JP2012070757A - Immunostimulatory sequence oligonucleotide and method for using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide immunomodulatory polynucleotides and methods for immunomodulation of individuals using the immunomodulatory polynucleotides.SOLUTION: The immunomodulatory polynucleotide is composed of more than 10 bases, and comprises: (a) a palindromic sequence comprising at least two CG dinucleotides, wherein the CG dinucleotides are separated by 0, 1, 2, 3, 4 or 5 bases and the palindromic sequence has a base composition of more than one-third As and Ts, and at least 8 bases in length; and (b) a (TCG), (wherein y is 1 or 2, wherein the 5' T of the (TCG)is positioned 0, 1, 2 or 3 bases from the 5' end of the polynucleotide) and wherein the (TCG)is separated from the 5' end of the palindromic sequence by 0, 1, or 2 bases.

Description

  The present invention relates to immunomodulatory polynucleotides. The invention also relates to the administration of the polynucleotide to modulate the immune response.

  The type of immune response that occurs against an infection or other antigen exposure can generally be characterized by a subset of helper T (Th) cells associated with this response. The Th1 subset contributes to classical cell-mediated functions such as late-type hypersensitivity and cytotoxic T lymphocyte (CTL) activation, whereas the Th2 subset is a helper for B cell activation As it works more effectively. The type of immune response to an antigen is generally affected by cytokines produced by cells that are responding to the antigen. Differences in cytokines secreted by Th1 and Th2 cells are thought to reflect the different biological functions of these two subsets. See, for example, Romagnani, Ann. Allergy Asthma Immunol., 85: 9-18 (2000).

  Th1 subsets are IL-2 and IFN- that activate CTL? This may be particularly suitable for responses to viral infections, intracellular pathogens, and tumor cells. The Th2 subset may be more suitable for response to free-living bacteria and parasites, as IL-4 and IL-5 are known to induce IgE production and eosinophil activation, respectively, and May mediate allergic reactions. In general, Th1 and Th2 cells secrete cytokines in distinct patterns, and one such reaction type can modulate the activity of the other reaction type. Th1 / Th2 balance bias can lead to an allergic reaction, for example, or alternatively, an increased CTL response.

  For many infectious diseases such as tuberculosis and malaria, the Th2-type response has little protective value against infection. Proposed vaccines that use small peptides derived from target antigens and other currently used antigenic substances to avoid the use of complete viral particles with possible infection achieve therapeutic effects It does not always elicit the necessary immune response. The lack of a therapeutically effective human immunodeficiency virus (HIV) vaccine is an unfortunate example of this drawback. Protein-based vaccines typically induce a Th2-type immune response, which is characterized by high titer neutralizing antibodies without significant cell-mediated immunity.

  In addition, some types of antibody responses are inappropriate in certain indications, most notably allergies where IgE antibody responses cause anaphylactic shock. In general, allergic reactions are also associated with Th2-type immune reactions. Allergic reactions, such as allergic asthma, occur within seconds to minutes after allergen exposure and are characterized by premature reactions characterized by cell degranulation, and 4-24 hours after allergen exposure, and eosinophils It is characterized by a delayed response characterized by infiltration into the allergen-exposed site. More specifically, early in the allergic reaction, allergens cross-link with IgE antibodies on basophils and mast cells, which in turn trigger degranulation and subsequently from mast cells and basophils. Triggers the release of histamine and other inflammatory mediators. During the late response period, eosinophils infiltrate the site of allergen exposure (where tissue damage and dysfunction occur).

Antigen immunotherapy for allergic disorders is small, but involves subcutaneous injection of increasing amounts of antigen. Such immunization treatments are at risk of inducing IgE-mediated anaphylaxis and do not effectively address cytokine-mediated events of late allergic reactions.
So far, this method has had very limited success.

Administration of certain DNA sequences, commonly known as immunostimulatory sequences, induces a Th1-type biased immune response as indicated by secretion of Th1-related cytokines. Administration of an immunostimulatory polynucleotide and an antigen results in a Th1-type immune response against the administered antigen. Roman et al., Nature Med, 3: 849-854 (1997). For example, mice injected intradermally with Escherichia coli β-galactosidase (β-Gal) in saline or adjuvant alum, specific IgG1 and IgE antibodies, and IL-4 and IL-5 It reacts by producing CD4 ⁺ cells that secrete but not IFN-γ, indicating that this T cell is predominant in the Th2 subset. However, mice injected intradermally with plasmid DNA (in saline) that encodes β-Gal and contains an immunostimulatory sequence (or by a tyne skin abrasion applicator) secreted IgG2a antibody as well as IFN-γ but IL -4 and IL-5 respond by producing nonsecreting CD4 ⁺ cells, indicating that these T cells are predominantly Th1 subset. Furthermore, specific IgE production by mice injected with this plasmid DNA was reduced by 66-75%. Raz et al., Proc. Natl. Acad Sci. USA, 93: 5141-5145 (1996). In general, the response to naked DNA immunization is characterized by the production of IL-2, TNFα and IFN-γ by antigen-stimulated CD4 ⁺ T cells, suggesting a Th1-type response. This is particularly important in the treatment of allergies and asthma, as shown by a decrease in IgE production. The ability of immunostimulatory polynucleotides to stimulate Th1-type immune responses has been demonstrated by bacterial antigens, viral antigens and allergens (see, eg, WO98 / 55495).

  References describing the immunostimulatory activity of polynucleotides include: Krug et al. (2001) Eur. J. Immunol. 31: 3026; Bauer et al. (2001) J. Immunol. 166: 5000; Klinman et al. 1999) Vaccine 17: 19; Jahn-Schmid et al. (1999) J. Allergy Clin. Immunol. 104: 1015; Tighe et al. (2000) Eur. J. Immunol. 30: 1939; Shirota et al. (2000 ) J. Immunol. 164: 5575; Klinman et al. (1999) Infect. Immun. 67: 5658; Sur et al. (1999) J. Immunol. 162: 6284; Magone et al. (2000) Eur. J. Immunol. 30: 1841; Kawarada et al. (2001) J. Immunol. 167: 5247; Kranzer et al. (2000) Immunology 99: 170; Krug et al. (2001) Eur. J. Immunol. 31: 2154; Hartmann et al. (2000) J. Immunol. 164: 944; Bauer et al. (1999) Immunology 97: 699; Fujieda et al. (2000) Am. J. Respir. Crit. Care Med. 162: 232; Krieg (2002) Annu. Rev. Immunol. 20: 709; Verthelyi et al. (2002) J. Immunol. 168: 1659; Hornung et al. (2002) J. Immunol. 168: 4531; Yamamoto et al. (2000) Springer Semin. Immunopathol. 22: 35; Lee et al. (2000) J. Immuno l. 165: 3631; Gursel et al. (2002) J. Leukoc. Biol. 71: 813; Gursel et al. (2002) Eur. J. Immunol. 32: 2617; Broide et al. (2001) J. Clin Immunol. 21: 175; Zhu et al. (2001) Immunology 103: 226; Klinman et al. (2002) Microbes Infect. 4: 897; Hartmann et al. (2000) J. Immunol. 164: 1617; Krieg ( 1999) Biochim. Biophys. Acta 1489: 107; Dalpke et al. (2002) Immunology 106: 102; Yu et al. (2002) Biochem. Bioplzys. Res. Commun. 297: 83; Hafner et al. (2001) CancerRes 61: 5523; Zwaveling et al. (2002) J. Immunol. 169: 350; Davis et al. (2000) Vaccine 18: 1920; Gierynska et al. (2002) J. Virol. 76: 6568; Lipford et al. (2000) J. Immunol. 165: 1228; Freidag et al. (2000) Infect. Immun. 68: 2948; Dieudonne et al. (2001) J. Allergy Clin. Immunol. 107: S233.

  Other references describing immunostimulatory sequences include Krieg et al. (1989) J. Immunol. 143: 2448-2451; Tokunaga et al. (1992) Microbiol. Imnzunol. 36: 55-66; Kataoka et al. (1992) Jpn. J. Cancer Res. 83: 244-247; Yamamoto et al. (1992) J. Immunol. 148: 4072-4076; Mojcik et al. (1993) Clin. Immuno. And Imnzunopathol. 67: 130- 136; Branda et al. (1993) Biochem. Pharmacol. 45: 2037-2043; Pisetsky et al. (1994) Life Sci. 54 (2): 101-107; Yamamoto et al. (1994a) Antisense Research and Development. 4: 119-122; Yamamoto et al. (1994b) Jpn. J. Cancer Res. 85: 775-779; Raz et al. (1994) Proc. Natl. Acad. Sci. USA 91: 9519- 9523; Kimura et al. (1994) J. Biochem. (Tokyo) 116: 991-994; Krieg et al. (1995) Nature 374: 546-549; Pisetsky et al. (1995) Ann. NY Acad. Sci. 772: 152- 163; Pisetsky (1996a) J. Immunol. 156: 421-423; Pisetsky (1996b) Immunity 5: 303-310; Zhao et al. (1996) Biochem. Pharmacol. 51: 173-182; Yi et al. (1996 ) J. Immunol. 156: 558-564; Ki-ieg (1996) Trends Microbiol. 4 (2): 73-76; Krieg et al. (1996) Antisense Nucleic Acid DrugDev. 6: 133-139; Klinman et al. (1996) Proc. Natl. Acad. Sci. USA. 93: 2879-2883; Raz et al. (1996) ; Sato et al. (1996) Science 273: 352-354; Stacey et al. (1996) J. Immunol. 157: 2116-2122; Ballas et al. (1996) J. Immunol. 157: 1840-1845; Branda et al. (1996) J. Lab. Clin. Med. 128: 329-338; Sonehara et al. (1996) J. Interferon and Cytokine Res. 16: 799-803; Klilunan et al. (1997) J. Immunol 158: 3635-3639; Sparwasser et al. (1997) Eur. J. Immunol. 27: 1671-1679; Roman et al. (1997); Carson et al. (1997) J. Exp. Med. 186: 1621 -1622; Chace et al. (1997) Clin. Immunol. And lininunopathol. 84: 185-193; Chu et al. (1997) J. Exp. Med. 186: 1623-1631; Lipford et al. (1997a) Eur J. Immunol. 27: 2340-2344; Lipford et al. (1997b) Eur. J. Immunol. 27: 3420-3426; Weiner et al. (1997) Proc. Natl. Acad. Sci. USA 94: 10833- 10837; Macfarlane et al. (1997) Immunology 91: 586-593; Schwartz et al. (1997) J. Clin. Invest. 100: 68-73; Stein et al (1997) Antisense Technology, Ch. 11 pp. 241-264, C. Lichtenstein and W. Nellen, Eds., IRL Press; Wooldridge et al. (1997) Blood 89: 2994-2998; Leclerc et al. (1997 ) Cell. Immunol. 179: 97-106; Kline et al. (1997) J. Invest. Med. 45 (3): 282A; Yi et al. (1998a) J. Immunol. 160: 1240-1245; Yi et al. (1998b) J. Immunol. 160: 4755-4761; Yi et al. (1998c) J. Immunol. 160: 5898-5906; Yi et al. (1998d) J. Immunol. 161: 4493-4497; Krieg (1998) Applied Antisense Oligonucleotide Technology Ch. 24, pp. 431-448, CA Stein and AM Krieg, Eds., Wiley- Liss, Inc .; Krieg et al. (1998a) Trends Microbiol. 6: 23-27; Krieg et al. (1998b) J. Immunol. 161: 2428-2434; Krieg et al. (1998c) Proc. Natl. Acad. Sci. USA 95: 12631-12636; Spiegelberg et al. (1998) Allergy 53 (45S) : 93-97; Horner et al. (1998) Cell Immunol. 190: 77-82; Jakob et al. (1998) J. Immunol. 161: 3042-3049; Redford et al. (1998) J. Immunol. 161 : 3930-3935; Weeratna et al. (1998) Antisense & Nucleic Acid Drug Development 8: 351-356; MCCluskie et al. (1998) J. Immunol. 161 (9): 4463-4466; Gramzinski et al. (1998) Mol. Med. 4: 109-118; Liu et al. (1998) Blood 92: 3730-3736 Moldoveanu et al. (1998) Vaccine 16: 1216-1224; Brazolot Milan et al. (1998) Proe. Natl. Acad. Sci. USA 95: 15553-15558; Briode et al. (1998) J. Immunol. 161 : 7054-7062; Briode et al. (1999) Int. Arch. Allergy ImmunoL 118: 453-456; Kovarik et al. (1999) J. Immunol. 162: 1611-1617; Spiegelberg et al. (1999) Pediatr. Pulmonol. Suppl. 18: 118-121; Martin-Orozco et al. (1999) Int. Immunol. 11: 1111-1118; EP 468, 520; WO 96/02555; WO 97/28259; WO 98/16247; WO WO 98/37919; WO 98/40100; WO 98/52581; WO 98/55495; WO 98/55609 and WO 99/11275. See also Elkins et al. (1999) J. Immunol. 162: 2291-2298, WO 98/52962, WO 99/33488, WO 99/33868, WO 99/51259 and WO 99/62923. See also Zimmermann et al. (1998) J. Immunol. 160: 3627-3630; Krieg (1999) Trends Microbiol. 7: 64-65 and US Pat. Nos. 5,663,153, 5,723,335 and 5,849,719. See also Liang et al. (1996) J. Clin. Invest. 98: 1119-1129; Bohle et al. (1999) Eur. J. Immunol. 29: 2344-2353 and WO 99/56755. WO 99/61056; WO 00/06588; WO 00/16804; WO 00/21556; WO 00/54803; WO 00/61151; WO 00/67023; WO 00/67787 as well as US Pat. No. 6,090, 791 See Manzel et al. (1999) Antisense Nucl. Acid Drug Dev. 9: 459-464; Verthelyi et al. (2001) J. Immunol. 166: 2372-2377; WO 01/15726; WO 01/12223; WO 01 / WO 01/35991; WO 01/51500; WO 01/54720; U.S. Patent Nos. 6,174, 872, 6,194,388, 6,207,646, 6,214,806, 6,218,371, 6,239,116 See WO 01/12804; WO 01/45750; WO 01/55341; WO 01/55370; WO 01/62207; WO 01/68077; WO 01/68078; WO 01/68103; WO 01/68116; WO 01 WO 01/68143; WO 01/68144; WO 01/72123; WO 01/76642; WO 01/83503; WO 01/93902; WO 02/026757; WO 02/052002; WO 02/069369; WO 02 / 074922; See also US Pat. Nos. 6,339,068, 6,406,705, 6,426,334, 6,426,336, 6,429,199, and 6,476,000.

Immunomodulatory polynucleotides usually include a CG sequence. Nucleotides adjacent to the IMP's CG also appear to play a role in the immunomodulatory activity of the polynucleotide.
There is a continuing need to identify immune prepared polynucleotides.

  All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.

  The present invention relates to immunomodulatory polynucleotides (IMPs) and methods of using these polynucleotides to modulate immune responses in individuals, particularly humans.

  In one aspect, the present invention provides immunomodulatory polynucleotides. In certain embodiments, the invention includes a composition comprising any of the immunomodulatory polynucleotides described herein. The composition may also include, for example, any of a pharmaceutically acceptable excipient or a number of other ingredients, such as an antigen.

In one aspect, the immunomodulatory polynucleotide of the invention is (a) a palindromic sequence comprising at least two CG dinucleotides, wherein the CG dinucleotide is 0, 1, 2, 3, 4 or 5 A palindromic sequence that is separated by bases and the palindromic sequence is at least 8 bases in length; and (b) (TCG) _y (where y is 1 or 2 and 5 ′ of (TCG) _y T is 0, 1, 2 or 3 bases from the 5 ′ end of the polynucleotide, and (TCG) _y is 0, 1, or 2 bases away from the 5 ′ end of the palindromic sequence). Comprising. In some of the immunoregulatory polynucleotides of the invention described in this paragraph or in this application, the palindromic sequence has a base composition of G and C, less than 2/3. In some embodiments, the palindromic sequence has a base composition of A and T greater than 1/3.

In another aspect, the immunomodulatory polynucleotide of the present invention is (a) a palindromic sequence comprising at least two CG dinucleotides, wherein the CG dinucleotide is 0, 1, 2, 3, 4 or 5 A palindromic sequence that is separated by bases and the palindromic sequence is at least 8 bases in length; and (b) (TCG) _y (where y is 1 or 2 and 5 in the (TCG) _y sequence) 'T is located at 0, 1, 2 or 3 bases from the 5 ′ end of the polynucleotide, and (TCG) _y sequence is 0, 1, or 2 bases away from the 5 ′ end of the palindromic sequence) comprises the further wherein the palindromic sequence of (a) includes all or part of the (TCG) _y sequence, and (TCG) _y sequence of CG is CG dinucleotides of the palindromic sequence of (a) It may be one of out.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (X 1 X 2 CGX 2 'X 1' (CG) p) z ( SEQ ID NO: 156) wherein N is a nucleoside, x = 0-3, y = 1-4, w = -2, −1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides and, the 5'T of (TCG (N _{q)) y} sequence the 5 'end of the polynucleotide in 0-3 bases); and (b) at least 8 bases a palindromic sequence of length , (X ₁ X ₂ CGX ₂ 'X ₁ ' (CG) _p ) a palindromic sequence comprising the first (X ₁ X ₂ CGX ₂ 'X ₁ ') of the _z sequence , Comprising. In some embodiments, X ₁ and X ₂ are each either A or T.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (X 1 X 2 CGX 3 X 3 'CGX 2' X 1 '(CG _P ) _z (SEQ ID NO: 159) (where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2) , P = 0 or 1, q = 0, 1 or 2, and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, and X ₂ and X ₂ ′ are self Complementary nucleosides, X ₃ and X ₃ ′ are self-complementary nucleosides, and 5′T of the (TCG (N _q )) _y sequence is 0-3 bases from the 5 ′ end of the polynucleotide. And (b) a palindromic sequence having a length of at least 10 bases, wherein (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ '(CG) _{p Z} (SEQ ID NO: 217) comprising a palindromic sequence comprising the first (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ ') (SEQ ID NO: 216) of the sequence. In some embodiments, when p = 1, X ₁ , X _2, and X ₃ are each either A or T. In some embodiments, when p = 0, at least two of X ₁ , X _2, and X ₃ are either A or T.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (X 1 X 2 X 3 X 4 X 5 CGX 5 'X 4' X _{3 'X 2' X 1 '} (CG) p) z ( SEQ ID NO: 160) (where, N is a nucleoside, a x = 0 to 3, a y = 1~4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1 to 20, X ₁ and X ₁ ′ are self-complementary X ₂ and X ₂ ′ are self-complementary nucleosides, X ₃ and X ₃ ′ are self-complementary nucleosides, X ₄ and X ₄ ′ are self-complementary nucleosides, X ₅ and X ₅ ′ is a self-complementary nucleoside, and 5′T of the (TCG (N _q )) _y sequence is 0-3 bases from the 5 ′ end of the polynucleotide); and Beauty (b) at least 12 bases a palindromic sequence _{length, (X 1 X 2 X 3} X 4 X 5 CGX 5 'X 4' X 3 'X 2' X 1 '(CG) p) z (SEQ ID NO: 219) sequence the first of _{(X 1 X 2 X 3 X} 4 X 5 CGX 5 'X 4' X 3 'X 2' X 1 ') ( SEQ ID NO: 218) and comprising at palindromic sequence, the Comprising. In some embodiments, at least three of X ₁ , X _2, X ₃ , X ₄ , and X ₅ are either A or T.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (CGX 1 X 1 'CG (CG) p) z ( SEQ ID NO: 161) (Where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1; q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, and 5′T of the (TCG (N _q )) _y sequence is poly 5 nucleotides 'in 0-3 bases from the end); and (b) at least 8 bases a palindromic sequence _{length, (CGX 1 X 1' CG} (CG) p) first of _z sequence A palindromic sequence comprising (CGX ₁ X ₁ 'CG).

In another aspect, the immunomodulatory polynucleotide of the present invention comprises (a) 5′-N _x (TCG (N _q )) _y N _w (X ₁ CGCGGX ₁ ′ (CG) _p ) _z (SEQ ID NO: 162) ( Where N is a nucleoside, x = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 and z = 1 to 20, X ₁ and X ₁ ′ are self-complementary nucleosides, and 5′T of the (TCG (N _q )) _y sequence is 5 of the polynucleotide. 'end from one to 0-3 bases); and (b) at least 8 bases a palindromic sequence _{length, (X 1 CGCGX 1' (} CG) p) z sequences first of (X ₁ CGCGX ₁ ') A palindromic sequence comprising a sequence.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (X 1 X 2 CGCGX 2 'X 1' (CG) p) z ( SEQ ID NO: 163) wherein N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides and, the 5'T of (TCG (N _{q)) y} sequence the 5 'end of the polynucleotide in 0-3 bases); and (b) at least 8 bases a palindromic sequence of length _{, (X 1 X 2 CGCGX 2} 'X 1' (CG) p) z ( SEQ ID NO: 220) sequence the first of _{(X 1 X 2 CGCGX 2 '} X 1' The comprising at palindromic sequence comprises. In some embodiments, X ₁ and X ₂ are each either A or T.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (X 1 X 2 X 3 CGCGX 3 'X 2' X 1 '(CG _P ) _z (SEQ ID NO: 164) (where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1 to 20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ 'Is a self-complementary nucleoside, X ₃ and X ₃ ' are self-complementary nucleosides, and 5'T of the (TCG (N _q )) _y sequence is 0-3 from the 5 'end of the polynucleotide. in base); and (b) a palindromic sequence at least 10 bases in _{length, (X 1 X 2 X 3} CGCGX 3 'X 2' X 1 '( G) _{p) z} (SEQ ID NO: 222) first _{(X 1 X 2 X 3 CGCGX} 3 'X 2' sequences X ₁ ') (SEQ ID NO: 221) and comprising at palindromic sequence comprises. In some embodiments, when p = 1, X ₁ , X _2, and X ₃ are either A or T. In some embodiments, when p = 0, at least two of X ₁ , X _2, and X ₃ are either A or T.

In another aspect, the immunomodulatory polynucleotide of the _{invention, (a) 5'-N x} (TCG (N q)) y N w (CGX 1 X 2 X 2 'X 1' CG (CG) p) z (SEQ ID NO: 165) (where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2 and p = 0. Or 1, q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, and X ₂ and X ₂ ′ are self-complementary nucleosides. And (TCG (N _q )) _y sequence 5′T is 0-3 bases from the 5 ′ end of the polynucleotide); and (b) a palindromic sequence of at least 8 bases in length. _{Te, (CGX 1 X 2 X 2} 'X 1' CG (CG) p) z ( SEQ ID NO: 223) sequence the first of _{(CGX 1 X 2 X 2 '} X 1' CG The comprising at palindromic sequence comprises. In some embodiments, X ₁ and X ₂ are each either A or T.

  In another aspect, the present invention provides a method of modulating an individual's immune response, comprising administering to the individual an amount of the immunomodulatory polynucleotide of the present invention sufficient to modulate said individual's immune response. A method comprising: The immunomodulation according to the method of the present invention can be applied to individuals suffering from disorders associated with Th2-type immune responses (eg allergies, allergy-induced asthma or atopic dermatitis), therapeutic vaccines (eg allergy epitopes, mycobacterial epitopes). Or vaccines containing tumor-associated epitopes) or prophylactic vaccines, and individuals, including individuals with cancer and individuals with infections.

  In a further aspect, the present invention provides a method for increasing interferon-gamma (IFN-γ) in an individual comprising administering to said individual an effective amount of an immunomodulatory polynucleotide of the present invention, I will provide a. Administration of the immunomodulatory polynucleotides of the invention increases IFN-γ in the individual.

  In another aspect, the present invention relates to a method of increasing interferon-alpha (IFN-α) in an individual comprising administering to said individual an effective amount of an immunomodulatory polynucleotide of the present invention, I will provide a. Administration of the immunomodulatory polynucleotides of the invention increases IFN-α in the individual.

  In another aspect, the invention is a method of ameliorating one or more symptoms of an infection, comprising administering an effective amount of an immunomodulatory polynucleotide of the invention to an individual having the infection. Method. Administration of the immunomodulatory polynucleotides of the invention ameliorates one or more symptoms of the infection.

  In another aspect, the present invention is a method of ameliorating one or more symptoms of an IgE-related disorder, comprising administering an effective amount of an immunomodulatory polynucleotide of the present invention to an individual having an IgE-related disorder. A method comprising: Administration of the immunomodulatory polynucleotides of the invention ameliorates one or more symptoms of IgE-related disorders.

  The invention further relates to a kit, preferably a kit for performing the method of the invention. The kits of the invention typically comprise an immunomodulatory polynucleotide of the invention (usually in a suitable container) and may further comprise instructions for the use of the immunomodulatory polynucleotide in immunomodulation of the individual.

FIG. 1 is a graph showing the amount (pg / ml) of IFN-α produced from human PBMC in response to changes in the amount of four different IMPs: SEQ ID NOs: 1, 27, 113 and 172. FIG. 2 includes a graph representing NK cytolytic activity stimulated with IMP.

The present inventors have discovered immunomodulatory polynucleotides and methods for modulating immune responses in individuals, particularly humans, using these immunomodulatory polynucleotides.
The composition of the invention comprises an immunomodulatory polynucleotide as described herein. The immunomodulatory polynucleotide of the present invention comprises: a) a palindromic sequence of at least 8 bases in length comprising at least one CG dinucleotide; and b) at least one TCG trinucleotide at or near the 5 ′ end of said polynucleotide, including.

  The inventor has discovered that the immunomodulatory polynucleotides of the present invention efficiently modulate immune cells, eg, human cells, in a variety of ways. The inventor is able to effectively stimulate the production of cytokines, such as type I interferons, such as IFN-α and IFN-ω, and IFN-γ, from human cells. The inventor has also discovered that the immunomodulatory polynucleotides of the present invention can effectively stimulate B cells to proliferate. The inventors have observed that some of the immunoregulatory polynucleotides of the present invention activate plasmacytoid dendritic cells to undergo maturation. The inventor has also observed that the presence of some of the immunoregulatory polynucleotides of the invention can lead to a delay in the apoptosis of plasmacytoid dendritic cells in culture.

  The present invention also provides a method of modulating an individual's immune response, wherein the method comprises modulating an immune modulatory polynucleotide of the present invention to said individual. Further provided is a kit comprising the IMP of the present invention. The kit may further comprise instructions for administering the immunomodulatory polynucleotide of the present invention for immunomodulation of the subject and the immunomodulatory polynucleotide.

General Techniques The practice of the present invention, unless otherwise stated, is within the skill of the art and includes the usual biology of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology. Will use technology. Such techniques are explained fully in the literature, such as the Molecular Cloning: A Laboratory Manual, 2nd edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, 1984); Animal Cell Culture (Edited by RI Freshney, 1987); Handbook of Experimental Immunology (edited by DM Weir and CC Blackwell); Gene Transfer Vectors for Mammalian Cells (edited by JM Miller and MP Calos, 1987); Current Protocols in Molecular Biology (edited by FM Ausubel et al., 1987) ); PCR: The Polymerase Chain Reaction (edited by Mullis et al., 1994); Current Protocols in Immunology (edited by JE Coligan et al., 1991); The Immunoassay Handbook (edited by D. Wild, Stockton Press NY, 1994); Bioconjugate Techniques (Gr For example, edited by T. Hermanson, Academic Press, 1996); and Methods of Immunological Analysis (edited by R. Masseyeff, WH Albert, and NA Staines, Weinheim: VCH Verlags gesellschaft, 1993).

Definitions As used herein, the singular forms “a (an)” and “the” include plural meanings unless the context clearly dictates otherwise. For example, an “an” IMP includes one or more IMPs.

  The terms `` polynucleotide '' and `` oligonucleotide '' used interchangeably in this specification are single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded RNA (ssRNA), and double-stranded RNA. (dsRNA), modified oligonucleotides and oligonucleotides or combinations thereof. The oligonucleotide may be linear or circular in shape, or the oligonucleotide can include both linear and circular segments. Oligonucleotides are generally polymers of nucleosides linked through phosphodiester linkages, but alternative linkages, such as phosphorothioate esters, can also be used in oligonucleotides. A nucleoside consists of a purine (adenine (A) or guanine (G) or derivative thereof) or pyrimidine (thymine (T), cytosine (C) or uracil (U), or derivative thereof) base linked to a sugar. Is done. The four nucleoside units (or bases) in DNA are called deoxyadenosine, deoxyguanosine, deoxythymidine, and deoxycytidine. A nucleotide is a phosphate ester of a nucleoside.

  The term “immunomodulatory polynucleotide” or “IMP” as used herein affects and / or contributes to a measurable immune response as measured in vitro, in vivo and / or ex vivo. Means a polynucleotide. Examples of measurable immune responses include, but are not limited to, lymphocyte populations such as antigen-specific antibody production, cytokine secretion, NK cells, CD4 + T lymphocytes, CD8 + T lymphocytes, B lymphocytes, etc. Including activation or expansion. Preferably, the IMP sequence preferentially activates a Th1-type reaction.

  The term “immunomodulation” or “modulate immune response” as used herein includes immunosuppressive effects in addition to immunostimulatory effects. Immunomodulation is a major qualitative change in the overall immune response, but quantitative changes can also occur with immune modulation. The immune response immunomodulated according to the present invention is the opposite of the “Th2-type” immune response, biased towards the “Th1-type” immune response. Th1-type reactions are typically considered cellular immune system (eg, cytotoxic lymphocyte) reactions, whereas Th2-type reactions are generally “humoral” or antibody-based. A Th1-type immune response is usually characterized by a “delayed-type hypersensitivity” response to an antigen, and IFN-γ, IFN-α, IL-2, IL-12, and TNF-β, as well as IL-6 Although increased levels of Th1-related cytokines such as can be detected at the biochemical level, IL-6 can also be associated with Th2-type responses. Th1-type immune responses are generally associated with the production of cytotoxic lymphocytes (CTLs) and low or transient production of antibodies. Th2-type immune responses are generally associated with relatively high levels of antibody production, including IgE production, absence or minimization of CTL production, and even the expression of Th2-related cytokines such as IL-4. Thus, the immunomodulation of the present invention can be recognized, for example, by an increase in IFN-γ and / or a decrease in IgE production in an individual treated with the method of the present invention as compared to no treatment.

  The term “3 ′” generally refers to a region or position of a polynucleotide or oligonucleotide 3 ′ (downstream) from another region or position of the same polynucleotide or oligonucleotide. The term “3 ′ end” means the 3 ′ end of a polynucleotide.

  The term “5 ′” generally refers to a region or position of a polynucleotide or oligonucleotide 5 ′ (upstream) from another region or position of the same polynucleotide or oligonucleotide. The term “5 ′ end” means the 3 ′ end of a polynucleotide.

  A region, part or sequence “adjacent” to another sequence is in direct contact with that region, part or sequence. For example, additional polynucleotide sequences (eg, TCG trinucleotides) that are adjacent to a particular portion of an immunomodulatory polynucleotide are in direct contact with that region.

  The term “palindromic sequence” or “palindromic” means an inverted nucleic acid sequence, for example ABCDD′C′B′A ′, where bases such as A and A ′, B And B ′, C and C ′, D and D ′ can form Watson-Crick base pairs. Such a sequence may be single-stranded, may form a double-stranded structure, or may form a hairpin loop structure depending on conditions. For example, as used herein, “8-base palindrome” means a nucleic acid sequence whose palindrome sequence is 8 bases in length, eg, ABCDD′C′B′A ′. The palindromic sequence may be part of a polynucleotide that also includes non-palindromic sequences. A polynucleotide may comprise one or more palindromic sequence portions and one or more non-palindromic sequence portions. Alternatively, the polynucleotide sequence may be entirely palindromic. In a polynucleotide having one or more palindromic sequence portions, the palindromic sequence portions may overlap each other, or the palindromic sequence portions may not overlap each other.

  The term “conjugate” means a complex in which an IMP and an antigen are linked. Such ligation linkages include covalent and / or non-covalent linkages.

  The term “antigen” refers to a substance that is specifically recognized and bound by an antibody or T cell antigen receptor. Antigens include peptides, proteins, glycoproteins, polysaccharides, glycoconjugates, carbohydrates, gangliosides, lipids, and phospholipids; some of them and combinations thereof. These antigens are found in nature or can be synthesized. Antigens suitable for administration with IMP include molecules capable of inducing a B cell or T cell antigen specific response. The antigen preferably induces an antibody reaction specific for the antigen. Haptens are included within the scope of “antigen”. Haptens are low molecular weight compounds that are not themselves immunogenic, but become immunogenic when complexed with an immunogenic molecule containing an antigenic determinant. Small molecules may need to be haptenized to be antigenic. Preferably, antigens of the present invention include peptides, lipids (eg, sterols, fatty acids, and phospholipids), polysaccharides such as those used in hemophilus influenza vaccines, gangliosides and glycoproteins.

  “Adjuvant” means a substance that, when added to an immunogenic substance such as an antigen, non-specifically enhances or enhances the immune response to the substance in the recipient host when exposed to this mixture.

  The term “peptide” refers to polypeptides and compositions of sufficient length that affect a biological response, such as antibody production or cytokine activity, regardless of whether the peptide is a hapten. Typically, a peptide comprises a length of at least 6 amino acid residues. The term “peptide” further includes modified amino acids (whether natural or non-natural), including but not limited to phosphorylation, glycosylation, PEGylation, lipidation and Methylation is included.

  An “antigenic peptide” includes purified natural peptides, synthetic peptides, recombinant proteins, crude protein extracts, attenuated or inactivated viruses, cells, microorganisms, or fragments of such peptides. it can. Thus, “antigenic peptide” or “antigenic polypeptide” means all or part of a polypeptide that exhibits one or more antigenic properties. Thus, for example, an “Amb a 1 antigenic polypeptide” or “Amb a 1 polypeptide antigen” is an amino acid sequence derived from Amb a 1 that is either the entire sequence, a portion of the sequence, and / or a modification of the sequence. Which exhibits antigenic properties (ie, specifically binds to antibodies or T cell receptors).

  A “delivery molecule” or “delivery carrier” is a chemical moiety that facilitates, allows, and / or enhances delivery of an immunomodulatory polynucleotide to a specific site and / or for a specific time. The delivery carrier may or may not further stimulate an immune response.

“Allergic reaction to an antigen” generally refers to an immune response characterized by the production of eosinophils and / or antigen-specific IgE and their consequent action. As is well known in the art, IgE binds to IgE receptors on mast cells and basophils. Upon subsequent exposure to an antigen recognized by IgE, this antigen cross-reacts with IgE on mast cells and basophils, resulting in degranulation of these cells, which includes histamine release, It is not limited.
The terms “allergic reaction to an antigen”, “allergy”, and “allergic condition” are understood and intended to be equally suitable for some applications of the methods of the invention. Furthermore, it is understood and intended that the methods of the present invention include those that are equally suitable for the treatment of pre-existing allergic conditions in addition to preventing allergic reactions.

  As used herein, the term “allergen” means an antigen or antigenic portion of a molecule, usually a protein, that induces an allergic reaction upon subject exposure. Typically, the subject is allergic to allergens, as indicated, for example, by either wheal and redness tests or methods known in the art. Even if only a small subset of subjects develop an allergic (eg, IgE) immune response upon exposure to the molecule, the molecule is referred to as an allergen. Many isolated allergens are known in the art. These include, but are not limited to, those presented in Table 1 of this application.

  The term “desensitization” refers to the process of administering increasing amounts of allergen to a susceptible subject. Examples of allergen dosages used for desensitization are known in the art, see, for example, Fornadley's paper (Otolaryngol. Clin. North Am., 31: 111-127 (1998)).

  “Antigen-specific immunotherapy” means an immunotherapy that is associated with an antigen and that results in antigen-specific modulation of the immune response. In the context of allergies, antigen-specific immunotherapy includes, but is not limited to, desensitization therapy.

  The term “microcarrier” is insoluble in water and has a size of less than about 150, 120 or 100 μm, preferably less than about 50-60 μm, preferably less than about 10 μm, preferably less than about 5, 2.5, 2 or 1.5 μm. A particulate composition having the following meaning. Microcarriers include “nanocarriers”, which are microcarriers having a size of less than about 1 μm, preferably less than about 500 nm. Microcarriers include solid phase particles, such as particles formed from biocompatible natural polymers, synthetic polymers or synthetic copolymers, but microcarriers formed from agarose or cross-linked agarose, as well as other such carriers. Biocompatible materials known in the art may or may not be included in the definition of microcarriers herein. Microcarriers for use in the present invention are biodegradable or non-biodegradable. Non-biodegradable solid-phase microcarriers are polymers or other materials that are non-corrosive and / or non-degradable under physiological conditions in mammals such as polystyrene, polypropylene, silica, ceramics, polyacrylamide, gold, latex, hydroxy Formed from apatite, dextran and ferromagnetic and paramagnetic materials. Biodegradable solid-phase microcarriers are degradable polymers (e.g. poly (lactic acid), poly (glycolic acid) and copolymers thereof) or corrosive polymers (e.g. 3,9-diethylidene) under physiological conditions in mammals. Can be formed from poly (orthoesters such as -2,4,8,10-tetraoxaspiro [5.5] undecane (DETOSU), or poly (anhydrides) such as poly (anhydrides) sebacate) Microcarriers are also in the liquid phase without antigen (eg oil or lipid based), eg liposomes, ISCOMs (immunostimulatory complexes, which are stable complexes of cholesterol, phospholipids and adjuvant-active saponins) Or it can be a droplet or micelle found in an oil-in-water or water-in-oil emulsion.The biodegradable liquid phase microcarriers typically include squalene and vegetable oils. Is mixed with biodegradable oils known in the art Microcarriers are typically spherical, but microcarriers deviating from spheres are acceptable (eg, oval, rods, etc.). Microcarriers are filterable from water and water-based (aqueous) solutions because of their insoluble nature (with respect to water).

  The term “non-biodegradable” as used herein applies to microcarriers that are not degraded or corroded under normal mammalian physiological conditions. In general, a microcarrier is non-biodegradable if it is not degraded after incubation in normal human serum at 37 ° C. for 72 hours (ie, if less than 5% of its mass or average polymer length is lost). Is considered.

  A microcarrier is considered “biodegradable” if it is degradable or corrosive under normal mammalian physiological conditions. In general, a microcarrier is biodegradable if it degrades after incubation in normal human serum at 37 ° C. for 72 hours (ie, when at least 5% of its mass or average polymer length is lost). Is considered.

  The “size” of the microcarrier is generally the “design size” or the intended size of the particles presented by the manufacturer. The size is a directly measured dimension, such as the average or maximum diameter, or can be determined by an indirect assay such as a filtration screening assay. Direct measurement of microcarrier size is typically performed with a microscope, generally an optical microscope or a scanning electron microscope (SEM), and compared to particles of known size or micrometer. Since small variations in size occur during the manufacturing process, a microcarrier is considered nominal size if the measured value indicates that the microcarrier is nominal measured value ± about 5-10%. The size characteristics can also be determined by dynamic light scattering or obscuration techniques. Alternatively, the microcarrier size can be determined by a filtration screening assay. At least 97% of the particles are on the surface of a filter, such as a polycarbonate filter or polysulfone filter, as opposed to a nominal size “screen” filter (ie, a “depth filter” that retains a particle lodge within the filter). The microcarrier is less than the nominal size. A microcarrier is larger than the nominal size when at least about 97% of the microcarrier particles are retained by a nominal size screen filter. Accordingly, at least about 97% of the microcarriers from about 10 μm to about 10 nm pass through the 10 μm pore screen filter and are retained on the 10 nm screen filter.

  As suggested by the previous discussion, the microcarrier size or size range is extrapolated to include approximate variations and estimates of the nominal size and / or size range. This is reflected by the use of the term “about” when referring to size and / or size range, and for a size or size range that does not mention “about” the size and / or size range is accurate. It doesn't mean that.

  The term “immunomodulatory polynucleotide / microcarrier complex” or “IMP / MC complex” means a complex of IMP and microcarrier. The components of the complex can be linked covalently or non-covalently. Non-covalent linkages can be mediated by any of non-covalent forces including hydrophobic interactions, ionic (electrostatic force) bonds, hydrogen bonds and / or van der Waals attractions. In the case of a hydrophobic linkage, this linkage is generally via a hydrophobic moiety (eg, cholesterol) covalently linked to the IMP.

  An “individual” includes vertebrates such as birds, and is preferably a mammal, more preferably a human. Mammals include, but are not limited to, humans, primates, livestock, hunting animals, rodents and pets.

  An “effective amount” or “sufficient amount” of a substance is an amount sufficient to affect a beneficial or desired result, including clinical results, and an “effective amount” depends on the circumstances in which it is applied. Determined. In the context of administering a composition that modulates an immune response to a co-administered antigen, an effective amount of an immunomodulatory polynucleotide and antigen is such as compared to the immune response obtained when the antigen is administered alone. An amount sufficient to achieve accommodation. An effective amount can be administered in a single or repeated dose.

  The term “simultaneous administration” as used herein means administering at least two different substances in a time sufficiently close to modulate the immune response. Preferably co-administration means co-administration of at least two different substances.

  “Stimulation” of a response or parameter includes inducing and / or enhancing the response or parameter. For example, “stimulation” of an immune response, such as a Th1 response, means an increase in response that can result from the induction and / or enhancement of the response. Similarly, “stimulation” of a cytokine or cell type (eg, CTL) means an increase in the amount or level of the cytokine or cell type. “Stimulation” of B cells includes, for example, enhanced B cell proliferation, induction of B cell activation and / or increased production of cytokines such as IL-6 and / or TNF-α from stimulated B cells. , Is included.

  An “IgE-related disorder” is a physiological condition characterized by elevated IgE levels that can be, in part, persistent or non-persistent. IgE-related disorders include allergies and allergic reactions, allergy-related disorders (described below), asthma, rhinitis, atopic dermatitis, conjunctivitis, urticaria, shock, bee venom (Hymenoptera sting) allergy, and drug allergies, and Including but not limited to parasitic infections. This term further relates to the manifestation of these disorders. In general, IgE in such disorders is antigen specific.

  “Allergy related disorder” means a disorder resulting from the action of an antigen-specific IgE immune response. Such effects can include, but are not limited to, hypotension and shock. Anaphylaxis is an example of an allergy-related disorder, during which histamine released into the circulating blood causes increased capillary permeability in addition to vasodilation, resulting in significant loss of plasma from the circulating blood Produce. Anaphylaxis can occur systemically so that related effects are experienced throughout the body, and can occur locally so that the reaction is limited to a particular target tissue or organ.

  As used herein, the term “viral disease” applies to diseases that have a virus as its etiological agent. Examples of viral diseases include hepatitis B, hepatitis C, influenza, acquired immune deficiency syndrome (AIDS), and shingles.

  A “treatment” as used herein and well understood in the art is a method of obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results for the purposes of the present invention include reduction or recovery of one or more symptoms, either detectable or undetectable, disappearance of disease extent, disease stabilization (i.e. , Not exacerbating) conditions, prevention of disease spread, slowing or slowing of disease progression, recovery or alleviation of disease state, and remission (either partial or complete), but are not limited to these. “Treatment” also means prolonging survival as compared to expected survival if not receiving treatment.

  “Relieving” a disease or disorder reduces the degree of the disease or disorder state and / or the development of undesirable clinical symptoms and / or delays or lengthens the time course of progression compared to not treating the disease. Means that. As is well understood by those skilled in the art, particularly in allergic situations, relaxation may occur during the modulation of the immune response to the allergen. Furthermore, relaxation does not necessarily occur with a single dose, but often occurs with a series of doses. Thus, an amount sufficient to alleviate the response or disorder can be administered in a single or repeated dose.

  “Antibody titer” or “antibody amount” that is “induced” by an immunomodulatory polynucleotide and antigen refers to the amount of antibody produced that is measured at a given time after administration of the immunomodulatory polynucleotide and antigen.

  A “Th1-related antibody” is an antibody whose production and / or increase is associated with a Th1 immune response. For example, IgG2a is a mouse Th1-related antibody. For purposes of the present invention, the Th1-related antibody measurement may be a measurement of one or more such antibodies. For example, in humans, measurements of Th1-related antibodies necessarily involve measurements of IgG1 and / or IgG3.

  A “Th2-related antibody” is an antibody whose production and / or increase is associated with a Th2 immune response. For example, IgG1 is a mouse Th2-related antibody. For the purposes of the present invention, the Th2-related antibody measurement may be a measurement of one or more such antibodies. For example, in humans, measurements of Th2-related antibodies necessarily involve measurements of IgG2 and / or IgG4.

“Suppressing” or “inhibiting” a function or activity, eg, cytokine production, antibody production, or histamine release, other than the condition or parameter of interest, otherwise compared to the same condition or otherwise It is to reduce function or activity compared to conditions.
For example, an immunomodulatory polynucleotide that suppresses histamine release and a composition containing an antigen reduces histamine release compared to, for example, histamine release induced by the antigen alone. As another example, an immunomodulatory polynucleotide that suppresses antibody production and a composition containing an antigen reduces the extent and / or level of the antibody, for example, as compared to the extent and / or level of the antibody produced by the antigen alone. .

  A “serum protein” is a protein normally found in the serum of disease-free mammals, particularly disease-free cattle. The most common serum protein is serum albumin.

  As used herein, the term “comprising” and its homologs are used in their generic meaning; that is, equivalent to the term “including” and the equivalent homologs.

Compositions of the Invention The present invention provides immunoregulatory sequences (IMPs) for modulating an individual's immune response. The composition of the present invention may comprise an immunomodulatory polynucleotide alone (or a combination of two or more immunomodulatory polynucleotides), or another immunomodulator, such as a peptide, an antigen (discussed below) and / or an additional adjuvant. Comprised of comprising. The composition of the invention can comprise an immunomodulatory polynucleotide and a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients including buffering agents are well known in the art. Remington's “The Science and Practice of Pharmacy” 20th edition, Mack Publishing (2000).

Upon administration, a composition comprising an antigen, an immunomodulatory polynucleotide of the invention, and optionally an adjuvant leads to an enhanced immune response to the antigen, resulting in a composition comprising IMP and antigen alone. Produces an enhanced immune response. Adjuvants are known in the art and include, but are not limited to, oil-in-water emulsions, water-in-oil emulsions, alum (aluminum salts), liposomes, and polystyrene, starch, polyphosphazenes and polylactide / polyglycosides. Including but not limited to microparticles. Still other suitable adjuvants are MF59, DETOX® (Ribi), squalene mixture (SAF-1), muramyl peptide, saponin derivative, mycobacterium cell wall preparation, monophosphoryl lipid A, mycolic acid derivative, Nonionic block copolymer surfactants, Quil A, cholera toxin B subunits, polyphosphazenes and derivatives, and immune stimuli such as those described in Takahashi et al. (Nature, 344: 873-875 (1990)) In addition to conjugates (ISCOMs), including but not limited to lipid-based adjuvants and others described herein.
For veterinary applications and antibody production in animals, the Freund's adjuvant (both complete and incomplete) mitogenic components can be used.

  The IMPs of the invention can also be combined with other therapies for specific indications. For example, in addition to IMP, the compositions of the present invention may include antimalarial drugs such as chloroquine for malaria patients, leishmaniacidal drugs such as pentamidine and / or allopurinol for leishmaniasis patients, and isoniazid for tuberculosis patients. It may comprise an anti-macrobacterial drug such as rifampin and / or ethambutol, or an allergen desensitizer in the case of atopic (allergic) patients.

  As described herein, the compositions of the present invention may include IMP and include one or more additional immunotherapeutic agents (ie, acting through and / or derived from the immune system) Substance), such as, but not limited to, cytokines, adjuvants and antibodies. Examples of therapeutic antibodies are those used in connection with cancer (eg, anti-tumor antibodies). For example, what is mentioned later is included.

Immunomodulatory polynucleotides The immunomodulatory polynucleotides of the invention comprise at least one palindromic sequence (ie, palindrome) that is at least 8 bases in length comprising at least one CG dinucleotide. The IMP also includes at least one TCG trinucleotide sequence at or near the 5 ′ end of the polynucleotide (ie, 5′-TCG). In some cases, the palindromic sequence includes all or part of 5′-TCG.

  IMP is easily identified using standard assays described in the art and showing various aspects of the immune response, such as cytokine secretion, antibody production, NK cell activation and T cell proliferation can do. For example, W97 / 28259; WO98 / 16247; WO99 / 11275; Krieg et al., Nature, 374: 546-549 (1995); Yamamoto et al. (1992a); Ballas et al. (1996); Klinman et al. (1997). Sato et al. (1996); Pisetsky, (1996a); Shimada et al., Jpn. J. Cancer Res., 77: 808-816 (1986); Cowdery et al., J. Immunol., 156: 4570-4575 (1996). Roman et al. (1997); Lipford et al. (1997a); see WO 98/55495 and WO 00/61151; Thus, these and other methods can be used to identify, test and / or confirm immunomodulatory IMPs.

  The IMP may be 10 bases or longer than base pairs, preferably 15 bases or longer than base pairs, more preferably 20 bases or longer than base pairs.

  As clearly communicated herein, it is understood that any and all parameters are independently selected for the formulas described herein. For example, if x = 0-2, y can be selected independently regardless of the x value (or other selectable parameters in the formula).

In some embodiments, the IMP is a) a palindromic sequence of at least 8 bases in length comprising at least 2 CG dinucleotides, wherein the CG dinucleotides are separated from each other by 0, 1, 2, 3, 4 or 5 bases A palindromic sequence, and b) a (TCG) _y sequence at 0, 1, 2, or 3 bases from the 5 ′ end of the polynucleotide, wherein y is 1 or 2, and (TCG) _y The 3 ′ end of the sequence comprises a (TCG) _y sequence that is 0, 1, or 2 bases away from the 5 ′ end of the palindromic sequence. In some embodiments, the CG dinucleotide of the (TCG) _y sequence of (b) may correspond to one of at least two CG dinucleotides within the palindromic sequence of (a). In some embodiments, the CG dinucleotides of the palindromic sequence are separated from each other by 1, 3 or 4 bases. In some IMPs of the invention, whether described in this paragraph or elsewhere in this application, the palindromic sequence has a base composition of G and C less than 2/3. In some embodiments, the palindromic sequence has a base composition of G and C greater than 1/3.

In some embodiments, the IMP is a) a palindromic sequence of at least 8 bases in length comprising at least 2 CG dinucleotides, wherein the CG dinucleotides are separated from each other by 0, 1, 2, 3, 4 or 5 bases A palindromic sequence, and b) a (TCG) _y sequence located at 0, 1, 2, or 3 bases from the 5 ′ end of the polynucleotide, wherein y is 1 or 2 (TCG) _y wherein said palindromic sequence includes all or part of the (TCG) _y sequence, and (b) the (TCG) _y sequence of CG dinucleotides, CG dinucleotides palindromic array of (a) May correspond to one of these. Preferably, in some embodiments, the CG dinucleotides of the palindromic sequence are separated from each other by 1, 3 or 4 bases.

Thus, in some embodiments, the IMP has the formula 5′-N _x (TCG (N _q )) _y N _w (X ₁ CGX ₁ ′ (CG) _p ) _z (SEQ ID NO: 155), where N is a nucleoside. , X = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, and 5′T of the (TCG (N _q )) _y sequence is 0-3 bases from the 5 ′ end of the polynucleotide. May be included). The IMP is a palindromic sequence having a length of 8 bases or more, and includes at least one of (X ₁ CGX ₁ ′ (CG) _p ) sequences. In W = -1 the _{IMP, (TCG (N q)} ) 3 in the _y-array 'bases the first (X ₁ CGX _1' is 5'X ₁ of (CG) _p) sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, when p = 0, X ₁ is either A or T.

を含んで成る。 In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

In some embodiments, it has the _{formula: 5'-N x (TCG (} N q)) y N w (X 1 X 2 X 3 CGX 3 'X 2' X 1 '(CG) p) z ( SEQ ID NO: 157 (Where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2 and p = 0 or 1, a q = 0, 1 or 2, and a z = 1 to 20, X ₁ and X ₁ ', X ₂ and X _2', and X ₃ and X ₃ 'are self-complementary And the 5′T of the (TCG (N _q )) _y sequence may be from 0 to 3 bases from the 5 ′ end of the polynucleotide. The IMP is further a palindromic sequence having a length of at least 8 bases, and at least one (X ₁ X ₂ X ₃ CGX ₃ 'X ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 224) sequence Further comprising a palindromic sequence comprising the first (X ₁ X ₂ X ₃ CGX ₃ 'X ₂ ' X ₁ '). In the W = −1 IMP, the 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ X ₃ CGX ₃ 'X ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 224). ) is the first 5'X ₁ sequence. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ X ₃ CGX ₃ 'X ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 224) are the sequences 5'X ₁ , X ₂ and X ₃ . In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, when p = 1, X ₁ , X ₂ , and X ₃ are either A or T. In some embodiments, when p = 0, at least two of X ₁ , X ₂ , and X ₃ are either A or T.

を含んで成る。 In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

In some embodiments, the IMP has the formula 5′-N _x (TCG (N _q )) _y N _w (X ₁ X ₂ X ₃ X ₄ CGX ₄ 'X ₃ ' X ₂ 'X ₁ ' (CG) _p ) _z (SEQ ID NO: 158) (where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2) , P = 0 or 1, q = 0, 1 or 2, and z = 1-20, X ₁ and X ₁ ′, X ₂ and X ₂ ′, X ₃ and X ₃ ′, and X ₄ and X ₄ ′ are self-complementary and comprise a sequence of (TCG (N _q )) _y sequence 5′T is 0-3 bases from the 5 ′ end of the polynucleotide) Sometimes. The IMP is further a palindromic sequence having a length of 10 bases or more, and at least one (X ₁ X ₂ X ₃ X ₄ CGX ₄ 'X ₃ ' X ₂ 'X ₁ ' (CG) _p ) (sequence No. 226) further comprising a palindromic sequence comprising the first (X ₁ X ₂ X ₃ X ₄ CGX ₄ 'X ₃ ' X ₂ 'X ₁ ') (SEQ ID NO: 225) of the sequence. In an IMP W = -1, (TCG (N q)) 3 in the _y-array 'base, the first _{(X 1 X 2 X 3 X} 4 CGX 4' X 3 'X 2' X 1 '(CG) p ) (a 5'X ₁ of SEQ ID NO: 226) sequence. . In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ X ₃ X ₄ CGX ₄ 'X ₃ ' X ₂ 'X ₁ ' (CG) _p ) (SEQ ID NO: 226) 5'X ₁ and X ₂ of the sequence. In the IMP with W = -3, (TCG (N _q )) 3rd from the end of the _y array (ie, 3rd from the end), 2nd from the back (ie, 2nd from the end), and last (ie, the end) the 3 'base, respectively, the first _{(X 1 X 2 X 3 X} 4 CGX 4'5'X 1 of _{X 3 'X 2' X 1} '(CG) p) ( SEQ ID NO: 226) sequence, X ₂ And X ₃ . In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, when p = 1, at least three of X ₁ , X ₂ , X ₃ , and X ₄ are either A or T. In some embodiments, when p = 0, at least two of X ₁ , X ₂ , X ₃ , and X ₄ are either A or T.

を含んで成る。 In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, the IMP has the formula 5′-N _x (TCG (N _q )) _y N _w (X ₁ CCGGX ₁ ′ (CG) _p ) _z (SEQ ID NO: 162), wherein N is a nucleoside. , X = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 and z = 1 to 20, X ₁ and X ₁ ′ are self-complementary, and 5′T of the (TCG (N _q )) _y sequence is 0 to 3 bases from the 5 ′ end of the polynucleotide. ) Sequences. The IMP further comprises a palindromic sequence having a length of 8 bases or more and comprising the first (X ₁ CCGGX ₁ ′) of at least one (X ₁ CCGGX ₁ ′ (CG) _p ) sequence. An array. In W = -1 the _{it, (TCG (N q)} ) 3 in the _y-array 'bases the first (X ₁ CGCGX _1' is 5'X ₁ of (CG) _p) sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0.1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, it has the _{formula: 5'-N x (TCG (} N q)) y N w (CGX 1 X 1 'CG (CG) p) z ( SEQ ID NO: 161) (where, N represents a nucleoside Yes, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 And z = 1 to 20, X ₁ and X ₁ ′ are self-complementary, and 5′T of the (TCG (N _q )) _y sequence is 0 to 5 ′ from the 5 ′ end of the polynucleotide. May comprise a sequence of 3 bases). The IMP further includes a palindromic sequence having a length of at least 8 bases and including the first (CGX ₁ X ₁ 'CG) of at least one (CGX ₁ X ₁ ' CG (CG) _p ) sequence. Comprising a palindromic sequence. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is CG and the first ( CGX ₁ X ₁ 'CG (CG) _p ) 5'CG of sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0.1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, the IMP has the formula: 5′-N _x (TCG (N _q )) _y N _w (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ '(CG) _p ) _z (SEQ ID NO: 159) (Where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2 and p = 0 or 1) a q = 0, 1 or 2, and a z = 1 to 20, X ₁ and X ₁ ', X ₂ and X _2', and X ₃ and X ₃ ', is self-complementary, and , (TCG (N _q )) _y sequence 5′T may comprise the sequence 0-3 bases from the 5 ′ end of the polynucleotide. The IMP is further a palindromic sequence having a length of 10 bases or more, and has at least one (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 217) sequence. A palindromic sequence comprising the first (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ ') (SEQ ID NO: 216). In the W = −1 IMP, the 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 217 ) is a 5'X ₁ of the array. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ '(CG) _p ) _z (SEQ ID NO: 217) 5'X ₁ and X ₂ of the sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, when p = 1, X ₁ , X _2, and X ₃ are each either A or T. In some embodiments, when p = 0, at least two of X ₁ , X _2, and X ₃ are either A or T. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

In some embodiments, the IMP has the formula: 5′-N _x (TCG (N _q )) _y N _w (X ₁ X ₂ CGX ₂ 'X ₁ ' (CG) _p ) _z (SEQ ID NO: 156) (where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1 to 20, X ₁ and X ₁ ′, X ₂ and X ₂ ′ are self-complementary, and 5′T of (TCG (N _q )) _y sequence May be from 0 to 3 bases from the 5 'end of the polynucleotide. The IMP further, a palindromic sequence of length of 8 bases, at least one _{(X 1 X 2 CGX 2 '} X 1' (CG) p) of the first _z sequences (X ₁ X ₂ CGX ₂ ' A palindromic sequence comprising X ₁ ′). In an IMP W = -1, (TCG (N q)) 3 in the _y-array 'base, the first (X ₁ X ₂ CGX _2' is 5'X ₁ of X ₁ '(CG) _p) sequence. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ CGX ₂ 'X ₁ ' (CG) _p ) 5'X ₁ and X ₂ of the sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, X ₁ and X ₂ are each either A or T.

を含んで成る。 In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, in an IMP comprising the formula of SEQ ID NO: 156, X ₁ X ₂ is not AA. In some embodiments, in an IMP comprising the formula of SEQ ID NO: 156, X ₁ is not A. Therefore, in some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, IMP has the _{formula: 5'-N x (TCG (} N q)) y N w (X 1 X 2 X 3 X 4 X 5 CGX 5 'X 4' X 3 'X 2' X 1 ' (CG) _p ) _z (SEQ ID NO: 160) (where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and z = 1 to 20, X ₁ and X ₁ ′, X ₂ and X ₂ ′, X ₃ and X ₃ ′, X ₄ and X ₄ ′, and X ₅ and X ₅ ′ are self-complementary, and 5′T of the (TCG (N _q )) _y sequence is 0 from the 5 ′ end of the polynucleotide. May comprise a sequence of ~ 3 bases). The IMP further, 12 bases or more a palindromic sequence length, at least one _{(X 1 X 2 X 3 X} 4 X 5 CGX 5 'X 4' X 3 'X 2' X 1 '(CG ) _p) (SEQ ID NO: 219) sequence the first _{(X 1 X 2 X 3 X} 4 X 5 CGX 5 'X 4' X 3 'X 2' X 1 ') ( palindromic comprising SEQ ID NO: 218) of An array. In an IMP W = -1, (TCG (N q)) 3 in the _y-array 'base, the first _{(X 1 X 2 X 3 X} 4 X 5 CGX 5' X 4 'X 3' X 2 'X 1 '(CG) _p ) (SEQ ID NO: 219) is 5'X ₁ of the sequence. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X _{1 X 2 X 3 X 4 X 5} CGX 5 'X 4' X 3 is a _{'X 2' X 1 '(} CG) p) ( SEQ ID NO: 219) sequence 5'X ₁ and X _2. In the IMP with W = -3, (TCG (N _q )) 3rd from the end of the _y array (ie, 3rd from the end), 2nd from the back (ie, 2nd from the end) and last (ie, the end) 'base, respectively, the first _{(X 1 X 2 X 3 X} 4 X 5 CGX 5' of the _{3 X 4 'X 3' X} 2 'X 1' (CG) p) ( SEQ ID NO: 219) sequences of 5 ' X ₁ , X ₂ and X ₃ . In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, at least three of X ₁ , X _2, X ₃ , X ₄ , and X ₅ are either A or T. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, IMP has the _{formula: 5'-N x (TCG (} N q)) y N w (X 1 X 2 CGCGX 2 'X 1' (CG) p) z ( SEQ ID NO: 163) (where, N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2, and a z = 1 to 20, X ₁ and X ₁ ', and X ₂ and X _2' are self-complementary, _{and, (TCG (N q))} 5 of the _y sequence ' T may comprise a sequence from 0 to 3 bases from the 5 ′ end of the polynucleotide. The IMP is further a palindromic sequence having a length of 8 bases or more, and is the first (X ₁ ) sequence of at least one (X ₁ X ₂ CCGGX ₂ 'X ₁ ' (CG) _p ) (SEQ ID NO: 220) A palindromic sequence comprising X ₂ CCGGX ₂ 'X ₁ '). In an IMP W = -1, (TCG (N q)) 3 in the _y-array 'base, the first _{(X 1 X 2 CGCGX 2'} X 1 '(CG) p) ( SEQ ID NO: 220) sequences of 5' it is X _1. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ CGCGGX ₂ 'X ₁ ' (CG) _p ) (SEQ ID NO: 220) 5'X ₁ and X ₂ of the sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, X ₁ and X ₂ are each either A or T. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, it has the _{formula: 5'-N x (TCG (} N q)) y N w (X 1 X 2 X 3 CGCGX 3 'X 2' X 1 '(CG) p) z ( SEQ ID NO: 164 (Where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2 and p = 0 or 1, a q = 0, 1 or 2, and a z = 1 to 20, X ₁ and X ₁ ', X ₂ and X _2', and X ₃ and X ₃ 'are self-complementary And the 5′T of the (TCG (N _q )) _y sequence may be from 0 to 3 bases from the 5 ′ end of the polynucleotide. The IMP is further a palindromic sequence having a length of 10 bases or more, and has at least one (X ₁ X ₂ X ₃ CCGGX ₃ 'X ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 222) sequence. A palindromic sequence comprising the first (X ₁ X ₂ X ₃ CCGGX ₃ 'X ₂ ' X ₁ ') (SEQ ID NO: 221). In an IMP W = -1, (TCG (N q)) 3 in the _y-array 'base, the first _{(X 1 X 2 X 3 CGCGX} 3' X 2 'X 1' (CG) p) ( SEQ ID NO: 222 ) is a 5'X ₁ sequence SEQ. In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is the first (X ₁ X ₂ X ₃ CCGGX ₃ 'X ₂ ' X ₁ '(CG) _p ) (SEQ ID NO: 222) 5'X ₁ and X ₂ of the sequence. In the IMP with W = -3, (TCG (N _q )) 3rd from the end of the _y array (ie, 3rd from the end), 2nd from the back (ie, 2nd from the end), and last (ie, the end) 'base, respectively, the first _{(X 1 X 2 X 3 CGCGX} 3' 3 is _{X 2 'X 1' (CG} ) p) ( SEQ ID NO: 222) 5'X ₁ sequence, X ₂ and X ₃ .
In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, when p = 1, X ₁ , X _2, and X ₃ are each either A or T. In some embodiments, when p = 0, at least two of X ₁ , X _2, and X ₃ are either A or T. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 In some embodiments, IMP has the _{formula: 5'-N x (TCG (} N q)) y N w (CGX 1 X 2 X 2 'X 1' CG (CG) p) z ( SEQ ID NO: 165) (where , N is a nucleoside, x = 0-3, y = 1-4, w = −2, −1, 0, 1 or 2, p = 0 or 1, q = 0 is 1 or 2, and a z = 1 to 20, X ₁ and X ₁ ', and X ₂ and X _2' are self-complementary, and, 5 (TCG (N _{q)) y} sequence 'T may comprise a sequence from 0 to 3 bases from the 5' end of the polynucleotide). The IMP is further a palindromic sequence having a length of 8 bases or more, and the first (CGX) of at least one (CGX ₁ X ₂ X ₂ 'X ₁ ' CG (CG) _p ) (SEQ ID NO: 223) sequence. _A palindromic sequence comprising ₁ X ₂ X ₂ 'X ₁ ' CG). In the IMP with W = -2, the second (ie, penultimate) and last (ie, penultimate) 3 ′ base of the (TCG (N _q )) _y sequence is CG and the first ( CGX ₁ X ₂ X ₂ 'X ₁ ' CG (CG) _p ) (SEQ ID NO: 223) 5'CG of the sequence. In some embodiments, the (TCG (N _q )) _y sequence is 0, 1 or 2 bases away from the palindromic sequence. In other embodiments, the palindromic sequence comprises all or part of the (TCG (N _q )) _y sequence. In some embodiments, X ₁ and X ₂ are each either A or T. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

For IMPs comprising any of the motifs described herein where y = 2 or greater (ie, SEQ ID NOs: 155-165), each (N _q of each of the y repeats of (TCG (N _q )) ) Are independently selected. For example, in an IMP with y = 2, the first TCG (N _q ) may be N = A and q = 1, and the second TCG (N _q ) . . . TCGATCG. . . . In this case, q = 0 may be used. In some embodiments of IMP comprising any of the motifs described herein (ie, SEQ ID NOs: 155-165), x is preferably 0 or 1. In some embodiments of IMP comprising any of the motifs described herein (ie, SEQ ID NOs: 155-165), y is preferably 1 or 2. In some embodiments of IMP comprising any of the motifs described herein (ie, SEQ ID NOs: 155-165), w is preferably 0. In some embodiments of IMP comprising any of the motifs described herein (ie, SEQ ID NOs: 155-165), z is preferably 1,2,3,4,5,6,7 or 8 It is.

As mentioned above, the IMP contains at least one palindromic sequence that is at least 8 bases in length. In some embodiments, the IMP comprises at least one palindromic sequence of at least the following lengths (bases): 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30. In some embodiments, the palindromic sequence is repeated at least once in the IMP. In some embodiments, the palindromic sequence also includes the 5 ′ base of the _y sequence, if any (TCG (N _q )).

  Immunomodulatory polynucleotides can include modifications. Modifications of IMP include any known in the art including, but not limited to, modification of 3'OH or 5OH groups, modification of nucleotide bases, modification of sugar components, and modification of phosphate groups. Various such modifications are described below. For modified bases, the modified base maintains the same specificity for its natural component via Watson-Crick base pairing (eg, the palindromic portion of the IMP is still self-complementary). As long as it is included in the palindromic sequence of IMP.

を含んで成る。 The IMP may be linear, cyclic, or may include a cyclic portion, and / or may include a hairpin loop. In some embodiments, the IMP has the following circular sequence (the palindromic sequence is underlined):

Comprising.

を含んで成る。 IMP can be single-stranded or double-stranded DNA, as can single-stranded or double-stranded RNA or other modified polynucleotides. In some embodiments, the IMP has the following double-stranded sequence:

Comprising.

The IMP may contain natural or modified unnatural bases and may contain modified sugars, phosphates, and / or termini. For example, in addition to phosphodiester linkages, phosphate modifications include, but are not limited to, methylphosphonates, phosphorothioates, phosphoramidites (cross-linked or non-cross-linked), phosphotriesters and phosphorodithioates, and used in any combination Can be done. Other non-phosphate linkages can also be used. In some embodiments, the polynucleotide of the invention comprises only a phosphodiester backbone. In some embodiments, the IMP comprises a combination of phosphate bonds in the phosphate backbone. For example, a combination of phosphodiester and phosphorothioate bonds. For example, in some embodiments, the IMP has the following sequence (“s” indicates a phosphorothioate linkage): 5′-TCGTCGAAACGTTTCGACAGT (SEQ ID NO: 62), all phosphorothioate linkages;
5'-TCGTTCGAACGTTCGAACGA (SEQ ID NO: 88), all phosphodiester linkages;
5′-TsCsGsTTCGAACGTTCGsAsAsCsGsA (SEQ ID NO: 89), phosphorothioate / phosphodiester chimera;
5'-GsGsTCGAACGTTCGAGsGsGsGsGsG (SEQ ID NO: 26), phosphorothioate / phosphodiester chimera;
5'-TsCsGsTCGAACGTTCGAGsGsGsGsGsG (SEQ ID NO: 33), phosphorothioate / phosphodiester chimera;
5'-TsCsGsTGCATCGATGCAGGsGsGsGsG (SEQ ID NO: 34), phosphorothioate / phosphodiester chimera,
Comprising.

Sugar modifications known in the art, such as 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA and 2'-alkoxy- or amino-RNA / DNA chimeras and the present specification Others described in the literature may also be performed and may be combined with any phosphate modification. Examples of base modifications (discussed further below) include the addition of an electron withdrawing group (eg, 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine) to cytosine C-5 and / or C-6 of IMP. , 5-iodocytosine), and addition of an electron withdrawing group to C-5 and / or C-6 of uracil of IMP (eg, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil) ), But is not limited thereto. See for example WO 99/62923. As mentioned above, the use of base modifications in palindromic sequences should not interfere with the self-complementary ability of bases involved in Watson-Crick base pairing. However, modified bases outside the palindromic sequence can be used without this limitation. For example, in some embodiments, the IMP has the following sequence:
5′-uCGuCGAACGTTCGAGATG (SEQ ID NO: 21), u = 2′-O-methyl-uridine;
5′-TcGTCGAACGTTCGAGATG (SEQ ID NO: 22), c = 2′-O-methyl-cytidine;
5′-TCGTcGAACGTTCGAGATG (SEQ ID NO: 23), c = 2′-O-methyl-cytidine;
5′-TBGTBGAABGTTBGAGATGAT (SEQ ID NO: 28), B = 5-bromo-2′-deoxycytidine,
Comprising.

  IMPs can be synthesized using techniques and nucleic acid synthesizers well known in the art, including but not limited to enzymatic methods, chemical methods and degradation of larger nucleotide sequences. See, for example, Ausubel et al. (1987); and Sambrook et al. (1989). When assembled enzymatically, individual units can be ligated, for example, with a ligase such as T4 DNA or RNA ligase. US Pat. No. 5,124,246. Oligonucleotide degradation can be achieved by exposing the oligonucleotide to a nuclease, as exemplified in US Pat. No. 4,650,675.

  IMP can also be isolated using routine polynucleotide isolation techniques. Such techniques include, but are not limited to, hybridization of probes to genomic or cDNA libraries to detect shared nucleotide sequences, antibody screening of expression libraries to detect shared structural features, and Includes synthesis of specific native sequences by polymerase chain reaction.

  Circular immunomodulatory polynucleotides can be isolated, synthesized by recombinant methods, or chemically synthesized. If the circular IMP is obtained by isolation or recombinant methods, the IMP will preferably be a plasmid. Chemical synthesis of relatively small circular oligonucleotides can be performed using any of the methods described in the references. See, for example, Gao et al. (Nucleic Acids Res., 23: 2025-2029 (1995)); and Wang et al. (Nucleic Acids Res., 22: 2326-2333 (1994)).

  Many IMP duplexes (ie, duplexes) and hairpin types are in dynamic equilibrium, although hairpin types usually prefer lower polynucleotide concentrations and higher temperatures. Covalent interchain or intrachain cross-linking increases the stability of duplexes or hairpins, respectively, against heat, ion, pH, and concentration induced conformational changes. Chemical cross-linking can be used to lock a polynucleotide in either a duplex or hairpin form for physicochemical and biological characterization. Cross-linked IMPs that are “locked” to a conformationally uniform and most active form (either duplex or hairpin) are potentially more active than their uncrosslinked counterparts There is. Thus, some IMPs of the present invention contain covalent interstrand and / or intrachain crosslinks.

  Various methods for chemically cross-linking double stranded DNA are known in the art. Any cross-linking method can be used as long as the cross-linked polynucleotide product retains the desired immunomodulatory activity.

One method results in a disulfide bridge between two opposing thymidines, for example at the ends of a duplex or hairpin. In the case of this cross-linking method, the oligonucleotide of interest is synthesized with 5′-DMT-N3- (tBu-SS-methyl) thymidine-3′-phosphoramidite (“T ^* ”). To form disulfide bridges, the mixed disulfide bonds are reduced, the oligonucleotides are purified, the strands are hybridized, and the compounds are oxidized in air to form intrachain bridges in the case of hairpins, or two In the case of the heavy chain type, an interchain bridge is formed. Alternatively, the oligonucleotide may be first hybridized, then reduced, purified, and oxidized with air. Such and other methods are described, for example, by Glick et al. (1991) J. Org. Chem. 56: 6746-6747, Glick et al. (1992) J. AMChem. Soc. 114: 5447-5448, Goodwin et al. (1994) Tetrahedron Letters 35: 1647-1650, Wang et al. (1995) J. 4in. Chem. Soc. 117: 2981-2991, Osborne et al. (1996) Bioorgafaic & Medicinal Chemistry Letters 6: 2339-2342 and Osborne et al. (1996) J. AMChem. Soc. 118: 11993-12003.

前記配列のそのようなヘアピン構造又は二重鎖構造は、遊離の５’−ＴＣＧを有するが、２つの位置（３’末端及び５’−末端から４塩基）に拘束されるであろう。 Examples of polynucleotide sequences in which 5′-DMT-N3- (tBu-SS-ethyl) thymidine-3′-phosphoramidite (“T ^* ”) can be incorporated for crosslinking include: 3 'end of SEQ ID NO: 27 analog (5'-TCGTCGAACGTTCGAGATGAT * -3', SEQ ID NO: 27 analog 1) and 5 'end of SEQ ID NO: 29 analog (5'-T ^* TCATCTCGAACGTTCGACGA-3', SEQ ID NO: 29 analog 1) Incorporation of T ^{* in} would result in a two-stranded duplex bridge at the 3 ′ end of the SEQ ID NO: 27 analog. By incorporating T ^* at the two positions of the SEQ ID NO: 113 analog, the two bridges will form a duplex, or a single bridge, and the hairpin shape will be maintained. For example, folding the sequence 5′-TCGT ^* AACGTTCGAACGTTCGAACGTTT ^* -3 (SEQ ID NO: 113 analog 1) into a hairpin structure and forming a bridge at the substituted T residue results in a bridged polynucleotide having the following secondary structure: Will.

Such a hairpin or duplex structure of the sequence has a free 5'-TCG but will be constrained at two positions (3 'end and 4 bases from the 5'-end).

  Another cross-linking method forms disulfide bridges between offset residues within the duplex or hairpin structure. In this cross-linking method, the oligonucleotide of interest is synthesized with a convertible nucleoside (commercially available, such as that sold by Glen Research). This method utilizes, for example, an AA disulfide or CA disulfide bridge, and can be linked through other bases. To form a disulfide modified polynucleotide, the polynucleotide containing the exchangeable nucleoside is reacted with cystamine (or other disulfide-containing amine). To form disulfide bridges, the mixed disulfide bonds are reduced, the oligonucleotides are purified, the strands are hybridized, and the compounds are oxidized in air to form intrachain bridges in the case of hairpins, or two In the case of the heavy chain type, an interchain bridge is formed. Alternatively, the oligonucleotide may be first hybridized, then reduced, purified, and oxidized with air. Such and other methods are described, for example, by Ferentz et al. (1991) J. Am. Chem. Soc. 113: 4000-4002 and Ferentz et al. (1993) J. Am. Chem. Soc. 115: 9006-9014.

Examples of polynucleotide sequences in which the offset N6-cystamine-2′-dA (A ^* ) residue is used to bridge the duplex include: Sequence ^{5'-TCGTCGAACGTTCGAGA * TGAT-3 '} , 3 of SEQ ID NO: 191' and its complementary strand ^{5'-ATCA * TCTCGAACGTTCGACGA-3 '} , 5 of SEQ ID NO: 192' incorporating the A ^* at an end, SEQ ID NO: 191 Will allow cross-linking in the double strand of the two strands at the 3 ′ end. Such modifications can also be used to crosslink the hairpin structure.

  Techniques for making oligonucleotides and modified oligonucleotides are known in the art. Natural DNA or RNA containing a phosphodiester linkage generally comprises sequential attachment of a suitable nucleoside phosphoramidite to the 5'-hydroxy group of a growing oligonucleotide attached to a solid support at the 3'-end, Synthesized by subsequent oxidation of the intermediate phosphite triester to the phosphate triester. Once the desired oligonucleotide sequence is synthesized, the oligonucleotide is removed from the support, the phosphotriester group is deprotected to a phosphodiester, and these nucleoside bases are aqueous ammonia. Or deprotected using other bases. For example, Beaucage's "Oligodeoxynucleotide Synthesis" (1993) in "Protocols for Oligonucleotides and Analogs, Synthesis and Properties" (Agrawal), Humana Press, Totowa, NJ; Warner et al., DNA, 3: 401 (1984). And U.S. Pat. No. 4,458,066.

  IMPs also include phosphate-modified oligonucleotides, some of which have been found to stabilize polynucleotides. Accordingly, some embodiments include stabilized immunomodulatory polynucleotides. The synthesis of polynucleotides containing modified phosphate bonds or non-phosphate bonds is also known in the art. For a review, see Mattieucci's “Oligonucleotide Analogs: an Overview” in “Oligonucleotides as Therapeutic Agents” (edited by D.J. Chadwick and G. Cardew), John Wiley and Sons, New York, NY (1997). Phosphorus derivatives (or modified phosphate groups) capable of binding to sugars or sugar analog moieties in the oligonucleotides of the present invention are monophosphate, diphosphate, triphosphate, alkyl phosphonate, phosphorothioate, phosphorothioate, It may be dithioate, phosphoramidate or the like. The preparation of the aforementioned phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides are also known per se and are not described in detail herein. Peyrottes et al., Nucleic Acids Res., 24: 1841-1848 (1996); Chaturvedi et al., Nucleic Acids Res., 24: 2318-2323 (1996); and Schultz et al., Nucleic Acids Res., 24: 2966-2973 ( 1996). For example, the synthesis of phosphorothioate oligonucleotides is similar to that previously described for natural oligonucleotides, except that the oxidation step is replaced by a sulfation step (Zon, `` Protocols for Oligonucleotides and Analogs, Synthesis and Properties ''). "Oligonucleoside Phosphorothioates" (1993), edited by Agrawal, Humana Press, pp. 165-190). Similarly, from phosphotriesters (Miller et al., JACS, 93: 6657-6665 (1971)), unbound phosphoramidates (Jager et al., Biochem., 27: 7247-7246 (1988)), N3 ′ The synthesis of other phosphate analogs such as phosphoramidates to P5 ′ (Nelson et al., JOC, 62: 7278-7287 (1997)) and phosphorodithioates (US Pat. No. 5,453,496) have also been described. Yes. Other non-phosphate based modified oligonucleotides can also be used (Stirchak et al., Nucleic Acids Res., 17: 6129-6141 (1989)). Oligonucleotides with a phosphorothioate backbone may be more immunogenic than those with a phosphodiester backbone and appear to be more resistant to degradation after injection into the host. Braun et al., J. Immunol., 141: 2084-2089 (1988); and Latimer et al., Mol. Immunol., 32: 1057-1064 (1995).

IMPs used in the present invention can comprise one or more ribonucleotides (including ribose as the sole or major sugar component), deoxyribonucleotides (including deoxyribose as the major sugar component), or As is known in the art, modified sugars or sugar analogs can be incorporated into IMPs. Thus, in addition to ribose and deoxyribose, the sugar moiety may be a pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose and sugar “analog” cyclopentyl group. This sugar may be in pyranosyl or furanosyl form. In IMP, the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2′-0-alkylribose, and the sugar is in each anocyclic base in either the α or β anomeric configuration. Can be combined. Sugar modifications include, but are not limited to, 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA / DNA chimeras. For example, sugar modifications in IMP include 2'-O-methyl-uridine and 2'-O-methyl-cytidine. The preparation of these sugars or sugar analogs and the respective “nucleosides” (wherein the sugar or sugar analog is bound to a heterocyclic base (nucleobase)) is of course known and such Except to the extent that the preparation is related to specific examples, there is no need for explanation in this specification.
Sugar modifications can be made and combined with phosphate modifications in the preparation of IMP.

The heterocyclic bases, or nucleobases incorporated into the IMP may be the natural main purine and pyrimidine bases (i.e., uracil, thymine, cytosine, adenine and guanine as described above), It may be a natural and synthetic modification of the main base.
Thus, IMP may contain 2'-deoxyuridine and / or 2-amino-2'-deoxyadenosine.

  Those skilled in the art will recognize that numerous “synthetic” non-natural nucleosides containing various heterocyclic bases and various sugar moieties (and sugar analogs) are available in the art, as well as other inventive criteria. As long as is satisfied, it will be appreciated that an IMP can contain one or several heterocyclic bases in addition to the five major base components of a natural nucleic acid. Preferably, however, the heterocyclic base in IMP is uracil-5-yl, cytosine-5-yl, adenine-7-yl, adenine-8-yl, guanine-7-yl, guanine-8-yl, 4 -Aminopyrrolo [2,3-d] pyrimidin-5-yl, 2-amino-4-oxopyrrolo [2,3-d] pyrimidin-5-yl, 2-amino-4-oxopyrrolo [2,3-d] pyrimidine Including, but not limited to, a 3-yl group, where purine is 9 in the IMP sugar moiety, 1 in pyrimidine, 7 in pyrrolopyrimidine, and pyrazolopyrimidine Bonded at the 1st position.

  The IMP may contain at least one modified base. The term “modified base” as used herein is synonymous with “base analog”, for example “modified cytosine” is synonymous with “cytosine analog”. Similarly, a “modified” nucleoside or nucleotide is defined herein as a synonym for a nucleoside or nucleotide “analog”. Examples of base modifications include, but are not limited to, addition of an electron withdrawing moiety to C-5 and / or C-6 of cytosine of IMP. The preferred electron withdrawing moiety is halogen. Such modified cytosines are azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil, 5, This includes, but is not limited to, 6-dihydrocytosine, 5-iodocytosine, hydroxyurea, iodouracil, 5-nitrocytosine, uracil, and any other pyrimidine analog or modified pyrimidine. Other examples of base modifications include, but are not limited to, addition of an electron withdrawing moiety to uracil C-5 and / or C-6 of IMP. The preferred electron withdrawing moiety is halogen. Such modified uracils include, but are not limited to, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil.

を含んで成る。 Other examples of base modifications include, but are not limited to, 2-amino-adenine, 6-thio-guanine, 2-thio-thymine, 4-thio-thymine, 5-propynyl-uracil, and 4-thio-uracil. , Including the addition of one or more thiol groups to the base. Other examples of base modifications include but are not limited to N4-ethylcytosine, 7-deazaguanine, 7-deaza-8-azaguanine and 5-hydroxycytosine. See, for example, Kandimalla et al. (2001) Bioorg Med. Chem. 9: 807-813. In some embodiments, the IMP has the following sequence (the palindromic sequence is underlined):

Comprising.

  As illustrated in Example 1, IMPs that maintain the duplex form at low concentrations tend to stimulate the production of IFN-α from human PBMC. Stabilization of the double-stranded polynucleotide type through cross-linking is as described above. Certain modified bases can also increase duplex stability if the complementary sequence is in duplex form. For example, 2-amino-dA (commercially available, such as that sold by Glen Research) has T and three hydrogen bonds instead of two hydrogen bonds when formed between dA and T. Form. SEQ ID NO: 188, which is an analog of SEQ ID NO: 27, contains 5 2-amino-dA at the 5 dA base position of SEQ ID NO: 27 and contains itself and a stronger duplex than SEQ ID NO: 27. Form (size exclusion chromatography data). Incorporation of these modified bases raises the Tm by about 3 ° C. per modification. As exemplified herein in Example 1, SEQ ID NO: 188 also induced more production of IFN-α when human PBMC were treated with 0.8 μg / ml IMP compared to SEQ ID NO: 27. . Double-stranded SEQ ID NO: 884 induced IFN-α production approximately 3-fold compared to single-stranded SEQ ID NO: 188.

  The preparation of base-modified nucleosides and the synthesis of modified oligonucleotides using base-modified nucleosides as precursors are described, for example, in US Pat. Nos. 4,910,300, 4,948,882, And US Pat. No. 5,093,232. These base-modified nucleosides are designed to be incorporated by chemical synthesis at either the terminal or internal position of the oligonucleotide. Such base-modified nucleosides present at either the terminal or internal position of the oligonucleotide can be used as positions for binding of peptides or other antigens. Nucleosides in which these sugar moieties have been modified have also been described (including US Pat. Nos. 4,849,513, 5,015,733, 5,118,800, 5,118,802) However, it is not limited to these.), And can be used similarly.

  In some embodiments, the immunomodulatory polynucleotide is approximately less than the following length (in bases or base pairs): 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175; 150; 125; 100; 75; 60; 50; 40; 30; 25; 20; 15; 14; 13; 12; 11; 10. In some embodiments, the immunomodulatory polynucleotide is approximately greater in length (in bases or base pairs): 10; 11; 12; 13; 14; 15; 20; 25; 30; 40; 50; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000; 7500; 10000; 20000; 50000. Alternatively, the immunomodulatory polynucleotide has the following upper limit: 10,000; 5,000; 2500; 2000; 1500; 1250; 1000; 750; 500; 300; 250; 200; 175; 150; 125; 100; 75; 60; 50; 40; 30; 25; 20; 15; 14; 13; 12; 11; 10 and the independently selected lower limit: 10; 11; 12; 13; 14; 15; 20; 25; 30; 40 50; 60; 75; 100; 125; 150; 175; 200; 250; 300; 350; 400; 500; 750; 1000; 2000; 5000; 7500, which may be any of the following: The lower limit is less than the upper limit. In some embodiments, the IMP is preferably about 200 bases or less in length.

The invention further provides methods for making the immunomodulatory polynucleotides described herein. The method is any of those described herein. For example, the method can synthesize IMP (eg, using solid phase synthesis) and can further include a purification step.
Purification methods are known in the art. Other preparation methods include combinations of immunomodulatory polynucleotides and antigens.

Antigen antigens can be co-administered with immunomodulatory polynucleotides and / or used in compositions (and in the preparation of these compositions) comprising immunomodulatory polynucleotides and antigens.

  In some embodiments, the antigen is an allergen. Examples of recombinant allergens are shown in Table 1. The preparation of many allergens is well known in the art and includes ragweed pollen allergen antigen B (Amb a 1) (Rafnar et al., J. Biol. Chem., 266: 1229-1236 (1991)), grass allergen Lol p 1 (Tamborini et al., Eur. J. Biochem., 249: 886-894 (1997)), chile mite allergens Der p1 and Der PII (Chua et al., J. Exp. Med, 167: 175-182 (1988); Int. Arch. Allergy Appl. Immunol., 91: 124-129 (1990)), pet cat allergen Fel d I (Rogers et al., Mol. Immunol., 30: 559-568 (1993)), birch pollen From Bet v1 (Breiteneder et al., EMBO J., 8: 1935-1938 (1989)), Japan gear allergens Cryj 1 and Cryj 2 (Kingetsu et al., Immunology, 99: 625-629 (2000)), and other tree pollen Including, but not limited to, the preparation of protein antigens (Elsayed et al., Scand. J. Clin. Lab. Invest. Suppl., 204: 17-31 (1991)). As indicated, tree-derived allergens are known and include allergens from straw, juniper, and Japanese cedar. The preparation of protein antigens for in vivo administration from grass pollen has been reported.

  In some embodiments, the allergen is a food allergen and a peanut allergen, such as Ara h I (Stanley et al., Adv. Exp. Med Biol., 409: 213-216 (1996)); a walnut allergen such as Jug r I (Tueber et al. , J. Allergy Clin. Immunol., 101: 807-814 (1998)); Brazil nut allergens, such as albumin (Pastorello et al., J. Allergy Clin. Immunol., 102: 1021-1027 (1998); Pen a I (Reese et al., Int. Arch. Allergy Immunol., 113: 240-242 (1997)); egg allergens such as ovomucoid (Crooke et al., J. Immunol., 159: 2026-2032 (1997)); milk Allergens such as bovine β-lactoglobulin (Selot et al., Clin. Exp. Allergy, 29: 1055-1063 (1999)); fish allergens such as parvalbumin (Van Do et al., Scand J. Immunol., 50: 619-625 (1999); Galland et al., J. Chromatogr. B. Biomed Sci. Appl., 706: 63-71 (1998)), but not limited thereto. Thus, the allergen is a latex allergen, including but not limited to Hev b 7 (Sowka et al., Eur. J. Biochem., 255: 213-219 (1998)). Table 1 shows an exemplary list of allergens that can be used.

In some embodiments, the antigen is derived from an infectious agent and includes protozoa, bacteria, fungi (including unicellular and multicellular), and viral infectious agents. Examples of suitable viral antigens are described herein and are known in the art. Bacteria include Hemophilus influenza, Mycobacterium tuberculosis and Bordetella pertussis.
Protozoan infectious agents include Plasmodium, Leishmania, Trypanosoma and Schistosoma species. Fungi include Candida albicans.

In some embodiments, the antigen is a viral antigen. Viral polypeptide antigens include HIV proteins such as HIV gag protein (including but not limited to membrane anchor (MA) protein, core capsid (CA) protein and nucleocapsid (NC) protein), HIV. Polymerase, influenza virus matrix (M) protein and influenza virus nucleocapsid (NP) protein, hepatitis B surface antigen (HBsAg), hepatitis B core protein (HBcAg), hepatitis e protein (HBeAg), hepatitis B DNA polymerase, Including but not limited to hepatitis C antigen and the like. References discussing influenza vaccination are Scherle and Gerhard, Proc. Natl. Acad Sci. USA, 85: 4446-4450 (1988); Scherle and Gerhard, J. Exp. Med, 164: 1114-1128 ( 1986); Granoff et al.,
Vaccine, 11: S46-51 (1993); Kodihalli et al., J. Virol, 71: 3391-3396 (1997); Ahmeida et al., Vaccine, 11: 1302-1309 (1993); Chen et al., Vaccine, 17: 653- 659 (1999); Govorkova and Smimov, Acta Virol., 41: 251-257 (1997); Koide et al., Vaccine, 13: 3-5 (1995); Mbawuike et al., Vaccine, 12: 1340-1348 (1994); Tamura et al., Vaccine, 12: 310-316 (1994); Tamura et al., Eur. J. Immunol., 22: 477-481 (1992); Hirabayashi et al., Vaccine, 8: 595-599 (1990). Examples of other antigenic polypeptides are genus- or subgenus-specific antigens, which are known for many infectious agents, adenoviruses, herpes simplex viruses, papillomaviruses, respiratory syncytial viruses (RSV) and poxvirus, but are not limited to these.

Many antigenic peptides and proteins are known and available in the art; others can be identified using routine techniques. With respect to immunization against tumor formation or treatment of existing tumors, immunomodulating peptides can be tumor cells (live or irradiated), tumor cell extracts, or protein subunits of tumor antigens such as Her-2 / neu, MartI, carcinoembryonic antigen (CEA), ganglioside, human milk fat globule
(HMFG), mucin (MUC1), MAGE antigen, BAGE antigen, GAGE antigen, gp100, prostate specific antigen (PSA) and tyrosinase. Immune-based contraceptives can be formed by comprising a sperm protein administered with IMP. Lea et al., Biochim. Biophys. Acta, 1307: 263 (1996).

  Attenuated and inactivated viruses are suitable for use as antigens herein. The preparation of these viruses is well known in the art and many are commercially available (see, eg, `` Medical Handbook for Physicians (PDR) '' (1998), 52nd edition, Medical Economics Company, Inc. ). For example, poliovirus is IPOL (registered trademark) (Pasteur Merieux Connaught) and ORIMUNE (registered trademark) (Lederle Laboratories), hepatitis A virus is VAQTA (registered trademark) (Merck), measles virus is The ATTENUVAX (registered trademark) (Merck), Mumps virus is commercially available as MUMPSVAX (registered trademark) (Merck), and the rubella virus is commercially available as MERUVAX (registered trademark) II (Merck). In addition, attenuated and inactivated viruses such as HIV-1, HIV-2, herpes simplex virus, hepatitis B virus, rotavirus, human and non-human papillomaviruses and slow brain viruses Can be provided.

  In some embodiments, the antigen comprises viral vectors such as vaccinia, adenovirus, and canarypox.

  Antigens can be isolated from their sources using purification techniques known in the art, and more conveniently can be produced using recombinant methods.

  Antigenic peptides can include purified natural peptides, synthetic peptides, recombinant proteins, crude protein extracts, attenuated or inactivated viruses, cells, microorganisms, or fragments of such peptides. Immunomodulatory peptides can be natural or synthesized chemically or enzymatically. Any chemical synthesis method known in the art is suitable. Medium phase peptides can be constructed using liquid phase peptide synthesis, or solid phase synthesis can be used for chemical construction of peptides. Atherton et al., Hoppe Seylers Z. Physiol. Chem., 362: 833-839 (1981). Proteolytic enzymes can also be used to bind amino acids for peptide production. Kullmann, Enzymatic Peptide Synthesis, CRC Press, (1987). Alternatively, the peptide can be obtained using cellular biochemical mechanisms or by isolation from a biological source. Recombinant DNA technology can be utilized for peptide production. Hames et al., Transcription and Translation: A Practical Approach, IRL Press, (1987). Peptides can also be isolated using standard techniques, such as affinity chromatography.

  Preferably, these antigens are peptides, lipids (eg, sterols excluding cholesterol, fatty acids, and phospholipids), H.P. Polysaccharides, gangliosides and glycoproteins such as those used in influenza vaccines. These can be obtained by several methods known in the art, including isolation and synthesis using chemical and enzymatic methods. In certain cases, such as many sterols, fatty acids and phospholipids, the antigenic portion of the molecule is commercially available.

  Examples of viral antigens useful in the subject compositions and methods of using the compositions include, but are not limited to, HIV antigens. Such antigens include, but are not limited to, antigens derived from these HIV envelope glycoproteins, including but not limited to gpl60, gp120 and gp41. Many sequences for HIV genes and antigens are known. For example, the Los Alamos National Laboratory HIV Sequence Database collects, curates and annotates HIV nucleotide and amino acid sequences. This database can be accessed on the Internet at http://hiv-web.lanl.gov/ and is published annually, see Human Retroviruses and AIDS Compendium (eg 2000).

  Antigens derived from infectious agents are, for example, from natural virus or bacterial extracts, from cells infected with infectious agents, from purified polypeptides, from recombinantly produced polypeptides and / or from synthetic peptides. It can be obtained using methods known in the technical field.

When used with an IMP- antigen antigen, the IMP can be administered with the antigen in a number of ways.
In some embodiments, the IMP and the antigen can be administered in spatial proximity to each other or in admixture (ie, in solution). As explained below, spatial proximity can be achieved in a number of ways, which can be by conjugation (ligation), encapsidation, attachment to a platform, or adsorption to a surface. In general, and most preferably, the IMP and antigen are closely associated at a distance effective to enhance the resulting immune response as compared to administration as a mixture of IMP and antigen.

  In some embodiments, the IMP is conjugated to an antigen. The IMP moiety may be coupled to the antigenic portion of the complex in a variety of ways, such as covalent and / or non-covalent interactions.

The linkage between the parts is made at the 3 'or 5' end of the IMP or at a suitable modified base at the IMP internal position. If the antigen is a peptide and contains an appropriate reactive group (eg, N-hydroxysuccinimide ester), it can react directly with the N ⁴ amino group of the cytosine residue. Depending on the number and position of cytosine residues in IMP, specific coupling at one or more residues can be achieved.

  Alternatively, modified oligonucleosides such as are known in the art can be incorporated at either end of the IMP or at internal positions. These can include blocked functional groups that, when deblocked, are reactive with various functional groups present or bound on the antigen of interest.

  If the antigen is a peptide or polypeptide, a portion of this conjugate can be attached to the 3'-end of the IMP by solid support chemistry. For example, the IMP moiety can be added to a polypeptide moiety that has been previously synthesized on a support. Haralambidis et al., Nucleic Acids Res., 18: 493-499 (1990a); and Haralambidis et al., Nucleic Acids Res., 18: 501-505 (1990b). Alternatively, IMP can be synthesized to be connected to the solid phase via a cleavable linker extending from the 3'-end. Upon chemical cleavage of the IMP from the support, the terminal thiol group remains at the 3′-end of the oligonucleotide (Zuckermann et al., Nucleic Acids Res., 15: 5305-5321 (1987); and Corey et al., Science, 238: 1401-1403 (1987)) or the terminal amino group remains at the 3′-end of the oligonucleotide (Nelson et al., Nucleic Acids Res., 17: 1781-1794 (1989)). The conjugation of amino-modified IMP to the amino group can be performed as described in the paper of Benoit et al. (Neuromethods, 6: 43-72 (1987)). Conjugation of a thiol-modified IMP to a carboxyl group can be performed as described in Sinah et al. ((1991) Oligonucleotide Analogues: A Practical Approach, IRL Press). Coupling of an oligonucleotide carrying an attached maleimide to the thiol side chain of a cysteine residue of a peptide is described in Tung et al. (Bioconjug. Chem., 2: 464-465 (1991)).

  The peptide or polypeptide portion of the conjugate can be attached to the 5 'end of the IMP via an amine, thiol, or carboxyl group that is incorporated into the oligonucleotide during synthesis. Preferably, when the oligonucleotide is immobilized on a solid support, a linking group comprising a protected amine, thiol, or carboxyl at one end and a phosphoramidite at the other end is covalently linked to the 5′-hydroxyl. ing. Agrawal et al., Nucleic Acids Res., 14: 6227-6245 (1986); Connolly, Nucleic Acids Res., 13: 4485-4502 (1985); Kremsky et al., Nucleic Acids Res., 15: 2891-2909 (1987); Connolly, Nucleic Acids Res., 15: 3131-3139 (1987); Bischoff et al., Anal. Biochem., 164: 336-344 (1987); Blanks et al., Nucleic Acids Res., 16: 10283-10299 (1988); And U.S. Pat. Nos. 4,849,513, 5,015,733, 5,118,800, and 5,118,802. Following deprotection, amine, thiol, and carboxyl functionality can be used to covalently attach the oligonucleotide to the peptide. Benoit et al. (1987); and Sinah et al. (1991).

  IMP-antigen conjugates can also be formed through non-covalent interactions such as ionic bonds, hydrophobic interactions, hydrogen bonds and / or van der Waals attractions.

  Non-covalently linked conjugates can include non-covalent interactions such as biotin-streptavidin complexes. A biotinyl group can be attached, for example, to a modified base of IMP. Roget et al., Nucleic Acids Res., 17: 7643-7651 (1989). Incorporation of a streptavidin moiety into the peptide moiety allows formation of a non-covalently linked complex of streptavidin-conjugated peptide and biotinylated oligonucleotide.

  Charged residues that can also interact with non-covalent associations via ionic interactions associated with residues within the antigen, such as IMP and charged amino acids, or with both oligonucleotides and antigens Can occur through the use of a linker moiety comprising For example, non-covalent conjugation can occur between a generally negatively charged IMP and a peptide's positively charged amino acid residues, such as polylysine, polyarginine, and polyhistidine residues.

  Non-covalent complexes between IMPs and antigens can occur through the DNA binding motifs of molecules that interact with DNA as their natural ligand. For example, such DNA binding motifs are found in transcription factors and -DNA antibodies.

  Linkage of IMP to lipid can be formed using standard methods. These methods include synthesis of oligonucleotide-phospholipid complexes (Yanagawa et al., Nucleic Acids Symp. Ser., 19: 189-192 (1988)), synthesis of oligonucleotide-fatty acid conjugates (Grabarek et al., Anal. Biochem 185: 131-135 (1990); and Staros et al., Anal. Biochem., 156: 220-222 (1986)), and synthesis of oligonucleotide-sterol conjugates (Boujrad et al., Proc. Natl. Acad Sci). USA, 90: 5728-573 1 (1993)), but is not limited thereto.

  The linkage of the oligonucleotide to the oligosaccharide can be formed using standard known methods. These methods include, but are not limited to, synthesis of oligonucleotide-oligosaccharide conjugates such that the oligosaccharide is part of an immunoglobulin. O'Shannessy et al., J. Applied Biochem., 7: 347-355 (1985).

  Linking a cyclic IMP to a peptide or antigen can be formed in several ways. If the cyclic IMP is synthesized using recombinant or chemical methods, modified nucleosides are suitable. Ruth, “Oligonucleotides and Analogues: A Practical Approach”, IRL Press, (1991). Standard linking techniques can then be used to connect the cyclic IMP to the antigen or other peptide. Goodchild, Bioconjug. Chem., 1: 165 (1990). When the cyclic IMP is isolated and synthesized using recombinant or chemical methods, this linkage is a chemical activation of a reactive group (e.g., a carbene radical) incorporated into an antigen or other peptide, Alternatively, it can be formed by light activation.

  Additional methods for binding peptides and other molecules to oligonucleotides are described in US Pat. No. 5,391,723; Kessler, “Nonradioactive labeling methods for Nucleic Acids”, Kricka (edit), Nonisotopic DNA Probe Techniques, Academic Press. (1992); and Geoghegan et al., Bioconjug. Chem., 3: 138-146 (1992).

  The IMP can also associate with the antigen in other ways. In some embodiments, the IMP and antigen are associated nearby by encapsulation. In another embodiment, the IMP and antigen are associated in close proximity by linkage to a platform molecule. A “platform molecule” (also referred to as “platform”) is a molecule that contains a site that allows binding of IMP and antigen. In other embodiments, the IMP and antigen associate in the vicinity by adsorption to the surface, preferably carrier particles.

  In some embodiments, the methods of the present invention may include an encapsulant (or such an encapsulant that can maintain association in the vicinity of the IMP and the first antigen until the complex is available to the target. A composition comprising). Preferably, the composition comprising IMP, antigen and encapsulant is in the form of an adjuvant oil-in-water emulsion, microparticles and / or liposomes. More preferably, the IMP, such as the covalent and / or non-covalent interaction-adjuvant oil-in-water emulsion, microparticles and / or liposomes encapsulating the immunomodulatory molecule, is about 0.04 μm to about 100 μm in size. It is particulate and preferably in any of the following ranges: from about 0.1 μm to about 20 μm; from about 0.15 μm to about 10 μm; from about 0.05 μm to about 1.00 μm; from about 0.05 μm to about 0.5 μm.

  Colloidal dispersions such as microspheres, beads, polymer composites, nanocapsules and lipid-based systems such as oil-in-water emulsions, micelles, mixed micelles and liposomes provide effective encapsulation of IMP-containing compositions. can do.

  The composition is further comprised of a wide range of components. These include, but are not limited to, alum, lipids, phospholipids, lipid membrane structures (LMS), polyethylene glycol (PEG), and other polymers such as polypeptides, glycopeptides, and polysaccharides.

  Polypeptides suitable for encapsulating components include, but are not limited to, any known in the art and include fatty acid binding proteins. Modified polypeptides include a variety of modifications, including but not limited to glycosylation, phosphorylation, myristylation, sulfation and hydroxylation. Suitable polypeptides as used herein are those that protect IMP-containing compositions to preserve their immunomodulatory activity. Examples of binding proteins include, but are not limited to albumin, such as bovine serum albumin (BSA) and pea albumin.

  Other suitable polymers may be any known in the pharmaceutical art and include, but are not limited to, natural polymers such as dextran, hydroxyethyl starch, and polysaccharides, and synthetic polymers. Examples of natural polymers include proteins, glycopeptides, polysaccharides, dextrans and lipids. The additional polymer may be a synthetic polymer. Examples of synthetic polymers suitable for use in the present invention include, but are not limited to, polyalkyl glycols (PAG) such as PEG, polyoxyethylene polyol (POP) such as polyoxyethylene glycerol (POG), polytrimethylene glycol ( PTG), polypropylene glycol (PPG), polyhydroxyethylene methacrylate, polyvinyl alcohol (PVA), polyacrylic acid, polyethyloxazoline, polyacrylamide, polyvinylpyrrolidone (PVP), polyamino acids, polyurethanes and polyphosphazenes. The synthetic polymer may be a linear or branched, substituted or unsubstituted homopolymer, copolymer or block copolymer of two or more different synthetic monomers.

  PEG for use in encapsulating the composition of the present invention is either purchased from a chemical supplier or synthesized using techniques known to those skilled in the art.

  As used herein, the term “LMS” refers to a layered lipid particle that is arranged such that the polar head group of a polar lipid faces the aqueous phase of the interface and forms a membrane structure. Examples of LMS include liposomes, micelles, cochleates (ie, generally cylindrical liposomes), μ emulsions, monolayer vesicles, multilayer vesicles, and the like.

  A preferred colloidal dispersion of the present invention is a liposome. In mice immunized with antigen encapsulated with liposomes, the liposomes appear to enhance the Th1-type immune response to the antigen. Aramaki et al., Vaccine, 13: 1809-1814 (1995). As used herein, “liposomes” or “lipid vesicles” are small vesicles bound to at least one and possibly more than one bilayer lipid membrane. Liposomes include sonication, extrusion, or removal of surfactant from a lipid-surfactant complex from phospholipids, glycolipids, lipids, steroids such as cholesterol, related molecules, or combinations thereof, Although not limited to these, it is artificially created by a technique known in the art. Liposomes can optionally further comprise additional components, such as tissue targeting components. The “lipid membrane” or “lipid bilayer” need not consist solely of lipids, but may additionally comprise any suitable other components, which include cholesterol and other steroids, fat-soluble chemistry If the material, any length of protein, and the general structure of the membrane is a sheet of two hydrophilic surfaces sandwiching one hydrophobic core, it contains other amphiphilic molecules, but these It is understood that the present invention is not limited to. For a general discussion of membrane structure, see "The Encyclopedia of Molecular Biology", J. Kendrew (1994). For suitable lipids see, for example, Lasic, “Liposomes: from Physics to Applications” (1993), Elsevier, Amsterdam.

  Methods for preparing liposomes containing IMP-containing compositions are known in the art. Lipid vesicles can be prepared by any suitable technique known in the art. Methods include, but are not limited to, microencapsulation, microfluidization, LLC method, ethanol injection, freon injection, “bubble” method, surfactant dialysis, hydration, sonication, and reverse phase evaporation. It is not a thing. Tested in Watwe et al., Curr. Sci., 68: 715-724 (1995). Techniques can be combined to provide the most desirable attributes.

The present invention encompasses the use of LMS containing tissue or cell targeting components. Such targeting components are components of LMS that, when administered to an intact animal, organ, or cell culture, enhance the accumulation of one tissue or cell site in preference to another tissue or cell site. It is. The targeting component is generally accessible from the outside of the liposome and is therefore preferably either bound to the outer surface or inserted into the outer lipid bilayer. Targeting components are small molecules such as peptides, larger peptide regions, antibodies specific for cell surface molecules or markers, or antigen-binding fragments thereof, nucleic acids, carbohydrates, complex carbohydrate regions, special lipids, or drugs. , A hormone, or a hapten bound to any of the aforementioned molecules.
Antibodies with specificity for cell surface markers specific to the cell type are known in the art and are readily prepared by methods known in the art.

  LMS can be targeted to cell types to which therapeutic treatment is directed, eg, cell types that modulate and / or participate in the immune response. Such target cells and organs include APCs such as macrophages, dendritic cells and lymphocytes, lymphoid structures such as lymph nodes and spleen, and non-lymphoid structures, particularly those in which dendritic cells are found. It is not limited to.

  The LMS composition of the present invention may additionally comprise a surfactant. Surfactants can be cationic, anionic, amphiphilic, or nonionic. Preferred surfactant types are nonionic surfactants; particularly preferred are water-soluble.

  In embodiments where the IMP and antigen are in close association by linkage to a platform molecule, the platform can be proteinaceous or non-proteinaceous (ie organic). Examples of proteinaceous platforms include, but are not limited to, albumin, gamma globulin, immunoglobulin (IgG) and ovalbumin. Borel et al., Immunol. Methods, 126: 159-168 (1990); Dumas et al., Arch. Dematol. Res., 287: 123-128 (1995); Borel et al., Int. Arch. Allergy Immunol., 107: 264- 267 (1995); Borel et al., Ann. NY Acad Sci., 778: 80-87 (1996). The platform is multivalent (ie, contains more than one binding or linking site) to accommodate binding to both IMP and antigen. Other examples of polymeric platforms are dextran, polyacrylamide, ficoll, carboxymethylcellulose, polyvinyl alcohol, and poly D-glutamic acid / D-lysine.

The principle of using platform molecules is well understood in the art.
In general, the platform includes or is derivatized to include appropriate binding sites for IMP and antigen. In addition or alternatively, the IMP and / or antigen is derivatized to provide a suitable linking group. For example, a simple platform is a bifunctional linker (ie, having two binding sites) such as a peptide. More examples are discussed below.

  Platform molecules are biologically stabilized to confer therapeutic efficacy, i.e. exhibit an in vivo elimination half-life from time to day to month, and are synthetic single strands of defined composition Preferably, it is configured. These generally have a molecular weight in the range of about 200 to about 1,000,000, preferably any of the following ranges: about 200 to about 500,000; about 200 to about 200,000; about 200 to about 50,000 (or less than, for example, less than 30,000 ). Examples of valency platform molecules include, for example, polyethylene glycol (PEG; preferably having a molecular weight of about 200 to about 8000), poly-D-lysine, polyvinyl alcohol, polyvinyl pyrrolidone, D-glutamic acid and D-lysine (ratio 3: The polymer as in 2). Other molecules that can be used are albumin and IgG.

  Other platform molecules suitable for use in the present invention are chemically defined, non-polymeric valence platform molecules such as those disclosed in US Pat. No. 5,552,391. Other homogeneous chemically defined valency platform molecules suitable for use in the present invention are derivatized 2,2′-ethylenedioxydiethylamine (EDDA) and triethylene glycol (TEG).

  Additional suitable valency platform molecules include tetraaminobenzene, heptaamino beta cyclodextrin, tetraaminopentaerythritol, 1,4,8,11-tetraazacyclotetradecane (Cyclam) and 1,4,7,10-tetra. Including but not limited to azacyclodecane (Cyclen).

  In general, these platforms are created by standard chemical synthesis techniques. PEG must be derivatized and made multivalent, which is achieved using standard techniques. Some materials suitable for complex synthesis such as PEG, albumin, and IgG are commercially available.

  Conjugation of the IMP and antigen to the platform molecule can be accomplished in a number of ways, and typically includes one or more crosslinkers and functional groups for the antigen and IMP platform and platform molecule. The platform and IMP and antigen must have appropriate linking groups. Linking groups are added to the platform using standard synthetic chemistry techniques. Linking groups can be added to polypeptide antigens and IMPs using either standard solid phase synthesis techniques or recombinant techniques. Recombinant methods require post-translational modifications to attach to the linker, and such methods are known in the art.

  As an example, a polypeptide includes an amino acid side chain moiety that includes a functional group, such as an amino, carboxyl or sulfhydryl group, utilized as a binding site for the polypeptide platform. Residues having such functional groups can be added to the polypeptide if the polypeptide already does not contain such groups. Such residues can be incorporated by solid phase synthesis techniques or recombinant techniques, all of which are well known in the art of peptide synthesis. The polypeptide has carbohydrate side chains (or if the antigen is a carbohydrate), functional amino, sulfhydryl and / or aldehyde groups can be incorporated therein by conventional chemistry. For example, primary amino groups can be incorporated by reaction of oxidized sugars with ethylenediamine in the presence of sodium cyanoborohydride, and sulfhydryls can be reacted with cysteamine dihydrochloride followed by reduction with standard disulfide reducing reagents. While aldehyde groups are generated after periodate oxidation. In a similar manner, the platform molecule may be further derivatized to contain a functional group if it does not already contain a suitable functional group.

Various lengths of hydrophilic linkers are useful for attaching IMP and antigen to the platform molecule. Suitable linkers include linear oligomers or polymers of ethylene glycol. Such linkers include linkers of the formula:
R ¹ S (CH ₂ CH ₂ O) _n CH ₂ CH ₂ O (CH ₂ ) _M CO ₂ R ₂ (where n = 0 to 200, m = 1 or 2 and R ¹ = H or protecting group Eg, trityl, R ² = H or alkyl or aryl, eg, 4-nitrophenyl ester). These linkers are useful in conjugating molecules containing thiol reactive groups such as haloacetyl, maleamide and the like via a thioether to a second molecule containing an amino group via an amide bond. These linkers are flexible with respect to the order of attachment, ie the thioether can be formed first or last.

  In an embodiment in which the IMP and the antigen are associated with each other by adsorbing on the surface, the surface may be in the form of carrier particles (for example, nanoparticles) formed with either an inorganic or organic core. Good. Examples of such nanoparticles include, but are not limited to, nanocrystalline particles, nanoparticles made by polymerization of alkyl cyanoacrylate, and nanoparticles made by polymerization of methylidene malonate. Other surfaces on which IMP and antigen can be adsorbed include, but are not limited to, activated carbon particles and protein-ceramic nanoplates. Other examples of carrier particles are presented herein.

  Adsorption of polynucleotides and polypeptides to surfaces for the purpose of delivering adsorbed molecules to cells is well known in the art. For example, Douglas et al., Crit. Rev. Ther. Drug. Carrier Syst., 3: 233-261 (1987); Hagiwara et al., In Vivo, 1: 241-252 (1987); Bousquet et al., Pharm. Res., 16 : 141-147 (1999); and Kossovsky et al., US Pat. No. 5,460,831. Preferably the material comprising the adsorbent surface is biodegradable. Adsorption of IMP and / or antigen to the surface may occur via non-covalent interactions, such as ionic and / or hydrophobic interactions.

  In general, the characteristics of a support such as nanoparticles, such as surface charge, particle size and molecular weight, depend on the polymerization conditions, monomer concentration and the presence of stabilizers during the polymerization process (Douglas et al., 1987). The surface of the carrier particles can be modified, for example, with a surface coating to allow or enhance IMP and / or antigen adsorption. Carrier particles with adsorbed IMP and / or antigen can be further coated with other substances. The addition of such other substances can, for example, extend the half-life of the particles once administered to the subject and / or target the particles to specific cell types or tissues, these Is as described herein.

  Nanocrystal surfaces on which IMP and antigen can be adsorbed have been described (see, eg, US Pat. No. 5,460,831). Nanocrystalline core particles (with a diameter of 1 μm or less) are coated with a surface energy modifying layer that facilitates adsorption of polypeptides, polynucleotides and / or other pharmaceutical substances. As disclosed in US Pat. No. 5,460,831, for example, core particles are coated with a surface that promotes adsorption of oligonucleotides and then antigen preparation, for example, in the form of a lipid-antigen mixture. Coated with objects. Such nanoparticles are self-assembled complexes of nanometer-sized particles that hold the inner layer of IMP and the outer layer of antigen, typically on the order of 0.1 μm.

  Another adsorbing surface is nanoparticles made by polymerization of alkyl cyanoacrylates. Alkyl cyanoacrylates can be polymerized in an aqueous medium acidified by the process of anionic polymerization. Depending on the polymerization conditions, small particles tend to have a size in the range of 20-3000 nm, and this can create nanoparticles with specific surface characteristics and specific surface charges (Douglas et al. 1987). For example, oligonucleotides can be adsorbed to polyisobutyl- and polyisohexyl cyanoacrylate nanoparticles in the presence of hydrophobic cations such as quaternary ammonium salts such as tetraphenylphosphonium chloride or cetyltrimethylammonium bromide. . Oligonucleotide adsorption to these nanoparticles appears to be mediated by the formation of ion pairs between the negatively charged phosphate group of the nucleic acid strand and the hydrophobic cation. For example, Lambert et al., Biochimie, 80: 969-976 (1998), Chavany et al., Pharm. Res., 11: 1370-1378 (1994); Chavany et al., Pharm. Res., 9: 441-449 (1992). Polypeptides can also be adsorbed to polyacrylcyanoacrylate nanoparticles. See, for example, Douglas et al., 1987; Schroeder et al., Peptides, 19: 777-780 (1998).

  Another adsorption surface is nanoparticles made by polymerization of methylidene malonate. For example, as explained in Bousquet et al. (1999), polypeptides adsorbed to poly (methylidene malonate 2.1.2) nanoparticles are adsorbed first by electrostatic force and then by stabilization by hydrophobic force. It seems.

IMP / MC Complex IMP can be administered in the form of an immunomodulatory polynucleotide / microcarrier (IMP / MC) complex. Accordingly, the present invention provides a composition comprising an IMP / MC complex.

  Microcarriers useful in the present invention are about 150, 120 or 100 μm in size, more typically less than about 50-60 μm, preferably less than about 10 μm, and for pure water Insoluble. The microcarriers used in the present invention are preferably biodegradable, but non-biodegradable microcarriers are acceptable. Microcarriers are usually solid phases such as “beads” or other particles, but liquid phase microcarriers such as oil-in-water emulsions comprising biodegradable polymers or oils are also contemplated. A wide range of biodegradable and non-biodegradable materials that are acceptable for use as microcarriers are known in the art.

  Microcarriers for use in the compositions or methods of the present invention typically have a size of less than about 10 μm (eg, an average diameter of less than about 10 μm, or at least about 97% of the particles pass through a 10 μm screen filter). Or include nanocarriers (ie, carriers of a size less than about 1 μm). Preferably, the microcarrier has an upper limit of about 9, 7, 5, 2 or 1 μm or 900, 800, 700, 600, 500, 400, 300, 250, 200 or 100 nm, and independently a lower limit of about 4, 2, Or selected from 1 μm or about 800, 600, 500, 400, 300, 250, 200, 150, 100, 50, 25, or 10 nm, where the lower limit is less than the upper limit. In some embodiments, the microcarrier has a size of about 1.0-1.5 μm, about 1.0-2.0 μm, or about 0.9-1.6 μm. In certain preferred embodiments, the microcarriers have a size of about 10 nm to about 5 μm or about 25 nm to about 4.5 μm, about 1 μm, about 1.2 μm, about 1.4 μm, about 1.5 μm, about 1.6 μm, about 1. 8 μm, about 2.0 μm, about 2.5 μm, or about 4.5 μm. When the microcarrier is a nanocarrier, preferred embodiments include nanocarriers of about 25 to about 300 nm, 50 to about 200 nm, about 50 nm, or about 200 nm.

  Solid phase biodegradable microcarriers are biodegradable polymers such as, but not limited to: biodegradable polyesters such as poly (lactic acid), poly (glycolic acid), and copolymers thereof (including block copolymers) and poly ( Block copolymers of lactic acid) and poly (ethylene glycol); polyorthoesters such as 3,9-diethylidene-2,4,8,10-tetraoxaspiro [5.5] undecane (DETOSU) based polymers; polyanhydrides, Poly (anhydrous) polymers based on relatively hydrophilic monomers such as eg sebacic acid; polyanhydrides, eg sebacic acid-derived monomers incorporating amino acids such as glycine or alanine (ie amino-terminated A polyanhydride polymer based on nitrogen linked to sebacic acid by an imide bond; a polyanhydride ester; a polyphosphine Poly (phosphazenes) (Schacht et al., Biotechnol. Bioeng., 1996: 102 (1996)), which contain hydrolysis-sensitive ester groups that can catalyze the degradation of the polymer backbone through the formation of benzene. As well as polyamides such as poly (lactic acid-co-lysine).

  A wide range of non-biodegradable materials for manufacturing microcarriers are also known, including polystyrene, polypropylene, polyethylene, silica, ceramic, polyacrylamide, dextran, hydroxyapatite, latex, gold, and ferromagnetic or paramagnetic However, it is not limited to these. In some embodiments, gold, latex and / or magnetic beads are excluded. In certain embodiments, the microcarrier can be made of a first material (eg, a magnetic material) encapsulated in a second material (eg, polystyrene).

Solid phase microspheres can be prepared using techniques known in the art. For example, they can be prepared by emulsion-solvent extraction / evaporation techniques.
In general, in this technique, biodegradable polymers such as polyanhydrides, poly (alkyl-α-cyanoacrylates) and poly (α-hydroxyesters) such as poly (lactic acid), poly (glycolic acid), poly (D, L-lactic acid-co-glycolic acid) and poly (caprolactone) are dissolved in a suitable organic solvent such as methylene chloride to constitute the dispersed phase (DP) of the emulsion. DP is emulsified by rapid homogenization into an excess volume of aqueous continuous phase (CP) comprising a dissolved surfactant such as polyvinyl alcohol (PVA) or polyvinyl pyrrolidone (PVP). The surfactant in the CP ensures that isolated and appropriately sized emulsion droplets are formed. The organic solvent is then extracted into CP and subsequently evaporated by raising the temperature of the system. The solid microparticles are then separated by centrifugation or filtration and dried, for example by lyophilization or application of vacuum, and then stored at 4 ° C.

  Physicochemical properties such as the average size, distribution and surface charge of the dried microspheres can be determined. The size characteristics can be determined, for example, by dynamic light scattering techniques, and the surface charge was determined by measuring the zeta potential.

  Liquid phase microcarriers include liposomes, micelles, oil droplets, and other liquid or oil based particles that incorporate biodegradable polymers or oils. In certain embodiments, the biodegradable polymer is a surfactant. In other embodiments, the liquid phase microcarrier is biodegradable due to the inclusion of biodegradable oils such as squalene or vegetable oil. One preferred liquid phase microcarrier is an oil droplet within an oil-in-water emulsion. Preferably, the oil-in-water emulsion used as a microcarrier comprises a biodegradable substituent, such as squalene.

  The IMP / MC complex contains IMP bound to the microcarrier surface (ie, the IMP is not encapsulated in the MC) and preferably comprises a plurality of molecules of IMP bound to each microcarrier. . In certain embodiments, a mixture of various IMPs is complexed with a microcarrier so that the microcarrier is bound to more than one IMP species. The binding between IMP and MC can be covalent or non-covalent. As will be appreciated by those skilled in the art, the IMP may be modified or derivatized and the microcarrier composition may be selected and / or modified to provide the desired binding for IMP / MC complex formation. Fits the desired type.

  Covalently bound IMP / MC complexes can be linked using covalent cross-linking techniques known in the art. Typically, the IMP moiety is modified either by incorporation of an additional moiety (e.g., a free amine, carboxyl or sulfhydryl group) or by incorporation of a modified (e.g., phosphorothioate) nucleotide base so that the IMP moiety is attached to the microcarrier. Provide sites that can be linked. The linkage between the IMP and MC parts of this complex can occur at the 3 'or 5' end of the IMP, or at a suitably modified base at an internal position of the IMP. The microcarrier is generally modified and incorporates a moiety through which a covalent bond is formed, but functional groups normally present on the microcarrier can also be utilized. IMP / MC are activated microcarriers that include an activating moiety that will form a covalent bond with IMP under conditions that allow the formation of a covalent complex (eg, in the presence of a crosslinker, or with IMP). Formed by incubation with IMP microcarriers.

  A wide range of cross-linking techniques are known in the art and include cross-linkers reactive with amino, carboxyl and sulfhydryl groups. As will be apparent to those skilled in the art, the choice of crosslinker and crosslinking protocol will depend on the desired final conformation of the IMP / MC complex in addition to the conformation of the IMP and microcarrier. The crosslinker is either homobifunctional or heterobifunctional. When a homobifunctional crosslinker is used, this crosslinker takes advantage of the same part of IMP and MC (e.g. if both IMP and MC contain one or more free amines, the aldehyde crosslinker is , IMP and MC can be used for covalent linkage.) Heterobifunctional crosslinkers utilize different moieties on the IMP and MC (e.g., maleimide-N-hydroxysuccinimide ester allows the free sulfhydryl on IMP and the free amine on MC to be covalently linked. Used) and the formation of internal-microcarrier bonds is preferably minimized. In most cases, it is preferred to crosslink through a first cross-linked moiety on the microcarrier and a second cross-linked moiety on the IMP, where the second cross-linked moiety is not present on the microcarrier. One preferred method of forming the IMP / MC complex is to incubate the IMP / MC complex by incubating the IMP and activated MC under conditions suitable for subsequent reaction with a heterobifunctional crosslinker. “Activation” of microcarriers by body formation. The crosslinker can incorporate a “spacer” arm between the reactive moieties, or the two reactive moieties within the crosslinker can be directly linked.

  In certain preferred embodiments, the IMP moiety comprises at least one free sulfhydryl (eg, provided by a 5′-thiol modified base or linker) for crosslinking to the microcarrier, while the microcarrier is free. Contains an amine group. Heterobifunctional crosslinkers are reactive with these two groups (eg, crosslinkers including maleimide groups and NHS-esters) so that succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate is , Used to activate MC and then covalently cross-linked to IMP to form IMP / MC complex.

  Non-covalent IMP / MC complexes can be linked by non-covalent bonds or interactions, which is common when the binding pair is linked to IMP and MC, such as ionic (electrostatic force) binding. , Hydrophobic interaction, hydrogen bonding, van der Waals attraction, or a combination of two or more different interactions.

  Preferred non-covalent IMP / MC complexes are typically complexed by hydrophobic or electrostatic (ionic) interactions, or combinations thereof (e.g., between polynucleotides bound to IMP and MC). Using a binding pair through base pairing). Due to the hydrophilic nature of the polynucleotide backbone, an IMP / MC complex that relies on hydrophobic interactions to form a complex generally requires the IMP of this complex to incorporate a highly hydrophobic moiety. Partial modification is required. Preferably, the hydrophobic moiety is biocompatible, non-immunogenic and occurs naturally in the individual for which the composition is intended (eg, found in mammals, particularly humans). Examples of preferred hydrophobic moieties include lipids, steroids, sterols such as cholesterol, and terpenes. The method of linking the hydrophobic moiety to the IMP will naturally depend on the conformation of the IMP and the identity of the hydrophobic moiety. This hydrophobic moiety can be added at any convenient site within the IMP, preferably either at the 5 ′ or 3 ′ end; when the cholesterol moiety is added to the IMP, the cholesterol moiety is Is preferably added to the 5 'end of IMP (see, eg, Godard et al., Eur. J. Biochem., 232: 404-410 (1995)). Preferably, microcarriers for use in IMP / MC composites linked by hydrophobic bonds can be made from hydrophobic materials such as oil droplets or hydrophobic polymers, but include a hydrophobic moiety. Hydrophilic materials modified in this way can also be used. If the microcarrier is a liposome or other liquid phase microcarrier with a lumen, the IMP / MC complex will mix IMP and MC after MC preparation to avoid encapsulation of IMP during the MC preparation process. It is formed by doing.

  Non-covalent IMP / MC complexes linked by electrostatic force bonding typically exhibit a highly negatively charged polynucleotide backbone. Thus, microcarriers for use in non-covalently bound IMP / MC complexes are generally positively charged (cationic) at physiological pH (eg, about pH 6.8-7.4). These microcarriers inherently carry a positive charge, but microcarriers produced from compounds that normally do not have a positive charge are derivatized or otherwise modified to be positively charged (cationic). The For example, the polymer used to make the microcarrier can be derivatized to add a positively charged group, such as a primary amine. Alternatively, the positively charged compound can be incorporated into the microcarrier formulation at the time of manufacture (e.g., using a positively charged surfactant during the manufacture of the poly (lactic acid) / poly (glycolic acid) copolymer to obtain the resulting micro A positive charge can be imparted on the carrier particles).

  To prepare cationic microspheres, cationic lipids or polymers as described herein, for example, 1,2-dioleoyl-1,2,3-trimethylammoniopropane (DOTAP), cetyltrimethylammonium bromide ( CTAB) or polylysine is added to either DP or CP, depending on the solubility of these phases.

  As described herein, IMP / MC complexes can be performed by adsorption onto cationic microspheres, preferably by incubation of the polynucleotide and these particles in an aqueous mixture. Such incubation can also be performed under desired conditions, including ambient temperature (room temperature) (eg, approximately 20 ° C.) or refrigeration (eg, 4 ° C.). Since cationic microspheres and polynucleotides associate relatively quickly, incubation may be at any convenient time interval, including 5, 10, 15 minutes or longer, overnight or longer. . For example, IMP can be adsorbed onto cationic microspheres by overnight aqueous incubation of polynucleotides and particles at 4 ° C. However, since cationic microspheres and polynucleotides associate spontaneously, IMP / MC complexes can be formed by simple co-administration of polynucleotide and MC. Microspheres can be characterized by size and surface charge before and after polynucleotide association. Selected batches can then be evaluated for activity against appropriate controls, for example, in the established human peripheral blood mononuclear cells (PBMC) and mouse splenocyte assays described herein. This formulation can also be evaluated on suitable animal models.

Non-covalent IMP / MC complexes linked by nucleotide base pairing can be made using conventional methodologies. In general, base-paired IMP / MC complexes are made using a microcarrier comprising a bound, preferably covalently linked polynucleotide (“capture polynucleotide”) that is at least partially complementary to the IMP. The The complementary segment between the IMP and the capture nucleotide is preferably at least 6, 8, 10 or 15 contig base pairs, more preferably at least 20 contig base pairs.
This capture nucleotide can be attached to the MC by any method known in the art and is preferably covalently attached to the IMP at the 5 'or 3' end.

In other embodiments, the binding pair can be used for linking IMP and MC in an IMP / MC complex. The binding pair may be a receptor and ligand, antibody and antigen (or epitope), or any other binding pair that binds with high affinity (eg, a Kd of less than about 10 ⁻⁸ ). One type of preferred binding pair is biotin and streptavidin or biotin and avidin, which form a very dense complex. When using a binding pair to mediate IMP / MC complex binding, the IMP is typically derivatized by covalent binding with one member of the binding pair, and the MC is the other of the binding pair. Derivatized by member. A mixture of these two derivatized compounds results in the formation of an IMP / MC complex.

  Many IMP / MC complex embodiments do not include antigens, and some embodiments exclude antigens associated with the disease or disorder that is the subject of IMP / MC complex therapy. In further embodiments, the IMP can also bind to one or more antigen molecules. The antigen can be bound in various ways to the IMP portion of the IMP / MC complex, including covalent and / or non-covalent interactions, as disclosed, for example, in WO 98/16247. . Alternatively, the antigen can be linked to a microcarrier. The linkage between the antigen and the IMP in the IMP / MC complex comprising the antigen bound to the IMP is made by techniques described herein and known in the art, which are directly covalently linked, crosslinker moieties. Including covalent complexes via (which may include spacer arms), non-covalent complexes via specific binding pairs (e.g. biotin and avidin), non-covalent complexes due to electrostatic forces, or hydrophobic bonds However, it is not limited to these.

IMP Complexes with Cationic Condensing Agents and Stabilizers IMP is a composition comprising a cationic condensing agent, IMP, and a stabilizer (ie, CIS) to modulate the immune response of a recipient. Composition). See U.S. Patent No. 60 / 402,968. In some embodiments, the CIS composition may also comprise an antigen and / or a fatty acid.

  The CIS compositions of the present invention are typically present in particulate form. As will be apparent to those skilled in the art, the CIS particle composition of the present invention will consist of groups of particles of different sizes. Due to this spontaneous variation, the particle “size” of the composition of the present invention can be issued in a range or as a maximum or minimum diameter. A particle is considered to be of a certain size if at least 95% (per mass) of the particles meet the specified dimensions (eg, if at least 97% of the particles are less than 20 μm in diameter, the composition is Considered to consist of particles with a diameter of less than 20 μm). Particle size can be determined by any conventional method known in the art, such as filtration (eg, use of a “depth” filter to capture particles larger than the cutoff size), dynamic light scattering, electron microscopy, It can be measured by TEM (particularly in combination with freeze fracture treatment), SEM and the like.

  Preferably, the CIS composition of the invention comprises particles that are less than about 50 μm in diameter, more preferably less than about 20 μm in diameter, although in some embodiments the particles are less than about 3, 2 or 1 μm in diameter. Will. Preferred particle sizes include diameters of about 0.01 μm to 50 μm, 0.02 to 20 μm, 0.05 to 5 μm, and 0.05 to 3 μm.

  The components of the CIS composition may be present in the composition in various ratios / amounts, but the amount of stabilizer and optional components such as fatty acids and antigens remains relatively unchanged, provided that they are stable. The agent generally ranges from about 0.1% to 0.5% (v / v), the fatty acid ranges from about 0 to 0.5%, and the antigen concentration is from about 0.1 to about 100 μg / mL, Preferably it ranges from about 1 to about 100 μg / mL, more preferably from about 10 to 50 μg / mL. The amounts and ratios of IMP and cationic condensing agent are subject to a greater variation range of the composition of the present invention. The amount of IMP varies to some extent depending on the molecular weight of IMP and generally ranges from about 50 μg / mL to about 2 mg / mL, preferably from about 100 μg / mL to 1 mg / mL. The cationic condensing agent is generally in excess of IMP (by weight), generally from about 1: 2 (IMP: cationic condensing agent) to about 1: 6, more preferably from about 2: 5 to 1: It exists at a ratio of 5.

  The particle size of the CIS composition depends on a number of variables. The particle size distribution in the composition can be adjusted by changing the ratio of cationic condensing agent to IMP. For example, by changing the ratio of cationic condensing agent to IMP in an exemplary composition with ISS / 0.4% Tween 85 / 0.4% oleic acid / polymyxin B, the average particle size is increased by cationic condensation. Agent: What is about 1.5 μm when IMC = 1 can be changed to about 45 μm when cationic condensing agent: IMP = 10.

  In some embodiments, the CIS composition comprises a cationic condensing agent, IMP, and a stabilizing agent that is a nonionic surfactant. In another embodiment, the composition comprises a membrane disrupting cationic lipopeptide (preferably polymyxin, more preferably polymyxin B), IMP and a stabilizer. In some embodiments, the stabilizer is not a serum protein (particularly not a bovine serum protein). An exemplary composition of this class of classes utilizes a polyoxyethylene ether surfactant such as Tween 80 or Tween 85 as a stabilizer and includes oleic acid as an optional additional stabilizer.

  In some embodiments, the CIS composition comprises immunomodulatory particles produced by combining a cationic condensing agent, an IMP, and a stabilizing agent that is a nonionic surfactant. In other embodiments, the compositions of the present invention comprise immunomodulatory particles produced by combining a membrane disrupting cationic lipopeptide (preferably polymyxin, more preferably polymyxin B) with an IMP and a stabilizer. It consists of In some embodiments, the stabilizer is not a serum protein (particularly not a bovine serum protein).

  In some embodiments, the CIS composition combines an IMP with a stabilizer that is a nonionic surfactant, thereby forming an IMP / stabilizer mixture, and a cationic condensing agent and an IMP / stabilizer. Comprising immunomodulatory particles formed by the step of combining with the mixture. In other embodiments, the compositions of the present invention combine IMP and a stabilizer that is a nonionic surfactant, thereby forming an IMP / stabilizer mixture, and a membrane disrupting cationic lipopeptide ( Preferably comprising immunomixing particles formed by combining polymyxin, more preferably polymyxin B) and an IMP / stabilizer mixture. In some embodiments, the stabilizer is not a serum protein (particularly not a bovine serum protein).

  In some embodiments, the CIS composition comprises an immunomodulatory particle comprising a cationic condensing agent and an IMP and a stabilizing agent that is a nonionic surfactant. In another embodiment, the composition of the invention comprises immunomodulatory particles comprising a membrane disrupting cationic lipopeptide (preferably polymyxin, more preferably polymyxin B), IMP and a stabilizer. In some embodiments, the stabilizer is not a serum protein (particularly not a bovine serum protein).

  Cationic condensing agents useful in CIS compositions and methods using CIS compositions are molecules that are positively charged at physiological pH (ie, a pH of about 7.0 to about 7.5). Preferably, the cationic condensing agent used in the present invention is a zwitterion or polycation, i.e. has more than one positive charge per molecule. Cationic condensing agents useful in the present invention include hydrophilic or amphiphilic polycations.

Preferred cationic condensing agents are: (a) membrane disrupting cationic lipopeptides such as, but not limited to, polymyxins such as polymyxin A, polymyxin B (eg polymyxin B ₁ and polymyxin B ₂ ), polymyxin C, polymyxin D, polymyxin E (also known as colistin), polymyxin K, polymyxin M, polymyxin P, polymyxin S and polymyxin T, circulin such as circulin A, circulin B, circulin C, circulin D, circulin E and circulin F, Octapeptin, amphotericin, such as amphotericin B, and acylated peptides, such as octanoyl-KFFKFFKFF and acyl KALA (octanoyl-WEAKLAKALAKAKLAKLAKALACALACEAEA (B) membrane-breaking cationic peptides, such as, but not limited to, polymyxin B nonapeptide, cecropin, such as cecropin A, cecropin B and cecropin P1, KFFKFFKFF and KALA (WEAKLAKALAKALAKHLAKALAKALKACEA); (c) single chain cationic surfactants For example, but not limited to cetyltrimethylammonium bromide (CTAB), benzyldimethyl-ammonium bromide (BDAB), CpyrB (cetyl-pyridinium bromide), CimB (cetylimidazolium bromide), and polycationic polymers, such as, but not limited to, poly -L-lysine (PLL) and polyethyleneimine (PEI) In some embodiments, the cationic condensing agent is a membrane disrupting cationic lipopeptide, preferably Or polymyxin B, more preferably polymyxin B. In some embodiments, the cationic condensing agent may exclude fatty acid esters (ie lipids) and double-chain cationic surfactants.

  Stabilizers useful in CIS compositions and methods using CIS compositions include those that are suspendable in water and that subsurface the surface tension of water, but are water soluble and / or water. Stabilizers that are completely miscible are preferred. A number of stabilizer groups are useful in the compositions and methods of the present invention, such as proteins (preferably hydrophilic proteins), nonionic surfactants, polymeric surfactants (eg, polyvinyl alcohol and polyvinyl pyrrolidone). , Cationic surfactants, anionic surfactants and fatty acids, but in some embodiments, serum proteins (particularly bovine serum proteins), fatty acids, and / or ionic surfactants from the definition of stabilizer. May be excluded.

  Any protein may be used as the stabilizer of the present invention. In some embodiments, the stabilizer is a protein that is not intended as an antigen (see discussion below); in these embodiments, the protein is from the same species as the subject recipient of the composition. It is preferably derived (eg, if the composition is intended for use in humans, the protein used as the stabilizer is preferably a human protein). Serum albumin is an exemplary protein useful as a stabilizer in the above embodiments. In other embodiments, the antigen is utilized as a stabilizer when the antigen is not required and is usually incompatible with the subject recipient. Antigens useful in the compositions and methods of the present invention are described below.

Nonionic surfactants useful in CIS compositions and methods using CIS compositions include glucamide, such as decyldimethylphosphine oxide (APO-10) and dimethyldodecylphosphine oxide (APO-12), octanoyl- N-methylglucamide (MEGA-8), nonanoyl-N-methylglucamide (MEGA-9) and decanoyl-N-methylglucamide (MEGA-10), polyoxyethylene ether surfactants such as polyoxyethylene ( 10) Dodecyl ester (Genapol C100), polyoxyethylene (4) lauryl ether (BRIJ (registered trademark) 30), polyoxyethylene (9) lauryl ether (LUBROL (registered trademark) PX), polyoxyethylene (23) lauryl ether BRIJ (registered trademark) 35), polyoxyethylene (2) cetyl ether (BRIJ (registered trademark) 52), polyoxyethylene (10) cetyl ether (BRIJ (registered trademark) 56), polyoxyethylene (20) cetyl ether (BRIJ (registered trademark) 58) polyoxyethylene (2) stearyl ether (BRIJ (registered trademark) 72), polyoxyethylene (10) stearyl ether (BRIJ (registered trademark) 76), polyoxyethylene (20) stearyl ether (BRIJ (registered trademark) 78), polyoxyethylene (100) stearyl ether (BRIJ (registered trademark) 700), polyoxyethylene (2) oleyl ether (BRIJ (registered trademark) 92), polyoxyethylene (10) oleyl Ether (BRIJ®) 97), polyoxyethylene (20) oleyl ether (BRIJ (registered trademark) 98), isotridecyl poly (ethylene glycol ether) ₈ (Genapol 80), PLURONIC (registered trademark) F-68, PLURONIC (registered trademark) F- 127, dodecyl poly (ethylene glycol ether) ₉ (Thesit), polyoxyethylene (10) isooctyl phenyl ether (TRITON (registered trademark) X-100), polyoxyethylene (8) isooctyl phenyl ether (TRITON (registered trademark)) X-114), polyethylene glycol sorbitan monolaurate (TWEEN (registered trademark) 20), polyoxyethylene sorbitan palmitate (TWEEN (registered trademark) 40), polyethylene glycol sorbitan mono Tearate (TWEEN® 60), polyoxyethylene sorbitan tristearate (TWEEN® 65), polyethylene glycol sorbitan monooleate (TWEEN® 80), polyoxyethylene (20) sorbitan oriole Ate (TWEEN® 85), poloxamer 188, and polyethylene glycol-p-isooctylphenyl ether (Nonidet NP40), alkyl maltoside surfactants such as cyclohexyl-n-ethyl-β-D-maltoside, cyclohexyl-n -Hexyl-β-D-maltoside, and cyclohexyl-n-methyl-β-D-maltoside, n-decanoyl sucrose, glucopyranoside such as methyl 6-O- (N-heptylcarbamoyl)- -D-glucopyranoside (HECAMEG) and alkyl glucopyranoside, such as n-decyl-β-D-glucopyranoside, n-heptyl-β-D-glucopyranoside, n-dodecyl-β-D-glucopyranoside, n-nonyl-β-D- Glucopyranoside, n-octyl-α-D-glucopyranoside, n-octyl-β-D-glucopyranoside, alkylthioglucopyranoside, such as n-heptyl-β-D-thioglucopyranoside, alkylmaltopyranoside, such as n-decyl-β -D-maltopyranoside and n-octyl-β-D-maltopyranoside, n-decyl-β-D-thiomaltoside, digitionin, n-dodecanoyl sucrose, n-dodecyl-β-D-maltoside, heptane 1,2 , 3-triol, n-octanoy -Β-D-glucosylamine (NOGA), n-octanoyl sucrose, poloxamers (polyoxyethylene / polyoxypropylene block copolymers) such as poloxamer 188 and poloxamer 407, and sulfobetamines such as SB-10, SB-12 and SB -14 as well as n-undecyl-β-D-maltoside. Preferred stabilizers include polyoxyethylene ether surfactants, particularly polyethylene glycol sorbitan monooleate and polyoxyethylene (20) sorbitan trioleate.

  Anionic surfactants useful in CIS compositions and methods using CIS compositions include caprylic acid and its salts, chenodeoxycholic acid and its salts, cholic acid and its salts, decanesulfonic acid and its salts, deoxycholic acid And salts thereof, glycodeoxycholic acid and salts thereof, lauroyl sarcosine and salts thereof, n-dodecyl sulfate and salts thereof (for example, sodium salt and lithium salt), taurochenodeoxycholic acid and salts thereof, taurocholic acid and salts thereof, taurolithol Acids and salts thereof, and tauroursodeoxycholic acid and salts thereof.

  Cationic surfactants include cetylpyridinium and its salts, cetyltrimethylammonium and its salts such as cetyltrimethylammonium bromide (CTAB), dodecyltrimethylammonium and its salts such as dodecyltrimethylammonium bromide, alkylammonium imidazoline, quaternary. Grade imidazolines, and tetradecyltrimethylammonium and its salts such as tetradecyltrimethylammonium bromide are included.

  The surfactant selected for use as a stabilizer is preferably one that is considered an oil / water emulsifying surfactant. Oil / water emulsifying surfactants are known in the art and are typically characterized by a hydrophobic / lipophilic balance (HLB) value of about 8 to about 18. Preferably, the surfactant incorporated in the particle composition has an HLB value of about 10 to about 16, more preferably about 11 to about 15 (eg, HLB = 15.4 of polyethylene glycol sorbitan monoleate; poly HLB of oxyethylene (10) isooctyl phenyl ether = 13.5; HLB of polyoxyethylene (20) sorbitan trioleate = 11).

  In some embodiments, the CIS composition may also include one or more fatty acids, or salts thereof, as additional components. In embodiments where a fatty acid is utilized as a stabilizer component and a fatty acid as an additional component of the composition, the fatty acid utilized as the stabilizer will be different from the fatty acid used as the “additional” component. Fatty acids useful in the CIS compositions of the present invention can range in size from 4 to 30 carbon atoms and are unsaturated (eg, stearic acid), monounsaturated (eg, oleic acid), or polyvalent Although unsaturated (for example, linolenic acid) may be used, monounsaturated fatty acids and polyunsaturated fatty acids are usually preferred.

  In some embodiments, the CIS composition is at least 4, 5, 6, 8, 10, 15, 18, or 20 carbon atoms and less than about 30, 25, 20, 19, 15, or 10 carbons. Atoms will incorporate fatty acids having a carbon chain length. Thus, in some embodiments, the fatty acids utilized in the present invention may have carbon chains with carbon atoms in the range of about 4-30, 5-25, 10-20, or 15-20.

  Fatty acids useful in CIS compositions include, but are not limited to, arachidonic acid, decanoic acid, docosanoic acid, docosahexaenoic acid, eicosanoic acid, heneicosanoic acid, heptadecanoic acid, heptanoic acid, hexanoic acid, lauric acid, linoleic acid, linolenic acid, Myristic acid, nonadecanoic acid, nonanoic acid, octanoic acid, oleic acid, palmitic acid, pentadecanoic acid, stearic acid, tetracosanoic acid, tricosanoic acid, tridecanoic acid, and undecanoic acid are included. Preferred fatty acids for use in the CIS composition include oleic acid, palmitoleic acid, and linoleic acid.

  In some embodiments of the invention, the antigen is incorporated into the CIS composition or is administered together with the CIS composition. These CIS compositions incorporating an antigen can incorporate the antigen into the particle composition itself, or can be dissolved or suspended in a solution in which the particle composition is suspended. Any antigen can be incorporated into the CIS composition of the present invention or co-administered with the composition.

Methods of the Invention As described herein, the IMP of the invention specifically stimulates the production of IL-6, TNF-α, IFN-γ and type I interferons, such as IFN-α and IFN-ω, May stimulate B cell proliferation and / or activate and differentiate plasmacytoid dendritic cells. The IMPs of the present invention also include other cytokines, chemokines and activation-related proteins such as, but not limited to, IP-10 (interferon-inducing protein 10 kDa), MCP-1 (monocyte chemotactic protein 1), MCP-2, Production of MCP-3, MIG, MIP-3b, CD80, CD86, CD40, CD54 and MHC class II may also be stimulated. The IMPs of the present invention also include IFN-α-inducible genes, including but not limited to 2,5-oligoadenylate synthase (2,5-OAS), interferon-stimulated gene-54K (ISG-54K) and guanylate-binding protein- 1 (GBP-1) expression can be stimulated. The immunomodulatory polynucleotides of the invention may also provide a signal that delays apoptosis of plasmacytoid dendritic cells. The immunomodulatory polynucleotides of the invention can also stimulate natural killer (NK) cytolytic activity. Thus, the IMP of the present invention is particularly effective in modulating an individual's immune response.

  The present invention provides a method of modulating an immune response in an individual, preferably a mammal, more preferably a human, comprising administering to the individual an IMP as described herein. Immunomodulation may include stimulation of a Th1-type immune response and / or inhibition or attenuation of a Th2-type immune response. IMP is administered in an amount sufficient to modulate the immune response. As described herein, modulation of the immune response may be humoral and / or cellular and is measured using standard techniques in the art and as described herein. The

  For example, an immune response of an animal or cell population, such as a mammal, optionally a human, blood cells (eg, PBMC, lymphocytes, dendritic cells), bronchoalveolar lavage cells, or a cell population comprising other cells or ISS-reactive cells Is achieved by contacting the cell with an IMP or an IMP-containing composition described herein (eg, IMP, IMP and antigen, IMP-antigen conjugate, IMP / microcarrier complex, etc.). The Modulation can be achieved by any form of contact, including, but not limited to, in vitro incubation of cells and IMP in vitro, application of IMP to mammalian (eg, laboratory animal) skin, and parenteral administration.

  The immune response of an animal or cell population can be determined by any method, including one or more of IFN-γ, IFN-α, IL-2, IL-12, TNF-α, IL-6, IL-4, IL-5, IP -10, ISG-54K, increased expression of MCP-1, or changes in characteristics of gene expression profiles of immune stimuli, and reactions such as B cell proliferation and dendritic cell maturation. The ability to stimulate the immune response of a cell population has a number of uses, such as in an assay system for immunosuppressive agents.

  A large number of individuals are suitable for receiving the immunomodulatory polynucleotides described herein. Preferably, but not necessarily, the individual is a human.

  In some embodiments, the individual suffers from a disorder associated with a Th2-type immune response, such as allergy or allergy-induced asthma. Administration of IMP results in immune regulation and increases the levels of cytokines associated with one or more Th1-type responses, which can result in a reduction in the characteristics of the Th2-type response associated with the individual's response to the allergen. Immunomodulation of an individual with a disorder associated with a Th2-type response results in a reduction or amelioration of one or more symptoms of the disorder. If the disorder is allergy or allergy-induced asthma, the amelioration of one or more symptoms includes one or more of the following relief: rhinitis, allergic conjunctivitis, circulating IgE levels, circulating histamine levels And / or requirements for “rescue” inhalation therapy (eg, inhaled albuterol administered by a dose-measuring inhaler or nebulizer).

  In a further embodiment, the individual subject for the immunomodulatory therapy of the present invention is an individual receiving a vaccine. This vaccine may be either a prophylactic vaccine or a therapeutic vaccine. A prophylactic vaccine comprises one or more epitopes associated with a disorder that an individual may be at risk (eg, M. tuberculosis antigen as a preventive vaccine for tuberculosis). A therapeutic vaccine is one or more epitopes associated with a particular disorder that the individual is afflicted with, eg, M. pneumoniae in tuberculosis patients. M. tuberculosis or M. tuberculosis M. bovis surface antigens, antigens that are allergic in allergic individuals (ie, allergic desensitization therapy), tumor cells from cancer individuals (eg, disclosed in US Pat. No. 5,484,596) ), Or a tumor-associated antigen in a cancer patient. As shown in Example 3 below, administration of IMP combined with hepatitis B surface antigen (HBsAg), a hepatitis virus antigen, increased the anti-HBsAg antibody titer in primates compared to administration of HBsAg alone. Arise.

The IMP can be given together with the vaccine (eg, by the same injection, or simultaneously but by separate injections), or the IMP can be administered individually (eg, before or after administration of the vaccine). , At least 12 hours). In certain embodiments, the antigen of the vaccine is part of an IMP linked either covalently or non-covalently to the IMP. Administration of an immunomodulatory polynucleotide therapy to an individual receiving a vaccine results in an immune response to the vaccine biased to a Th1-type response compared to an individual receiving the vaccine without IMP. The bias towards Th1-type response is due to delayed hypersensitivity (DTH) response to antigens in vaccines, cytokines associated with increased IFN-γ and other Th1-type responses, production of CTLs specific to vaccine antigens Decreased or attenuated levels of IgE specific for vaccine antigen, decreased Th2-related antibody specific for vaccine antigen, and / or increased Th1-related antibody specific for vaccine antigen . In the case of therapeutic vaccines, administration of IMP and vaccine results in the recovery of one or more symptoms of the disorder for which the vaccine is intended for treatment.
As will be apparent to those skilled in the art, the exact symptoms and methods for their improvement will depend on the disorder sought to be treated. For example, if the therapeutic vaccine is for tuberculosis, IMP treatment with the vaccine results in relief of cough, pleural or chest wall pain, fever and / or other symptoms known in the art. If the vaccine is an allergen used in allergic desensitization therapy, this treatment may reduce allergic symptoms (e.g. rhinitis, allergic conjunctivitis, circulating blood levels of IgE, and / or circulating blood levels of histamine). Decrease).

Other aspects of the invention relate to immunomodulatory therapy for individuals with pre-existing diseases or disorders, such as cancer or infection. Cancer is an attractive target for immunomodulation because most cancers express tumor-related and / or tumor-specific antigens that are not found in other cells in the body. Stimulation of a Th1-type response to tumor cells results in direct and / or bystander killing of the tumor cells by the immune system, leading to a decrease in cancer cells and / or a reduction in symptoms. Administration of IMP to individuals with cancer results in stimulation of a Th1-type immune response against tumor cells. Such an immune response may cause tumor cells to become bioactive by direct action of cellular immune system cells (e.g., CTL) or components of the humoral immune system, or by cells adjacent to cells targeted by the immune system. Killed by any of the standard actions. See, for example, Cho et al., Nat. Biotechnol., 18: 509-514 (2000). In the context of cancer, administration of IMP may further include administration of one or more additional therapeutic agents, such as anti-tumor antibodies, chemotherapy regimes and / or radiation therapy. Anti-tumor antibodies, such as but not limited to anti-tumor antibody fragments and / or derivatives thereof, and monoclonal anti-tumor antibodies, fragments and / or derivatives thereof, are Are known in the art, such as administration of various antibody reagents (eg, RITUXAN® (rituximab); HERCEPTIN® (transtuzumab)). Administration of one or more additional therapeutic agents may occur before, after and / or simultaneously with administration of IMP.

  The immunomodulatory therapy of the present invention is also useful for individuals with infections, particularly infections that are resistant to humoral immune responses (eg, mycobacterial infections and diseases caused by intracellular pathogens). Immunomodulatory therapy can be used for the treatment of infections caused by cellular pathogens (eg bacteria or protozoa) or by subcellular pathogens (eg viruses). IMP therapy is associated with tuberculosis (eg, M. tuberculosis and / or M. bovis infection), Hansen's disease (ie, M. leprae infection). ), Or M. M. marinum or M.M. It can be administered to an individual suffering from a mycobacterial disease such as an M. ulcerans infection. IMP therapy is further used to treat viral infections, including infections caused by influenza virus, respiratory syncytial virus (RSV), hepatitis B virus, hepatitis C virus, herpes virus, especially herpes simplex virus, and papilloma virus. Is also useful. Malaria (eg infection by Plasmodium vivax, P. ovale, P. falciparum and / or P. malariae) Leishmania (eg, Leishmania donovani, L. tropica, L. mexicana, L. braziliensis, L. perbiana) peruviana), L. infantum, L. chagasi, and / or L. aethiopica infections), and toxoplasmosis (ie, Toxoplasmosis gonzii) Diseases caused by intracellular parasites such as (infection caused by Toxoplasmosis gondii) also benefit from IMP therapy. IMP therapy is further performed by schistosomiasis (i.e., Schistosoma genus, e.g., S. haematobium, S. mansoni, S. japonicum), and Mekong schistosomiasis (S. It is also useful for the treatment of parasitic diseases such as infections due to blood-sucking insects such as mekongi) and liver-sucking insects (ie infections due to Clonorchis sinensis). Administration of IMP to an individual suffering from an infection results in a recovery of the symptoms of the infection. In some embodiments, the infectious disease is not a viral disease.

The invention further provides a method of increasing or stimulating at least one of Th1-related cytokines in an individual, comprising IL-2, IL-12, TNF-β, IFN-γ and IFN-α. Including.
In some embodiments, the invention provides a method of increasing or stimulating IFN-γ in an individual, particularly an individual in need of increased IFN-γ levels, by administering an effective amount of IMP to the individual. A method for increasing INF-γ. An individual in need of an increase in IFN-γ is a person with a disorder that generally responds to administration of IFN-γ. Such disorders include many inflammatory diseases such as but not limited to ulcerative colitis. Such disorders also result in many fibrotic diseases such as, but not limited to, idiopathic pulmonary fibrosis (IPF), scleroderma, cutaneous radiation-induced fibrosis, liver fibrosis such as schistosomiasis-induced liver fibrosis , Renal fibrosis and other conditions that can be ameliorated by administration of IFN-γ. Administration of the IMP / MC complex of the present invention results in an increase in IFN-γ levels and recovery of one or more symptoms, stabilization of one or more symptoms, or progression of disease in response to IFN-γ. Providing prevention (eg, reduction or elimination of additional lesions or symptoms).

  The methods of the invention can be performed in conjunction with other therapies that constitute a standard treatment for the disorder, such as administration of anti-inflammatory agents in IPF, such as systemic corticosteroid therapy (eg, cortisone).

  In some embodiments, the present invention provides a method for increasing type I interferons, such as IFN-α, IFN-β and IFN-ω, in an individual, particularly an individual in need of increased type I interferon levels, Methods of increasing type I interferon levels by administering an amount of IMP are provided. In some embodiments, the present invention provides a method for increasing IFN-α in an individual, particularly an individual in need of increased INF-α levels, by administering an effective amount of IMP, whereby IFN-α levels are increased. Provides a method of increasing. An individual in need of an increase in IFN-α is generally one who has a disorder that is responsive to administration of IFN-α, such as recombinant IFN-α, such as viral infection and cancer. In some embodiments where higher levels of increased production of IFN-α are desired, the IMP is at least the following lengths (base lengths): 10, 12, 14, 16, 18, 20, 22, 24 , 26, 28 or 30 and in some embodiments, the IMP comprises at least one palindromic sequence having a length greater than 30 bases.

  Administration of the IMP of the present invention results in an increase in IFN-α levels and recovery of one or more symptoms, stabilization of one or more symptoms, and / or prevention of progression of a disorder responsive to IFN-α or Cause delay (eg, reduction or elimination of additional lesions or symptoms). The method of the invention can be carried out in conjunction with other therapies that constitute a standard treatment for the disorders, such as the administration of antiviral agents for viral infections.

  Also provided is a method of reducing IgE levels, particularly serum levels, in an individual with an IgE-related disorder by administering an effective amount of IMP to the individual. In such methods, the immunomodulatory polynucleotide can be administered alone (eg, without an antigen) or with an antigen such as an allergen. Reduction in IgE results in the recovery of one or more symptoms of IgE-related disorders. Such symptoms include allergic symptoms such as rhinitis, conjunctivitis, reduced sensitivity to allergens, reduced allergic symptoms in allergic individuals, or reduced severity of allergic reactions. Accordingly, the present invention also provides a method for treating an allergic condition in an individual. In some embodiments, a method of treating an allergic condition comprises administering an immunomodulatory polynucleotide with a specific amount or a specific dose of antigen. With any additional antigen administration, the amount or dose of antigen administered can be maintained, decreased, or increased during treatment (as in conventional desensitization therapy). .

  In some embodiments, the present invention provides a method of stimulating CTL production in an individual, particularly an individual in need of increased CTL number and / or activity, wherein an effective amount of IMP is added to the individual so that CTL production is increased. A method comprising the steps of: An individual in need of increased CTL production is generally a person with a disorder that responds to CTL activity. Such disorders include, but are not limited to, cancer and cell infections. Administration of the IMPs of the present invention results in an increase in CTL levels and prevention or delay of the recovery of one or more symptoms, stabilization of one or more symptoms and / or progression of a disorder responsive to CTL activity (e.g. Resulting in additional focus or reduction or disappearance of symptoms).

  The methods of the invention can be used in any aspect described herein, such as IMP (with or without antigen, or with or without antigen over the course of administration) in the form of an immunomodulatory polynucleotide / microcarrier complex, Alternatively, it includes administration of an IMP that is closely associated with the antigen.

  As will be apparent to those skilled in the art, the methods of the invention can be practiced in combination with other therapies for the particular indication for which IMP is administered. For example, IMP therapy may be combined with anti-malarial drugs such as chloroquinone for malaria patients and combined with leishmaniacidal drugs such as pentamidine and / or allopurinol for leishmania patients. Can be administered in combination with anti-mycobacterial drugs such as isoniazid, rifampin and / or ethambutol or in combination with allergen desensitization therapy for atopic (allergy) patients.

  As described herein, administration of IMP further includes, but is not limited to, cytokines, adjuvants and antibodies (including antibody fragments and / or derivatives and monoclonal antibodies, fragments and / or derivatives thereof). Administration of one or more additional immunotherapeutic agents (ie, substances that act on the immune system and / or substances derived from the immune system). Examples of therapeutic antibodies include those used in cancer settings (eg, anti-tumor antibodies). Administration of such additional immunotherapeutic agents applies to all methods described herein.

  IMP can also be administered in combination with an adjuvant. Administration of an antigen and IMP and an adjuvant can lead to an enhanced immune response to that antigen, resulting in an enhanced immune response compared to that resulting from a composition comprising only IMP and the antigen. Adjuvants are known in the art and include, but are not limited to, oil-in-water emulsions, water-in-oil emulsions, alum (aluminum salts), liposomes, and polystyrene, starch, polyphosphazenes and polylactide / polyglycerides. Including but not limited to microparticles. Other suitable adjuvants are also MF59, DETOX® (Ribi), squalene mixture (SAF-1), muramyl peptide, saponin derivative, mycobacterial cell wall preparation, monophosphoryl lipid A, mycolic acid derivative, non- Ionic block copolymer surfactants, Quil A, cholera toxin B subunits, polyphosphazenes and derivatives, and immune stimulating complexes (ISCOMs) as described in Takahashi et al. (Nature, 344: 873-875 (1990)). ) In addition to lipid-based adjuvants and others described herein. Freund's adjuvant (both complete and incomplete) mitogenic components can be used for veterinary applications and antibody production in animals.

Administration and Evaluation of Immune Response As described herein, IMP can be administered together with other pharmaceutical and / or immunogenic and / or immunostimulatory substances and their physiological It can be combined with an acceptable carrier (thus the present invention includes these compositions). The IMP may be any of those described herein.

  Thus, IMP can be administered in combination with other immunotherapeutic agents such as, but not limited to, cytokines, adjuvants and antibodies.

  As with all immunogenic compositions, the immunologically effective amount and method of administration of a particular IMP formulation will vary based on factors apparent to the individual, what condition is being treated, and those skilled in the art. be able to. Factors to consider are: antigenicity when the antigen is administered, whether IMP is administered with or covalently attached to an adjuvant, delivery molecule and / or antigen, route of administration and immunity administered Includes the number of actives. Such factors are known in the art and can be determined by one skilled in the art without undue experimentation. Suitable dosage ranges are those that provide the desired modulation of the immune response (eg, stimulation of IFN-α and / or IFN-γ). Where an immune response to the antigen is desired, an appropriate dosage range is one that provides modulation of the desired immune response to the antigen. In general, dosage is determined by the amount of IMP administered to the patient, rather than the total amount of IMP-containing composition administered. A useful dose range of IMP, when given by the amount of IMP delivered, may be, for example, approximately any of the following: 1-500 μg / kg, 100-400 μg / kg, 200-300 μg / kg, 1-100 μg / kg, 100-200 μg / kg, 300-400 μg / kg, 400-500 μg / kg. The absolute amount administered to each patient depends on pharmaceutical properties such as bioavailability, clearance rate and route of administration.

  The effective amount and method of administration of a particular IMP formulation can vary based on the individual patient, the desired outcome and / or the type of disorder, the stage of the disease and other factors apparent to those skilled in the art. Useful routes of administration for particular applications will be apparent to those skilled in the art. Routes of administration include, but are not limited to, topical, dermal, transdermal, transmucosal, transepidermal, parenteral, gastrointestinal tract, and nasopharynx and transpulmonary including transbronchial and transalveolar. It is not a thing. A suitable dose range is one that provides sufficient IMP-containing composition to achieve a tissue concentration of about 1-10 μm as measured by blood level. The absolute amount administered to each patient depends on pharmacological properties such as bioavailability, clearance rate and route of administration.

  As described herein, tissue with APC and high concentrations of APC is a preferred target for IMP. Therefore, administration of IMP to mammalian skin and / or mucosa is preferred when APC is present at relatively high concentrations.

  The present invention provides IMP formulations suitable for topical application including, but not limited to, physiologically acceptable implants, ointments, creams, rinses and gels. Topical administration is, for example, by a bandage or bandage with a delivery system dispersed therein, by direct administration to an incision or open wound in the delivery system, or percutaneous administration directed to the site of interest. Can depend on the device. Creams, rinses, gels or ointments in which IMP is dispersed are suitable for use as topical ointments or wound fillers.

  The preferred route of dermal administration is the least invasive. Of these means, transdermal delivery, epidermal administration and subcutaneous injection are preferred. Epidermal administration by these means is preferred for relatively high APC concentrations that are expected to be present in intradermal tissue.

  Transdermal administration is achieved by applying creams, rinses, gels, and the like that allow IMP to penetrate the skin and into the bloodstream. Compositions suitable for transdermal administration are pharmaceutically acceptable suspensions, oils, creams that are applied directly to the skin or incorporated into a protective carrier (a so-called “patch”) such as a transdermal device. Including, but not limited to, ointments and ointments. Examples of suitable creams, ointments and the like can be found in, for example, “Doctor's Desk Reference”.

  For transdermal delivery, iontophoresis is a suitable method. Transport by ion osmosis can be accomplished using commercially available patches that deliver their products continuously through unbroken skin for a period of several days or longer. Use of this method allows for controlled delivery of relatively high concentrations of the pharmaceutical composition, allows for infusion of the combination drug, and allows simultaneous use of absorption enhancers.

  An illustrated patch product for use in this method is LECTRO PATCH, a registered trademark product of General Medical, Inc. (Los Angeles, CA). The product can be adapted to be administered continuously and / or periodically to electrically maintain the storage electrode at a neutral pH and to administer different concentrations of the dose. The preparation and use of this patch must be in accordance with the manufacturer's written instructions attached to the LECTRO PATCH product; these instructions are incorporated herein by this reference. Other occlusive patch systems are also suitable.

  For transdermal delivery, low frequency ultrasound delivery is also a suitable method. Mitragotri et al., Science, 269: 850-853 (1995). The application of low frequency (about 1 MHz) ultrasound allows for generally controlled delivery of therapeutic compositions, including those of high molecular weight.

  Epidermal administration is essentially associated with mechanically or chemically stimulating the outermost layer of the epidermis so that it is sufficient to elicit an immune response to the stimulant. In particular, this stimulation must be sufficient to cause APC at the stimulation site.

  An exemplary mechanical stimulation means utilizes a number of very narrow, short tines that can be used to stimulate the skin and induce APC at the stimulation site, and the end of this tine. IMP transferred from For example, the MONO-VACC old tuberculin test manufactured by Pasteur Merieux (Lyon, France) includes equipment suitable for the introduction of IMP-containing compositions.

  The device (distributed in the United States by Connaught Laboratories, Swiftwater, PA) consists of a plastic container with a syringe plunger on one end and a tined disc on the other. The tines disc support a large number of very narrow and short tines that simply scratch the outermost layer of epidermal cells. Each of these tines of the MONO-VACC kit is coated with old tuberculin; in the present invention, each needle is coated with a pharmaceutical composition of an immunomodulatory polynucleotide formulation. Use of the device is preferably in accordance with the manufacturer's written instructions provided with the device product. Similar devices that can be used in this embodiment are those currently used to perform allergy tests.

  Another suitable method of epidermal administration of IMP is the use of chemicals that stimulate the outermost cells of the epidermis, thereby eliciting an immune response sufficient to attract APC to that area. An example is a keratinocyte solubilizing substance such as salicylic acid used in a commercial topical hair removal cream sold under the trademark NAIR by the company Noxema. This method can also be used to achieve epithelial administration in the mucosa. Chemical stimulants can also be applied in combination with mechanical stimulants (eg, as occurs when the MONO-VACC type tines are also coated with chemical stimulants). The IMP can be suspended in a carrier that also contains a chemical stimulant or co-administered therewith.

  Parenteral routes of administration include electrical (iontophoresis) or direct injection, such as direct injection into the central venous system, intravenous, intramuscular, intraperitoneal, intradermal, or subcutaneous injection, but these It is not limited to. Formulations of IMPs suitable for parenteral administration are generally formulated in USP water or water for injection and further contain pH buffers, salt extenders, preservatives and other pharmaceutically acceptable excipients. Also good. Immunomodulatory polynucleotides for parenteral injection can be formulated in pharmaceutically acceptable sterile isotonic solutions such as injectable saline and phosphate buffered saline.

  Gastrointestinal routes of administration include, but are not limited to, feeding and rectal. The present invention includes pharmaceutically acceptable powders, pills, or solutions for oral ingestion, and IMPs suitable for gastrointestinal administration, including but not limited to rectal administration. Contains formulation. As will be apparent to those skilled in the art, pills or suppositories further comprise a pharmaceutically acceptable solid, such as starch, to provide the bulk of the composition.

  Nasopharyngeal and pulmonary administration includes those achieved by inhalation and includes delivery routes such as intranasal, intrabronchial and intraalveolar routes. The present invention includes IMP formulations suitable for administration by inhalation, including, but not limited to, powder forms for dry powder inhalation delivery systems in addition to liquid suspensions for aerosol formation. Devices suitable for administration by inhalation of IMP formulations include, but are not limited to, atomizers, vapor inhalers, nebulizers, and dry powder inhalation delivery devices.

  As is well known in the art, solutions or suspensions used in the routes of administration described herein may comprise one or more of the following components: sterile diluents such as water for injection, Saline, non-volatile oil, polyethylene glycol, glycerin, propylene glycol or other synthetic solvents; bactericides such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; Buffers such as acetate, citrate or phosphate, and substances that modulate tonicity, such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

As is well known in the art, pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (water soluble) or suspensions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL® (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
It is preferable to include isotonic agents, for example, polyalcohols such as sugar, mannitol, sorbitol and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by comprising in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

  As is well known in the art, sterile injectable solutions should be mixed with the active compound in the required amount, in the appropriate solvent, with one or a combination of the ingredients listed above and, if necessary, filter sterilized subsequently. Can be prepared. Generally, dispersions are prepared by incorporating the active compound into a sterile carrier that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred method of preparation is to form those powders from a sterile filtered solution of the active ingredient plus any additional desired ingredients, vacuum drying and Freeze-dried.

  The choice of delivery route can be used to modulate the induced immune response. For example, when influenza virus vectors are administered intramuscularly or by the epidermal (gene gun) route, IgG titers and CTL activity are the same; however, muscle inoculation mainly produces IgG2a, but the epidermal route is mostly IgG1. Pertmer et al., J. Virol., 70: 6119-6125 (1996). Thus, those skilled in the art can take advantage of slight differences in immunogenicity induced by different routes of administration of the immunomodulatory polynucleotides of the present invention.

  The compositions and administration methods described above illustrate, but are not limited to, administration methods for the IMP formulations of the present invention. Methods of making various compositions and devices are within the ability of those skilled in the art and will not be described in detail herein.

  Analysis of the immune response to IMP (both qualitative and quantitative) may be by methods known in the art, including antigen-specific antibody production (measurement of specific antibody subclass), CD4 + T cells, NK cells or CTLs. Activation of specific populations of lymphocytes such as IFN-γ, IFN-α, IFN-ω, TNF-α, IL-2, IL-4, IL-5, IL-6, IL-10, IL- 12, including but not limited to measuring production of cytokines and chemokines and / or histamine release such as IP-10, MCP-1, MCP-2, MCP-3, MIG or MIP-3β Absent. Methods for measuring specific antibody responses include enzyme-linked immunosorbent assays (ELISA) and are well known in the art. Measurement of the number of specific types of lymphocytes such as CD4 + T cells can be performed, for example, with a fluorescence activated cell sorter (FACS). Measurement of activation of a particular cell population can be accomplished by determining the expression of a marker, such as a cell surface marker, that is specific for activation of a particular cell type. Cell marker expression can be measured, for example, by measuring RNA expression or cell surface expression of a particular marker, for example by FACS analysis. Cytotoxicity and CTL assays can be performed, for example, as described in Raz et al. (Proc. Natl. Acad. Sci. USA, 91: 9519-9523 (1994)) and Cho et al. (2000). it can. The cytokine concentration can be measured by, for example, ELISA. Measurement of dendritic cell maturation can be performed, for example, as described in Hartomann et al., Proc. Natl. Acad. Sci. USA 96: 9305-9310. These and other assays for assessing immune responses to immunogens are well known in the art. See, for example, “Selected Methods in Cellular Immunology” (1980), edited by Mishell and Shiigi, W.H. Freeman and Co.

  Analysis of immune response to IMP (both qualitative and quantitative) can also be cytokines, chemokines and / or other molecules induced by cytokines such as IFN-γ and / or IFN-α, the production of which is stimulated by IMP It may be by measuring the level of what is being done. Accordingly, IMPs of the present invention also include IFNγ and / or IFN-α-inducing cytokines, chemokines and inflammatory proteins such as, but not limited to, IP-10 (interferon-inducing protein 10 kDa), IFN-γ-induced monokines, and It may stimulate the expression of sphere chemotactic protein 1 (MCP-1). The immune response to IMP can also be cytokines, chemokines and / or other molecules known to have antiviral activity, such as 2,5-oligoadenylate synthase (2,5-OAS), interferon-stimulated genes— It can also be analyzed by measuring the levels of 54K (ISG-54K) and guanylate binding protein-1 (GBP-1). Thus, antiviral molecules and molecules induced by IFN-γ and / or IFN-α can be used as markers for IMP activity. The production of such interferon-inducing molecules and / or the measurement of gene expression may be by any method known in the art, such as, but not limited to, quantitative PCR to measure ELISA and RNA production.

  Preferably, the Th1-type response is stimulated, ie induced, and / or enhanced. Referring to the present invention, stimulation of a Th1-type immune response can be determined in vitro or ex vivo by comparing and measuring cytokine production from cells treated with IMP and those not treated with IMP. . Methods for determining cellular cytokine production include those described herein and methods known in the art. The type of cytokine produced in response to IMP treatment indicates a Th1-type or Th2-type biased immune response by the cell. As used herein, the term “Th1-type bias” cytokine production is relative to the production of cytokines associated with a Th1-type immune response in the presence of a stimulatory factor, in the absence of stimulation. Meaning measurable increase in production. Examples of such Th1-type biased cytokines include, but are not limited to IL-2, IL-12, IFN-γ and IFN-α. In contrast, “Th2-type biased cytokine” means those associated with a Th2-type immune response and includes, but is not limited to, IL-4, IL-5, and IL-13. Absent. Cells useful for determining IMP activity include primary cells isolated from immune system cells, hosts and / or cell lines, preferably APCs and lymphocytes, and even more preferably macrophages and T cells.

  Stimulation of a Th1-type immune response can also be measured in a host treated with IMP, including but not limited to: (1) a decrease in IL-4 or IL-5 levels measured before and after antigen exposure; or optionally Detection of decreased (or even absent) levels of IL-4 or IL-5 in IMP-treated hosts compared to antigen-stimulated or stimulated and exposed controls without IMP; (2) Increased levels of IL-12, IL-18, and / or IFN (α, β, or γ) before and after antigen exposure; or controls stimulated or stimulated and exposed without IMP in IMP-treated hosts Detection of higher levels of IL-12, IL-18 and / or IFN (α, β, or γ) as compared to (3) IMP of “Th1-type bias” antibody production in IMP-treated hosts Comparison with untreated control; and / or (4) anti Reduced levels of antigen-specific IgE measured before and after exposure; or lower antigen-specific IgE in hosts treated with IMP compared to controls stimulated without IMP or stimulated and exposed ( Or can be determined by methods known in the art including level detection. Various of these determinations may be made in the cytokines produced by APC and / or lymphocytes, preferably macrophages and / or T cells, using the methods described herein or methods known in the art. This can be done by in vitro or ex vivo determination. Some of these determinations can be made by measuring the class and / or subclass of antigen-specific antibodies using the methods described herein or methods known in the art.

  The class and / or subclass of antigen-specific antibody produced in response to IMP treatment indicates a Th1-type or Th2-type biased immune response by the cell. As used herein, the production of the term “Th1-type-biased” antibody (ie, a Th1-related antibody) refers to the production of antibodies associated with a measurable increase in Th1-type immune response. One or more Th1-related antibodies can be measured. Examples of such Th1-type polarized antibodies are human IgG1 and / or IgG3 (eg Widhe et al., Scand J. Immunol., 47: 575-581 (1998)) and de Martino et al., Ann. Allergy Asthima Immunol. 83: 160-164 (1999)), as well as mouse IgG2a, but is not limited thereto. In contrast, “Th2-type biased antibody” means that associated with a Th2-type immune response, and human IgG2, IgG4 and / or IgE (eg, Widhe et al. (1998) and de Martino et al. ( 1999)) and mouse IgG1 and / or IgE, but are not limited thereto.

  Th1-type biased cytokine induction resulting from IMP administration results in enhanced cellular immune responses such as those performed by NK cells, cytotoxic killer cells, Th1 helpers and memory cells. These reactions are particularly beneficial for use in prophylactic or therapeutic vaccines against tumors in addition to viruses, fungi, protozoan parasites, bacteria, allergic diseases and asthma.

  In some embodiments, the Th2 response is suppressed (reduced). Inhibition of the Th2 response is due to, for example, decreased levels of Th2-related cytokines, such as IL-4 and IL-5, decreased levels of Th2-related antibodies, and also decreased IgE and decreased histamine release in response to allergens. Can be determined.

Kits of the Invention The present invention provides kits. In certain embodiments, the kits of the invention comprise one or more containers comprising an IMP, as generally described herein. The kit may further comprise a method described herein (eg, immunomodulation, recovery of one or more symptoms of an infection, increase of IFN-γ levels, increase of IFN-α levels, or recovery of IgE-related disorders). ), A suitable set of instructions regarding the use of the IMP, usually comprising a written instruction.

  The kit may comprise any convenient IMP packaged in a suitable package. For example, if the IMP is a dry formulation (eg, lyophilized or dry powder), a vial with a resilient seal is typically used so that the IMP is a liquid resilient closure Can be easily resuspended by injection through. Ampules with removable closures that are not elastic (eg, sealed glass) or elastic closures are most conveniently used for IMP liquid formulations. Similarly, packaging for use in combination with certain devices such as inhalers, nasal administration devices (eg, atomizers) or infusion devices such as minipumps is also contemplated.

  Instructions related to the use of IMP generally include information regarding doses, dosing schedules, and routes of administration regarding the intended use. The container of IMP may be a unit dose, a bulk package (eg, a repeated dose package), or a subunit volume. The instructions supplied in the kit of the present invention are typically instructions on a label or package insert (e.g., a piece of paper included in the kit), but are machine-readable instructions. Documents (eg, instruction manuals held on magnetic storage disks or optical storage disks) are also acceptable.

  In some embodiments, the kit further comprises an antigen (or one or more antigens), which may or may not be packaged in the same container (formulation) as the IMP. Antigens are described herein.

  In certain embodiments, a kit of the invention comprises IMP in the form of an immunomodulatory polynucleotide / microcarrier complex (IMP / MC), and further any of the methods described herein (eg, immunization A set of instructions on the use of the IMP / MC complex for regulation, recovery of one or more symptoms of infection, increased IFN-γ levels, increased IFN-α levels, or recovery of IgE-related disorders) In general, a written instruction manual can be provided.

In some embodiments, kits of the invention that include materials for generating IMP / MC complexes generally include separate containers for IMP and MC, but in some embodiments, rather than pre-generated MC, MC-generated material is supplied. IMP and MC are preferably supplied in a form that allows formation of an IMP / MC complex upon mixing of the supplied IMP and MC.
This configuration is preferred when IMP / MC complexes are linked by non-covalent bonds. This form is also preferred when IMP and MC are cross-linked by a heterobifunctional crosslinker; either IMP or MC is provided in an “activated” form (eg, heterobifunctional A moiety that is linked to a crosslinker so that it is reactive with IMP is available).

  A kit of IMP / MC composite comprising liquid phase MC preferably comprises one or more containers containing materials that produce liquid phase MC. For example, an IMP / MC kit for an oil-in-water emulsion MC can comprise one or more containers containing an oil phase and an aqueous phase. The contents of the container are emulsified to produce MC, which can then be mixed with IMP, preferably IMP modified to incorporate a hydrophobic moiety. Such materials can be added to a container of oil and water for making an oil-in-water emulsion, or a lyophilized liposome component (e.g., a mixture of phospholipids, cholesterol and a surfactant), as well as an aqueous phase (e.g., A container of a pharmaceutically acceptable aqueous buffer). In some embodiments, the kits of the present invention may comprise an IMP in the form of a cationic condensing agent-IMP-stabilizer (CIS) composition and any immunomodulatory CIS particle composition as described herein. In one or more containers. Alternatively, the kit comprises a container for the components of the CIS composition of the invention. The configuration of this embodiment includes a kit having an IMP / stabilizer mixture container and a cationic condensing agent container and a kit having an IMP container, a stabilizer container, and a cationic condensing agent container. The kit further includes a suitable set of instructions, generally written instructions, relating to the use of the CIS particle composition for any of the methods described herein (eg, immunomodulation). Recovery of one or more symptoms of infection, increased IFN-γ levels, increased IFN-α levels, or recovery of IgE-related disorders). A kit embodiment comprising a container of components of a CIS composition will generally include instructions for production of the CIS composition in accordance with the methods disclosed herein. In addition to the CIS composition and / or the components of the CIS composition of the present invention, the kit embodiment is also described in the instructions for generating the CIS composition and herein, according to the methods disclosed herein. Instructions for use of the immunomodulatory CIS composition for any of the methods may also be enclosed.

  The following examples are provided to illustrate but not limit the present invention.

Example 1: Immunoregulation of human cells with an immunomodulatory polynucleotide A control sample comprising an immunoregulatory polynucleotide (IMP) or a polynucleotide containing no immunoregulatory sequence (5'-TGACTGTGAACCTTAGAGATGA-3 '(SEQ ID NO: 2)), SAC and medium alone were tested for immunomodulatory activity against human peripheral blood mononuclear cells (PBMC).
A standard immunoregulatory polynucleotide, 5'-TGACTGTGAACGTTCGAGATGA (SEQ ID NO: 1), was also tested. Unless otherwise noted, the polynucleotides tested are fully modified phosphorothioate oligodeoxynucleotides.

Peripheral blood was collected from volunteers by venipuncture using a heparinized syringe. The blood was layered on a FICOLL® (Amersham Pharmacia Biotech) cushion and centrifuged. PBMCs located at the FICOLL® interface were collected and then washed twice with cold phosphate buffered saline (PBS). These cells are resuspended and in 48 or 96 well plates 10% heat-inactivated human AB serum and 50 units / mL penicillin, 50 μg / mL streptomycin, 300 μg / mL glutamine, 1 mM sodium pyruvate, and 1 × MEM non-essential Cultured at 2 × 10 ⁶ cells / mL in RPMI 1640 containing amino acids (NEAA).

  The cells are cultured for 24 hours in the presence of the test sample (IMP or control) in an amount ranging from 0.2 to 20 μg / ml, after which cell-free medium is collected from each well and IFN-γ and IFN- Assayed for alpha concentration. IFN-γ and IFN-α were assayed using BioSource International's CYTOSCREEN® ELISA kit according to the manufacturer's instructions. Typically, test samples were tested with PBMC from 4 human donors.

  IMP stimulated IFN-γ and / or IFN-α secretion by human PBMC. In human PBMC assays, IFN-γ background levels can vary significantly from donor to donor. However, other cytokines, such as IFN-α, generally show a stable pattern of activation and show conventionally low background levels under unstimulated conditions. Examples of results from such PBMC assays are summarized in Tables 2-7.

  In a dose escalation assay, PBMCs from 4 donors were stimulated with 0.2-20 μg / ml of the above SEQ ID NO: 27. The amounts of IFN-α and IFN-γ were assayed as described above, and the results from the four donors were averaged and the average results are presented in Table 2.

  As can be seen from the results presented in Table 2, the ability to induce the production of IFN-α increases as the dose of IMP decreases and decreases with activation with dose of about 3-8 μg / ml. It became the optimum value. Additional assays confirmed this result.

が試験された。 PBMCs from 4 donors were stimulated with 20 μg / ml IMP or control and stimulation of IFN-α and IFN-γ production was assessed as described above. Among polynucleotides:

Were tested.

  The results of cytokine production from PBMC from each donor are averaged and the average results are presented in Table 3.

  As shown in Table 3, the IMP that stimulated the production of IFN-α more than the IMP standard SEQ ID NO: 1 has at least a TCG sequence (5′-TCG sequence) at or near the 5 ′ end of the polynucleotide. And a palindromic sequence having a length of at least 8 bases either next to the 5′-TCG sequence or within 3 bases thereof. Usually, the stimulation of IFN-γ production reflects the stimulation of IFN-α production, but the variation range of IFN-γ stimulation was less than that of IFN-α. In polynucleotides where the palindromic sequence and the 5′-TCG are separated, this separation is due to or overlaps with a second TCG trinucleotide (see, eg, SEQ ID NO: 14). It is preferable for the production of INF-α. As described above, IMP containing 5'-TCG but no palindromic sequence induced very low levels of IFN-γ and did not induce IFN-α production (see, eg, SEQ ID NOs: 18 and 11). See IMPs containing a 6-8 base palindrome but no 5′-TCG induced IFN-gamma, but IFN-α was at very low levels (see, eg, SEQ ID NOs: 1 and 4). ). In particular, an IMP comprising a TCG with a maximum of 3 bases removed from the 5 ′ end of the polynucleotide and a palindromic sequence of at least 10 bases in length is compared with SEQ ID NO: 1, which is an IMP standard that does not contain 5′-TCG. In particular, high levels of IFN-α were induced (see, eg, SEQ ID NOs: 24 and 8).

An assay was performed to test the IMP dose dependency on stimulation of IFN-α production. The IMPs tested in this assay were altered in the position of the palindromic sequence within the polynucleotide and / or the location of at least one TCG sequence at the 5 ′ end. Among the tested polynucleotides, there were some that had CG dinucleotide and 5′-TCG sequences but no palindromic sequence of 8 bases or longer (eg, SEQ ID NO: 11; SEQ ID NO: 18 5'-TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 3)). Polynucleotides having a CG dinucleotide and a palindromic sequence of 8 bases or more in length but no 5′-TCG trinucleotide were also tested (eg, SEQ ID NO: 1; SEQ ID NO: 4; 5′-ATCATCTCGAACGTTCGACGA (SEQ ID NO: 29); 5′-AACGTTCGAACGTTCGAACGTTT (SEQ ID NO: 67); 5′-TCAACGTTCGAACGTTCGAACGTT (SEQ ID NO: 68); 5′-GACGATCGTCGACGATCGTC (SEQ ID NO: 85)).
PBMCs from 4 donors were stimulated with 0.8, 4.0 or 20 μg / ml IMP or control. Stimulation of IFN-α production was evaluated as described above and the averaged results from 4 donors are reported in Table 4.

  The results presented in Table 4 show that a palindromic sequence at least 8 bases in length and at least one TCG sequence at or near the 5 ′ end of the polynucleotide are important for stimulation of human PBMC-derived IFN-α. I support it.

  Another assay was performed to test the IMP dose dependency on stimulation of IFN-α production. The IMP tested in this assay was altered for the presence of CG dinucleotide and 5'-TCG sequences in the polynucleotide. Among the tested polynucleotides, it has a palindromic sequence but no CG dinucleotide (eg, SEQ ID NO: 2; 5′-TGCTTGCAAGCTTGCAAGCA (SEQ ID NO: 90), 5′-TCAGTCAGTCAGCTGACTGACTGA (SEQ ID NO: 96)), and / Or 5′-TCG sequence (eg, SEQ ID NO: 1, 90, 96; 5′-ACCGATAACGTTGCCGGTGACGGCACCACG (SEQ ID NO: 92), 5′-AACAACAACGTTGTTGTT (SEQ ID NO: 95), 5′-ACCGATAACGTTGCCGGTGACGGCACCACG (SEQ ID NO: 25), 5 ′ -There were some that did not have AACAACAACGTTGTTGTT (SEQ ID NO: 94)). Further tested in this assay was the polynucleotide 5′-TCGTTGCAAGCTTGCAACGA (SEQ ID NO: 91). Some of the IMPs changed the phosphate backbone composition. PBMC from 3 donors were stimulated with either 0.8, 4.0 or 20 μg / ml IMP or control. Stimulation of IFN-α production was assessed by dropping PBMC from three donors as described above, and the averaged results for the three donors are reported in Table 5.

  As can be seen from the results presented in Table 5, the reversal of the highly active sequence SEQ ID NO: 42 CG dinucleotide to the GC dinucleotide disables the ability of SEQ ID NO: 90 to induce IFN-α. Similarly, the palindromic polynucleotide of SEQ ID NO: 96 that does not have a CG dinucleotide is also inactive.

  As can be seen in Table 5, two representative phosphodiester polynucleotides, SEQ ID NO: 25 and SEQ ID NO: 94, and their fully modified phosphorothioate versions, SEQ ID NO: 92 and SEQ ID NO: 95, are each from human PBMC to IFN It was not active in inducing -α. SEQ ID NOs: 25 and 92 contain multiple CG dinucleotides and the motif AACGTT, but they do not contain TCG or at least 8 base palindromic sequences. SEQ ID NOs: 94 and 95 are 18 base palindrome and contain one CG dinucleotide but no TCG trinucleotide. Accordingly, these polynucleotides are not compatible with the motifs described herein.

SEQ ID NOs: 26, 30, 32, and 33 that contain all phosphorothioate linkages (SEQ ID NOs: 30 and 32) or that contain chimeric phosphorothioate / phosphodiester linkages (SEQ ID NOs: 26 and 33) are derived from human PBMC Large amounts of IFN-α were induced.
SEQ ID NOs: 34 (including the chimeric phosphorothioate / phosphorodiester linkage) and 93 (total phosphorothioate linkage) both derived IFN-α from human PBMC.

  In an assay to test the effect of palindromic sequence length on IFN-α stimulation, PBMCs from four donors were stimulated with either 2 μg / ml or 20 μg / ml IMP or control, and IFN-α Production stimuli were evaluated as described above and the averaged results are reported in Table 6. Among the polynucleotides, 5′-TTCGAACGTTCGTTAACGTTCG (SEQ ID NO: 20) and 5′-TCGTCGAACGTTCGAACGTTCG (SEQ ID NO: 19) were tested.

  The results presented in Table 6 show the importance of stimulation of human PBMC-derived IFN-α with a palindromic sequence of at least 8 bases in length and at least one TCG sequence at or near the 5 ′ end of the polynucleotide. I support it.

  In an assay to test the IFN-α stimulating activity of IMPs with various 12 base palindromes, PBMCs from 4 donors were stimulated with 0.8, 4 or 20 μg / ml IMP or control and IFN-α Production stimuli were evaluated as described above and the averaged results are reported in Table 7.

The results presented in Table 7 suggest that any of the tested IMPs with a 12 base palindrome was active in stimulating INF-α from human PMBC. These IMPs have the sequence TCGX ₁ X ₂ CGX ₂ 'X ₁ ' CGA (SEQ ID NO: 198), where there are no nucleotide restrictions for X ₁ and X ₂ apart from the flow of CGCG, CCGG and GCGC, These have already been described as immunostimulatory or immunoneutralizing sequences (Krieg et al. (1998) Proc. Natl. Acad. Sci. USA 95: 12631-12636), for example SEQ ID NOs: 49 and 50. Is active in stimulating IFN-α and comprises the sequence CGCG SEQ ID NO: 49 exemplifies an immunomodulatory polynucleotide comprising the aforementioned SEQ ID NO: 161. SEQ ID NO: 50 is an immunity comprising the aforementioned SEQ ID NO: 162 Illustrative regulatory polynucleotides.

  IMPs with longer palindromes induced higher levels of IFN-α from human PBMC, especially with lower amounts of IMP. As can be seen from the results of the assay shown in FIG. 1, the amount of IFN-α produced from the cells in response to SEQ ID NO: 172 is SEQ ID NO: 113, SEQ ID NO: 27 and SEQ ID NO: IMP at a dose of 0.4 μg / ml. Significantly higher than number 1. In addition, the amount of IFN-α produced in response to SEQ ID NO: 172 was significantly higher than SEQ ID NO: 27 and SEQ ID NO: 1 at a dose of IMP of 0.8 μg / ml (p <0.001). The length of the IMP palindrome is 28 bases in SEQ ID NO: 172, 22 bases in SEQ ID NO: 113, 12 bases in SEQ ID NO: 27, and 8 bases in SEQ ID NO: 1.

が試験された。４人のドナー由来のＰＢＭＣが０．８，４．０又は２０μｇ／ｍｌのＩＭＰあるいはコントロールで刺激され、そしてＩＦＮ−αの産生の結果は上述のとおり評価した。４人のドナーについての各ＩＭＰ濃度での平均した結果を表８にて報告する。 In another assay, total IMP length and IMP palindromic length were compared for induction of IFN-α production from human PBMC. Among the polynucleotides, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 12, SEQ ID NO: 27,

Were tested. PBMCs from 4 donors were stimulated with 0.8, 4.0 or 20 μg / ml IMP or control and the results of IFN-α production were evaluated as described above. The averaged results at each IMP concentration for 4 donors are reported in Table 8.

  The results presented in Table 8 show that for the tested polynucleotides, the minimum total length of the polynucleotide to stimulate IFN-α production in human PBMC is about 12 bases, and a palindrome of about 10 bases in length. It is suggested that it has. Thus, in some embodiments where higher levels of IFN-α are desired to be produced, the IMP has at least the following lengths (base lengths): 10, 12, 14, 16, 1820, 22, 24, 26, 28 or 30 includes at least one palindromic sequence, and in some embodiments, the IMP includes at least one palindromic sequence having a length greater than 30 bases.

  In another assay, PBMC from three donors were stimulated with 0.8, 4.0 or 20 μg / ml IMP or control. Stimulation of IFN-α, IFN-β and IFN-ω production was evaluated as described above. IFN-ω was assayed using the PBL Biomedical Laboratories ELISA kit, and the lower and upper limits of detection of IFN-ω were 48 pg / ml and 6000 pg / ml, respectively. IFN-β was assayed using the BioSource ELISA kit with upper and lower detection limits of 12 IU / ml and 3046 IU / ml, respectively. The average results for 3 donors at each IMP concentration are reported in Table 9.

  As can be seen in Table 9, the IMPs of the present invention stimulate IFN-ω production from human PBMC as well as IFN-α production. In the above assay, IFN-β was not detected.

  In another assay, the duplex form of the polynucleotide was compared to the non-duplex form for induction of IFN-α production from human PBMC. Among the polynucleotides, SEQ ID NO: 1, SEQ ID NO: SEQ ID NO: 90, SEQ ID NO: 27, and 5'-TCGTCGAACGTTCGAGATGAT / 5'-ATCATCTCGAACGTTCGACGA (SEQ ID NO: 182-duplex of SEQ ID NO: 27 and SEQ ID NO: 29) are tested. It was. PBMCs from 3 donors were stimulated with 0.4, 0.8, 4.0 or 20 μg / ml IMP or control, and the results of IFN-α production were evaluated as described above. The duplex was compared to a single sequence using the same total amount of polynucleotide (eg, 4 μg / ml SEQ ID NO: 27 is 2 μg / ml SEQ ID NO: 27 and 2 μg / ml SEQ ID NO: 27). Compared to SEQ ID NO: 182 of 4 μg / ml duplex containing 29). The average results for 3 donors at each concentration are reported in Table 10.

  As can be seen in Table 10, SEQ ID NO: 27 duplex form of SEQ ID NO: 182 is more active than SEQ ID NO: 27 in stimulating IFN-α production with lower amounts of IMP. At higher amounts (4 and 20 μg / ml), SEQ ID NO: 27 was somewhat more stimulating.

  In another assay, polynucleotides containing modified bases and polynucleotides without modified bases were compared for induction of IFN-α production from human PBMC. Among the polynucleotides, SEQ ID NO: 1, SEQ ID NO: 2, 5′-TCGTCGAACGTTCGAGATGAT (SEQ ID NO: 27) and 5′-TCXTCXAACXTTCXAGATGAT (X = 7-deaza-dG. SEQ ID NO: 193) were tested. SEQ ID NO: 27 and SEQ ID NO: 193 have identical nucleotide sequences except that the four dGs of SEQ ID NO: 27 are replaced with deaza-dG. PBMCs from 4 donors were stimulated with 0.8, 4.0 or 20 μg / ml IMP or control and the results of IFN-α production were evaluated as described above. The average results for 4 donors at each IMP concentration are reported in Table 11.

  As can be seen in Table 11, SEQ ID NO: 193 has IFN-α stimulating activity comparable to SEQ ID NO: 27, except for an amount of 0.8 μg / ml.

Single and double stranded forms of polynucleotides containing modified bases were assayed for activity in inducing IFN-α production from human PBMC. Among polynucleotides, single-stranded and double-stranded SEQ ID NO: 1, single-stranded SEQ ID NO: 2, single-stranded SEQ ID NO: 29. Single-stranded and double-stranded SEQ ID NO: 27, single-stranded and double-stranded SEQ ID NO: 187, single-stranded and double-stranded SEQ ID NO: 188, single-stranded and double-stranded SEQ ID NO: 189, single-stranded Strand and double-stranded SEQ ID NO: 190, single-stranded SEQ ID NO: 194, and single-stranded SEQ ID NO: 197 were tested. SEQ ID NO: 187, 188, 189, 190, 194 and 197 have the same nucleotide sequence as SEQ ID NO: 27, except for the noted substitutions: 5′-TCGTCGAA ^* CGT ^* TCGAGATGAT (A ^* = 2-amino-dA; T ^* = 2-thio-dT) (SEQ ID NO: 189);
5′-TCGTCGA ^* A ^* CGT ^* T ^* CGAGATGAT (A ^* = 2-amino-dA; T ^* = 2-thio-dT) (SEQ ID NO: 190);
5'-TCG ^* TCG ^* AACG ^* TTCG ^* AG ^* ATG ^* AT (G ^* = 7-deaza-8-aza-dG) (SEQ ID NO: 187);
5′-TCG ^* AACG ^* TTCG ^* AACG ^* TTCG ^* AACG ^* TT (G ^* = 7-deaza-8-aza-dG) (SEQ ID NO: 194);
5'-TCGTCGA ^* A ^* CGTTCGA ^* GA ^* TGA ^* T (A ^* = 2-amino-dA) (SEQ ID NO: 188);
5′-TCGA ^* A ^* CGTTCGA ^* A ^* CGTTCGA ^* A ^* CGTT (A ^* = 2-amino-dA) (SEQ ID NO: 197).

  PBMCs from 8 donors were variously stimulated with 0.2, 0.4, 0.8, 1.6, 4.0 or 8 μg / ml IMP or control and the result of IFN-α production was It was evaluated as described above. The duplex was compared to a single sequence using the same total amount of polynucleotide (eg, 4 μg / ml SEQ ID NO: 27 is 2 μg / ml SEQ ID NO: 27 and 2 μg / ml SEQ ID NO: 29). 4 μg / ml duplex containing SEQ ID NO: 182). The average results for 8 donors at each concentration are reported in Table 12.

  As can be seen in Table 12, the use of some modified bases in IMP may result in polynucleotides having IFN-α stimulating activity. With the exception of 183, these results also indicate that the formation of double-stranded polynucleotides with complementary sequences results in highly active IMPs, especially at lower amounts, for stimulation of IFN-α production. Polynucleotides that cannot form duplexes themselves, such as SEQ ID NOs: 189 and 190, induce slightly IFN-α, while longer sequences (eg, SEQ ID NO: 172, 30 having a 28 base palindrome) ) And duplex SEQ ID NO: 182 may contain more IFN-α in lower amounts (eg, 0.4 and 0) than SEQ ID NO: 27 and other IMPs having a palindrome length of less than 28 bases. .8 μg / ml). As discussed herein, some modified bases can increase the stability of the formed duplex.

Example 2 Activation of human B cells by immunomodulatory polynucleotides The ability of IMP to activate human B cells was determined by measuring B cell proliferation and IL-6 production in response to incubation with IMP. Human PBMC were incubated with CD19MACS beads (Miltenyi Biotec) and passed through a magnet to separate CD19 ⁺ B cells through positive selection ( ^> 98% CD19 ^{+ as} determined by FACS). For proliferation assays, B cells were cultured at 1 × 10 ⁵ / well (5 × 10 ⁵ / ml) in 96 well round bottom plates. The cells were incubated in triplicate with 2 μg / ml IMP or control for 72 hours. At the end of the incubation period, the plates were pulse labeled with ³ H-thymidine (1 μCi / well, Amersham) and incubated for an additional 8 hours. Plates were subsequently collected and radioactivity uptake was determined using standard liquid scintillation techniques and data was collected in counts per second (cpm). For IL-6 secretion, B cells were cultured in 48-well plates at 0.5-1 x 10 < ⁶ > / well with 5 [mu] g / ml IMP or controls and using ELISA with a CytoSet antibody pair according to the instructions (BioSource). Assayed for IL-6. The maximum / minimum detection limit was 4000/2 pg / ml.

  The results of the B cell proliferation assay presented in Table 13 are the mean of triplicate cell proliferation cpm values and the average of all donor cpm for cells from each donor. The results of the B cell IL-6 assay presented in Table 13 are the amount of IL-6 produced from the cells of each donor and the average value of all donors.

  From the results presented in Table 13, compounds containing CG dinucleoti induced B cell proliferation and IL-6 production. As can be seen from the results presented in Table 9, good B cell stimulating activity in immunomodulatory polynucleotides depends on the presence of CG dinucleotides, but for higher IFN-α induction, There seems to be no need for specialized motifs.

  In another assay, the duplex form of the polynucleotide was compared to the non-duplex form for B cell activation. Among the polynucleotides, the duplexes of SEQ ID NO: 1, SEQ ID NO: 90, SEQ ID NO: 27, and SEQ ID NO: 182—SEQ ID NO: 27 and SEQ ID NO: 29 were tested. B cells from three donors were stimulated with 1.0 or 5.0 μg / ml IMP or control, respectively, and the results of cell proliferation and IL-6 production were evaluated as described above. The average results for 3 donors at each IMP concentration are reported in Table 14.

  From the results presented in Table 14, SEQ ID NO: 182 in the duplex form of SEQ ID NO: 27 is approximately equivalent to SEQ ID NO: 27 in B cell activation as measured by stimulating IL-6 production and cell proliferation. It is.

Example 3: Immunoregulation of mouse cells with immunomodulatory polynucleotides Immunomodulatory or control polynucleotides were assayed for immunomodulatory activity against mouse splenocytes. The polynucleotides tested were fully modified phosphorothioate oligodeoxynucleotides. Among the polynucleotides, SEQ ID NO: 1 (positive control) and SEQ ID NO: 2 (negative control) were tested.

  BALB / c mouse spleen fragments were digested with collagenase / dispase (0.1 U / mL / 0.8 U / mL) dissolved in phosphate buffered saline (PBS) for 45 minutes at 37 ° C. Mechanical dispersion was achieved by forcing through a metal screen. Dispersed splenocytes were pelleted by centrifugation and then resuspended in fresh medium (in addition to 10% fetal calf serum, 50 units / mL penicillin, 50 μg / mL streptomycin, 2 mM glutamine, and 0.05 mM β-mercaptoethanol Including RPMI 1640).

Mouse splenocytes were dispensed into wells of a 96-well plate ( ⁷ × 10 ⁷ cells / ml) and incubated at 37 ° C. for 1 hour. 100 μL of 2 × concentration test sample and control were added and the cells were further incubated for 24 hours. Each test sample or control was tested in duplicate. Medium was collected from each well and frozen at -80 ° C before testing. The collected medium was thawed and tested by ELISA for cytokine concentrations. Polynucleotides were tested at various concentrations including 5.0, 1.0 and 0.1 μg / ml. Among the polynucleotides, 5′-TGACTGTGAACGTTCGAAATGA (SEQ ID NO: 36) and 5′-TGACTGTGAACGTTCGAAGTGA (SEQ ID NO: 37) were tested. Control samples included Staphylococcus aureus (SAC) (CalBiochem) with medium alone and PANSORBIN® heat-sterilized formalin fixed.

  IL-6, IL-12 and IFN-γ were assayed using a sandwich format ELISA. Medium from mouse splenocyte assay was incubated in microtiter plates coated with anti-IL-6, anti-IL-12p40 / p70 or anti-IFN-γ monoclonal antibody (Nunc). Bound cytokine (IL-6, IL-12 or IFN-γ) is a biotinylated anti-cytokine antibody (anti-IL-6, anti-IL-12p40 / p70 or anti-IFN-γ) and streptavidin-horseradish peroxidase complex Detection using a secondary antibody, color development in the presence of peroxidase using the chromogenic peroxidase substrate 3,3 ′, 5,5′-tetramethylbenzidine (TMB), and absorbance at 450 nm measured by Emax Precision It quantified by measuring using a microplate reader (Molecular Devices). IL-6 values less than 45 pg / ml were assigned values of 45 pg / ml (ie 45 = <45). IL-12p40 / p70 values less than 36 pg / ml were assigned a value of 36 pg / ml (ie 36 = <36). Values of IFN-γ less than 54 pg / ml were assigned values of 54 pg / ml (ie 54 = <54).

  Tables 15 and 16 summarize the results of the assay for cytokine production by IMP. Immunomodulatory polynucleotides, including CG dinucleotides, are generally IL-6, IL-12 by mouse splenocytes, regardless of the presence of the more specialized motif described herein for advanced IFN-α induction. And IFN-γ were stimulated.

  From the results presented in Tables 15 and 16, all compounds containing CpG motifs induce IL-12 production from mouse splenocytes, and most, if not all, compounds containing CpG motifs are mouse splenocytes. Production of IL-6 and IFN-γ from. As can be seen from the results presented in Tables 15 and 16, the IL-6, IL-12 and IFN-γ stimulating activity of immunoregulatory polynucleotides on mouse splenocytes is generally dependent on the presence of CG dinucleotides, but high IFN It does not appear to require the more specialized motifs described herein for -α induction.

Example 4: Stimulation of Interferon-Induced Gene Expression by Immunomodulatory Polynucleotides As demonstrated herein, immunomodulatory polynucleotides can induce the production of IFN-γ and / or IFN-α from PBMC. IMP was assayed for activity on human PBMC using quantitative PCR technology, TaqMan technology to induce mRNA expression of additional cytokine genes, chemokine genes and other genes. The tested polynucleotide is a fully modified phosphorothioate oligodeoxynucleotide. Among the polynucleotides, SEQ ID NO: (positive control) and SEQ ID NO: 2 (negative control) were tested.

  Human PBMC was prepared as described in Example 1. Cells were cultured for 24 hours at 5 μg / ml in the presence of test sample (IMP or control). Total RNA was extracted using Qiagen RNeasy Mini Protocol (Qiagen) and converted to cDNA using oligo dT (Promega), random hexamer (Promega), and SuperScript RT II (Invitrogen). Either the QuantiTect SYBR green PCR master mix (Qiagen) and naked primer (synthesized with Operon) or the QuantiTect probe PCR master mix (Qiagen) and probe-labeled PDAR primer (Applied BioSystems). PCR was performed using The reaction was performed using GeneAmp5700 Sequence Detector (PE BioSystems).

Examples of synthetic primer sequences are as follows (listed from 5 ′ to 3 ′):

IFN-γ, IL-1α, IL-6, IP-10, MCP-3, and MIP-3β were measured using PDAR provided by PE BioSystems. The threshold cycle (C _T ) value of each gene is the formula 1.8 ^(UBQ-GENE) (100,000) (where UBQ is the average C _T of triplicate ubiquitin runs and GENE is the focus of a two pair of run average C _T of the gene, and 100,000 is arbitrarily selected all values as a factor to zero than. the medium alone as a negative control for each experiment Stimulations are assigned a value of 1 and all data are expressed as multiples of induction relative to the negative control.

  Table 17 summarizes the results of the assay for expression of cytokine, chemokine and inflammatory protein genes from PBMC according to IMP SEQ ID NO: 27. The polypeptide 5′-GGTGCATCGATGCAGGGGGG (SEQ ID NO: 154) was also tested. Data are shown with SEM as the average of fold induction over media control (value of 1.0).

  As shown in Table 17, SEQ ID NO: 27 strongly induced the expression of chemokines IP-10, MCP-2, MCP-3, MIG, and MIP-3β. IL-1α expression was reduced in the presence of SEQ ID NO: 27. Furthermore, SEQ ID NO: 27 is an IFN-α-inducible gene 2,5-oligoadenylate synthase (2,5-OAS), interferon-stimulated gene-54K (ISG-54K), and guanylate-binding protein-1 (GBP-1). ) Expression was significantly increased.

  In these assays, the IMP of SEQ ID NO: 27 is chemokine G-CSF, IL-1β, IL-6, IL-12p40, IL-23, TNF-α, or the chemokine BCA-1, IL-8, LPTN, MCP. -1, MDC, MIP-1a, MIP-1b, MIP-3a, RANTES, and TARC had no significant effect on expressed mRNA levels.

Example 5: Stimulation of NK cytolytic activity by immunomodulatory polynucleotides IMPs of the present invention stimulate improved natural killer (NK) cytolytic activity compared to IMP standards. NK cytolytic activity was assayed via lysis of K562 target cells. In summary, PBMC were stimulated in culture for 48 hours with 10 mg / ml IMP (optimally determined amount) or negative control polypeptide. Treated PBMC were subsequently co-cultured with K562 tumor target cells supplemented with ⁵¹ Cr at a range of effector: target ratios for 4 hours. The ⁵¹ Cr released upon cell lysis was measured with a TopCount NXT scintillation counter (Packard) and recorded in counts per second (cpm).

  The results of NK cell stimulation from two different PBMC donors are shown in FIG. The IMPs used in the assay are SEQ ID NO: 1, SEQ ID NO: 90, SEQ ID NO: 27, SEQ ID NO: 172, and SEQ ID NO: 113. The length of the IMP palindrome is 28 bases in SEQ ID NO: 172, 22 bases in SEQ ID NO: 113, 12 bases in SEQ ID NO: 27, and 8 bases in SEQ ID NO: 1. The non-IMP control SEQ ID NO: 90 has a palindrome of 20 bases in length, but includes a 5'-C, G-3 'sequence. In this experiment, IMP having a palindrome having a length of 12 bases or more exhibits NK cytolytic activity to an increased scale as compared with SEQ ID NO: 1, which is an IMP standard having a palindrome having a length of 8 bases. I was stimulated.

  While the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent to those skilled in the art that certain changes and modifications may be practiced. Accordingly, the description and examples should not be construed as limiting the scope of the invention.

Claims (35)

An immunomodulatory polynucleotide comprising:
a) a palindromic sequence comprising at least two CG dinucleotides separated by 0, 1, 2, 3, 4 or 5 bases, the palindromic sequence being at least 8 bases in length; and b) ( TCG) _y (where y is 1 or 2, and 5′T of (TCG) _y is 0, 1, 2 or 3 bases from the 5 ′ end of the polynucleotide), 0, 1, or 2 bases away from the 5 ′ end of the palindromic sequence (TCG) _y ,
An immunomodulatory polynucleotide comprising.   The immunoregulatory polynucleotide according to claim 1, wherein the palindromic sequence has a base composition of A and T, more than 1/3. 2. The immunoregulatory polynucleotide of claim 1, wherein the palindromic sequence comprises all or part of the (TCG) _y sequence. An immunomodulatory polynucleotide comprising:
a) a palindromic sequence comprising at least two CG dinucleotides separated by 0, 1, 2, 3, 4 or 5 bases, the palindromic sequence being at least 8 bases in length; and b) ( TCG) _y sequence (where y is 1 or 2, and 5′T of the (TCG) _y sequence is located at 0, 1, 2 or 3 bases from the 5 ′ end of the polynucleotide),
Comprising:
(A) a palindromic sequence is comprises all or part of the (TCG) _y sequence; a is and one CG of the (TCG) _y sequence of CG dinucleotides of the palindromic sequence of (a) An immunomodulatory polynucleotide.   The immunoregulatory polynucleotide according to claim 4, wherein the palindromic sequence has a base composition of A and T, more than 1/3. 5. The immunomodulatory polynucleotide of claim 4, wherein the palindromic sequence comprises all or part of the (TCG) _y sequence. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (X 1 X 2 CGX 2 'X 1' (CG) p) z ( SEQ ID NO: 156) (where, N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1, q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides, and 5 ′ of the (TCG (N _q )) _y sequence T is 0 to 3 bases from the 5 ′ end of the polynucleotide); and b) a palindromic sequence having a length of at least 8 bases, wherein (X ₁ X ₂ CGX ₂ 'X ₁ ' (CG) _p A palindromic sequence comprising the first (X ₁ X ₂ CGX ₂ 'X ₁ ') of the _z sequence;
An immunomodulatory polynucleotide comprising.   The immunoregulatory polynucleotide according to claim 7, wherein the palindromic sequence has a base composition of more than 1/3 of A and T.   The immunoregulatory poly of claim 7, comprising a sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 39, SEQ ID NO: 53, SEQ ID NO: 55, SEQ ID NO: 113, SEQ ID NO: 175, and SEQ ID NO: 172. nucleotide. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (X 1 X 2 CGX 3 X 3 'CGX 2' X 1 '(CG) p) z ( SEQ ID NO: 159)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1; q = 0, 1 or 2, and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides, X ₃ and X ₃ ′ is a self-complementary nucleoside, and 5′T of the (TCG (N _q )) _y sequence is 0-3 bases from the 5 ′ end of the polynucleotide); and b) at least 10 bases A palindromic sequence of length (X ₁ X ₂ CGX ₃ X ₃ 'CGX ₂ ' X ₁ '(CG) _p ) _z first (X ₁ X ₂ CGX ₃ X ₃ ' CGX ₂ 'X ₁ ') palindromic sequence, comprising
An immunomodulatory polynucleotide comprising.   The immunoregulatory polynucleotide according to claim 10, wherein the palindromic sequence has a base composition of more than 1/3 of A and T. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (X 1 X 2 X 3 X 4 X 5 CGX 5 'X 4' X 3 'X 2' X 1 '(CG) p) z ( SEQ ID NO: 160)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1 Q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides, X ₃ and X ₃ ′ are self-complementary nucleosides, X ₄ and X ₄ ′ are self-complementary nucleosides, X ₅ and X ₅ ′ are self-complementary nucleosides, and (TCG (N _q ) ) 5′T of the _y sequence is 0 to 3 bases from the 5 ′ end of the polynucleotide; and b) a palindromic sequence having a length of at least 12 bases, (X ₁ X ₂ X ₃ X ₄ X ₅ CGX ₅ 'X ₄ ' X ₃ 'X ₂ ' X ₁ '(CG) _p ) First (X ₁ X ₂ X ₃ X ₄ X ₅ CGX ₅ ' X ₄ 'X _{3 in z} sequence A palindromic sequence comprising 'X ₂ ' X ₁ '),
An immunomodulatory polynucleotide comprising.   The immunoregulatory polynucleotide according to claim 12, wherein the palindromic sequence has a base composition of more than 1/3 A and T. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (CGX 1 X 1 'CG (CG) p) z ( SEQ ID NO: 161)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1; q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, and 5′T of the (TCG (N _q )) _y sequence is 5 polynucleotide 'from end to 0-3 base); and b) at least 8 bases in length of a palindromic _{sequence, CGX 1 X 1' CG (} CG) p) z sequences first of (CGX _A palindromic sequence comprising ₁ X ₁ 'CG),
An immunomodulatory polynucleotide comprising.   The immunoregulatory polynucleotide according to claim 14, wherein the palindromic sequence has a base composition of more than 1/3 A and T. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (X 1 CGCGX 1 '(CG) p) z ( SEQ ID NO: 162)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -1, 0, 1 or 2, p = 0 or 1, q = 0 1 or 2 and z = 1 to 20, X ₁ and X ₁ ′ are self-complementary nucleosides, and 5′T of the (TCG (N _q )) _y sequence is 5 'end from one to 0-3 bases); and b) a palindromic sequence length of at least 8 _{bases, (X 1 CGCGX 1' (} CG) p) z sequences first of (X ₁ CGCGX ₁ A palindromic sequence comprising ')
An immunomodulatory polynucleotide comprising.   The immunoregulatory polynucleotide according to claim 16, wherein the palindromic sequence has a base composition of more than 1/3 A and T. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (X 1 X 2 CGCGX 2 'X 1' (CG) p) z ( SEQ ID NO: 163)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1; q = 0, 1 or 2, and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides, and ( TCG (N _q )) 5′T of the _y sequence is 0-3 bases from the 5 ′ end of the polynucleotide); and b) a palindromic sequence of at least 8 bases in length, (X ₁ X ₂ CCGGX ₂ 'X ₁ ' (CG) _p ) a palindromic sequence comprising the first (X ₁ X ₂ CCGGX ₂ 'X ₁ ') of the _z sequence,
An immunomodulatory polynucleotide comprising.   19. The immunoregulatory polynucleotide of claim 18, wherein the palindromic sequence has a base composition of more than 1/3 A and T. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (X 1 X 2 X 3 CGCGX 3 'X 2' X 1 '(CG) p) z ( SEQ ID NO: 164)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -3, -2, -1, 0, 1 or 2, p = 0 or 1 Q = 0, 1 or 2 and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides, X ₃ and X ₃ 'are self-complementary nucleosides, and, (TCG (N _q)) is 5'T of _y sequence 5 of the polynucleotide' in 0-3 bases from the end); at least and b) A 10-base long palindromic sequence, (X ₁ X ₂ X ₃ CCGGX ₃ 'X ₂ ' X ₁ '(CG) _p ) _z sequence first (X ₁ X ₂ X ₃ CCGGX ₃ ' X _A palindromic sequence comprising ₂ 'X ₁ '),
An immunomodulatory polynucleotide comprising.   21. The immunomodulatory polynucleotide of claim 20, wherein the palindromic sequence has a base composition of more than 1/3 A and T. An immunomodulatory polynucleotide comprising:
_{a) 5'-N x (TCG} (N q)) y N w (CGX 1 X 2 X 2 'X 1' CG (CG) p) z ( SEQ ID NO: 165)
(Where N is a nucleoside, x = 0-3, y = 1-4, w = -2, -1, 0, 1 or 2, p = 0 or 1; q = 0, 1 or 2, and z = 1-20, X ₁ and X ₁ ′ are self-complementary nucleosides, X ₂ and X ₂ ′ are self-complementary nucleosides, and ( TCG (N _q )) 5′T of the _y sequence is 0-3 bases from the 5 ′ end of the polynucleotide); and b) a palindromic sequence of at least 8 bases in length (CGX ₁ X ₂ X ₂ 'X ₁ ' CG (CG) _p ) a palindromic sequence comprising the first (CGX ₁ X ₂ X ₂ 'X ₁ ' CG) of the _z sequence,
An immunomodulatory polynucleotide comprising.   23. The immunomodulatory polynucleotide of claim 22, wherein the palindromic sequence has a base composition of more than 1/3 A and T.   An immunomodulatory composition comprising the immunomodulatory polynucleotide of claim 1.   A method of modulating an individual's immune response, comprising administering to the individual an amount of the immunomodulatory polynucleotide of claim 1 sufficient to modulate the individual's immune response.   A method of modulating an individual's immune response comprising administering to the individual an amount of the immunomodulatory polynucleotide of claim 4 sufficient to modulate the individual's immune response. A method for increasing an individual's interferon-gamma (IFN-γ) comprising:
2. A method comprising administering to said individual an immunomodulatory polynucleotide according to claim 1 in an amount sufficient to increase IFN-γ of said individual. A method for increasing an individual's interferon-gamma (IFN-γ) comprising:
5. A method comprising administering to said individual an immunomodulatory polynucleotide according to claim 4 in an amount sufficient to increase IFN-γ of said individual. A method of increasing interferon-alpha (IFN-α) in an individual comprising:
2. A method comprising administering to said individual an immunomodulatory polynucleotide according to claim 1 in an amount sufficient to increase IFN-α of said individual. A method of increasing interferon-alpha (IFN-α) in an individual comprising:
5. A method comprising administering to said individual an immunomodulatory polynucleotide according to claim 4 in an amount sufficient to increase IFN-α of said individual. A method of increasing interferon-alpha (IFN-α) in an individual comprising:
8. A method comprising administering to said individual an immunomodulatory polynucleotide according to claim 7 in an amount sufficient to increase IFN-α of said individual. A method of recovering an individual's symptoms of infection:
A method comprising administering to said individual an effective amount of an immunomodulatory polynucleotide according to claim 1, wherein an effective amount is an amount sufficient to ameliorate the symptoms of said infection. A method of recovering an individual's symptoms of infection:
A method comprising administering to said individual an effective amount of an immunomodulatory polynucleotide according to claim 4, wherein the effective amount is an amount sufficient to ameliorate the symptoms of said infection. A method of ameliorating an individual's symptoms of an IgE-related disorder comprising:
Administering an effective amount of the immunomodulatory polynucleotide of claim 1 to an individual having an IgE-related disorder, wherein an effective amount is sufficient to ameliorate symptoms of said IgE-related disorder Method, which is quantity. A method of ameliorating an individual's symptoms of an IgE-related disorder comprising:
Administering an effective amount of the immunomodulatory polynucleotide of claim 4 to an individual having an IgE-related disorder, wherein an effective amount is sufficient to ameliorate symptoms of said IgE-related disorder Method, which is quantity.

Images