JP2011244690A - Vegf-binding protein element - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a vascular endothelial cell growth factor (VEGF)-binding protein useful for detecting the VEGF.SOLUTION: The protein is obtained by fusing a VEGF receptor 1's immunoglobulin domain 2 and a transmembrane domain.

Description

  The present invention relates to a VEGF-binding protein that can be used, for example, for detection of vascular endothelial growth factor (hereinafter referred to as “VEGF”).

  VEGF is a dimer-forming glycoprotein that binds to vascular endothelial growth factor receptor (hereinafter referred to as “VEGFR”) 1 and VEGFR2 and stimulates the proliferation of vascular endothelial cells, thereby Start is induced (Non-Patent Document 1).

  In addition, VEGF has been found to play an important role in angiogenesis caused by diseases such as diabetic retinopathy, rheumatoid arthritis, and tumors (Non-Patent Document 2). It is very important for early detection of these diseases. In particular, tumors are tumor markers because of increased blood concentrations of VEGF, and are mainly detected by antibodies.

  On the other hand, VEGFR1 and VEGFR2 are known to bind to VEGF, with the second and third immunoglobulin 2 and immunoglobulin 3 from the N-terminal among the seven immunoglobulin-like domains in the extracellular region. Yes. The affinity of VEGFR1 for VEGF is about 50 times higher than that of VEGFR2 (Non-patent Document 3).

  Patent Document 1 discloses that a polypeptide containing the first immunoglobulin-like domain and the second immunoglobulin-like domain in the extracellular region of FLT-1, which is VEGFR1, binds to VEGF with specific and high affinity, and has VEGF activity. That it can be inhibited.

  By the way, conventionally, a device having high functionality of a biomolecule has been produced by fusing the biomolecule and the device. In particular, research has been progressing in which a membrane protein or the like is incorporated into a liposome to produce a proteoliposome having a membrane protein function and incorporated into a device or the like having a lipid membrane (Non-patent Document 4).

JP 2006-094861 A

Carmeliet, P. et al., “Nature”, 1996, 380, 435-439 Aiello, L. P. et al., "N. Engl. J. Med.", 1994, 331, pp. 1480-1487 Waltenberger, J. et al., "J. Biol. Chem", 1994, 269, pp. 26988-26995 Zagnoni, M. et al., "Lab Chip", 2007, Vol. 7, pp. 1176-1183

  In general, membrane proteins such as VEGFR have high functionality, and if these membrane proteins can be used freely, the application range such as biosensing and drug screening is wide. However, since VEGFR1 is a membrane protein having a large molecular weight, it is difficult to use a protein including all regions as a protein element for VEGF detection.

  Therefore, in view of the above-described circumstances, an object of the present invention is to provide a VEGF binding protein useful for VEGF detection.

  As a result of diligent research to solve the above problems, immunoglobulin domain 2 (amino acid positions 129-229 in the full-length protein) and transmembrane region (amino acid positions in the full-length protein) of human VEGFR1 (hereinafter simply referred to as “VEGFR1”) 758-780) was produced, and it was found that the fusion protein bound well to VEGF and could be used for detection of VEGF, and the present invention was completed.

The present invention includes the following.
(1) Any one of the following (a) to (c) VEGF binding protein.
(a) a protein comprising the amino acid sequence shown in SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 and exhibiting VEGF binding activity
(c) A fusion protein in which a foreign protein or peptide and the protein described in (a) or (b) above are linked. (2) A gene encoding the VEGF binding protein described in (1).
(3) A recombinant vector comprising the gene according to (2).
(4) A transformant having the recombinant vector according to (3).
(5) A proteoliposome comprising the VEGF-binding protein according to (1) and a liposome.
(6) A VEGF detection kit comprising the VEGF-binding protein according to (1) or the proteoliposome according to (5).
(7) A method for detecting VEGF, comprising a step of contacting the VEGF-binding protein according to (1) or the proteoliposome according to (5) with VEGF in a biological sample.
(8) A method for examining a VEGF-related disease, comprising a step of contacting the VEGF-binding protein according to (1) or the proteoliposome according to (5) with VEGF in a patient-derived biological sample.
(9) The method according to (8), wherein the VEGF-related disease is a disease selected from the group consisting of retinopathy, rheumatoid arthritis and tumor.

  According to the present invention, VEGF can be detected well. In addition, according to the present invention, VEGF-related diseases can be examined by detecting VEGF in a biological sample derived from a patient.

It is a photograph which shows the result of having used the VEGF binding protein containing elution fraction in an Example for SDS-polyacrylamide gel electrophoresis. It is a sensorgram which shows the binding activity of the VEGF binding protein containing proteoliposome to the anti-MBP antibody in an Example. It is a sensorgram which shows the binding activity of the VEGF binding protein containing proteoliposome to VEGF in an Example.

Hereinafter, the present invention will be described in detail.
The VEGF binding protein according to the present invention is any one of the following proteins (a) to (c):
(a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2;
(b) a protein consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 and exhibiting VEGF binding activity;
(c) A fusion protein in which a foreign protein or peptide and the protein described in (a) or (b) above are linked.

  The protein described in (a) above is a protein in which immunoglobulin domain 2 of VEGFR1 (amino acid positions 129 to 229 in the full length VEGFR1 protein) and a transmembrane region (amino acid positions 758 to 780 in the full length VEGFR1 protein) are fused. Specifically, in the amino acid sequence shown in SEQ ID NO: 2, the amino acid sequence at amino acid positions 1-101 corresponds to immunoglobulin domain 2 of VEGFR1, and the amino acid sequence at amino acid positions 102-124 is in the transmembrane region of VEGFR1. Equivalent to. Conventionally, VEGFR1 is a membrane protein having a large molecular weight, and it has been very difficult to express a protein having VEGF binding activity and including all regions in a host such as Escherichia coli. However, according to the protein described in (a) above, the encoded gene can be easily expressed in a host such as Escherichia coli, and the expressed protein can have VEGF binding activity.

  In the protein described in (b) above, one or several (for example, 1 to 10, preferably 1 to 5, particularly preferably 1 to 3) amino acids are deleted from the amino acid sequence shown in SEQ ID NO: 2. , A protein consisting of a substituted or added amino acid sequence and exhibiting VEGF binding activity. Examples of the position of the deletion, substitution or addition include the transmembrane region of VEGFR1 (that is, amino acid positions 102 to 124 in SEQ ID NO: 2).

  The protein described in (c) above is a fusion protein in which a foreign protein or peptide and the protein described in (a) or (b) above are linked. Here, “foreign protein or peptide” means a protein or peptide exogenous to VEGFR1. Examples of the foreign protein or peptide include a protein or peptide (glutathione S-transferase, maltose binding protein (MBP), thioredoxin, cellulose binding domain, streptavidin binding peptide, histidine tag, etc.) used for protein purification. The position where the foreign protein or peptide is linked can be appropriately selected so that the protein described in (a) or (b) above and the foreign protein or peptide have their respective functions or activities. For example, the foreign protein or peptide can be linked to the N-terminal side or C-terminal side of the protein described in (a) or (b) above.

  A protein comprising an amino acid sequence having an amino acid identity of 80% or more, preferably 90% or more, particularly preferably 95% or more with respect to the amino acid sequence shown in SEQ ID NO: 2, and exhibiting VEGF binding activity is also present. Included in the VEGF binding protein according to the invention.

  The VEGF binding protein according to the present invention is, for example, a case where the VEGF binding protein according to the present invention is contacted with the VEGF protein, the complex of the VEGF binding protein and the VEGF protein is measured, and the complex is significantly detected. In addition, it can be determined that it has VEGF binding activity. The VEGF to which the VEGF-binding protein according to the present invention binds may be any member of the VEGF family that binds to VEGFR1, and examples thereof include VEGF-A splicing variants VEGF121, VEGF165, VEGF189, and VEGF206. .

The gene according to the present invention is a gene encoding the VEGF binding protein according to the present invention. By introducing the gene into a host, the VEGF binding protein according to the present invention can be expressed. Examples of the gene according to the present invention include a gene consisting of the base (nucleotide) sequence shown in SEQ ID NO: 1 encoding the protein described in (a) above;
In the base sequence shown in SEQ ID NO: 1, from the base sequence in which one or several (for example, 1 to 10, preferably 1 to 5, particularly preferably 1 to 3) bases have been deleted, substituted or added A gene encoding a protein comprising and exhibiting VEGF binding activity;
A gene encoding a protein comprising a nucleotide sequence having a nucleotide identity of 80% or more, preferably 90% or more, particularly preferably 95% or more with respect to the nucleotide sequence shown in SEQ ID NO: 1 and exhibiting VEGF binding activity ;
A gene that hybridizes under stringent conditions with a DNA consisting of a base sequence complementary to the base sequence shown in SEQ ID NO: 1 and encodes a protein exhibiting VEGF binding activity;
Is mentioned. Here, “stringent conditions” refers to, for example, conditions in which the sodium concentration is 25 to 500 mM, preferably 25 to 300 mM, and the temperature is 42 to 68 ° C., preferably 42 to 65 ° C. More specifically, 5 × SSC (83 mM NaCl, 83 mM sodium citrate), temperature 42 ° C. These genes can appropriately include, for example, a start codon, a stop codon, a promoter, and the like.

  Furthermore, a DNA in which a gene encoding a foreign protein or peptide is operably linked to these genes is a gene encoding the protein described in (c) above, and is included in the gene according to the present invention.

  For example, the VEGF binding protein according to the present invention can be expressed by transforming the gene according to the present invention into a host. The host is not particularly limited, but Saccharomyces cerevisiae, Shizosaccharomyces pombe, Pichia pastoris, Candida albicans, Morsenurum Yeast such as (Hansenula polymorpha); Escherichia such as Escherichia coli, Bacillus such as Bacillus subtilis or bacteria belonging to the genus Pseudomonas such as Pseudomonas putida; Animal cells; insect cells such as Sf9; plants belonging to the Brassicaceae family.

  First, the gene according to the present invention is prepared. The gene according to the present invention can be easily obtained by PCR using, for example, a genomic DNA such as human from which VEGFR1 is derived as a template.

  Once the base sequence is determined, the gene according to the present invention is then synthesized by chemical synthesis, by PCR using the cloned probe as a template, or by hybridizing a DNA fragment having the base sequence as a probe. Can be obtained. Furthermore, a mutant of the gene according to the present invention having a function equivalent to that before mutation can be synthesized by site-directed mutagenesis. In order to introduce a mutation into the gene according to the present invention, a known method such as the Kunkel method, the Gapped duplex method, the megaprimer PCR method, or a similar method can be employed.

  When preparing a gene encoding a fusion protein containing a foreign protein or peptide as the gene according to the present invention, the gene encoding the foreign protein or peptide to the gene encoding the protein described in (a) or (b) above Prepare DNA linked to. Such DNA may be linked DNA itself or a vector containing the DNA. A method for linking a gene encoding a foreign protein or peptide to a gene encoding the protein described in (a) or (b) above is a purified gene encoding the protein described in (a) or (b) above, and A method in which a gene encoding a foreign protein or peptide is cleaved with an appropriate restriction enzyme and ligated is employed. In addition, an in vitro method using PCR, etc., or yeast by allowing a region homologous to each of the gene encoding the protein described in (a) or (b) and a gene encoding a foreign protein or peptide. A method of linking the two by an in vivo method using a method such as the above may be used.

  A recombinant vector containing the gene according to the present invention can be obtained by inserting the gene according to the present invention into an appropriate vector. The vector to be used is not particularly limited as long as it can replicate in the host, and examples thereof include plasmids, shuttle vectors, helper plasmids and the like. Further, when the vector itself does not have replication ability, it may be a DNA fragment that can be replicated by insertion into a host chromosome.

  As plasmid DNA, plasmids derived from E. coli (eg, pET16b, pBR322, pBR325, pUC118, pUC119, pUC18, pUC19, pBluescript, pMAL-c5x, etc.), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, etc.), yeast-derived Examples include plasmids (for example, YEp systems such as YEp13, YCp systems such as YCp50, etc.), and examples of phage DNA include λ phage. Furthermore, animal viruses such as retrovirus or vaccinia virus and insect virus vectors such as baculovirus can also be used.

  As described above, the method of inserting the gene according to the present invention into a vector is performed according to the method of linking a gene encoding a foreign protein or peptide to the gene encoding the protein described in (a) or (b) above. be able to.

  Furthermore, a transformant is prepared by introducing a recombinant vector containing the gene according to the present invention (hereinafter referred to as “recombinant vector according to the present invention”) into a host.

  The method for introducing the recombinant vector according to the present invention into yeast is not particularly limited as long as it is a method for introducing DNA into yeast. For example, electroporation (electroporation method), spheroplast method, lithium acetate method, etc. Is mentioned. Alternatively, it may be a YIp-type vector or a method of transforming yeast into a chromosome by substitution / insertion into a chromosome using a DNA sequence homologous to an arbitrary region in the chromosome.

  The method for introducing the recombinant vector according to the present invention into bacteria is not particularly limited as long as it is a method for introducing DNA into bacteria. Examples thereof include a method using calcium ions and an electroporation method.

  When animal cells are used as hosts, monkey cells COS-7, Vero, Chinese hamster ovary cells (CHO cells), mouse L cells and the like are used. Examples of the method for introducing the recombinant vector according to the present invention into animal cells include the electroporation method, the calcium phosphate method, and the lipofection method.

  When insect cells are used as hosts, Sf9 cells and the like are used. Examples of the method for introducing the recombinant vector according to the present invention into insect cells include calcium phosphate method, lipofection method, electroporation method and the like.

  When using a plant as a host, the whole plant body, plant organs (e.g. leaves, petals, stems, roots, seeds, etc.), plant tissues (e.g. epidermis, phloem, soft tissue, xylem, vascular bundles, etc.), plant culture Cells or the like are used. Examples of the method for introducing the recombinant vector according to the present invention into a plant include an electroporation method, an Agrobacterium method, a particle gun method, and a PEG method.

Whether or not the recombinant vector according to the present invention has been incorporated into the host can be confirmed by PCR, Southern hybridization, Northern hybridization, or the like. For example, DNA is prepared from the transformant, and PCR is performed by designing a primer specific for the gene according to the present invention. Thereafter, the amplified product is transformed by performing agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc., staining with ethidium bromide, SYBR Green solution, etc., and detecting the amplified product as a band. Make sure. Moreover, PCR can be performed using a primer previously labeled with a fluorescent dye or the like to detect an amplification product. Furthermore, a method of binding the amplification product to a solid phase such as a microplate and confirming the amplification product by fluorescence, enzyme reaction, or the like may be employed.
As described above, the VEGF binding protein according to the present invention can be obtained from the above-described transformant.

  On the other hand, since the VEGF-binding protein according to the present invention has a transmembrane region of VEGFR1, it can be made into a proteoliposome by embedding it in the lipid membrane of the liposome (hereinafter referred to as “proteoliposome according to the present invention”). . For example, liposomes are made using E. coli polar extract (Avanti polar lipid). Specifically, liposomes are prepared by dissolving lipid in OG (octylglycoside), dialyzing, and freeze-thawing using liquid nitrogen. Next, the prepared liposome, the VEGF binding protein according to the present invention, and OG are mixed, left at room temperature for a predetermined time, and subjected to dialysis. After dialysis, the solution can be collected and subjected to centrifugation to remove the precipitate, and the resulting supernatant can be obtained as proteoliposomes.

  Moreover, VEGF in a biological sample can be detected using the VEGF-binding protein or proteoliposome according to the present invention (hereinafter referred to as “the VEGF detection method according to the present invention”). Examples of the biological sample include cells derived from a subject, tissues and organs, body fluids such as blood (serum and plasma) and saliva, and discharged products.

  In the VEGF detection method according to the present invention, first, the VEGF binding protein or proteoliposome according to the present invention and VEGF in a biological sample are brought into contact with each other and bound. Since the proteoliposome according to the present invention carries the VEGF-binding protein according to the present invention on a lipid membrane, it will bind to VEGF by the contact.

  Subsequently, after the binding reaction, the obtained VEGF-binding protein or proteoliposome according to the present invention and the complex of VEGF are detected, for example, the amount of VEGF in a biological sample is measured, or the presence of the VEGF Can be detected. Examples of the measurement or detection method include a surface plasmon resonance (SPR) method, a detection method using a fluorescent dye, a Western blot method using an antibody, an ELISA, and the like.

  When using the surface plasmon resonance (SPR) method, for example, a biological sample is flowed to a support (for example, a chip) on which a VEGF binding protein or proteoliposome according to the present invention is immobilized, and surface plasmon resonance is performed. Measurement is performed using a measuring apparatus, and the binding between the VEGF-binding protein or proteoliposome according to the present invention and VEGF in a biological sample can be detected by a sensorgram.

  In the detection method using a fluorescent dye, for example, the VEGF binding protein or proteoliposome according to the present invention to which a fluorescent dye is added is brought into contact with a biological sample and eluted, and the fluorescence intensity derived from the fluorescent dye is used as an indicator. A complex of a VEGF binding protein or proteoliposome according to the invention and VEGF in a biological sample can be detected.

  In Western blotting, the VEGF binding protein or proteoliposome according to the present invention and a biological sample are brought into contact with each other to perform a binding reaction. Next, after separating the reaction solution by SDS-polyacrylamide electrophoresis, it is transferred to a nitrocellulose membrane or the like, and an antibody specific for VEGF (or an antibody specific for immunoglobulin domain 2 of VEGFR1) is used. A complex of VEGF binding protein or proteoliposome according to the present invention and VEGF in a biological sample can be detected.

  In the ELISA method, for example, the VEGF binding protein or proteoliposome according to the present invention is immobilized on a multiwell plate, and then a biological sample is reacted. Thereafter, a complex of the VEGF binding protein or proteoliposome according to the present invention and VEGF in a biological sample can be detected using an antibody specific for VEGF. The antibody can also be secondarily detected using alkaline phosphatase, peroxidase-conjugated anti-IgG antibody or the like.

  Further, in accordance with the VEGF detection method according to the present invention, the VEGF-binding protein or proteoliposome according to the present invention can be used as a VEGF detection kit. In addition to the VEGF-binding protein or proteoliposome according to the present invention, the kit can contain reagents, instruction manuals, and the like.

  On the other hand, according to the VEGF detection method according to the present invention, the VEGF-related disease in a patient is examined by detecting VEGF in a patient-derived biological sample using the VEGF-binding protein or proteoliposome according to the present invention. (Or evaluation or diagnosis). Here, `` VEGF-related disease '' means a disease associated with abnormal expression of VEGF, such as retinopathy (diabetic retinopathy, proliferative retinopathy, etc.), rheumatoid arthritis, tumor (cancer) (gastric cancer, colon Rectal cancer, etc.). Regarding diabetic retinopathy, it is known that VEGF concentration is significantly higher in diabetic retinopathy patients than in non-diabetic retinopathy patients in body fluid samples derived from the eyes (Non-patent Document 2). For proliferative retinopathy, it is known that plasma samples have significantly higher VEGF levels in proliferative retinopathy patients compared to healthy subjects (Lip PL et al., “Invest. Ophthalmol. Vis. Sci.”, 2000, 41, pp. 2115-2119). Regarding rheumatoid arthritis, it is known that serum samples have significantly higher VEGF levels in patients with rheumatoid arthritis compared to healthy subjects (Ballara S et al., `` Arthritis Rheum. '', 2001, 44, pp. 2055-2064). Regarding gastric cancer and colorectal cancer, it is known that VEGF concentration is significantly higher in gastric cancer patients and colorectal cancer patients than in healthy individuals in plasma samples (Hyodo I et al., “Eur J Cancer.”, 1998 Year 34, pp. 2041-2045). In addition, the concentration of VEGF in the plasma of general healthy subjects is 26 ± 8.2 pg / ml ((Hyodo I et al., “Eur J Cancer”, 1998, Vol. 34, pp. 2041-2045) or 38.3 pg / ml. (Mitsubishi Chemical Medience Corporation website: http://data.medience.co.jp/compendium/main.asp?field=15&m_class=03&s_class=0001)

  Therefore, according to the VEGF detection method of the present invention, the VEGF concentration in a patient-derived biological sample is measured using the VEGF-binding protein or proteoliposome of the present invention, and the biology derived from a healthy subject or the like The patient from whom the biological sample is derived has or is at risk of suffering from a VEGF-related disease if significantly higher than the VEGF concentration in the experimental sample (negative control sample) be able to.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to these Examples.

Evaluation of binding activity of VEGF-binding protein-containing proteoliposomes to VEGF
1. Preparation of VEGF binding protein
Using human placenta cDNA (Clontech) as a template, subcloning of the immunoglobulin domain of human VEGFR1 that binds to VEGF was performed. For DNA encoding human VEGFR1 immunoglobulin domain 2 (amino acid positions 129-229 in the full-length protein: hereinafter referred to as “VEGFR1 (129-229)”), Human placenta cDNA (Clontech) was used as a template and the following primers:
forward: GCGAATTCCATATGAGTGATACAGGTAGACCTTTCGTAG (SEQ ID NO: 3); and
reverse: GCTGGATCCTCAGATTGTATTGGTTTGTCGATGTGTGAG (SEQ ID NO: 4)
PCR was performed using. PCR cycle conditions are: initial denaturation: 94 ° C. 2 min, denaturation 94 ° C. 15 sec: annealing 56 ° C. to 50.5 ° C. (56 ° C., 55 ° C., 52.5 ° C., 50.5 ° C.) 30 sec: extension reaction 68 ° C. 35 sec (cycle number: annealing temperature) 56 ° C., 55 ° C., 52.5 ° C. three times, and 50.5 ° C. 17 times).

  Subsequently, the PCR product was purified, treated with restriction enzymes using NdeI and BamHI, and then purified. Thereafter, the obtained DNA fragment was inserted into a pET16b vector similarly treated with NdeI and BamHI.

Further, for the DNA sequence encoding VEGFR1 (129-229) in the pET16b vector, the following primers:
forward: GCGAATTCCATATGAGTGATACAGGTAGACCTTTCGTAG (SEQ ID NO: 3);
reverse1: CGTAAGTAGTGACACTTTGTACTCGACTAGTGAGATTGTACGTG (SEQ ID NO: 5);
reverse2: GACTAGTGAGATTGTACGTGGACACACCGACGCTGAGAGAAGACC (SEQ ID NO: 6);
reverse3: GACGCTGAGAGAAGACCGAGGATAATTGGGAGAAATAGACTCCTAGGAGG (SEQ ID NO: 7)
The DNA sequence encoding the human VEGFR1 transmembrane region (amino acid positions 758-780 in the full-length protein: hereinafter referred to as “VEGFR1 transmembrane region (758-780)”) was converted into VEGFR1 (129-229). DNA fragment (SEQ ID NO: 2) encoding a protein (SEQ ID NO: 2), which is elongated to the 3 ′ end of the DNA sequence encoding) and fused with VEGFR1 (129-229) and VEGFR1 transmembrane region (758-780) 1) was amplified. PCR cycle conditions were initial denaturation: 94 ° C. 2 min, denaturation 98 ° C. 15 sec: annealing 47 ° C. to 56 ° C. (47 ° C., 49 ° C., 56 ° C., 55 ° C., 54 ° C.) 30 sec: extension reaction 68 ° C. 45 sec (number of cycles) : Annealing temperature 47 ° C., 49 ° C. 4 times, 56 ° C., 55 ° C. 3 times, 54 ° C. 17 times).

  Subsequently, the PCR product was purified, treated with restriction enzymes using NdeI and BamHI, and then purified. Thereafter, the obtained DNA fragment was inserted into a pET16b vector similarly treated with NdeI and BamHI.

  Furthermore, the pET16b vector inserted with a DNA fragment encoding a protein fused with VEGFR1 (129-229) and VEGFR1 transmembrane region (758-780) was subjected to restriction enzyme treatment with NcoI and BamHI, and the DNA Fragments were collected.

  As a result, the sequence of the recovered DNA fragment was the amino acid sequence MGHHHHHHHHHHSSGHIEGRHM derived from the pET16b vector at the 5 ′ end of the DNA fragment encoding the protein fused with VEGFR1 (129-229) and VEGFR1 transmembrane region (758-780). This is a sequence provided with a DNA sequence (SEQ ID NO: 8) encoding (SEQ ID NO: 9) (hereinafter referred to as “pET16b-derived peptide”). Thereafter, the DNA fragment was inserted into a pMAL-c5x vector that had been subjected to restriction enzyme treatment using NcoI and BamHI. The pMAL-c5x vector contains DNA encoding maltose binding protein (MBP). Therefore, by this insertion, the pMAL-c5x vector is a fusion protein consisting of MBP, pET16b-derived peptide, VEGFR1 (129-229) and VEGFR1 transmembrane region (758-780) from the N-terminus (hereinafter referred to as `` MBP-VEGFR1 (129 -229) -TM (Transmembrane) ”).

Using the obtained vector, E. coli Rosetta-gami B (DE3) strain was transformed. The obtained transformant was cultured in LB medium, IPTG was added so that the final concentration was 0.2 mM when OD ₆₀₀ = 0.5, and the culture was performed at 20 ° C. overnight.

  The cells were collected after overnight culture. A disruption buffer (50 mM Tris-HCl, 150 mM NaCl, pH 7.5) was added to the collected cells, and ultrasonic disruption (Power H, 30 sec on 30 sec off, 15 min) was performed with a Bioraptor (Cosmo Bio).

  After ultrasonic disruption, the obtained cell lysate is subjected to centrifugation (14000 rpm, 4 ° C, 10 min), and the resulting supernatant is further subjected to ultracentrifugation (100000 g, 4 ° C, 1 h), The precipitated fraction was collected as a membrane fraction.

  The resulting precipitate fraction was solubilized with a solubilization buffer (50 mM Tris HCl, 150 mM NaCl, 1% DM (decyl maltoside), pH 7.5), and then subjected to centrifugation (14000 rpm, 4 ° C, 10 min). The precipitate was removed. The supernatant fraction was passed through an amylose resin, washed with a washing buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% DM, pH 7.5), and eluted with a buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% DM, 20 mM). Elute with maltose, pH 7.5).

  The results of subjecting the eluted fraction to SDS-polyacrylamide gel electrophoresis are shown in FIG. In FIG. 1, each sample is as follows. “Elution”: elution fraction, “amylose resin”: amylose resin binding protein, “WASH”: washed fraction, “Flow through”: amylose resin flow-through fraction, “before purification”: fraction before purification. In addition, the band shown by the arrow in FIG. 1 shows MBP-VEGFR1 (129-229) -TM protein.

2. Preparation of liposomes Liposomes were prepared using E. coli polar extract (Avanti polar lipid). Lipids were dissolved in 3% OG (octylglycoside) and dialyzed overnight against 10 mM HEPES / 150 mM NaCl (pH 7.4). After dialysis, freeze-thawing was performed 5 times using liquid nitrogen.

3. Production of proteoliposomes The liposomes produced in Section 2 above, MBP-VEGFR1 (129-229) -TM protein, and 10% OG were mixed and allowed to stand at room temperature for 15 minutes. Thereafter, dialysis was performed at 4 ° C. for 24 hours using 10 mM HEPES / 150 mM NaCl (pH 7.4). After dialysis, the solution was recovered and subjected to centrifugation (14000 rpm, 4 ° C., 10 min) to remove the precipitate, and the resulting supernatant was used as a proteoliposome.

4. Evaluation of MBP-VEGFR1 (129-229) -TM protein activity by BIACORE using surface plasmon resonance (SPR) method
4-1. Immobilization of proteoliposome to BIACORE L1 chip First, the BIACORE L1 chip was washed by flowing 10 mM HEPES / 150 mM NaCl / 20 mM CHAPS (pH 7.4) at a flow rate of 10 μl / min for 5 minutes.

  Next, the MBP-VEGFR1 (129-229) -TM protein-containing proteoliposome or liposome (negative control) obtained in Section 3 above was immobilized on the washed BIACORE L1 chip by flowing at a flow rate of 1 μl / min for 50 minutes. did.

  After the immobilization of the proteoliposome or liposome, 100 μg / ml BSA was passed through the chip at a flow rate of 1 μl / min for 5 minutes.

4-2. Binding activity to proteoliposomes About the proteoliposome immobilized on the BIACORE L1 chip prepared in section 4-1 above, the binding activity to anti-MBP antibody (MBL) and VEGF165 (Wako Pure Chemical Industries) was The measurement was performed by SPR method at 25 ° C. in 10 mM HEPES / 150 mM NaCl (pH 7.4).
The results are shown in FIGS.

  FIG. 2 is a sensorgram showing the binding activity of MBP-VEGFR1 (129-229) -TM protein-containing proteoliposomes to anti-MBP antibodies. In FIG. 2, the vertical axis represents response (Resounance Unit: RU), and the horizontal axis represents time (second: s). FIG. 2 shows the reaction of each concentration of anti-MBP antibody shown on a chip on which MBP-VEGFR1 (129-229) -TM protein-containing proteoliposome was immobilized and a chip on which a negative control liposome was immobilized. It is the result of subtracting the response in the chip on which the liposome is immobilized from the response in the chip on which the proteoliposome is immobilized.

  On the other hand, FIG. 3 is a sensorgram showing the binding activity of MBP-VEGFR1 (129-229) -TM protein-containing proteoliposomes to VEGF165. In FIG. 3, the vertical axis represents response (RU), and the horizontal axis represents time (s). FIG. 3 shows the reaction of each concentration of VEGF165 shown above to a chip immobilized with MBP-VEGFR1 (129-229) -TM protein-containing proteoliposome and a chip immobilized with a negative control liposome. It is the result of subtracting the response in the chip on which the liposome is immobilized from the response in the chip on which the liposome is immobilized.

  As can be seen from FIG. 3, it was found that the MBP-VEGFR1 (129-229) -TM protein-containing proteoliposomes on the BIACORE L1 chip have binding activity for VEGF.

Claims (9)

The vascular endothelial growth factor binding protein of any one of the following (a)-(c).
(a) a protein comprising the amino acid sequence shown in SEQ ID NO: 2
(b) a protein comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2 and exhibiting vascular endothelial growth factor binding activity
(c) a fusion protein in which a foreign protein or peptide and the protein described in (a) or (b) above are linked   A gene encoding the vascular endothelial growth factor binding protein according to claim 1.   A recombinant vector comprising the gene according to claim 2.   A transformant comprising the recombinant vector according to claim 3.   A proteoliposome comprising the vascular endothelial growth factor binding protein according to claim 1 and a liposome.   A vascular endothelial growth factor detection kit comprising the vascular endothelial growth factor binding protein according to claim 1 or the proteoliposome according to claim 5.   A method for detecting a vascular endothelial growth factor comprising the step of contacting the vascular endothelial growth factor binding protein according to claim 1 or the proteoliposome according to claim 5 with a vascular endothelial growth factor in a biological sample.   A vascular endothelial growth factor-related disease test comprising the step of contacting the vascular endothelial growth factor binding protein according to claim 1 or the proteoliposome according to claim 5 with a vascular endothelial growth factor in a patient-derived biological sample. Method.   9. The method of claim 8, wherein the vascular endothelial growth factor related disease is a disease selected from the group consisting of retinopathy, rheumatoid arthritis and tumor.

Images