JP2012039967A - Heat-resistant cellobiohydrolase and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide cellobiohydrolase II excellent in the heat resistance, and the use thereof.SOLUTION: A protein with cellobiohydrolase activity includes an amino acid sequence with one or two amino acid substitutions selected from kinds of mutation at 16 positions in the amino acid sequence composed of a specific sequence.

Description

  The present invention relates to cellobiohydrolase for effectively utilizing cellulose contained in biomass and use thereof.

  Cellulose is a polymer compound in which glucose, which is a sugar, is condensed by β-1,4 glycosidic bonds, and constitutes a strong crystal structure by intermolecular hydrogen bonding. In order to decompose cellulose and further saccharify it into glucose and use it as a raw material for fermentation, in order to decompose cellulose into monosaccharide (saccharification), at least three types of cellulases (cellulose, endoglucanase, cellobiohydrolase and β-glucosidase) A synergistic effect of degrading enzymes).

  Cellobiohydrolase II (GHF6) derived from Phanerochaete chrysosporium is known as a cellobiohydrolase with excellent cellulolytic activity (Patent Document 1, Non-Patent Document 1). Further, it is known that the decomposition efficiency of cellulose is higher as the temperature during the reaction is higher.

JP 2010-41996 A

Uzcatsgui et al. Biotechnol. 19 (2-3): 271-85

  However, cellobiohydrolase II derived from P. chrysosporium has low heat resistance and is difficult to use for the cellulose decomposition reaction at a high temperature at which high decomposition efficiency is expected.

  Accordingly, an object of the present disclosure is to provide cellobiohydrolase II excellent in heat resistance and use thereof.

  The inventors of the present invention have produced a large number of variants for the purpose of improving the heat resistance of cellobiohydrolase II derived from P. chrysosporium. I was able to find it. The disclosure herein is provided based on these findings.

  According to the disclosure of the present specification, a protein having cellobiohydrolase activity, which corresponds to one or more amino acid substitutions selected from the amino acid substitution table shown below in the amino acid sequence represented by SEQ ID NO: 2. A protein comprising an amino acid sequence having an amino acid substitution is provided.

  Further, according to the disclosure of the present specification, DNA encoding any of these proteins is provided, and an expression DNA construct containing the DNA and a cell transformed with the DNA construct of the invention are provided. Further, according to the disclosure of the present specification, the cellulase composition containing the protein and the cellulose-containing material and the protein are brought into contact with each other. Provided is a method for producing a useful substance, comprising a step of culturing a fermentation microorganism in the presence of one or more cellulases.

It is a figure which shows the amino acid substitution (displayed in the lower stage) of the amino acid sequence of PcCBH2 (upper stage), and a heat-resistant mutation candidate site | part. It is a figure which shows a heat-resistant candidate mutant and its heat-resistant temperature. It is a figure which shows the relationship between the heat-resistant temperature of a heat-resistant candidate mutant, and the PSC decomposition | disassembly activity before heat processing, and shows the mutant 5-6 (black square) of an initial sequence, and each heat-resistant candidate mutant (x) It is a figure which shows the residual activity value of the variant which has an advantageous variation | mutation in a 52 degreeC environment. It is a figure which shows the accumulation | storage experiment result of the 2nd generation advantageous mutation. It is a figure which shows the accumulation | storage experiment result of the 3rd generation advantageous mutation. It is a figure which shows the accumulation | storage experiment result of the 4th generation advantageous mutation. It is a figure which shows the accumulation | storage experiment result of the 5th generation advantageous mutation. It is a figure which shows the accumulation | storage experiment result of the 6th generation advantageous mutation. It is a figure which shows the heat test result of a screening experiment. It is a figure which shows the heat resistance evaluation result of the mutant obtained by screening. It is a figure which shows the heat test result of the heat-resistant variant of each generation. It is a figure which shows the durability evaluation result in 50 degreeC environment. It is a figure which shows the accumulation effect of an advantageous variation | mutation, an initial stage arrangement | sequence is a square, Mall4 is a triangle, and the heat-resistant variant of each generation is shown by a diamond. It is a figure which shows the specific activity evaluation result of yeast expression refinement | purification cellulase. It is a figure which shows the heat-resistant evaluation result of a heat-resistant variant, and shows the mutant which carried out the expression refinement | purification with yeast in gray, and the gray which was synthesized in vitro. It is a figure which shows the durability in 50 degreeC environment of a yeast expression refinement | mutation mutant. It is a figure which shows the pH dependence of a yeast expression refinement | mutation mutant. It is a figure which shows the ethanol concentration dependence of yeast expression refinement | purification cellulase. It is a figure which shows the temperature dependence of a yeast expression refinement | mutation mutant. It is the graph which evaluated the synergistic effect when a commercially available enzyme preparation cell crust was mix | blended with various ratio with respect to the wild type PcCBH2 and Mall4 variant, respectively, with the amount of reducing sugars. The upper panel (A) shows the evaluation results of wild-type PcCBH2, and the lower panel (B) shows the evaluation results of Mall4 mutant. The heat resistance evaluation result of Mall4 mutant which deleted CBD is shown. It is a figure which shows the heat resistance evaluation of the Mall4 variant substituted by CBD derived from a different organism.

  The disclosure of the present specification relates to a protein having cellobiohydrolase activity derived from Phanerochaete chrysosporium having excellent heat resistance and use thereof. The protein disclosed in the present specification has one or more amino acid substitutions in the amino acid sequence (SEQ ID NO: 2) of the catalytic domain of cellobiohydrolase II from P. chrysosporium, and has cellobiohydrolase activity. Yes. Such a protein has higher heat resistance than the original protein (a protein consisting of the amino acid sequence represented by SEQ ID NO: 2 or a full-length protein containing the sequence). According to this protein, the high cellobiohydrolase activity of cellobiohydrolase II derived from P. chrysosporium can be used for the cellulose decomposition reaction at a higher temperature, and a high cellulose decomposition efficiency can be obtained.

  Hereinafter, various embodiments included in the disclosure of the present specification will be described in detail. As used herein, “GHF (Glycoside Hydrolase Family)” means glycoside hydrolysis provided on the homepage of CAZy (Carbohydrate active Enzymes) (http://www.cazy.org/fam/acc_GH.html). It is a classification of degrading enzymes.

((Protein derived from amino acid sequence (SEQ ID NO: 2) derived from cellobiohydrolase II of P. chrysosporium and having cellobiohydrolase activity)
The amino acid sequence represented by SEQ ID NO: 2 encodes the amino acid sequence of P. chrysosporium cellobiohydrolase II catalytic domain (Appl. Environ. Microbaial. 60 (12), 4387-4393 (1994)). P. chrysosporium cellobiohydrolase II has a cellulose-binding domain via a linker at the N-terminus of the catalytic domain represented by SEQ ID NO: 2.

  The protein disclosed in the present specification has a predetermined amino acid substitution in the amino acid sequence represented by SEQ ID NO: 2 and an amino acid sequence to which another amino acid sequence is added as long as it has cellobiohydrolase activity It may consist of For example, the protein may have a cellulose binding domain (CBD). CBDs may be linked via a linker. An amino acid sequence represented by SEQ ID NO: 4 is given as an amino acid sequence to which another amino acid sequence represented by SEQ ID NO: 2 is added. This amino acid sequence is the full-length amino acid sequence of cellobiohydrolase II of P. chrysosporium, and has a catalytic domain (amino acid sequence represented by SEQ ID NO: 2) of CBD, linker and cellobiohydrolase from the N-terminus. Even a protein having the amino acid sequence represented by SEQ ID NO: 4 has an amino acid substitution disclosed in the present specification in the amino acid sequence represented by SEQ ID NO: 2 in the protein, whereby CBD or the like is added. Even if it is, heat resistance is improved.

  This protein can have an amino acid substitution corresponding to one or more amino acid substitutions shown in Table 1 in the amino acid sequence of the catalytic domain of cellobiohydrolase II obtained from P. chrysosporium (SEQ ID NO: 2). “Having an amino acid substitution corresponding to one or more amino acid substitutions in the amino acid sequence” means that the amino acid sequence represented by SEQ ID NO: 2 has one or more amino acid substitutions selected from Table 1, In the amino acid sequence having a certain relationship with the amino acid sequence represented by No. 2, the amino acid corresponding to one or more amino acid substitutions selected from Table 1 when compared with the amino acid sequence represented by SEQ ID No. 2 It means having a substitution. The term “with amino acid substitution” means that the amino acid before substitution and the amino acid after substitution are respectively specified at the position, and as a result, it is only necessary to have an amino acid identified by “amino acid substitution”. Means. That is, “having an amino acid substitution of“ M176L ”means having an L (leucine) at the site corresponding to position 176 in the amino acid sequence represented by SEQ ID NO: 2. Hereinafter, amino acid substitution, which is a mutation that can be included in the present protein, will be described.

  This protein may have an amino acid sequence having a combination of 1 or 2 amino acid substitutions shown in each column of Table 2 as a unit in the amino acid sequence represented by SEQ ID NO: 2. Among them, the second amino acid sequence preferably has at least one amino acid substitution corresponding to one or more selected from T259H and Q298S + F299L. It is preferable to include both or any of T47I and S51Q in combination with each of these mutations. In addition, it preferably contains a mutation of M176I. Furthermore, it preferably contains a mutation of A158E. In addition, preferably it contains both or any of the mutations Q224R + A226S. Furthermore, in addition, it preferably contains a mutation of S100T. In addition, it preferably contains one or more mutations selected from the group consisting of T29S, N42K, Q121K, I282V and F123Y, more preferably 3 or more, and still more preferably 4 or more. More preferably, there are 5 types.

From the above, preferred examples of the present protein include amino acid sequences having at least the combinations of amino acid substitutions shown in Table 3 below in the amino acid sequence represented by SEQ ID NO: 2. Among these, the third generation or later is preferable, more preferably the fourth generation or later, further preferably the fifth generation or later, more preferably the sixth generation or later, and most preferably the seventh generation or later. In Table 3, a protein having a combination of amino acid substitutions of “21” and further comprising one or more amino acid substitutions selected from the group consisting of T29S, N42K, Q121K, I282V and F123Y is also preferable.

  The cellobiohydrolase activity of this protein is obtained by subjecting a solution of this protein to a suitable concentration (for example, 50 mM acetate buffer (pH 5.0)) to the decomposition of phosphoric acid swollen cellulose (reaction conditions, 40 ° C., 16 hours), It can be obtained by evaluating the amount of reducing sugar in the centrifugal supernatant of the reaction solution using the TZ assay method.

  The heat resistance of this protein can be represented by the heat resistant temperature obtained by the following method. That is, a solution having an appropriate concentration of the mutant (for example, 50 mM acetate buffer (pH 5.0) in an appropriate range such as 49 ° C., 50 ° C., 51 ° C., 52 ° C., 53 ° C., 54 ° C., 55 ° C. and 56 ° C.) After maintaining the temperature at each temperature for 2 hours, the residual activity after the heat treatment was determined using the TZ assay method for the amount of reducing sugar in the centrifugal supernatant after decomposition of phosphate-swelled cellulose (reaction conditions, 40 ° C., 16 hours). The cellobiohydrolase activity at each temperature is measured by evaluation, and the activity is defined as the remaining activity at each temperature, which is expressed as a ratio (%) of the remaining activity after heat treatment to the activity before heat treatment, From the remaining activity (%) at each temperature, the temperature at which the remaining activity is 50% is defined as the heat resistant temperature (° C.).

  In addition, the heat resistance of the protein can be simply determined by the residual activity (%) after storage for a predetermined time at a predetermined temperature (for example, a specific temperature of 50 ° C. or higher). For example, the buffer solution of the present protein may be held at a predetermined temperature for 2 hours, and after the heat treatment, the remaining activity (%) may be obtained in the same manner as described above (reaction conditions, 40 ° C., 16 hours).

  Regarding the heat resistance of the present protein, either or both of the heat resistant temperature and the residual activity at a predetermined temperature can be used as an index, but preferably the heat resistant temperature is used as an index.

  The protein preferably has a heat resistance of 50 ° C. or higher, more preferably 50.5 ° C. or higher, still more preferably 51.0 ° C. or higher, and even more preferably 52.0 ° C. or higher. Yes, more preferably 52.5 ° C. or higher, even more preferably 53.0 ° C. or higher, still more preferably 53.5 ° C. or higher. Still more preferably, it is 54.0 degreeC or more, More preferably, it is 54.5 degreeC or more, More preferably, it is 55.0 degreeC or more.

  The protein also preferably has a durability (residual activity) at 50 ° C. of 80% or more in 24 hours, more preferably 90% or more. The durability at 50 ° C. is preferably 80% or more in 48 hours, and more preferably 90% or more. Further, the durability at 50 ° C. is preferably 80% or more at 72 hours, and more preferably 90% or more.

  In this protein, the number of amino acid substitutions shown in Table 1 is preferably 2 or more, more preferably 3 or more, still more preferably 4 or more, still more preferably 5 or more, still more preferably 6 or more, and even more preferably. 7 or more are provided. Furthermore, it is known that the heat resistance is improved if the number of amino acid substitutions is 8 or more. Most preferably, it is 13 or more.

  This protein may be provided with one or more amino acid substitutions selected from the amino acid substitutions shown in Table 1 in the amino acid sequence represented by SEQ ID NO: 2 and combinations of amino acid substitutions shown in Table 2. Further, the amino acid sequence having a certain relationship with the amino acid sequence represented by SEQ ID NO: 2 may have amino acid substitutions corresponding to the amino acid substitutions shown in Table 1. Whether it corresponds to the amino acid substitution shown in Table 1 is determined by aligning two or more amino acid sequences by a method for determining identity and similarity described later. The protein having an amino acid sequence having a certain relationship with the amino acid sequence represented by SEQ ID NO: 2 will be described below.

  As one aspect of the amino acid sequence having a certain relationship with the amino acid sequence represented by SEQ ID NO: 2, an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 The protein which consists of is mentioned. Any one type of amino acid mutation, ie, deletion, substitution or addition, for each amino acid sequence may be used, or two or more types may be combined. The total number of these mutations is not particularly limited, but is preferably about 1 or more and 25 or less. More preferably, they are 1 or more and 20 or less, More preferably, they are 1 or more and 15 or less. As an example of amino acid substitution, conservative substitution is preferable, and specific examples include substitution within the following groups. (Glycine, alanine) (valine, isoleucine, leucine) (aspartic acid, glutamic acid) (asparagine, glutamine) (serine, threonine) (lysine, arginine) (phenylalanine, tyrosine).

  Another embodiment includes an amino acid sequence having an amino acid sequence having 70% or more identity to the amino acid sequence represented by SEQ ID NO: 2 and having cellobiohydrolase activity. The identity is preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, and still more preferably 95% or more. Most preferably, it is 98% or more.

  As used herein, identity or similarity is a relationship between two or more proteins or two or more polynucleotides determined by comparing sequences, as is known in the art. In the art, “identity” means between protein or polynucleotide sequences, as determined by alignment between protein or polynucleotide sequences, or in some cases by alignment between a series of such sequences. Means the degree of sequence invariance. Similarity is also the correlation between protein or polynucleotide sequences, as determined by alignment between protein or polynucleotide sequences, or in some cases by alignment between a series of partial sequences. Means the degree of More specifically, it is determined by sequence identity and conservation (substitutions that maintain specific amino acids in the sequence or physicochemical properties in the sequence). The similarity is referred to as Similarity in the BLAST sequence homology search result described later. The method for determining identity and similarity is preferably a method designed to align the longest between the sequences to be compared. Methods for determining identity and similarity are provided as programs available to the public. For example, BLAST (Basic Local Alignment Search Tool) program by Altschul et al. (Eg Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ., J. Mol. Biol., 215: p403-410 (1990), Altschyl SF, Madden TL, Schaffer AA, Zhang J, Miller W, Lipman DJ., Nucleic Acids Res. 25: p3389-3402 (1997)). The conditions for using software such as BLAST are not particularly limited, but it is preferable to use default values.

  In still another embodiment, the cell code is encoded by DNA that hybridizes under stringent conditions with DNA comprising a base sequence complementary to the DNA comprising the base sequence encoding the specific amino acid sequence represented by SEQ ID NO: 2. Examples include amino acid sequences having biohydrolase activity. The stringent condition refers to, for example, a condition in which a so-called specific hybrid is formed and a non-specific hybrid is not formed. For example, a nucleic acid having a high nucleotide sequence identity, that is, a predetermined nucleotide sequence of 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, more preferably 98% or more. Examples include a condition in which complementary strands of DNA consisting of nucleotide sequences having the identity are hybridized and complementary strands of nucleic acids having lower homology are not hybridized. More specifically, the sodium salt concentration is 15 to 750 mM, preferably 50 to 750 mM, more preferably 300 to 750 mM, the temperature is 25 to 70 ° C., preferably 50 to 70 ° C., more preferably 55 to 65 ° C., formamide The condition is that the concentration is 0 to 50%, preferably 20 to 50%, more preferably 35 to 45%. Furthermore, under stringent conditions, the filter washing conditions after hybridization are usually such that the sodium salt concentration is 15 to 600 mM, preferably 50 to 600 mM, more preferably 300 to 600 mM, and the temperature is 50 to 70 ° C., preferably It is 55-70 degreeC, More preferably, it is 60-65 degreeC. From the above, as yet another aspect, the predetermined base sequence is 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, and still more preferably 98% or more. Examples thereof include proteins encoded by DNA having a base sequence having sex and having cellobiohydrolase activity.

  Examples of the amino acid sequence having a certain relationship with the amino acid sequence represented by SEQ ID NO: 2 include other mutations known in cellobiohydrolase II derived from Phanerochaete chrysosporium (for example, mutations related to activity enhancement). .

  In addition, it is preferable that the present protein itself including a modification contains an amino acid mutation of preferably 25 or less, more preferably 20 or less, and still more preferably about 15 or less in the amino acid sequence represented by SEQ ID NO: 2. Moreover, the protein itself has an amino acid sequence having 70% or more identity to the amino acid sequence represented by SEQ ID NO: 2 and has a cellobiohydrolase activity. The identity is preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, and still more preferably 95% or more. Most preferably, it is 98% or more. Further, the present protein itself is encoded by DNA that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to DNA consisting of the base sequence encoding the specific amino acid sequence represented by SEQ ID NO: 2, It preferably has biohydrolase activity. As yet another embodiment, the base sequence of the DNA encoding the amino acid sequence represented by SEQ ID NO: 2 and 80% or more, preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, more preferably It is preferably encoded by DNA having a base sequence having 98% or more identity and has cellobiohydrolase activity.

  Amino acid substitution in this protein can be introduced by various techniques. For example, a method of modifying gene information such as DNA having the base sequence represented by SEQ ID NO: 1 encoding the amino acid sequence represented by SEQ ID NO: 2 or the amino acid sequence having a certain relationship therewith can be used. In order to obtain the protein of the present invention by introducing a mutation into DNA and modifying the genetic information, in addition to the method of designing the mutation in advance and obtaining DNA encoding the amino acid sequence containing the mutation, the Kunkel method, A known method such as a Gapped duplex method or a method according to this can be employed. For example, mutations are introduced using a mutation introduction kit (for example, Mutan-K (manufactured by TAKARA) or Mutan-G (manufactured by TAKARA)) using site-directed mutagenesis. Moreover, gene mutation introduction and chimera genes can be constructed by techniques such as error introduction PCR and DNA shuffling. Error introduction PCR and DNA shuffling are techniques known in the art. For example, for error introduction PCR, Chen K, and Arnold FH. 1993, Proc. Natl. Acad. Sci. USA, 90: 5618-5622 In addition, molecular evolution engineering methods such as DNA shuffling and cassette PCR are described in, for example, Kurtzman, AL, Govindarajan, S., Vahle, K., Jones, JT, Heinrichs, V., Patten PA, Advances in directed protein evolution. by recursive genetic recombination: applications to therapeutic proteins. Curr. Opinion Biotechnol., 12, 361-370, 2001, and Okuta, A., Ohnishi, A. and Harayama, S., PCR isolation of catechol 2,3-dioxygenase See Gene fragments from environmental samples and their assembly into functional genes. Gene, 212, 221-228, 1998. Among these, it is preferable to employ a cell-free protein synthesis system that uses a molecular evolution method for introducing random mutations by error-prone PCR or the like. As a cell-free protein synthesis system applied to error-prone PCR, a protein synthesis system described in Japanese Patent Application Laid-Open Nos. 2006-61080 and 2003-116590 filed by the applicant of the present application can be used. By using these cell-free protein synthesis systems by the present applicant, an active enzyme can be easily obtained. For this reason, error-prone PCR to which these protein synthesis systems are applied can be preferably used as a technique for obtaining the protein of the present invention.

  The protein can be obtained by a genetic engineering technique using a cell-free synthesis system of the protein as described above, or a suitable host cell is transformed with the DNA encoding the protein, and the present invention is used in the transformed cell. It can be obtained by a genetic engineering technique for producing a protein. A genetic engineering protein production method using transformed cells can be performed according to the method described in Molecular Cloning 3rd Edition, Current Protocols in Molecular Biology and the like.

  In addition, when this protein is a protein produced by a transformed cell using P. chrysosporium or various microorganisms as a host, these bacteria are cultured to obtain a culture supernatant, and this protein is separated from this culture supernatant.・ Purify it. A known protein separation / purification method may be applied to the separation or purification.

  When this protein is produced in a transformed cell of a eukaryotic microorganism such as yeast in which sugar chain modification is expected, heat resistance is improved by sugar chain modification. That is, according to the present inventors, it was observed that the heat resistance of the present protein expressed in yeast is improved by about 2 ° C. than the same protein synthesized in a cell-free synthesis system. Examples of the protein include N-type sugar chain modification (sites corresponding to N189 and N317 in the amino acid sequence represented by SEQ ID NO: 2) and O-type sugar chain modification. At least this protein expressed in yeast such as S. cerevisiae has higher heat resistance than other proteins of the same amino acid sequence obtained by other microorganisms, in vitro synthesis or chemical synthesis, even if the amino acid sequence is the same. Have. Therefore, a transformed cell of a eukaryotic microorganism in which sugar chain modification is expected is a preferred embodiment as a production medium for this protein or as it is as a microorganism for fermentation.

(DNA encoding this protein)
According to the disclosure herein, a polynucleotide encoding the protein is provided. The polynucleotide can be obtained by a chemical synthesis method, various PCR methods, or the like. The polynucleotide may be in any form such as DNA (which may be either double-stranded or single-stranded), RNA, or DNA / RNA hybrid. Examples include DNAs encoding the amino acid sequences of various variants having one or more of the amino acid mutations included in Table 1 above, and DNAs encoding the amino acid sequences of each variant described in Table 2 above.

(DNA construct)
The DNA construct of the present invention contains DNA encoding the present protein. More specifically, DNA encoding amino acid sequences of various variants having one or more of the amino acid mutations included in Table 1 above, combinations of each mutation described in Table 2 above, and Table 3 It contains DNA encoding the amino acid sequence of the variant shown. The DNA construct of the present invention can take the form of an expression vector intended primarily for transformation of suitable host cells. Depending on the transformation method and the retention form of the polynucleotide in the host cell (form introduced into the chromosome, form retained outside the chromosome, etc.), components other than the coding region are appropriately determined. Moreover, the form of a DNA construct can take various forms according to a use form. For example, it can take the form of a DNA fragment, and can also take the form of an appropriate vector such as a plasmid or cosmid.

  The present DNA construct may be constructed such that the present protein can be expressed in a form capable of constituting a protein complex described below. That is, it may be formed so that a fusion protein in which a dockerin domain is added to the present protein can be expressed. Further, as a construct for expression capable of constituting a protein complex, a construct for expressing a cohesin protein including DNA encoding the cohesin protein may be constructed. In such an expression construct, the encoded DNA of the fusion protein or cohesin protein is prepared in various forms in the same manner as the DNA encoding the present protein.

(Transformed cells)
One aspect of the transformed cell of the present invention is a transformed cell that expresses the present protein, and can be obtained by transforming an appropriate host cell with the above-described DNA construct of the present invention. For example, a transformed cell that expresses only the present protein on the cell surface layer or secretes it outside the cell can be used as the present protein. In addition, a culture obtained by culturing such a transformed cell can be used as a preferred source of the protein.

  The transformed cell may be any cell that can express the protein, and the type of the transformed cell is not limited. However, considering production and recovery of the protein, bacteria such as Escherichia coli can be mentioned. It is a eukaryotic microorganism for degradation and utilization of cellulose. The eukaryotic microorganism is not particularly limited, and for example, various known yeasts can be used. In consideration of ethanol fermentation described later, yeasts of the genus Saccharomyces cerevisiae such as Saccharomyces cerevisiae, yeasts of the genus Schizosaccharomyces pombe such as Schizosaccharomyces pombe, Candida shehatae, etc. Yeast of the genus Candida, yeast of the genus Pichia such as Pichia stipitis, yeast of the genus Hansenula, yeast of the genus Trichosporon, yeast of the genus Brettanomyces, the genus Pachysolen And yeast of the genus Yamadazyma, yeasts of the genus Kluyveromyces such as Kluyveromyces marxianus and Kluveromyces lactis. Of these, Saccharomyces yeasts are preferable from the viewpoint of industrial availability. Of these, Saccharomyces cerevisiae is preferable. In addition, eukaryotic microorganisms are Aspergillus oryzae, Aspergillus aculeatus, Aspergillus niger, Aspergillus nidulans, Aspergillus soya, Aspergillus soyya, Aspergillus soya Aspergillus (Aspergillus kawachii), Aspergillus awamori (Aspergillus saitoi), Aspergillus saitoi, etc. may be used. Cellulase non-producing microorganisms are more preferred for expressing large amounts of heterologous proteins. In addition, examples of eukaryotic microorganisms include Trichoderma genus bacteria such as Trichoderma reesei, which are cellulase-producing microorganisms, and wood rot fungi including white rot fungi. By using a cellulase-producing microorganism as a host, the present protein can be produced simultaneously with cellulase, hemicellulase and the like that can be produced by these microorganisms.

  In consideration of the use of the transformed cell for cellulose degradation, the transformed cell is preferably one that secretes the protein outside the cell or presents it on the cell surface. In order to impart extracellular secretion properties and cell surface presentation properties to this protein, known secretion signals and surface layer presentation systems can be used. For example, a secretory signal, an aggregating protein, or a part of the amino acid sequence is given. Examples of the secretion signal include secretion signals of glucoamylase genes of Rhizopus oryzae and C. albicans, yeast invertase leader, α factor leader and the like. Examples of the aggregating protein include a peptide consisting of 320 amino acid residues in the 5 'region of the SAG1 gene encoding α-agglutinin. Polypeptides and techniques for displaying a desired protein on the cell surface are disclosed in WO01 / 79483, JP2003-235579, WO2002 / 042483, WO2003 / 016525, and JP2006. No. 136223, Fujita et al. (Fujita et al., 2004. Appl Environ Microbiol 70: 1207-1212 and Fujita et al., 2002. Appl Environ Microbiol 68: 5136-5141.), Murai et al., 1998. Appl Environ Microbiol 64: 4857 -4861.

  As will be described later, this transformed cell displays the cohesin protein derived from the cellulosome-producing microorganism on the cell surface, secretes this protein with dockerin added outside the cell, and binds this protein to the cohesin protein by cohesin-dockerin binding. The protein may be presented via a cell surface layer.

  Yeast that can be modified with a sugar chain and that expresses the present protein is a preferred transformed cell because it can improve the heat resistance of the present protein synthesized in vitro. Cells expressing this protein, preferably eukaryotic microorganisms, such as yeast, are capable of degrading cellulose, saccharifying, and co-promoting saccharification and fermentation with improved cellobiohydrolase activity and enhanced synergistic effects. In the process (simultaneous progress of saccharification and fermentation), it is possible to increase the decomposition efficiency of cellulose and embody the efficient use of cellulose.

  Any of the transformed cells disclosed in the present specification described above can be prepared according to the method described in Molecular Cloning 3rd Edition, Current Protocols in Molecular Biology, etc. . Vectors for the transformation of host cells such as eukaryotic microorganisms and methods for their construction are well known to those skilled in the art and disclosed in Molecular Cloning 3rd Edition, Current Protocols in Molecular Biology, etc. Yes. Similarly, vectors for expressing cohesin proteins and proteins having a dockrin domain in eukaryotic microorganisms and construction methods thereof are also well known to those skilled in the art. In addition, for transformation, various conventionally known methods such as transformation method, transfection method, conjugation method, protoplast method, electroporation method, lipofection method, lithium acetate method and the like can be used as well. Well known in the art.

(Cellulase composition)
According to the disclosure of the present specification, there is provided a composition comprising the protein and one or more kinds selected from the group consisting of other cellulases, for example, other cellobiohydrolases and endoglucanases. The According to this composition, a high cellulolytic activity can be exhibited due to the excellent cellobiohydrolase activity of this protein. Cellulases other than the present protein contained in the present composition are not particularly limited and are appropriately selected from known cellulases. For example, endoglucanases of other origins not derived from Phanerochaete chrysosporium can be mentioned. Examples of endoglucanases derived from other sources include various known endoglucanases, which can be used alone or in combination of two or more. An example is endoglucanase belonging to GHF5. Among endoglucanases classified as GHF5, preferably, endoglucanase derived from Trichoderma reesei, endoglucanase derived from Aspergillus oryzae, and endoglucanase derived from Aspergillus niger can be preferably used. More preferred is an endoglucanase derived from Trichoderma reesei endoglucanase Aspergillus niger. The endoglucanase classified as GHF5 can be used by appropriately combining one or more selected from such endoglucanases. The cellulase composition may contain β-glucosidase.

  The endoglucanase includes endoglucanase belonging to GHF12. Among these, endoglucanase derived from Trichoderma reesei, endoglucanase derived from Aspergillus niger, and endoglucanase derived from Aspergillus oryzae can be mentioned. One or more selected from these endoglucanases can be used in appropriate combination. The endoglucanase may be an endoglucanase belonging to GHF7 and GHF45. Among these, an endoglucanase derived from Trichoderma reesei can be preferably used.

  The cellulase composition may contain an endoglucanase derived from Phanerochaete chrysosporium. The endoglucanase derived from Phanerochaete chrysosporium can be easily obtained together with cellobiohydrolase II and its variant when cellobiohydrolase II and its variant are obtained from a culture of Phanerochaete chrysosporium or the like.

  The cellulase composition may contain other cellulases other than endoglucanases. For example, cellobiohydrolase I belonging to GHF7 can be contained. As for cellobiohydrolase I, cellobiohydrolase I cooperates with cellobiohydrolase II and the like, so that a synergistic effect of cellulose degradation is further exhibited. Cellobiohydrolase I may be derived from Phanerochaete chrysosporium or from other sources.

  The present cellulase composition may contain two or more cellulases obtained from a culture of cellulase-producing bacteria other than Phanerochaete chrysosporium (may be a culture supernatant). The cellulase-producing bacterium is not particularly limited and can be appropriately selected. Preferred examples of endoglucanase include Trichoderma reesei, Aspergillus aculeatus, Aspergillus niger, Aspergillus oryzae and the like. More preferred is Trichoderma reesei.

  This cellulase composition can be obtained by producing and combining the present protein and, if necessary, other cellulases chemically or genetically. You may make it obtain this cellulase composition by producing all the cellulases which comprise this cellulase composition by genetic engineering with the same host cell, and collect | recovering the culture supernatant and culture | cultivation microbial cells.

  The present cellulase composition may contain the present protein and other cellulases as purified ones, or may contain other proteins and other components as unpurified proteins. The form of the preparation is not particularly limited, and may be a solid preparation (powder (lyophilized body, etc.), tablet, granule, etc.) or a solution (a frozen body during distribution). ).

(This protein complex)
The protein complex disclosed in the present specification includes the present protein and the present protein on the cohesin protein through a cohesin-docklin bond. It is known that a certain kind of bacteria constructs a protein structure holding a plurality of types of cellulases on the surface of its own cell, and the protein structure is known as a cellulosome. The cellulosome is composed of cellulase held in a scaffoldin protein. The cellulosome and scaffoldin protein are bound between the dockrin domain and the cohesin domain, ie, the cohesin-dockerin bond. Are combined. Several amino acid sequences of the dockrin domain and cohesin domain in known cellulosomes have already been disclosed. The cohesin-docklin bond is considered to be non-covalent and based on a hydrogen bond depending on the amino acid sequence. Therefore, according to this disclosure, an artificial cellulosome, that is, a protein complex, can be obtained from the present protein with a dockrin domain added and a scaffoldin protein (referred to as a cohesin protein) having one or more cohesin domains. Can be built.

  In this protein complex, the protein is chimerized (chimeric protein) by adding a dockerin domain. A dockerin domain is a site | part which makes this protein couple | bond with the cohesin protein mentioned later by a cohesin-docklin bond. The dockerin domain is provided, for example, in a part of cellulase constituting the cellulosome of a known cellulosome-producing microorganism. The dockerin domain used in the present cellulase complex is selected from the known dockerin domains of cellulases of various cellulosome-producing microorganisms. For example, an amino acid sequence containing the dockrin domain of C. thermocellum endoglucanase can be mentioned. The dockerin domain may be on either the N-terminal side or the C-terminal side of the active domain, but is preferably located on the C-terminal side.

  In the present protein complex, another cellulase that may be contained in the present cellulase composition described above may be retained in the cohesin protein. Other cellulases may be chimerized with the addition of a dockerin domain as in the present protein, or may be cellulases that inherently have a dockerin domain. The dockerin domain added to other cellulases may be the same as or different from the dockerin domain added to the present protein.

  The cohesin protein has one or more cohesin domains that bind to the dockrin domain of the protein. Thereby, cohesin protein can hold | maintain this protein by a cohesin-docklin coupling | bonding, and functions as a skeleton protein of this protein complex. In addition, the protein complex may include a cohesin protein having a combination or sequence of different cohesin domains for holding other cellulases.

  One or more cohesin domains provided in the cohesin protein are derived from the cohesin domain provided in the cellulosomal scaffoldin protein. The cohesin domain is known as a domain that binds a catalytically active cellulase or the like provided in type I to III skeletal proteins in cellulosomes formed by cellulosome-producing microorganisms (Nakaku et al., Protein nucleic acid enzyme, Vol.44, No.10 (1999), p41-p50, Demain, AL, et al., Microbiol Mol. Biol Rev., 69 (1), 124-54 (2005), Doi, RH, et al., J. Bacterol., 185 (20), 5907-5914 (2003), etc.). That is, the cohesin domain includes a type I cohesin domain on a cellulosome type I skeletal protein, a type II cohesin domain on the same type II skeletal protein, and a type III cohesin domain on a type III skeletal protein. Many of these types of cohesin domains have been sequenced in various cellulosome-producing microorganisms. The amino acid sequences and DNA sequences of these various types of cohesins are various protein databases and DNA sequence databases accessible via NCBI HP (http://www.ncbi.nlm.nih.gov/), etc. Can be obtained more easily.

  A cohesin domain is a domain derived from such a cohesin domain and can bind to the dockerin domain of the chimeric protein. Chimerization of the dockerin domain into the active domain of cellulase may be difficult due to unintentionally reduced activity of the active domain, so select the cohesin domain according to the dockerin domain of the chimeric protein be able to. In addition, the cohesin domain can be selected in consideration of the strength of the cohesin-docklin bond and the like.

  In the present protein complex, for example, the dockerin domain of the chimeric protein may be, for example, the cohesin domain of the C. thermocellum scaholdin protein relative to the dockin domain of celA of C. thermocellum.

  The present protein complex may be an independent form as a protein complex, or may be immobilized or held on an appropriate carrier. Moreover, the state shown on the surface layer of microorganisms, such as yeast, may be sufficient. The present protein complex can be obtained, for example, by obtaining each protein by a known protein production method and self-assembling the chimeric protein with the cohesin protein under the condition in which these proteins are brought into contact with each other. When presenting the present protein complex on the cell surface, cohesin protein is presented on the cell surface and the chimeric protein is expressed so as to be secreted outside the cell.

  In addition, the present protein complex can be obtained by mixing a culture supernatant of a microorganism that secretes and expresses one or more of its constituent proteins or a protein purified product thereof, bringing all the constituent proteins into contact with each other and allowing them to self-assemble. . Note that not all of the constituent proteins may be secreted and expressed by the microorganism, and if necessary, constituent proteins that are not produced by the microorganism may be separately produced and mixed. In addition, in the case of a microorganism that secretes and expresses all of the constituent proteins, since the protein is contained in the culture supernatant of the microorganism in a state capable of self-assembly, the protein complex can be obtained in the culture supernatant.

(Production method of cellulose degradation products)
The method for producing a degradation product of cellulose disclosed in the present specification provides a method comprising a step of bringing a material containing cellulose into contact with one or more cellulases containing the protein. According to this method, cellulose can be efficiently decomposed at a higher temperature by using the present protein, which is a cellobiohydrolase with improved heat resistance. The temperature for cellulosic decomposition is, for example, 50 ° C. or more and 70 ° C. or less, more preferably 50 ° C. or more and 65 ° C. or less, and further preferably 50 ° C. or more and 60 ° C. or less.

  As 1 type (s) or 2 or more types of cellulases used at this process, it can select from the other cellulases which can be contained in this cellulase composition suitably, and can use them. In the decomposition step, cellulase may be supplied as the present cellulase composition or may be provided as the present protein complex. Conditions such as treatment temperature and time in the decomposition step can be appropriately set depending on the type of cellulase used and the supply form of cellulose.

  In the present specification, the cellulose may be supplied as a cellulose that has undergone a separation step from other components from biomass, or biomass that has been subjected to untreated or partial pretreatment in which lignin, hemicellulose, and / or pectin coexist. For example, it may be supplied as a material containing cellulose. As a material containing cellulose, waste resources such as rice straw, wheat straw, bagasse, and dead grass, as well as unused resources may be used, and there is no particular limitation as long as cellulose is contained. Moreover, in this specification, as a cellulose degradation product, what is necessary is just the low molecular weight thing of a cellulose, and glucose, its oligomer, cellobiose etc. are mentioned.

(Useful substance production method)
According to the disclosure of the present specification, it is a method for producing a useful substance, obtained by contacting a material containing cellulose with one or more cellulases containing the protein, and the contacting step. There is provided a method comprising culturing a microorganism in the presence of a carbon source containing the degradation product of cellulose. According to this production method, since the improved cellobiohydrolase activity contributes to the degradation of cellulose using this protein, it is possible to efficiently degrade the cellulose. In this production method, the cellulose decomposition step and the microorganism cultivation step can be carried out independently. Therefore, in the cellulose decomposition step, the cellulase composition or the protein complex may be used as an enzyme preparation to decompose cellulose, and then the cellulose decomposition product may be supplied to the culturing step for fermentation.

  Moreover, according to the indication of this specification, the production method of a useful substance including the process of culture | cultivating microorganisms in the presence of 2 or more types of cellulases containing this protein for the carbon source containing cellulose is also provided. According to this form, based on the improved cellobiohydrolase activity of the present protein, a so-called simultaneous saccharification / fermentation process (CBP) can be efficiently performed. In this embodiment, the microorganism for fermentation may self-produce the protein and other cellulases, or may be supplied from the outside. Self-production and external supply may be combined. When a microorganism self-produces two or more kinds of proteins including the present protein, the form may be such that the present protein or the like is secreted outside the cell, or may be presented on the cell surface.

  As the microorganisms used in the culturing step, ethanol-producing microorganisms such as yeast and eukaryotic microorganisms such as Aspergillus can be preferably used, starting with the host already described for the transformed cells. The microorganism may be an artificially obtained microorganism. For example, it may be genetically engineered so that it can produce a compound that is not the original metabolite obtained by replacing or adding one or more enzymes in the metabolic system from glucose by genetic recombination. Good. By using such microorganisms, for example, biochemicals such as the production of fine chemicals (coenzyme Q10, vitamins and their raw materials, etc.) by adding an isoprenod synthesis pathway, the production of glycerin by modification of glycolysis, and the raw materials for plastics and chemical products. Applicable to refinery technology. Although it does not specifically limit as a useful substance, The thing which can produce | generate microorganisms using glucose is preferable, and as above-mentioned, the substance over the biorefinery technique can be made into object.

  EXAMPLES Hereinafter, although an Example is given and this invention is demonstrated concretely, this invention is not limited to these Examples. The gene recombination operation described below was performed according to the previously described Molecular Cloning.

(1) Selection of heat resistant candidate mutations
Cellobiohydrolase II (PcCBH2) derived from P. chrysosporium has a structure in which the catalytic domain and the cellulose binding domain (CBD) are connected by a linker. In the following examples, heat resistance was attempted by amino acid substitution in the catalytic domain. That is, the homology search was performed on the amino acid sequences of the catalytic domains of cellobiohydrase II and PcCBH2 derived from five kinds of heat-resistant molds (Hypocrea koningii, Acremonium cellulolyticus Y-94, Agaricus bisporus, Talaromyces emersonii, Lentinula edodes L54). At each site of the amino acid sequence after the above homology search, a site having high homology between heat-resistant mold-derived cellulases and an amino acid different from PcCBH2 was searched. As a result, 45 amino acid substitutions at 45 sites satisfying the above conditions were selected as heat-resistant candidate mutations. Each mutation candidate site and its amino acid substitution are shown in FIG.

(2) Construction of mutant containing heat-resistant candidate mutation PcCBH2 mutant 5-6 (SEQ ID NO: 5, SEQ ID NO: 6) was used as an initial sequence for heat resistance. Mutant 5-6 has an amino acid substitution (S22P substitution (mutation on the base sequence: T64C)) and synonymous substitution (mutation on the base sequence: G9A) only in its CBD in the amino acid sequence represented by SEQ ID NO: 4. It is known that these are mutants that have higher protein synthesis than wild-type PcCBH2 in vitro synthesis. In order to evaluate the contribution of the above heat-resistant candidate mutations to heat resistance, mutants 5-6 containing one or two mutation candidates (amino acid substitutions) (hereinafter referred to as heat-resistant candidate mutants) are as follows: As shown in Table 4, a total of 43 pieces were prepared. Plasmid chain is amplified by inverse PCR method using oligomer DNA encoding amino acid sequences corresponding to these mutants and its closest complementary strand oligomer DNA as primers, phosphorylated at 5'-end, and then ligated plasmid Obtained through cyclization and transformation into E. coli. Mutation introduction of each mutant was confirmed by sequencing. In the following Examples, these 43 mutation positions are shown as mutation positions when the first amino acid (S) of the amino acid sequence of the catalytic domain of PcCBH2 (SEQ ID NO: 2) is 1.

(3) Method for in vitro synthesis of cellulase Forty-three variants were synthesized in vitro. As a template for in vitro synthesis, primers (5'- ATCTCGATCCCGCGAAATTAATAC-3 '(SEQ ID NO: 7), 5'-TCCGG ATATA GTTCC TCCTT TCAG-3' (SEQ ID NO: 8)) are used for the DNA obtained in (1). A PCR product amplified by using a PCR purification kit (Qiagen) was used. This PCR product includes a T7 promoter sequence, an initiation codon, a gene sequence, a termination codon, and a terminator sequence.

  The in vitro synthesis of the mutants was performed as a transcription / translation coupling reaction in vitro at 26 ° C. for 3 hours using the reaction solution having the composition shown in Table 5. As a promoter of cell-free protein synthesis reaction, creatine kinase was added as an ATP-generating enzyme (ADP + phosphocreatine → ATP) to compensate for ATP depletion, rifampicin was added as an RNA synthesis initiation inhibitor, and folinic acid was added as an RNA transcription inhibitor . In addition, S30 cell extract (-DTT) extracted from Escherichia coli A19 strain that highly expressed various chaperones was used as a factor to assist protein folding. Furthermore, mold-derived protein disulfide isomerase, which is an SS bond formation promoting factor, was also added.

(1) Method of heat resistance test of mutant The synthesized mutant is diluted 100 times with 50 mM acetate buffer (pH 5.0) and incubated at 49, 50, 51, 52, 53 and 54 ° C. for 2 hours. After the heat treatment, the residual activity was determined by the TZ assay method (Journal of Biochemical and Biophysical Methods, 11 (1985)) after the decomposition of phosphate swelling cellulose (PSC) (reaction conditions: 40 ° C., 16 hours). 109-115). The residual activity was expressed as a ratio with the activity before heat treatment. The heat-resistant temperature of cellulase was defined as the temperature at which the residual activity was 50%.

(2) Heat resistance test of heat-resistant candidate mutants All the 43 mutants prepared were subjected to the above heat resistance evaluation. The results are shown in FIG. As shown in FIG. 2, the heat resistance temperature of the mutant 5-6 of the initial sequence was 50.3 ° C., whereas the heat resistance temperature of the mutant containing the heat resistant mutation candidate was between 48 and 51.5 ° C. It was uneven. Moreover, when the cellobiohydrolase activity before heat processing was evaluated, as shown in FIG. 3, there was no mutant which decreased remarkably compared with the initial mutant 5-6. In other words, it was shown that no effect on cellulase activity was observed even when the amino acid was replaced with a thermostable candidate amino acid.

(3) Selection of advantageous mutation As a result of the above heat resistance evaluation, 13 mutants with improved heat resistance were obtained. The mutation with improved heat resistance was called an advantageous mutation. The advantageous mutations obtained in this experiment are shown in Table 6 and FIG. As shown in FIG. 4, these advantageous mutations all improved the residual activity by 1.3 to 7 times as compared with the ice-cooled holding condition after the incubation at 52 ° C. for 2 hours. .

(4) Selection of first-generation mutants DNA in which advantageous mutations were added to the parent sequence one by one was synthesized, and each mutant was synthesized in vitro in the same manner as in Example 1 using the DNA as a template. When heat resistance evaluation was performed according to the implemented method, it was set as the 1st generation mutant by the advantageous mutation M-18 having the highest heat resistance. In addition, the combination of the mutation in the mutant for every generation is shown below.

(2nd generation selection)
A mutant (W1820) in which the advantageous mutation Q298S / F299L (M1-20) was introduced into the mutant T259H (M1-18) obtained in Example 2 was synthesized in the same manner as in Example 1, and the same as in Example 2. The heat resistance was evaluated. The results are shown in FIG. As shown in FIG. 5, the heat resistance of W1820 accumulating advantageous mutations was improved compared to M1-18 and M1-20. This mutant was selected as the second generation.

(3rd generation selection)
An advantageous mutation (M1-1, -2, -4, -12) was introduced into the mutant W18 + 20 obtained in Example 3, and the mutant was synthesized in the same manner as in Example 1. Similarly, the heat resistance was evaluated. The results are shown in FIG. As shown in FIG. 6, the heat resistance of the mutant (Tri4) introduced with the advantageous mutation T47I / S51Q (M1-4) was most improved. This mutant was selected as the third generation.

(4th generation selection)
Mutants obtained by introducing four advantageous mutations (M1-1, -11, -12, -14, -15) into the mutant Tri4 into which three advantageous mutations obtained in Example 4 were introduced, 1 was synthesized in the same manner as in Example 1, and the heat resistance was evaluated in the same manner as in Example 2. The results are shown in FIG. As shown in FIG. 7, the heat resistance of the mutant (Quad15) introduced with the advantageous mutation M176I (M1-15) was most improved. This mutant was selected as the fourth generation.

(5th generation selection)
Four advantageous mutations (M1-1, -11, -12, -27) were respectively introduced into the mutant Quad15 into which four advantageous mutations obtained in Example 5 were introduced. In the same manner as in Example 2, the heat resistance was evaluated. The results are shown in FIG. As shown in FIG. 8, the heat resistance was evaluated. As a result, the heat resistance of the mutant (Quint12) introduced with the advantageous mutation A158E (M1-12) was most improved. This mutant was selected as the fifth generation.

(6th generation selection)
Advantageous mutation Q224R / A226S (M1-37), which had a high contribution to heat resistance, was added to the mutant Quint12 in which five advantageous mutations obtained in Example 6 were introduced, and three other advantageous mutations (M1-1, M1-1) Mutants into which -21 and -25) were respectively introduced were synthesized in the same manner as in Example 1, and the heat resistance was evaluated in the same manner as in Example 2. The results are shown in FIG. As shown in FIG. 9, the heat resistance of the mutant (Sept25) in which Q224R / A226S and the advantageous mutation S100T (M1-25) were introduced into Quint12 was most improved. This mutant was selected as the sixth generation.

(1) Acquisition of heat-resistant mutants by screening Advantageous mutations (M1-1, -2, -11, -21, -27) that have not been added are introduced into the mutant Sept25 with variation and then the highest by screening. An attempt was made to obtain mutants having heat resistance. Specifically, mutations were introduced using QuickChange Multi Site-Directed Mutagenesis Kit (Stratagene), and 92 mutants thereof were cloned. Mutants synthesized in vitro in the same manner as in Example 1 were subjected to heat treatment at 56 ° C. for 2 hours, and then screened using the remaining activity before heat treatment as an indicator. The results are shown in FIG. As shown in FIG. 10, a mutant was obtained in which the residual activity against heat treatment was improved about 5 times compared to Sept25.

(2) Evaluation of heat resistance of mutants obtained by screening Heat resistance was evaluated in the same manner as in Example 2 for the top three mutants having the highest residual activity in the above screening. The results are shown in FIG. As shown in FIG. 11, all of the three mutants evaluated had an improved heat resistant temperature of 1 ° C. compared to Sept25.

(3) Determination of amino acid sequence of heat-resistant mutant obtained by screening The amino acid sequence of the heat-resistant mutant obtained above was analyzed by base sequence analysis. As a result, it was found that all of the remaining advantageous mutations (M1-1, -2, -11, -21, -27) were included. This obtained clone was designated as the final mutant (referred to as Mall4) in the heat resistance experiment.

(Evaluation of heat resistance of each generation heat-resistant mutant)
A heat resistance test was conducted for each generation of heat mutants obtained so far. The results are shown in FIG. As shown in FIG. 12, as a result, it was confirmed that the heat-resistant temperature was improved as the advantageous mutation was added. The heat resistance temperature of the initial mutant 5-6 is 49.9 ° C., whereas the heat resistant mutant Sept25 is improved by 4.4 ° C. to 54.3 ° C., and the final mutant Mall4 is increased by 5.4 ° C. 54 It was 3 ° C.

(Durability evaluation of synthetic cellulase in vitro)
Durability in a 50 ° C. environment was evaluated using wild-type PcCBH2, mutant 5-6, and heat-resistant mutant Sept25. Specifically, each cellulase was synthesized in vitro, diluted 100-fold with 50 mM acetate buffer pH 5.0, and then incubated at 50 ° C. Sampling was carried out after 0, 3, 6, 9, 24, 32 and 52 hours, and the amount of reducing sugar in the centrifugal supernatant was measured. The results are shown in FIG. As shown in FIG. 13, wild-type PcCBH2 was almost inactivated in 24 hours, whereas Sept25 maintained 90% activity even after 52 hours in a 50 ° C. environment.

(Verification of advantageous mutation effect)
Using the parent sequence of each heat-resistant mutant, the theoretical value and the actual measurement value of the heat-resistant temperature were compared. The theoretical value of the heat resistant temperature is calculated by calculating the degree of contribution of each advantageous mutation to the heat resistance improvement (difference between the heat resistant temperature of the advantageous mutant and the heat resistant temperature of the mutant 5-6). The total contribution of mutation was calculated by adding to the heat resistant temperature of mutant 5-6 (49.9 ° C.). The results are shown in FIG. As shown in FIG. 14, linearity was observed between the theoretical value and the actually measured value of the heat resistant temperature. This result indicates that the addability is almost completely established in the present PcCBH2 heat resistance experiment.

(1) Mutant expression in yeast and purification method thereof Wild-type PcCBH2 and the heat-resistant mutants Sept25 and Mall4 obtained above are introduced into the yeast expression vector pRS436, and cellulase is secreted and expressed in S. cerevisiae BJ5465 strain. It was. For purification, the enzyme was adsorbed on an Avicel column equilibrated with a buffer solution containing ammonium sulfate (1M (NH ₄ ) ₃ SO ₄ , 0.1M Tris pH 7.0), washed with the above buffer solution, and then eluted with MilliQ water. did.

(2) Method for quantifying purified mutants This is an image analysis software for detecting and expressing the color density of a CBB-stained band by SDS-PAGE with respect to yeast expression purified mutants using a fluorescence image analyzer (FLA9000, Fuji Film Co., Ltd.). Quantitative analysis was performed with Multi Gauge (Fuji Film Co., Ltd.).

(3) Specific activity evaluation The specific activity of the yeast expression purified cellulase was evaluated. The amount of each cellulase was adjusted to 10 ng based on the results of quantitative analysis, and reacted at 40 ° C. for 3 hours with 100 μl of 0.5% PSC. The amount of reducing sugar in the centrifugal supernatant was evaluated by TZ assay. The results are shown in FIG. As shown in FIG. 15, the specific activity of the purified cellulase was about 90% for Sept25 and almost the same for Mall4 compared to the wild type.

(1) Evaluation of heat resistance of yeast-expressing mutants The heat resistance of mutants expressed in yeast obtained in Example 13 was evaluated. Each sample was diluted to the same protein concentration (10 ng / 50 μl) with 50 mM acetate buffer pH 5.0, and the heat resistance was evaluated by the method according to Example 2. In order to prevent non-specific adsorption to the tube, a surfactant Triton X-100 was added to the acetate buffer so that the final concentration was 0.01%. At the same time, the heat resistance of WT, Sept25, and Mall4 synthesized in a test tube by the method shown in Example 1 was also evaluated. The heat resistance was evaluated by the residual activity after incubation for 2 hours at 49, 51, 53, 55, 57, and 59 ° C. The results are shown in FIG. As shown in FIG. 16, the heat resistance of yeast-expressing mutants also improved in the order of WT, Sept25, and Mall4, and the more heat resistant beneficial mutations introduced as in the results of in vitro synthesis, the better the heat resistance. It was. In addition, the yeast expression mutants had higher heat resistant temperatures than the mutants synthesized in vitro. That is, the heat resistant temperature of the yeast expression mutant Mall4 was 58.1 ° C., which was 5.7 ° C. higher than that of WT. The difference in heat-resistant temperature between the in vitro synthase and the yeast-expressed enzyme was thought to be due to the effect of improving heat resistance by modifying the sugar chain on the protein due to yeast expression.

(2) Durability Evaluation of Yeast Expression Mutant Durability in a 50 ° C. environment was evaluated using wild type PcCBH2, heat-resistant mutants Sept25 and Mall4. Specifically, each protein was diluted with 50 mM acetate buffer pH 5.0 to the same protein concentration (10 ng / 50 ul), and then kept at 50 ° C. Sampling was performed after 0, 6, 24, 40, 50, and 72 hours, and the amount of reducing sugar in the centrifugally purified supernatant was measured. The results are shown in FIG. As shown in FIG. 17, wild type PcCBH2 was almost inactivated after 72 hours, whereas thermostabilized mutants (Sept25 and Mall4) had 90% or more activity even after 72 hours in a 50 ° C. environment. It was kept.

(3) Evaluation of pH dependence of yeast expression mutants The pH dependence of yeast expression mutants was evaluated. Each protein (wild type PcCBH2, Sept25, Mall4) diluted with 0.5 mM acetate buffer pH 5.0 to the same protein concentration (10 ng / 50 μl) was used. The same amount of each protein was added to 1% PSC adjusted to pH 3 to 9 with 25 mM phosphate citrate buffer, and the mixture was allowed to decompose at 40 ° C. for 16 hours. did. The results are shown in FIG. As shown in FIG. 18, the heat-resistant mutant also showed the same behavior as wild-type PcCBH2, and the relative activity gradually decreased with pH 4 and 5 as peaks.

(4) Evaluation of dependency of yeast expression mutant on ethanol concentration The dependency of yeast expression mutant on ethanol concentration was evaluated. Each protein (wild-type PcCBH2, Sept25, Mall4) was diluted with 50 mM acetate buffer pH 5.0 to a cellulase concentration (10 ng / 50 ul), and then each ethanol concentration was adjusted to 0, 2, 5, 10% 0.8% The same amount was added to PSC, followed by degradation reaction at 40 ° C. for 16 hours, and the amount of reducing sugar in the centrifugal supernatant was evaluated by TZ assay. The results are shown in FIG. As shown in FIG. 19, the thermostabilized mutant also showed the same behavior as wild-type PcCBH2, and the cellulase activity decreased with increasing ethanol concentration.

(5) Temperature dependence evaluation The temperature dependence of the yeast expression mutant was evaluated. Each protein (wild type PcCBH2 and Mall4) was diluted to a cellulase concentration (10 ng / 50 μl) with 50 mM acetate buffer pH 5.0, diluted 100-fold with 50 mM acetate buffer pH 5.0, and then mixed with the same amount of 1% PSC. The reaction was carried out at 25 ° C, 30 ° C, 35 ° C, 40 ° C, 45 ° C, 50 ° C, 55 ° C, 60 ° C, 65 ° C and 70 ° C for 0, 1, 2, 3 and 5 hours. The degradation activity was evaluated based on the amount of reducing sugar in each centrifugal supernatant. The evaluation of the optimum temperature used data after 2 hours in which the slope of the change with time was kept linear. The results are shown in FIG. As shown in FIG. 20, on the high temperature side (55 to 70 ° C.), the heat-resistant mutant Mall4 had a higher relative activity than the wild type PcCBH2. On the other hand, at low temperature (25-50 ° C.), the relative activity of Mall4 was almost the same as that of wild-type PcCBH2.

(Synergistic effect with commercial enzyme cell crust)
It is known that wild-type PcCBH2 increases the effect more than the decomposition activity of a single substance, that is, exhibits a synergistic effect when added to a commercially available enzyme cell crust. Therefore, the effect of addition to cell crust was also examined in the thermostable PcCBH2 mutant Mall4. Wild-type PcCBH2 and Mall4 purified by yeast expression were mixed alone and in various ratios, and subjected to a degradation reaction at 40 ° C for 16 hours using Avicel as a substrate (final concentration 0.25%). Evaluated by quantity. The results are shown in FIG. The upper part of FIG. 21 shows the evaluation result of wild-type PcCBH2, and the lower part of FIG. 21 shows the evaluation result of Mall4 mutant. The upper side of each graph shows the added amount of PcCBH2, and the lower side shows the added amount of cell crust. Cell crust and PcCBH2 single activities are represented by diamonds and squares, additive predictions are represented by x, and the measured synergistic effects are represented by triangles.

  As shown in FIG. 21, both wild-type PcCBH2 and Mall4 showed the same behavior with respect to the addition of cell crust, and the amounts of reducing sugars during mixing both exceeded the predicted addition value. From the above, it was shown that the heat-resistant mutant Mall4 has a synergistic effect with the cell crust, like the wild-type PcCBH2.

(Evaluation of heat resistance of Cc-deficient PcCBH2 mutants)
A mutant was prepared by deleting the CBD site of the thermostable mutant Mall4. The mutant is composed of two types of oligomer sequences (5′-GGATCTGCGGTCACGACCACCTCCGTT -3 ′ (SEQ ID NO: 9), 5′-CATATGTATATCTCCTTCTTAAAGT-) using a plasmid in which DNA encoding the mutant is inserted into NdeI / HindIII of pET23b as a template. Inverse PCR was performed using 3 ′ (SEQ ID NO: 10) as a primer, and the obtained PCR product was extracted by agarose gel electrophoresis and gel staining, and the DNA in the gel was removed from the kit (Wizard® SV Gel and Extracted using PCR Clean-up System (Promega) After phosphorylating both 5'-ends with polynucleotide kinase (New England BioLabs), the extracted DNA fragment was used with ligation kit (DNA Ligation kit, Takara). The ligation product was introduced into E. coli DH5α strain, the transformant was cultured, and then a plasmid extraction purification kit (QIAprep Spin Miniprep K The plasmid containing the target DNA fragment was taken out by it, Qiagen), and deletion of the CBD site was confirmed by sequencing.
Subsequently, the mutant protein was obtained by a cell-free synthesis method. That is, as a template for in vitro synthesis, two primers (5′-ATCTC GATCC CGCGA AATTA ATAC-3 ′ (SEQ ID NO: 7), 5′-TCCGGATATAGTTCCTCCTTTCAG-3 ′ (SEQ ID NO: 8) were used for the prepared plasmid. A PCR product purified by amplification and PCR purification kit (Qiagen) was used, which contains a T7 promoter sequence, start codon, gene sequence, stop codon, and terminator sequence.

  In vitro synthesis was performed by a reaction solution having the composition shown in Table 7 and in vitro transcription / translation coupling reaction at 26 ° C. for 3 hours. As a promoter of cell-free protein synthesis reaction, creatine kinase was added as an ATP-generating enzyme (ADP + phosphocreatine → ATP) to compensate for ATP depletion, rifampicin was added as an RNA synthesis initiation inhibitor, and folinic acid was added as an RNA transcription inhibitor . In addition, S30 cell extract (-DTT) extracted from Escherichia coli A19 strain that highly expressed various chaperones was used as a factor to assist protein folding. Furthermore, mold-derived protein disulfide isomerase, which is an SS bond formation promoting factor, was also added. In order to evaluate the amount of cellulase synthesized, a synthetic reaction was performed by mixing lysine (FluoroTect GreenLys in vitro Translation Labeling System: Promega) labeled with fluorescence. In addition, mutants 5-6 and Mall4 were also synthesized in vitro.

(Preparation of DNA fragment for in-situ synthesis of cellobiohydrolase II from Phanerochaete chrysosporium lacking CBD)
Two types of oligomer sequences (5'-GGATCTGCGGTCACGACCACCTCCGTT-3 '(SEQ ID NO: 9), 5'- CATATGTATATCTCCTTCTTAAAGT, using the plasmid pET23b_PcCBH2wt into which the cellobiohydrase gene (SEQ ID NO: 3) was inserted into NdeI / HindIII of pET23b Inverse PCR was performed using -3 ′ (SEQ ID NO: 10) as a primer. For the obtained PCR product, the target band was taken out by agarose gel electrophoresis and gel staining, and the DNA in the gel was extracted using a kit (Wizard® SV Gel and PCR Clean-up System, Promega). The extracted DNA fragment was phosphorylated at both 5′-ends with a polynucleotide kinase (New England BioLabs), and then ligated using a ligation kit (DNA Ligation kit, Takara). The ligation product was introduced into E. coli DH5α strain, the transformant was cultured, and a plasmid containing the target DNA fragment was taken out using a plasmid extraction purification kit (QIAprep Spin Miniprep Kit, Qiagen). The deletion of the CBD site was confirmed by sequencing.

  The heat resistance of each cellulase obtained was evaluated. The result is shown in FIG. As shown in FIG. 22, the heat-resistant mutant Mall4 and the heat-resistant mutant Mall4 from which CBD has been deleted are all better than the initial sequence compared to the mutant 5-6 (having CBD). It was found to have heat resistance. From this result, it was found that the mutant disclosed in the present specification can exhibit heat resistance based on the mutation of the catalytic domain regardless of the possession state of CBD.

(Evaluation of heat resistance of mutants substituted with CBD from different organisms)
A mutant was prepared by exchanging the CBD site of wild type and heat-resistant mutant Mall4 with CBD of endoglucanase (EGII) derived from Trichoderma harsianum. These two types of mutants are designated as ThCBD1-PcCD (W) and ThCBD1-Mall4 (W), respectively.

  Among these mutants, ThCBD1-PcCD (W) is a CBD1 region derived from CBD1 of T. harzianum endoglucanase II (including a linker, hereinafter referred to as ThCBD1 + linker portion; SEQ ID NO: 11, 12) and P. chrysosporium. It is a variant in which the cell region of cellobiohydrolase II (hereinafter referred to as full-length PcCBH2 (SEQ ID NOs: 3 and 4)) is fused with the CD region (PcCD, including linker, SEQ ID NOs: 13 and 14). An expression vector for secreting and expressing this mutant in Saccharomyces cerevisiae was prepared as follows.

  The total synthesis was commissioned to Operon Biotechnology Co., Ltd., with the ThCBD1 + linker moiety and PcCBH2 full length, which are the basis of the mutant, optimized for yeast codons. Based on the total synthesized DNA fragment, a gene fragment (ThCBD1-PcCD (W)) in which a ThCBD1 + linker moiety was fused to PcCD was produced by using overlapping primers and the following primers.

  For secretion expression in S. cerevisiae, pAUR112-GAPSSRG in which a TDH3 promoter-Rhizopus orizae glucoamylase-derived signal sequence (MQLFNLPLKVSFFLVLSYFSLLVSAA) -CYC terminator was inserted into the SmaI site of pAUR112 (Takara Bio) was used. Subcloning pAUR112-GAPSSRG with restriction enzymes treated with SphI and ClaI and using the In-Fusion Advantage PCR Cloning Kit (Takara Bio) so that the four genes produced are downstream of the signal sequence derived from glucoamylase of Rhizopus orizae Then, a secretory expression vector was constructed. The constructed vector was transformed into BJ5465 strain using Frozen-EZ Yeast Transformation II Kit (Zymo Research), and each transformant was selected with a selection marker prepared in the plasmid.

  In addition, ThCBD1-Mall4 (W) uses Mall4 whose catalytic domain sequence is optimized for yeast codons and uses the same primers as those used for obtaining ThCBD1-PcCD (W). Mall4 (W) gene fragment (ThCBD1 + linker part fused to Mall4 CD (including linker part)) gene fragment was prepared. Thereafter, this mutant was obtained from a transformant prepared in the same manner as described above. Evaluation of heat resistance was carried out using the culture supernatant of yeast in which each of these mutants was secreted and expressed. The results are shown in FIG.

  As shown in FIG. 23, it is shown that ThCBD1-Mall4 (W) having the catalytic domain of thermostable mutant Mall4 has improved heat resistance compared to wild-type PcCBH2 and ThCBS1-PcCD (W). It was done. That is, the heat resistance of cellulase having the Mall4 catalytic domain was improved even when CBD was exchanged with one derived from a different organism. From the above results, it is meant that it contributes to the improvement of the heat resistance of cellulase regardless of the origin of the catalytic domain CBD having a heat resistant mutation.

  According to the results of Examples 16 and 17, it was found that a thermostable cellulase can be provided by using a catalytic domain having a thermostable mutation regardless of the presence or type of CBD.

SEQ ID NOs: 5 and 6: mutants, SEQ ID NOs: 7 to 10, 15 to 18: primers

Claims (18)

A protein having cellobiohydrolase activity,
A protein comprising an amino acid sequence having an amino acid substitution corresponding to one or more amino acid substitutions selected from the amino acid substitution table shown below in the amino acid sequence represented by SEQ ID NO: 2.
The protein according to claim 1, wherein the amino acid sequence is selected from amino acid sequences having a combination of amino acid substitutions corresponding to the amino acid substitutions shown in each column of the following table in the amino acid sequence represented by SEQ ID NO: 2.
  3. The protein of claim 1 or 2 produced by a transformed eukaryotic cell that has been genetically modified to express the protein of claim 1 or 2.   DNA encoding the protein according to any one of claims 1 to 3.   An expression DNA construct comprising the DNA of claim 4.   A cell transformed with the DNA construct according to claim 5.   The cell according to claim 6, wherein the protein according to claim 1 or 2 is surface-presented or extracellularly secreted.   The cell according to claim 6 or 7, which is a eukaryotic microorganism.   The cell according to claim 8, wherein the eukaryotic microorganism is a non-cellulase-producing microorganism.   The cell according to claim 8 or 9, which is a yeast.   The cell according to claim 8 or 9, which is a koji mold.   The cell according to claim 8, wherein the eukaryotic microorganism is a cellulase-producing microorganism.   The cell according to claim 12, wherein the cellulase-producing microorganism is Trichoderma reesei.   A cellulase composition comprising the protein according to claim 1. A method for producing a degradation product of cellulose,
A production method comprising a step of bringing a material containing cellulose into contact with one or more cellulases containing the protein. A method for producing useful substances,
A method for producing a useful substance, comprising a step of culturing a microorganism using a carbon source containing cellulose in the presence of two or more cellulases containing the protein.   The production method according to claim 1, wherein the microorganism secretes the protein according to any one of claims 1 to 3 outside the cell or presents the protein on a cell surface.   A protein complex comprising the protein according to claim 1.