo-F (5'-) was prepared using the chromosome of FU340 strain (Yoshida, K., Fujita, Y., & Ehrlich, SD (1999)., J. Bacteriol. 181, 6081-6091) as a template. A DNA fragment containing a neomycin-resistant gene was obtained by PCR amplification with a pair of gttggctgtttgaatttgattggaattccggcacagcgtctataaataggg-3 '(SEQ ID NO: 15) and pta-neo-R (5'-aatacaaaaaccccacccctggatccgcgcttctttaggctgatggctc-3' (SEQ ID NO: 16)). When PCR amplification is performed using a mixture of the above three DNA fragments as a template and a pair of primers pta-F1 and pta-R2, pta-neo-F and pta-R1, pta-neo-R and pta In -F2, sequences complementary to each other are added on the 5 ′ side, and a long DNA fragment in which three fragments are linked is obtained. 168 strains of Bacillus subtilis were transformed using this DNA fragment, and mutants resistant to 15 μg / ml neomycin were selected and used as pta gene disrupted strains.

  Using the chromosome extracted from the pta gene-disrupted strain, the lctE gene-disrupted strain was transformed, and the mutant strains that acquired resistance to both 50 μg / ml spectinomycin and 15 μg / ml neomycin were selected. did.

(2) By culturing mutant strain 1, the ability of mutant strain 1 to produce acetoin was confirmed.
Mutant 1 was shaken and cultured overnight at 37 ° C and 180 rpm in 5 ml LB liquid medium (1.0 w / v% Bacto Tryptone, 1.0 w / v% Bacto Yeast Extract, 1.0 w / v% NaCl). This was precultured. The main culture was performed as follows. The medium after the pre-culture was mixed with 50 ml of the main culture medium (Soytone medium; 1.0 w / v% Bacto Soytone, 0.5 w / v% Bacto Yeast Extract, 1.0 w / v% NaCl, 0.4 w / v% glucose) was diluted and mixed so that the cell turbidity OD ₆₀₀ = 0.050. Thereafter, the cells were cultured with shaking at 37 ° C. and 150 rpm. The Erlenmeyer flask was capped with a silicone stopper to minimize the exchange of air inside and outside.

(3) The concentration of acetoin in the medium was measured according to a known method (Grundy, FJ, Waters, DA, Takova, TY & Henkin, TM (1993)., Mol. Microbiol. 10 (2). 259-271. ). Briefly, 500 μl of the main culture medium (culture solution) is transferred to a 1.5 ml microtube, centrifuged (4 ° C., 21,900 × g, 1 min) to recover the supernatant, and the supernatant with distilled water. A sample solution diluted 200 times was used as a sample solution. Add 0.2 ml of 2.5 N NaOH aqueous solution containing 5% α-naphthol and 0.2 ml of 0.5% creatine aqueous solution to 1 ml of sample solution, mix well, and incubate at room temperature for 1 hour, and then measure OD ₅₄₀ . A calibration curve was prepared using an acetoin sample with a known concentration, and the acetoin concentration was calculated.

  The results are shown in FIG. Mutant 1 was found to produce more acetoin than the wild strain. Moreover, although the amount of acetoin in a culture medium increased temporarily, it turned out that it reduces gradually from about 12 hours after culture | cultivation. It was found that the conversion rate (molar ratio) of glucose to acetoin was increased by about 30% in the mutant strain 1 compared to the wild strain.

Reference Example 2 Production of Mutant 2 (ΔacoA) (1) As mutant 2 (ΔacoA), a strain having a genotype of acoA :: cat was produced as follows.
A pair of DNA primers acoA-F1 (5'-gctgaaaaagcgcctatgag-3 '(SEQ ID NO: 17)) and acoA-R1 (5'-ttgtgcgcctccttctatttt-3' (SEQ ID NO: 18)) using the chromosome of Bacillus subtilis 168 as a template, And about 500 bp DNA fragments by PCR amplification with acoA-F2 (5'-gaaaaagccgtctcgttcag-3 '(SEQ ID NO: 19)) and acoA-R2 (5'-cgccgaacatataacggaat-3' (SEQ ID NO: 20)) Two species were obtained. The former corresponds to the adjacent region on the upstream side of the acoA gene, and the latter corresponds to the adjacent region on the downstream side of the acoA gene downstream. On the other hand, primer acoA-cat-F (5 ') using the chromosome of FU342 strain (Yoshida, K., Fujita, Y., & Ehrlich, SD (1999)., J. Bacteriol. 181,6081-6091.) As a template. -Anatagaaggaggcgcacaagattggagctgatgtcac-3 '(SEQ ID NO: 21)) and acoA-cat-R (5'-ctgaacgagacggctttttcgaacctacctctcctcaa-3' (SEQ ID NO: 22)) PCR amplification with a pair of DNA fragments containing the chloramphenicol resistance gene It was. When PCR amplification is performed using a mixture of the above three DNA fragments as a template and primers acoA-F1 and acoA-R2, acoA-cat-F and acoA-cat-R are respectively acoA-R1 and acoA-cat-R. A sequence complementary to acoA-F2 is added on the 5 ′ side, and a long DNA fragment in which three fragments are linked is obtained. Using this DNA fragment, 168 strains of Bacillus subtilis were transformed to select a mutant exhibiting resistance to 10 μg / ml chloramphenicol.

(2) Using mutant 2, preculture and main culture were performed in the same manner as in Reference Example 1 (2), and the acetoin concentration in the medium was measured by the same method as in Reference Example 1 (3).

  The results are shown in FIG. Compared to the wild type, mutant 2 did not decrease acetoin in the medium even after culturing for 12 hours or more.

Example 1 Production of Acetoin Producing Cell 1 (ΔacoAΔlctEΔpta) As acetoin producing cell 1 (ΔacoAΔlctEΔpta), a strain having a genotype of acoA :: cat lctE :: spec pta :: neo was produced. The acetoin-producing cell 1 is obtained from the mutant 1 (lctE :: spec pta :: neo) prepared in Reference Example 1 using the chromosomal DNA of the mutant 2 (acoA :: cat) prepared in Reference Example 2. It was prepared by performing transformation and selecting mutants that acquired resistance to all of 10 μg / ml chloramphenicol, 50 μg / ml spectinomycin, and 15 μg / ml neomycin.

(Example 2) Production of acetoin The acetoin-producing cells 1 obtained in Example 1 were cultured to produce acetoin.
First, main culture was performed by pre-culture and a medium containing 0.4 w / v% glucose by the same method as in Reference Example 1 (2). In addition, after pre-cultured in the same manner as in Reference Example 1 (2), the main culture was treated with high-concentration glucose-added Soytone medium (Soytone medium supplemented with 3.6 w / v% glucose) at 4 w / v% glucose. The culture was performed in the same manner as in Reference Example 1 (2) except that it was used as a medium containing.

  The acetoin concentration was measured by the same operation as in Reference Example 1 (3). In addition, when Soytone medium supplemented with high-concentration glucose was used for the main culture, an appropriately diluted supernatant of the medium (culture solution) was used as a sample solution for acetoin concentration measurement.

The results are shown in FIGS. In the case of a medium containing 0.4 w / v% glucose, the amount of acetoin reaches almost the maximum in 8 hours after culturing in the wild type, and gradually decreases after 12 hours. The amount of acetoin continued to increase until about 12 hours later, and then did not decrease until 48 hours. The conversion rate (molar ratio) of acetoin-producing cell 1 from glucose achieved 90%.
In the case of a medium containing 4 w / v% glucose, the amount of acetoin gradually increases in the wild type, but the amount of acetoin produced by acetoin-producing cells 1 reaches a maximum at 24 hours after culturing, and then 96 hours. No change was seen until later.

(Reference Example 3) Production of Mutant 3 (ΔalsR1) (1) As mutant 3 (ΔalsR1), a strain with a genotype of amyE :: cat, Pspac-alsR1 was placed in the amyE region of the Bacillus subtilis chromosome in an E. coli plasmid. It was prepared by introducing the DNA strand obtained from pCRE-test-alsR1 by homologous recombination. Specifically, it was produced as follows.
First, in the preparation of pCRE-test-alsR1, primers alsR1-F1 (5'-cgc ggatcc atggagcttcgccatcttcaa-3 '(SEQ ID NO: 23)) and alsR1-R1 (5'-catgtatagagcaggccatgc-3 '(SEQ ID NO: 24)) as well as alsR1-F2 (5'-gcatggcctgctctatacatg-3' (SEQ ID NO: 25)) and alsR1-R2 (5'-cgc ggatcc tgtacctgcatcactctcttt-3 '(SEQ ID NO: 26)) PCR amplification was performed to amplify the 5 'fragment (approx. 600 bp) and 3' fragment (approx. 300 bp) in the ORS of alsR (the underlined part in the primer sequence is the restriction enzyme recognition) Shows the sequence). When PCR amplification is performed using a mixture of each PCR fragment as a template and a pair of primers alsR1-F1 and alsR1-R2, alsR1-R1 and alsR1-F2 are complementary to each other, and the ORF of alsR The alsR allele (alsR1) is amplified because it has a complementary sequence from residues 592 to 612 and is designed to have a point mutation in which the adenine at residue 601 becomes guanine. A vector plasmid pCRE-test (Miwa, Y., Nakata, A., Ogiwara, A., Yamamoto, M. & Fujita, Y. (2000). Nucleic. Acids. Res. 28, 1206-1210.). A point mutation at residue 601 of the alsR1 ORF was confirmed by determining the nucleotide sequence, and designated pCRE-test-alsR1.
168 strains of Bacillus subtilis were transformed with the DNA strand obtained by treating the pCRE-test-alsR1 with PstI, and one of the 10 μg / ml chloramphenicol resistant strains was designated as mutant 3. .

(2) Culture of mutant strain 3 and measurement of acetoin concentration in the medium were performed in the same manner as in Example 2 using a medium containing 4 w / v% glucose for main culture.

  The results are shown in FIG. In the wild strain, the amount of acetoin gradually increased until 96 hours after the culture. On the other hand, in the mutant strain 3, the acetoin conversion rate (molar ratio) from glucose at 90 hours after culturing was 90%, but it was found that the amount of acetoin decreased thereafter.

(Example 3) Production of acetoin-producing cell 2 (alsR1ΔacoA) (1) As acetoin-producing cell 2 (alsR1ΔacoA), a strain having a genotype of amyE :: tet, Pspac-alsR1 acoA :: cat was produced as follows. did.
Mutant strain 3 (amyE :: cat, Pspac-) obtained in Reference Example 3 using pCm :: Tc (Steinmetz, M. & Richter, R. (1994). Gene. 142, 79-83) DNA. alsR1) was transformed to obtain a mutant strain that was resistant to 12.5 μg / ml tetracycline and sensitive to 10 μg / ml chloramphenicol (the chloramphenicol resistance gene on the chromosome was replaced with a tetracycline resistance gene). . The resulting tetracycline resistant strain was transformed with the chromosomal DNA of mutant strain 2 (acoA :: cat) obtained in Reference Example 2 to obtain both 12.5 μg / ml tetracycline and 10 μg / ml chloramphenicol. One of the strains that became resistant was designated as acetoin-producing mutant cell 2 (named Bacillus subtilis MY05 strain).

(Example 4) Production of acetoin In the same manner as in Reference Example 3 (2), acetoin-producing cells 2 were cultured in a medium containing 4 w / v% glucose to produce acetoin. Measurement of the concentration of acetoin in the medium was carried out in the same manner as in Reference Example 3 (2).

  The results are shown in FIG. In acetoin-producing cell 2, acetoin production increased until 96 hours after culturing. It was found that the amount of acetoin decreased after 96 hours in mutant 3 (ΔacoA), whereas the decrease in the amount of acetoin was suppressed in acetoin-producing cell 2.

(Example 5) Production of acetoin-producing cells 3 (alsR1ΔacoAΔlacE) and 4 (alsR1ΔacoAΔpta) As acetoin-producing cells 3 (alsR1ΔacoAΔlacE), a strain having a genotype of amyE :: tet, Pspac-alsR1 acoA :: cat lctE :: spec Was prepared as follows. Using the chromosome extracted from the lctE gene disruption strain prepared in Reference Example 1, acetoin-producing mutant cells 2 were transformed, and 12.5 μg / ml tetracycline, 10 μg / ml chloramphenicol, 50 μg / ml spectinomycin One of the strains that became resistant to both was designated as acetoin-producing mutant cell 3.
As acetoin-producing cells 4 (alsR1ΔacoAΔpta), a strain having a genotype of amyE :: tet, Pspac-alsR1 acoA :: cat pta :: neo was prepared as follows. Using the chromosome extracted from the pta gene disruption strain prepared in Reference Example 1, acetoin-producing mutant cells 2 were transformed into any of 12.5 μg / ml tetracycline, 10 μg / ml chloramphenicol, and 10 μg / ml neomycin. One of the strains that became resistant to this was designated as acetoin-producing mutant cell 4.

  The cell of the present invention can produce acetoin inexpensively and efficiently in the cell using glucose as a raw material. In addition, the acetoin production method of the present invention using such cells is simple because acetoin can be produced in one step. The obtained acetoin is useful as an intermediate for diacetyl and 2,3-butanediol in addition to being applicable as a food additive and a cosmetic raw material.

That is, this invention consists of the following.
1. An acetoin-producing cell in which the function of acetoin dehydrogenase is deficient or reduced, and an enzyme group that synthesizes acetolactic acid from pyruvate and acetoin is constitutively expressed.
2. 2. The acetoin-producing cell according to item 1 above, wherein the gene encoding the enzyme group forms a single operon.
3. The deficiency or reduction in the function of acetoin dehydrogenase is due to the artificial destruction of the gene encoding acetoin dehydrogenase, and the constitutive expression of the enzyme group is related to the operon expression control system. 3. The acetoin-producing cell according to item 2 above, which is caused by introducing a mutation that modifies the acetoin.
4). An acetoin-producing cell in which the functions of three proteins, acetoin dehydrogenase, phosphate acetyltransferase, and lactate dehydrogenase are deficient or reduced.
5. A gene that encodes acetoin dehydrogenase, a gene that encodes acetoin dehydrogenase, which is deficient or reduced in function of the three proteins of acetoin dehydrogenase, phosphate acetyltransferase, and lactate dehydrogenase, 5. The acetoin-producing cell according to item 4, wherein the acetoin-producing cell is obtained by artificially destroying three kinds of genes that encode lactate dehydrogenase.
6). 4. The acetoin-producing cell according to any one of items 1 to 3, wherein the function of at least one protein of phosphoric acetyltransferase and lactate dehydrogenase is deficient or reduced.
7). Among the genes encoding phosphoric acid acetyltransferase and lactate dehydrogenase, the loss or reduction of the function of at least one protein is a gene encoding phosphate acetyltransferase, and a gene encoding lactate dehydrogenase, 7. The acetoin-producing cell according to item 6 above, which is due to artificial destruction of at least one gene.
8). 8. The cell according to any one of 1 to 7 above, wherein the cell is a bacterium belonging to the genus Bacillus.
9. 9. The cell according to item 8 above, wherein the cell is a Bacillus subtilis mutant strain having a deposit number of FERM P-22036 (reception date: October 28, 2010).
10. 10. A method for producing acetoin, comprising a step of culturing the cell according to any one of items 1 to 9 in the presence of glucose.
11. 10. A method for producing acetoin, comprising a step of culturing the cell according to any one of 1 to 3 and 6 to 9 in the presence of 1 to 10 w / v% glucose.
12 9. A method for producing acetoin, comprising a step of culturing the cell according to any one of items 4, 5, and 8 in the presence of 0.2 to 2 w / v% glucose.
13. 13. The acetoin production method according to any one of items 10 to 12, further comprising a step of isolating acetoin from the culture filtrate obtained in the culturing step.

As acetoin-producing cells of the present invention, specifically, to the National Institute of Advanced Industrial Science and Technology Patent Organism Depositary Center (Yubinbango305-8566 Higashi, Tsukuba, Ibaraki, 1-1-1 Tsukuba Central 6), accession number FERM The Bacillus subtilis mutant strain (named Bacillus subtilis MY05) deposited at P-22036 (Reception date: October 28, 2010) is exemplified.

Claims (13)

An acetoin-producing cell in which the function of acetoin dehydrogenase is deficient or reduced, and an enzyme group that synthesizes acetolactic acid from pyruvate and acetoin is constitutively expressed. The acetoin-producing cell according to claim 1, wherein the gene encoding the enzyme group forms a single operon. The deficiency or reduction in the function of acetoin dehydrogenase is due to the artificial destruction of the gene encoding acetoin dehydrogenase, and the constitutive expression of the enzyme group is related to the operon expression control system. The acetoin-producing cell according to claim 2, wherein the acetoin-producing cell is derived from introduction of a mutation to be modified. An acetoin-producing cell in which the functions of three proteins, acetoin dehydrogenase, phosphate acetyltransferase, and lactate dehydrogenase are deficient or reduced. A gene that encodes acetoin dehydrogenase, a gene that encodes acetoin dehydrogenase, which is deficient or reduced in function of the three proteins of acetoin dehydrogenase, phosphate acetyltransferase, and lactate dehydrogenase, The acetoin-producing cell according to claim 4, wherein the acetoin-producing cell is obtained by artificially destroying three kinds of genes encoding a lactate dehydrogenase and a gene encoding lactate dehydrogenase. Furthermore, the acetoin producing cell according to any one of claims 1 to 3, wherein a function of at least one protein of phosphate acetyltransferase and lactate dehydrogenase is deficient or reduced. Among the genes encoding phosphoric acid acetyltransferase and lactate dehydrogenase, the loss or reduction of the function of at least one protein is a gene encoding phosphate acetyltransferase, and a gene encoding lactate dehydrogenase, The acetoin-producing cell according to claim 6, which is caused by artificially destroying at least one gene. The cell according to any one of claims 1 to 7, wherein the cell is a bacterium belonging to the genus Bacillus. The cell according to claim 8, wherein the cell is a Bacillus subtilis mutant strain having a receipt number of FERM AP-22036 (reception date: October 28, 2010). The acetoin manufacturing method including the process of culture | cultivating the cell of any one of Claims 1-9 in presence of glucose. A method for producing acetoin, comprising a step of culturing the cell according to any one of claims 1 to 3 and 6 to 9 in the presence of 1 to 10 w / v% glucose. A method for producing acetoin, comprising a step of culturing the cell according to any one of claims 4, 5, and 8 in the presence of 0.2 to 2 w / v% glucose. The method for producing acetoin according to any one of claims 10 to 12, further comprising a step of isolating acetoin from the culture filtrate obtained in the culturing step.