JP2011182691A - Arf6 GENE FUNCTION-DEFICIENT ANIMAL AND UTILIZATION METHOD THEREOF - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an Arf6 gene function-deficient animal, to provide a method for inspecting tumor, and to provide a method for screening a tumor therapeutic agent. <P>SOLUTION: There are provided the Arf6 gene function-deficient animal, and the transgenic animal having a Cre gene controlled by a promoter of the gene specifically expressing in a vascular endothelial cell. The promoter of the gene specifically expressing in the vascular endothelial cell is the promoter of the Tie2 gene. The tumor therapeutic agent containing the Arf6 inhibitor as an active ingredient, the method for inspecting the tumor by using the Arf6 gene function-deficient animal, and the method for screening the tumor therapeutic agent are also provided. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to an Arf6 gene loss-of-function animal in which Arf6 gene function is lost. The present invention also relates to a pharmaceutical composition for tumor treatment comprising an Arf6 inhibitor as an active ingredient and a screening method for a tumor therapeutic agent. Furthermore, the present invention relates to a method for examining tumor responsiveness to a drug using the animal, a screening method for an antitumor proliferating agent administered in combination with an angiogenesis inhibitor, and a screening method for a therapeutic agent for Arf6-related diseases.

  Cancer is a disease that develops due to DNA damage or the like, but many oncogenes or tumor suppressor genes have been identified. This indicates that cancer is not a single cause disease. For this reason, the properties of cancers, that is, tumor cells, possessed by each patient are diverse, and application of a treatment method in accordance with the properties of each tumor cell is required (Non-patent Document 1). Therefore, knowing what properties each cancer has and what anti-tumor agents are sensitive is very important information for constructing treatment strategies. In addition, regarding antitumor agents, possessing various drugs that act by different mechanisms is considered to be the basis for considering tailor-made treatment.

  Examples of the target of the antitumor agent include inhibition of growth of the tumor cell itself (targeting the cell cycle and microtubules) or inhibition of angiogenesis in the tumor tissue. When a drug targeting tumor cell growth inhibition is administered, the growth inhibitory effect on other normal cells cannot be ignored, and the administered patient often suffers from side effects.

  In general, the growth of cancer cells requires angiogenesis for the supply of oxygen and nutrients into the cancer tissue. Therefore, it is important as an anti-tumor agent target to inhibit angiogenesis for the purpose of cutting off the supply of oxygen and nutrients to cancer tissues and preventing cancer cells from metastasizing through the bloodstream. . When targeting angiogenesis inhibition, it can suppress the growth of cancer tissue, but does not induce the death of the cancer cell itself, so it is clinically desirable to use a drug that targets the cancer cell itself. It has been. Vascular Endothelial Growth Factor (VEGF) and Hepatocyte Growth Factor (HGF) are thought to play important roles in angiogenesis in cancer tissues. Yes. Anti-VEGF drugs are already in clinical use. Anti-HGF drugs are currently in the preclinical stage, but are expected to be put to practical use (Non-patent Document 2).

Heng, H. H. et al., J Cell Physiol 220, 538-547 (2009) You, W. K. and McDonald, D. M., BMB Rep 41, 833-839 (2008)

  Under such circumstances, development of a novel tumor therapeutic agent and a screening method thereof, a method for simply examining tumor sensitivity to an angiogenesis inhibitor, and a method for screening a tumor growth inhibitor that can be administered in combination with an angiogenesis inhibitor Is needed.

  In order to elucidate the physiological role of low molecular weight G protein adenosine diphosphate (ADP) -ribosylation factor 6 (Arf6) in the past, the present inventors made Arf6 gene knockout (KO) mice and analyzed them. However, these KO mice died from embryonic day 13.5, and almost all individuals died before birth (Suzuki, T. et al., Mol Cell Biol 26, 6149- 6156 (2006)). As a result of analyzing the fetus of a KO mouse, it was determined that the cause of death of the KO mouse was dysplasia of the liver. At the same time, the KO mice were found to have angiogenic abnormalities. Based on the above findings, the present inventors have made a vascular endothelial cell-specific conditional knockout mouse (cKO) (Tie2-Cre: Arf6-flox / flox) for the first time, and have intensively studied the ecology of the cKO mouse. As a result, the present invention has been completed.

That is, the present invention relates to the following.
[1] A non-human mammal that has lost the function of the Arf6 gene.
[2] The non-human mammal according to [1] above, wherein the function of the Arf6 gene is lost in at least one allele on the chromosome.
[3] The non-human mammal according to [2], which is a transgenic animal having a Cre gene controlled by a promoter of a gene specifically expressed in vascular endothelial cells.
[4] The non-human mammal according to [3] above, wherein the promoter of a gene specifically expressed in the vascular endothelial cell is a Tie2 gene promoter.
[5] The non-human mammal according to any one of [1] to [4], which is a rodent animal.
[6] A pharmaceutical composition for treating a tumor, comprising an Arf6 inhibitor as an active ingredient.
[7] The pharmaceutical composition according to [6] above, wherein the tumor expresses Arf6.
[8] The pharmaceutical composition according to [6], wherein the tumor is breast cancer.
[9] The pharmaceutical composition according to any one of [6] to [8], wherein the Arf6 inhibitor is selected from the following (a) or (b).
(A) Inhibitor of signal transduction through ARF6 protein in tumor cells (b) Inhibitor of expression of Arf6 gene [10] A method for examining tumor responsiveness to an angiogenesis inhibitor, comprising the following steps.
(A) Transplanting tumor cells or tumor tissue into the non-human mammal according to any one of [1] to [5] (b) Measuring the growth rate of the transplanted tumor cells or tumor tissue Step [11] The method according to [10], wherein the angiogenesis inhibitor is an Arf6 inhibitor or an HGF inhibitor.
[12] A screening method for an antitumor proliferating agent administered in combination with an angiogenesis inhibitor, comprising the following steps. (A) a step of transplanting tumor cells or tumor tissue to the non-human mammal according to any one of [1] to [5] (b) a step of administering a candidate drug to the animal (c) the transplant Measuring the growth rate of the tumor cells or tumor tissue obtained [13] The method according to [12] above, wherein the angiogenesis inhibitor is an Arf6 inhibitor or an HGF inhibitor.
[14] A screening method for a therapeutic agent for an Arf6-related disease, comprising a step of administering a candidate drug to the Arf6 gene-deficient animal according to any one of [1] to [5].

  According to the present invention, a novel tumor therapeutic agent and a screening method thereof are provided. The Arf6 gene loss-of-function animal of the present invention is useful for elucidating the biological function of the Arf6 gene and the protein encoded by the gene. By administering a tumor collected from a patient to the Arf6 gene loss-of-function animal of the present invention, the tumor responsiveness to an angiogenesis inhibitor can be easily examined. Furthermore, by administering a candidate compound for an antitumor proliferating agent to an Arf6 gene loss animal of the present invention, an optimal drug as an antitumor proliferating agent to be administered in combination with an angiogenesis inhibitor can be easily screened. Furthermore, a therapeutic agent for an Arf6-related disease can be easily screened by administering a candidate compound to the Arf6 gene-deficient animal of the present invention.

It is a figure which shows the preparation methods of an Arf6-floxed mouse. It is a figure which shows the reduction | decrease of the blood vessel density in a Tie2-Arf6-cKO fetus. (A) shows the results of observation of blood vessels of wild-type, Arf6-KO, Arf6-flox / flox, and Tie2-Arf6-cKO mouse embryos at E11.5 and E13.5. The arrowhead shows a short blood vessel with Arf6-KO, and the red frame in the right figure shows the observed site. (B) It is a figure which shows the result of having quantified the length of the blood vessel of the head of E11.5 day. (C) It is a figure which shows the result of having quantified the length of the blood vessel of the back part on the E13.5 day. It is a figure which shows the cancer tissue increase of B16 melanoma transplanted to Tie2-Arf6-cKO mouse | mouth and a control mouse | mouth. (A) B16 melanoma cells were injected subcutaneously into the back of Tie2-Arf6-cKO mice and control mice, and the results of observation of cancer tissue 14 days later from outside the body are shown. (B) shows the results of comparing the size of cancer tissue 14 days after injection. (C) shows the results of quantifying the size of cancer tissue over time. It is a figure which shows the blood vessel structure in the tumor tissue in a Tie2-Arf6-cKO mouse. (A) 14 days after injection into mice subcutaneously, cancer tissues were taken out, and the sections were immunostained with anti-PECAM1 antibody. (B) The results of quantifying the area occupied by blood vessels in one visual field from the sections stained in (A) are shown. It is a figure which shows the tube formation when the vascular endothelial cell isolated and cultured from the Arf6-floxed mouse | mouth is infected with the adenovirus which expresses Cre recombinase protein, or a control adenovirus, and is stimulated with VEGF or HGF.

1． Arf6 gene loss-of-function animal The present invention provides a non-human mammal that has lost the function of the Arf6 gene.

  In the present invention, “Arf6 gene” means a gene encoding adenosine diphosphate (ADP) -ribosylation factor 6. The ARF6 protein encoded by the Arf6 gene is a guanosine triphosphate (GTP) binding protein that is ubiquitously expressed in various cells, and controls membrane transport and actin cytoskeleton composition (D'Saura-Schorey C and Chavrier P , Nat Rev Mol Cell Biol 7: 347-358 (2008), Myers KR and Casanova JE, Trends Cell Biol 18: 184-192 (2008)).

  The Arf6 gene is conserved in a wide range of animal species, and the base sequences of Arf6 genes of a plurality of animal species have already been analyzed, and the sequence information is registered in the database (see Table 1).

  Therefore, in the present invention, the “Arf6 gene” includes orthologs of various mammalian Arf6 genes, and further includes not only genomic genes but also messenger RNA (mRNA) and cDNA. The CDS sequence of human Arf6 gene and the amino acid sequence of ARF6 protein are shown in SEQ ID NOs: 1 and 2, respectively. Further, the CDS sequence of the mouse Arf6 gene and the amino acid sequence of the ARF6 protein are shown in SEQ ID NOs: 3 and 4, respectively.

  In the present invention, “the function of the Arf6 gene has been lost” means that the normal function of the Arf6 gene has been lost. Examples of such a state include not only a state where the Arf6 gene product is not expressed at all, but also a state where the expression product of the gene (for example, hnRNA, mRNA or protein) does not have its normal function. Such loss of function of the Arf6 gene can be caused by deletion, substitution, and / or insertion of one or more nucleotides in the expression control region including the Arf6 gene or its transcriptional regulatory region or promoter region. The site for performing the deletion, substitution and / or insertion, and the sequence to be deleted, substituted and / or inserted are not particularly limited as long as the normal function of the Arf6 gene can be lost, but preferably Preferably, at least one exon of the Arf6 gene is deleted.

  In the Arf6 gene loss-of-function animal of the present invention, it is sufficient that the function of the Arf6 gene is lost in at least one allele (heterozygote) on the chromosome, but preferably it is lost in both alleles (homologue). Bonding) is preferred.

  In addition, the “non-human mammal” according to the present invention is not particularly limited as long as it is a mammal other than a human, but from the viewpoint of easy acquisition of next-generation animals by genetic recombination and mating, mouse, rat, guinea pig, rabbit Rodents such as are preferred.

2． Method for producing Arf6 gene-deficient animal The Arf6 gene-deficient animal of the present invention can be produced by using techniques such as gene targeting, Cre-loxP system, somatic cell clone, RNAi and the like.

2.1 Gene targeting Gene targeting is a technique for introducing a mutation into a specific gene on a chromosome using homologous recombination (Capeccchi, MR Science, 244, 1288-1292, 1989).

(1) Construction of targeting vector First, in order to construct a targeting vector for losing Arf6 gene function, a genomic DNA library of the target animal is prepared. As this genomic DNA library, it is preferable to use a library prepared from genomic DNA derived from an animal of the same strain as the Arf6 gene functional loss animal to be used so that the recombination frequency does not decrease due to polymorphism or the like. A commercially available library may be used as such a library. Alternatively, it can be prepared by screening using Arf6 cDNA or a partial sequence thereof as a probe and cloning the DNA sequence of the Arf6 genomic gene. For details of the method for preparing a genomic DNA library, the following can be referred to. "Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001", "Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997"

  Next, the cloned genomic DNA is analyzed by sequencing, Southern blotting, restriction enzyme digestion and the like to identify the position of the exon and the restriction enzyme site. Based on the sequence information obtained by such analysis, a mutation introduction site and the like are determined.

  In the present invention, mutations (deletions, substitutions and / or insertions) to be introduced onto the chromosome are not particularly limited as long as the normal function of the Arf6 gene is impaired, and these mutations include intron regions and exon regions of the Arf6 gene. Alternatively, it may be present in the expression control region of Arf6 gene. The mutation is preferably present in an exon region of the Arf6 gene, more preferably a mutation in which at least one exon of the Arf6 gene is deleted, and most preferably a mutation in which all the exons are deleted. This is because such a mutation can surely delete the function of the Arf6 gene.

  The targeting vector may contain a selection marker for selection of recombinants in addition to the 3 'and 5' homologous regions (3 'arm and 5' arm, respectively) of the mutation introduction site. Examples of selectable markers include neomycin resistance gene, positive selection marker such as hygromycin B phosphotransferase gene, expression reporter for genes to be disrupted such as LacZ, GFP (Green Fluorescence Protein) and luciferase gene, herpes simplex virus thymidine kinase gene ( HSV-TK) and negative selection markers such as diphtheria toxin A fragment (DTA), but are not limited thereto. Further, the vector may include an appropriate restriction enzyme cleavage site for linearizing the vector outside the homologous region.

  FIG. 1 shows an example of a targeting vector for loss of mouse Arf6 gene function. This construct is constructed to replace the sequence containing exons 1 and 2 of the Arf6 genomic gene with a homologous region containing the neomycin resistance gene. Furthermore, DTA is inserted into the vector as a negative selection marker. Such a targeting vector can be constructed based on a commercially available plasmid vector (for example, pBluescriptII (manufactured by Stratagene)).

(2) Introduction of targeting vector into pluripotent stem cells Next, the constructed targeting vector is introduced into pluripotent stem cells that can differentiate into germ cells. Examples of such stem cells include induced pluripotent stem cells (Induced Pluripotent Stem Cells: iPS cells) or embryonic stem cells (Embryonic Stem Cells: ES cells). iPS cells are established with cells of mice, rats, dogs, pigs, cynomolgus monkeys, and the like, while ES cells are established with cells of mice, rats, hamsters, pigs, cows, cynomolgus monkeys, and the like.

  The targeting vector can be introduced into the pluripotent stem cell by a known gene introduction method such as electroporation, microinjection, calcium phosphate method, lipofection method, virus infection and the like. For details of the gene introduction method, the Cold Spring Harbor Laboratory Press and the like can be referred to.

  Pluripotent stem cells into which a targeting vector has been introduced can be easily selected using a marker inserted into the vector. For example, in the case of cells introduced with a neomycin resistance gene as a marker, primary selection can be performed by culturing in a medium supplemented with G418. When the targeting vector contains a gene for a fluorescent protein such as GFP as a marker, sorting of fluorescent protein-expressing cells using FACS (Fluorescence Activated Cell Sorter) or the like may be performed in addition to drug resistance selection. .

  In pluripotent stem cells into which the targeting vector has been introduced, a part of the Arf6 gene on the chromosome is replaced by the homologous recombination sequence of the vector by homologous recombination, and the endogenous Arf6 gene is destroyed. Whether or not the desired homologous recombination has occurred can be determined by genotype analysis using Southern blotting, PCR method or the like. Genotype analysis by Southern blotting can be carried out by using a sequence such as a drug resistance gene or a fluorescent protein gene contained only in recombinant cells as a probe. Genotype analysis by PCR also detects primers that are complementary to sequences such as drug resistance genes or fluorescent protein genes contained only in recombinant cells, and PCR amplification is performed using these primers. can do.

(3) Production of chimeric animal A pluripotent stem cell into which a targeting vector has been introduced is introduced into an early embryo derived from a strain having a coat color different from that from which the pluripotent stem cell is derived, and is generated as a chimeric animal. For example, in the case of homologous recombination of mouse ES cells, ES cells derived from the 129 strain having agouti hair color and early embryos such as C57BL / 6 mice with black hair can be used. Thus, if a chimeric animal is produced using pluripotent stem cells derived from different strains and early embryos, the chimera rate can be determined from the coat color.

  Introduction of pluripotent stem cells into early embryos can be accomplished by microinjection (Hogan, B. et al. “Manipulating the Mouse Embryo” Cold Spring Habor Laboratory Press, 1988) or aggregation (Andra, N. et al. Proc. Natl. Acad. Sci. USA, 90, 8424-8428, 1993, Stephen, AW et al. Proc. Natl. Acad. Sci. USA, 90, 4582-4585, 1993).

The microinjection method is a method in which pluripotent stem cells are directly injected into an embryo at an early stage of development (for example, from an 8-cell embryo to a blastocyst. In this method, a micromanipulator is applied to an embryo collected from an animal. Recombinant pluripotent stem cells are directly injected under a microscope to produce a chimeric embryo, whereas in the aggregation method, 1 to 2 8-cell stage embryos and pluripotent stem cells from which the zona pellucida has been removed Chimera embryos are obtained by aggregating the cells in the co-culture.
A desired chimeric animal can be obtained by transplanting the thus-produced chimeric embryo into the uterus of a foster parent (pseudopregnant animal).

(4) Production of an Arf6 gene function loss animal A heterozygous animal with an Arf6 gene function loss can be obtained by crossing a chimeric animal obtained from a foster parent with a wild-type animal of the same strain. The genotype of each individual can be determined temporarily by appearance characteristics such as hair color, and can be determined by genotype analysis using the Southern blotting or PCR method described above. Next, homozygous animals can be obtained by crossing heterozygous Arf6 gene function-deficient animals.

  The offspring of the Arf6 gene loss-of-function animal produced as described above is also included in the Arf6 gene loss-of-function animal of the present invention as long as the function of the Arf6 gene on the chromosome is lost.

2.2 Utilization of Cre-loxP system As described above, the present inventors made Arf6 knockout (KO) mice and analyzed them. As a result, these KO mice were found to be around embryonic day 13.5. It has been found that almost all individuals die by birth (Suzuki, T. et al., Mol Cell Biol 26, 6149-6156 (2006)). From the above findings, when the Arf6 gene function is deficient in the whole body from the early stage of development, it is considered that the Arf6 gene function-deficient animal cannot survive after delivery. Therefore, in the present invention, it is preferable that the loss of function of the gene of an Arf6 gene function loss animal is controlled in a time-specific or tissue-specific manner. Examples of animals that can control loss of Arf6 gene function in a time-specific or tissue-specific manner include Arf6 gene conditional knockout (cKO) animals.
cKO animals are animals in which a target gene is deleted in a time-specific or tissue-specific manner using the Cre-loxP system (Kuhn R. et al., Science, 269, 1427-1429, 1995). The loxP (locus of X-ing-over) sequence is a DNA sequence consisting of 34 base pairs (5'-ATAACTTCGTATAGCATACATTATACGAAGTTAT-3 ': SEQ ID NO: 5) and is a sequence recognized by Cre (Causes recombination) recombination enzyme. . Two loxP sequences on the gene cause specific recombination in the presence of Cre protein. Therefore, homologous recombination of the genomic Arf6 gene of a host cell (such as a pluripotent stem cell) with a targeting vector containing a part of the Arf6 gene (preferably one or more exons) between two loxP sites, When a Cre expression vector whose expression is controlled in a time-specific or tissue-specific manner is incorporated into the host cell, the Arf6 gene portion between loxPs is deleted by the expression of the time-specific or tissue-specific Cre protein. be able to.

  Specific examples of methods for controlling Cre expression in a time-specific or tissue-specific manner include promoters or specific genes that are activated only after the animal has grown to a certain stage (eg, germ cell marker genes). And a method of inserting a Cre gene under the control of a promoter of a gene (eg, vascular endothelial cell marker gene) that is specifically expressed in the above tissue. Specific examples of promoters that enable time-specific expression control include, for example, the Neuron specific enolase gene (expressed in neurons after 3 days of birth) and the Pcp2 gene (expressed in cerebellar Purkinje cells after 6 days of birth) ) And the like. Specific examples of promoters that enable tissue-specific expression control include, for example, albumin gene (specifically expressed in hepatocytes), insulin gene (specifically expressed in pancreatic β cells) and Nestin gene (neural Promoters specifically expressed in stem cells and glial cells).

In addition, by using CreER or CreERT2 (hereinafter referred to as “CreER”), which is a fusion protein of the ligand binding domain of Estrogen Receptor (ER) and Cre protein, the nuclear translocation of Cre protein is time-specific. Can be adjusted. CreER and the like remain in the cytoplasm in an inactive state and do not move into the nucleus. However, in the presence of tamoxifen (a derivative of estrogen), CreER and the like are activated and translocate to the nucleus to cut out the sequence sandwiched by loxP. This property can be used to knock out genes while controlling both tissue and time parameters. First, a gene encoding CreER or the like is incorporated under the control of a promoter that enables the above-described tissue-specific expression control to produce an expression vector that expresses CreER or the like in a tissue-specific manner, and a cell into which this vector has been introduced By generating an animal from the above, a transgenic animal that expresses CreER and the like in a tissue-specific manner is produced. Next, this animal is mated with a transgenic animal having a sequence in which the Arf6 gene is sandwiched between loxP sequences, and CreER and the like are expressed in a tissue-specific manner, and the Arf6 gene has a sequence in which the Arf6 gene is sandwiched between loxP sequences. A double transgenic animal is produced. By administering tamoxifen to this animal at a desired timing, CreER and the like are activated, and the Arf6 gene can be knocked out tissue-specifically and time-specifically. For the production of conditional knockout animals using CreER, etc., the following can be referred to: CreERT2 expression system by Nestin gene promoter (Forni et al., J Neurosci 26, 9593-9602 (2006)), VE-cadherin CreERT2 expression system by gene promoter (Monvoisin et al., Dev Dyn 12, 3413-3422 (2006)) and CreERT2 expression system by Na _V 1.8 gene promoter (Zhao et al., Genesis 18, 364-371 (2006)).

  In the Examples of the present application, the present inventors use a vector in which the Cre gene is inserted under the promoter control of the Tie2 gene that is specifically expressed in vascular endothelial cells. The Tie2 gene encodes a tyrosine kinase receptor, also called a TEK receptor tyrosine kinase, and is known to be specifically expressed in endothelial cells. For information on the promoter of the Tie2 gene and methods for generating Tie2-Cre mice, see the following: Schlaeger et al., Proc Natl Acad Sci USA 94, 3058-3063 (1997) and Kisanuki et al., Dev Biol 230, 230-242 (2001).

  The first method for creating cKO animals using the Cre-loxP system is to homologously recombine pluripotent stem cells with a targeting vector that contains a part of Arf6 gene (preferably one or more exons) between two loxP sites. Then, a double transgenic pluripotent stem cell is produced by introducing a Cre expression vector whose expression is controlled in a time-specific or tissue-specific manner into the cell, and the double transgenic cell is introduced into an early embryo. And a method of producing a cKO animal by mating the chimeric animals. Alternatively, as a second method, a single transgenic pluripotent stem cell homologously recombined with the loxP targeting vector is introduced into an early embryo to produce a chimeric animal, and the chimeric animal is mated to obtain a loxP homologous recombinant animal. Make it. On the other hand, a Cre-expressing recombinant animal into which a Cre expression vector has been introduced is prepared. Then, a Cre-loxP recombinant animal is produced by crossing the loxP homologous recombinant animal with a Cre-expressing recombinant animal.

2.3 Somatic cell clones In animals where pluripotent stem cells are not available, somatic cell clones (I. Wilmut et al, Nature, Vol. 385, 810-813, 1997, AE Schnieke et al, Science, Vol. 278, 2130- 2133, 1997) can also be used to produce Arf6 gene-deficient animals. A somatic cell clone is a clone generated by transplanting a nucleus extracted from a somatic cell into an enucleated unfertilized egg to produce a cloned embryo and then transplanting this cloned embryo into a foster mother's uterus. Therefore, the aforementioned genetic recombination is performed on somatic cells to cause loss of Arf6 gene function, the somatic cell nucleus is removed, and this is transplanted into an enucleated unfertilized egg to produce a cloned embryo. it can. Next, if this cloned embryo is transplanted and generated in the uterus of a foster parent (pseudopregnant animal), a somatic cell cloned animal having a loss of function of the Arf6 gene can be obtained.

2.4 RNAi
In addition to the above, an RNA interference (RNAi) method using siRNA (small interfering RNA) or the like can be used as a method for deleting the function of the Arf6 gene. RNAi is a multi-step process that takes place in multiple stages. First, double-stranded RNA (Double Stranded RNA: dsRNA) or hairpin-shaped shRNA (Small Hairpin RNA) expressed from an RNAi expression vector is recognized by Dicer and degraded into 21-23 nucleotide siRNAs. The siRNAs are then incorporated into an RNAi target complex called the RNA-Induced Silencing Complex (RISC), where the RISC and siRNAs complex contains a sequence that is complementary to the siRNA sequence. Binds to mRNA and degrades mRNA. The target mRNA is cleaved at the center of the region complementary to the siRNA. Finally, the target mRNA is rapidly degraded and the protein expression level decreases. The most potent siRNA duplex is known to be a 21 nucleotide long sequence with two uridine residue overhangs at each 3 'end of the 19 bp duplex (Elbashir SM et al. Genes and Dev, 15, 188-200 (2001)).

Therefore, in order to obtain an Arf6 gene knockdown animal, first, a nucleotide containing a sequence complementary to a part of the Arf6 gene sequence shown in SEQ ID NO: 1 can be expressed as dsRNA or shRNA in an appropriate RNAi expression vector. Insert to make RNAi vector. Next, the vector is introduced into a pluripotent stem cell, a hetero animal is generated from the pluripotent stem cell, and the hetero animals are mated. Thereby, an Arf6 gene knockdown animal can be obtained. For the sequence of siRNA targeting Arf6, see, for example, Balana ME et al., (Journal of Cell Science 118, 2201-2210 (2005)).
The design and synthesis of dsRNA or shRNA can be performed with a commercially available DNA / RNA synthesizer, eg, Applied Biosystems 394, or can be commissioned to a third party (eg, TAKARA Bio).

In addition, as reported in Dickins RA. Et al., (Nature Genetics, 39 (7): 914-921 (2007)), it is possible to suppress time-specific or tissue-specific expression by RNAi. Specifically, first, an RNAi expression vector is prepared so that dsRNA or shRNA for targeting Arf6 gene can be expressed under the control of a tetracycline sensitive (Tet-On) promoter. Next, the RNAi expression vector is transfected into pluripotent stem cells to produce transgenic pluripotent stem cells. On the other hand, a tetracycline trans-activator (tTA) under the control of a time-specific or tissue-specific promoter as described in “2.2 Use of Cre-loxP system” above. Is prepared, and the tTA expression vector is introduced into the transgenic pluripotent stem cells. Furthermore, by generating a chimeric animal from the obtained double transgenic pluripotent stem cells, mating the chimeric animals, creating a heterozygous animal of Arf6 conditional knockout, by mating the animals, An animal capable of knocking down both alleles of the Arf6 gene in a time-specific or tissue-specific manner can be produced.
Alternatively, by separately producing a first transgenic animal introduced with the RNAi expression vector and a second transgenic animal introduced with the tTA expression vector, and mating these first and second animals An animal capable of knocking down the Arf6 gene in a time-specific or tissue-specific manner can also be produced.
Tetracycline-sensitive RNAi expression vectors may be commercially available (eg, Knockout ^™ Tet RNAi System P (Clontech)) or Dickins RA. Et al., (Nature Genetics, 39 (7): 914-921 (2007)).

3． Phenotype of Arf6 gene loss-of-function animal In the Arf6 gene loss-of-function animal of the present invention, when a phenotype different from that of a wild-type animal of the same strain appears, it is predicted that it is caused by loss of function of the Arf6 gene. For example, changes represented by the following were observed in mice with loss of Arf6 gene function.
(1) Decrease in angiogenesis (2) Decrease in the growth rate of transplanted tumor cells Regarding the decrease in angiogenesis, it was found that the angiogenesis induced by HGF was particularly reduced (Fig. 5).
Therefore, knowledge about the biological function of the Arf6 gene can be obtained by analyzing the phenotype of the Arf6 gene loss-of-function animal of the present invention.

Four. Antitumor agents comprising an Arf6 inhibitory substance as an active ingredient As a result of observing the phenotype of the Arf6 gene-deficient animal of the present invention in detail, the present inventors have confirmed that tumors in the animal body are inhibited by inhibiting the function of the Arf6 gene. It has been found that the proliferation rate of the cells decreases. Therefore, when a drug containing an inhibitor of Arf6 gene or ARF6 protein is administered to a tumor patient, the function of Arf6 gene or ARF6 protein is inhibited in the body of the tumor patient, resulting in a tumor treatment effect. Can do.
Therefore, the present invention provides a pharmaceutical composition for treating a tumor comprising an Arf6 inhibitor as an active ingredient.

  The type of tumor to be treated by the pharmaceutical composition of the present invention is not particularly limited, and may be a benign tumor or a malignant tumor. Examples of such tumors include (1) sarcomas such as osteosarcoma and soft tissue sarcomas, (2) breast cancer, lung carcinoma, bladder carcinoma, thyroid carcinoma, prostate carcinoma, colon carcinoma, colorectal carcinoma, pancreatic carcinoma, Gastric carcinoma, liver carcinoma, uterine carcinoma, cervical carcinoma, ovarian carcinoma, etc., (3) lymphoma such as Hodgkin and non-Hodgkin lymphoma, (4) neuroblastoma, (5) melanoma, (6) myeloma, ( 7) Wilms tumor, (8) Leukemia such as acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic leukemia (ALL) and chronic lymphocytic leukemia (CLL), (9) glioma, (10 ) Retinoblastoma and the like, but not limited thereto. Preferably, the tumor is a tumor with angiogenesis, most preferably a tumor expressing Arf6. Even in human breast cancer, it has been reported that expression of Arf6 activator is frequently observed in cancer with high metastatic potential (Sabe et al., Traffic 10, 982-993 (2009)).

In the present invention, “Arf6 inhibitor” means a drug or compound having an effect of inhibiting the function of Arf6. As “inhibition of Arf6 function”, (a) inhibition of signal transduction via ARF6 protein in tumor cells and (b) inhibition of expression of Arf6 gene are considered.
Inhibition of signal transduction via ARF6 protein is particularly preferred because ARF6 protein has an inactive form bound to GDP and an active form bound to GTP, and particularly preferably, inhibits the function of GTP-bound ARF6 protein. It is done. Substances having such an inhibitory effect include compounds or neutralizing antibodies that bind to GTP-bound ARF6 protein and lose its function, or substances that inactivate GTP-bound ARF6 protein.
As a compound or neutralizing antibody that binds to GTP-binding ARF6 protein and loses its function, a compound or antibody that inhibits the binding of ARF6 protein to GTP by binding to the GTP binding site of ARF6 protein is considered. . An antibody having the GTP binding site of ARF6 protein as an epitope immunizes an appropriate antibody-producing animal (for example, a rodent such as guinea pig and rabbit) with a peptide containing the GTP binding site of ARF6 protein, and from the serum according to a standard method It can be produced by purification. Moreover, such an antibody is preferably a monoclonal antibody, and more preferably a humanized monoclonal antibody. For a method for producing a humanized monoclonal antibody, see, for example, Japanese Patent Publication No. 2912618.
Examples of substances that inactivate GTP-bound ARF6 protein include G Protein-Coupled Receptor Kinase-Interacting Protein 1 (GIT1) (Meyer MZ et al., JBC March 24, Vol. 281, Number 12, 7919-7926 (2006)).
On the other hand, examples of substances that inhibit the expression of Arf6 gene include Arf6 gene expression products, such as substances that inhibit the synthesis of Arf6 hnRNA, mRNA, and peptides, and substances that degrade these expression products. Specific examples of such substances include mutant proteins of ARF6 (for example, T27N mutant in which the 27th threonine of the amino acid sequence is substituted with asparagine, or an effector region mutant that has lost the ability to bind to a specific protein) Etc.), SesinH3 and its similar compounds that inhibit cytohesin (one of the active factors Guanine-nucleotide Exchange Factor (ARF6-GEF) of ARF6), ARF-GEP100 (Guanine-nucleotide Exchange Protein 100) or EFA6 which is ARF6-GEF (Exchange Factor for Arf6) activity-deficient mutant, ARF6-GAP (GTPase-activating protein), and siRNA described in the above item “2.4 RNAi”.

  Although a patient will not be specifically limited if it is a mammal which has a tumor, Preferably it is a human.

  The administration route of the pharmaceutical composition of the present invention is not particularly limited as long as it is a route generally adopted for administration of the candidate drug. Specific examples include oral, sublingual, nasal, and pulmonary. , Transgastrointestinal tract, transcutaneous, eye drop, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, local injection, and surgical transplantation, preferably intravenous injection.

“Treating” a tumor means reducing the growth rate of the tumor present in the patient. If the tumor growth rate decreases when the pharmaceutical composition of the present invention is administered as compared with the case where the tumor is not administered, the tumor is reduced in its “increase rate” by the pharmaceutical composition of the present invention. It can be judged.
Tumor growth in a patient can be easily traced using diagnostic equipment such as MRI (magnetic resonance imaging) or echo.

  The pharmaceutical composition of the present invention may be a solid agent such as a capsule, a tablet or a powder, or may be a liquid agent such as a solution, suspension or emulsion, or a semi-liquid preparation such as an ointment, cream or paste. .

  The active ingredients may be used alone or in combination with other pharmacologically acceptable ingredients. Examples of other pharmacologically acceptable ingredients include excipients, binders, disintegrants, antioxidants, preservatives, adjuvants, lubricants, sweeteners, fragrances, etc. It is not limited to.

  The pharmaceutical composition of the present invention may contain a therapeutically effective amount of an active ingredient, Arf6 inhibitor. Here, the “therapeutically effective amount” means an amount capable of reducing the rate of tumor growth by administering the amount of the active ingredient to the subject. For example, in the case of intravenous injections, the therapeutically effective amount is 0.001 to 10% by weight, preferably 0.01 to 5% by weight, and more preferably 0.1 to 2% by weight.

  The dose and frequency of administration of the pharmaceutical composition of the present invention vary depending on various factors such as the subject's species, body weight, sex, age, tumor disease progression, and administration route, but doctors, veterinarians, dentists A person skilled in the art such as a doctor or a pharmacist can determine the dose in consideration of each factor. For example, when the pharmaceutical composition of the present invention is locally administered to an adult having a body weight of 60 kg, it may be administered 1 to 4 times, preferably 1 or 2 times daily, and the dose per time is 0.1 to 150 mg. Yes, preferably 1-50 mg.

  The above therapeutically effective dose, dose, and administration frequency are listed as typical values, and even when the value is higher or lower than this, it is fully conceivable that the increase rate of the tumor decreases. Therefore, numerical values exceeding or below the therapeutically effective amount, dosage and administration frequency are also included as the therapeutically effective amount, dosage and administration frequency of the pharmaceutical composition of the present invention.

Five. As a result of detailed observation of the phenotype of the Arf6 gene loss-of-function animal of the present invention, the present inventors have observed the growth rate of tumor cells in the animal body by inhibiting the function of the Arf6 gene. I found it to decline. Based on this finding, if any compound can be confirmed to have an Arf6 inhibitory effect, the function of the Arf6 gene or ARF6 protein will be inhibited in the animal body to which the compound is administered. The rate of increase is also expected to decline. Therefore, it can be determined that such a compound having an Arf6 inhibitory effect has an action of reducing the rate of tumor growth.
Therefore, the present invention provides a screening method for a therapeutic agent for tumor, comprising the following steps.
(A) A step of bringing a tumor cell into contact with a candidate compound (b) A step of detecting a function inhibitory effect of Arf6

  In the present invention, the “tumor” of the “tumor cell” is as described in the above section “4. Antitumor agent containing Arf6 inhibitor as an active ingredient”. Therefore, the tumor cell means a cell contained in the tumor. The tumor cells are preferably those in which the Arf6 gene is expressed.

  Candidate compounds are not particularly limited, and specific examples include compounds that have been suggested to be associated with decreased Arf6 activity, such as mediators of the GDP / GTP cycle of ARF6 protein. Candidate compounds may be in any form such as peptides, low molecular compounds, high molecular compounds, salts or precursors thereof.

  In the present invention, “contacting a tumor cell with a candidate compound” means that the candidate compound is close enough to cause an interaction with a molecule on the surface of the tumor cell, binds to the molecule, or the tumor. It means to adjust the conditions to be taken up into cells. When the tumor cells are cultured cells, the cells can be brought into contact with the candidate compound by adding the candidate compound at a certain concentration or higher to the culture medium in contact with the cell. On the other hand, when tumor cells are present in an animal body, the tumor cells can be brought into contact with the candidate compound by administering the animal to the animal in a certain amount. In this case, the administration route is as described in the section of “4. Antitumor agent containing Arf6 inhibitor as active ingredient” above.

In the present invention, “function inhibition of Arf6” is as described in the above item “4. Antitumor agent containing Arf6 inhibitor as an active ingredient”. The inhibitory effect of Arf6 on the function of the candidate compound can be confirmed as a decrease in the expression level of the Arf6 gene or a decrease in the ARF6 protein level due to administration of the candidate compound. The expression level of the Arf6 gene can be measured by RT-PCR using a tumor cell extract and agarose gel electrophoresis, Real-Time PCR, Northern blotting, microarray analysis, mass spectrometry, and the like. Primers or probes used in these measurement methods can be designed and synthesized based on the Arf6 gene sequence registered in a database such as GenBank.
On the other hand, the amount of ARF6 protein can be measured by SDS-PAGE using a tumor cell extract, two-dimensional electrophoresis analysis, Western blotting method, surface plasmon resonance method and various chromatographic methods. As the antibody or fragment thereof used in these measurement methods, a commercially available anti-ARF6 antibody (for example, Sigma, A5230) may be used, or the item “4. Antitumor agent containing Arf6 inhibitor as an active ingredient” above. An antibody prepared by the method described in 1. above may be used.

  Since the ARF6 protein includes an inactive form bound to GDP and an active form bound to GTP, it is preferable to measure the amount of GTP-bound ARF6 protein in confirming “function inhibition of Arf6”. The present inventors specifically bind JTP3 and JIP4 leucine zipper regions (LZ region and LZII region, respectively), which are JNK-interacting proteins (JIP), to GTP-binding ARF6 protein, and other ARF family proteins or It has been found that it does not interact with GDP-bound ARF6 protein, and has completed the method for quantifying GTP-bound ARF6 protein using the LZ region of JIP3 and the LZII region of JIP4. Therefore, the amount of GTP-bound ARF6 protein can be measured by the above quantitative method.

6． Method for Examining Tumor Response to Anti-Angiogenesis Agent The present invention provides a method for examining tumor responsiveness to an angiogenesis inhibitor using the above-mentioned Arf6 gene loss animal.
In anti-tumor treatment, chemotherapy is administered to administer a tumor growth inhibitor that suppresses the growth of tumor cells and / or an angiogenesis inhibitor that suppresses angiogenesis, but the tumor growth inhibitor is not tumorigenic Since the activity of normal cells is also inhibited, it is preferable to suppress the dose as much as possible. Therefore, prior to treatment, if it can be determined that the patient's tumor is highly sensitive to an angiogenesis inhibitor, a treatment plan with an anti-tumor effect mainly due to the action of the angiogenesis inhibitor will be established, and tumor growth will occur. It becomes possible to suppress the dose of the inhibitor.
As described above, the Arf6 gene loss-of-function animal of the present invention exhibits a phenotype in which the level of angiogenesis is reduced compared to the wild-type animal of the same strain. Therefore, when a tumor collected from a patient is transplanted into an Arf6 gene loss-of-function animal of the present invention and the growth rate is judged to be reduced, the growth of the tumor is considered highly dependent on angiogenesis. Therefore, it is expected that the growth of the tumor can be suppressed by administration of the angiogenesis inhibitor.

  Specific steps of this method include a step of transplanting a tumor tissue or a cell contained in the tissue removed from a patient into the Arf6 gene function loss animal of the present invention, and the transplanted tumor tissue or cell as an Arf6 gene function loss animal. And the like, and the step of measuring the growth rate of tumor tissue or cells.

Although a patient will not be specifically limited if it is a mammal which has a tumor, Preferably it is a human.
The types of tumors are as described in the section “4. Antitumor agents containing Arf6 inhibitor as an active ingredient” above.
These tumor tissues may be transplanted to the Arf6 gene loss animal of the present invention immediately after excision, or tumor cells are isolated from the excised tumor tissue, and a fixed number of cells are transplanted to the Arf6 gene function loss animal. May be. The transplantation method is not particularly limited, but subcutaneous injection or intraperitoneal injection is preferable because of the ease of re-extraction of the transplanted tumor cells.

When a tumor tissue is directly transplanted, the growth rate (%) can be measured using the volume or weight of the tumor tissue or the rate of increase of the number of tumor cells as an index, but when measured based on the volume, The growth rate can be determined by the following equation.
Tumor growth rate (%) = [{(tumor volume at re-extraction) − (volume at transplant)} / (volume at transplant)] × 100

Moreover, the volume of the tumor tissue can be obtained by the following equation.
Tumor volume = length x width ² x 0.52

  When the rate of increase of the tumor transplanted into the animal with loss of Arf6 gene function is smaller than the rate of increase of the tumor transplanted with the wild type animal (control animal) of the same strain as the animal with loss of Arf6 gene function, the tumor is vascularized It can be judged that it has sensitivity to an angiogenesis inhibitor.

Comparison of the growth rate of tumors transplanted between Arf6 loss-of-function animals and control animals was made by transplanting part of the tumor tissue collected from patients into Arf6 loss-of-function animals and control the remaining tissues (or parts thereof). You may carry out by transplanting to an animal and observing the growth process of a tumor in parallel. Alternatively, when there are multiple data on the rate of increase in the Arf6 gene loss-of-function animal of the present invention regarding the same type of tumor as the sample tumor, the average value obtained by statistically processing the data, the standard You may judge by comparing with the reference value derived | led-out from a deviation etc.
The average value, standard deviation, and the like of the tumor growth rate can be obtained by various statistical methods. Specifically, the body weight at the time of transplantation of the mouse used and the weight, volume, or cell number of the tumor were used as parameters. It can be obtained by two-way ANOVA analysis with statistical analysis software such as IBM SSPS Statistics 18 (SSPS). By increasing the population in addition to the statistical analysis population as the new growth rate of the tumor sample obtained by the implementation of the method of the present invention, the accuracy of the analysis can be further improved.

  In the present method, the “angiogenesis inhibitor” is not particularly limited, but in the Arf6 gene loss-of-function animal of the present invention, the Arf gene function is lost, and HGF-stimulated angiogenesis is particularly reduced. Therefore, preferred examples of the angiogenesis inhibitor include, but are not limited to, Arf6 inhibitors and HGF inhibitors. Specific examples of Arf6 activation inhibitors include, for example, cytohesin inhibitor SecinH3 (Hafner, M. et al., Nature 444, 941-944 (2006)) and siRNA targeting Arf6. However, the present invention is not limited to this. On the other hand, examples of HGF inhibitors include HGF neutralizing antibodies (Cao, B. et al., Proc Natl Aad Sci USA 98, 7443-7448 (2001)), PHA-665752 which is a c-Met kinase activity inhibitor. (Christensen, JG et al., Cancer Res 63, 7345-7355 (2003)), c-Met decoy peptide Soluble Met (Michieli, P. et al., Cancer Cell 6, 61-73 (2004)), NK4 (Brockmann MA et al., Clin Cancer Res 9, 4578-4585 (2003)), an antagonist of HGF, and U1 snRNA / ribosome (Abounader, R) for the suppression of HGF and c-Met expression et al., J Natl Cancer Inst 91, 1548-1556 (1999)).

7． The present invention provides a screening method for an antitumor proliferating agent that is administered in combination with an angiogenesis inhibitor, using the aforementioned Arf6 gene loss-of-function animal.
As described above, since the tumor growth inhibitor has strong side effects, it is possible to reduce the burden on the patient by minimizing the dose. Therefore, prior to actual treatment, if a tumor growth inhibitor that promotes tumor shrinkage most effectively against a tumor specific to a patient can be screened, the dose of the tumor growth inhibitor can be reduced to a small amount. The burden on the patient can be greatly reduced. However, in anti-tumor treatment, chemotherapy using a combination of a tumor growth inhibitor and an angiogenesis inhibitor is generally carried out, and both of these drugs have antitumor effects and were actually observed. It is difficult to determine the contribution rate of a tumor growth inhibitor alone to tumor shrinkage.

  However, when the Arf6 gene loss-of-function animal of the present invention is used for screening for a tumor growth inhibitor, since angiogenesis is suppressed in the animal, there is no need to administer the angiogenesis inhibitor, and the tumor growth inhibitor alone The antitumor effect of can be observed. That is, a tumor tissue or tumor cell of a patient is transplanted into a plurality of individuals of the Arf6 gene loss-of-function animal of the present invention, each candidate drug is administered to the animal, the growth rate of the transplanted tumor cell is measured, Can be selected as appropriate for the treatment of the patient's tumor.

  The angiogenesis inhibitor is as described in the above section “6. Method for examining tumor responsiveness to angiogenesis inhibitors”.

  Examples of candidate drugs include drugs that have already been confirmed to have antitumor effects, compounds that potentially have antitumor effects, and the like. Specific examples of such agents or compounds include antimetabolites (eg, 5-fluorouracil (5-FU)), folate antimetabolites (eg, dihydropteroate synthase inhibitors sulfadiazine and sulfamethoxa Sol, dihydrofolate reductase inhibitor (DHFR inhibitor) methotrexate, trimethoprim, pyrimethamine,), pyrimidine metabolism inhibitor (eg, thymidylate synthase inhibitor 5-FU, flucytosine (5-FC)), purine metabolism Inhibitors (eg, IMPDH inhibitor 6-mercaptopurine and its prodrug azathioprine), adenosine deaminase (ADA) inhibitors (eg, pentostatin), ribonucleotide reductase inhibitors (ribonucleotide reductase inhibitors) Some hydroxyureas), nucleotides Log (purine analogs thioguanine, fludarabine phosphate and cladribine, pyrimidine analogs cytarabine and gemcitabine), L-asparaginase, alkylating agents (eg, nitrogen mustard cyclophosphamide, melphalan and thiotepa, platinum preparations) Cisplatin, carboplatin and oxaliplatin, nitrosourea dacarbacin, procarbacin and ranimustine) antitumor constituents (sarcomycin, mitomycin C, doxorubicin, epirubicin, daunorubicin, bleomycin), topoisomerase inhibitors (irinotecan, nogitecan, toposinside, doxorubiside, doxorubiside , Levofloxacin, ciprofloxacin), microtubule polymerization inhibitor (vinblastine, vincristine, bin Syn), colchicine, microtubule depolymerization inhibitors (paclitaxel, docetaxel), molecular targeting agents (trastuzumab, rituximab, imatinib, gefitinib, bortezomib, erlotinib), steroid drugs such as dexamethasone, finasteride, aromatase inhibitors and tamoxifen Combinations may be mentioned, but are not limited to the above.

  “Administration” refers to bringing a tumor tissue transplanted into an Arf6 gene loss animal into contact with a candidate drug. The administration route of the candidate drug for the antitumor agent is not particularly limited as long as it is a route generally adopted for administration of the candidate agent. Specific examples include oral, sublingual, nasal, transnasal. Examples include lung, trans-gastrointestinal tract, transdermal, eye drop, intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, local injection, and surgical transplantation.

  The method for transplanting tumor tissue or tumor cells and the method for measuring the growth rate are as described in the previous section “6. Method for examining tumor responsiveness to angiogenesis inhibitors”.

8． The present invention provides a screening method for a therapeutic agent for an Arf6-related disease using the aforementioned Arf6 gene-deficient animal.
The Arf6 gene loss-of-function animal of the present invention has a loss of Arf6 gene function and exhibits a phenotype different from that of a wild-type animal of the same strain. When the functional disorder (for example, reduction of angiogenesis) or the like is reduced, it can be determined that the drug has a therapeutic effect on Arf6-related diseases. Therefore, a therapeutic agent for an Arf6-related disease can be screened by administering a candidate drug for treating an Arf6-related disease to an Arf6-gene-deficient animal of the present invention and observing a change in the phenotype of the animal.

  In the present invention, the term “Arf6-related disease” mainly means a disease or disorder caused by loss of function of the Arf6 gene. In addition, the Arf6 gene has a normal function and ARF6 having a normal function. When the protein is expressed, a disease or disorder associated with abnormal expression level of the gene or protein (ie, decreased or increased expression level compared to the wild type), abnormal activation of ARF6 protein or Also included are diseases or disorders caused by inactivation, as well as diseases or disorders associated with increased or decreased intracellular concentrations of activators or inhibitors of Arf6 gene or protein.

  ARF6 protein has been suggested to play an important role in the metastatic potential of tumor cells (Hashimoto et al., Proc Natl Acad Sci USA 101, 6647-6652 (2004); Sabe et al., Traffic 10, 982-993 (2009)), it has been reported that even in human breast cancer, expression of Arf6 activator is frequently observed in cancers with high metastatic potential (Sabe et al., Traffic 10, 982). -993 (2009)). Thus, specific examples of Arf6-related diseases include tumors, particularly breast cancer. Other specific examples of Arf6-related diseases include Niemann-Pick Type C Disease, various infectious diseases (especially Chlamydia infection, etc.), insulin resistant diabetes, Dent disease and Fancony syndrome. For example, Schweitzer, JK et al (PLoS One 4, e5193) describes that increasing the activity of Arf6 suppresses the pathology of Niemann-Pick Type C Disease, and Balana, ME (J Cell Sci 118, 2201-2210 (2005)) describes that Arf6 is required for infection of various bacteria including Chlamydia. Furthermore, Hafner, M. et al (Nature 444, 941-944 (2006)) reported that inhibition of Arf6 activity showed an insulin-resistant diabetic state, Annan LE et al (Am J Physiol Cell (Physiol 286, C768 (2004)), it is reported that the regulation of intracellular transport of ClC-5 chloride channel by Arf6 is involved in the deterioration of the pathology of Fancony syndrome. The following can be referred to for the relationship between Dent's disease and ARF6 (Marshansky V et al., Biochem Cell Biol 79, 678 (2001)).

  With regard to diseases or disorders associated with Arf6, it is expected that many types of diseases or disorders other than those described above will be identified by future studies using Arf6 gene loss-of-function animals of the present invention.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, this invention is not limited to the aspect described in the Example.

experimental method
Construction of cKO mouse The mouse Arf6 gene is located on chromosome 12 and consists of two exons. A targeting vector was constructed with a loxP site inserted between both exons (Fig. 1). The neomycin resistance gene (Neo) for selection of recombinants can be removed in the presence of flippase because the FRT sequence is flanked at both ends (Floxed allele). In the presence of Cre recombinase, the region sandwiched by loxP is lost and becomes Knockout allele. . The vector thus prepared was transfected into a mouse ES cell line (TT2) by electroporation, and a homologous recombinant was isolated.

  ES cells that had undergone correct homologous recombination were positively selected with the neomycin resistance gene and negatively selected with the DTA gene. The homologous recombinant ES cells thus obtained were injected into blastocysts, and these blastocysts were transplanted into temporary parents to produce chimeric mice. The resulting male chimeric mouse was mated with a C57BL / 6J female mouse to obtain a hetero mouse (Arf6-flox / +). After the male and female of this hetero mouse (Arf6-flox / +) are mated to obtain a homo mouse (Arf6-flox / flox), the homo mouse is mated with a Tie2-Cre mouse to obtain a Tie2-Cre; Arf6-flox / + Mice were obtained. The Tie2-Cre; Arf6-flox / + mouse and a homo mouse (Arf6-flox / flox) were crossed to obtain a blood vessel-specific Arf6-cKO mouse (Tie2-Cre-Arf6-cKO).

Establishment of mouse vascular endothelial cells
Vascular endothelial cells derived from Arf6-flox / flox mice were established using polyoma middle T antigen according to the method described in Balconi G et al., (Arterioscler Thromb Vasc Biol 20: 1443-1451 (2000)). Arf6-flox / flox mouse E11.5 fetuses treated with collagenase / dispase solution (GIBCO), then on a dish coated with 0.1% gelatin (Sigma) for 24 hours at 37 ° C and 5% CO ₂ Cultured. Thereafter, a retrovirus expressing the polyoma middle T antigen was infected. This antigen is capable of specifically immortalizing vascular endothelial cells. A colony of vascular endothelial cells immortalized after 1 to 2 weeks was observed under a microscope, and a vascular endothelial cell line purified by mechanically removing other cells was established. Established vascular endothelial cells retain the properties of vascular endothelial cells by VE-Cadherin immunostaining (clone: c-19, Santa Cruz Biotechnology) and RT-PCR of VEGF receptors, endoglin and PECAM1 It was confirmed. The sequences of primers used for PCR of VEGF receptor, endoglin and PECAM1 are as follows.
VEGFR1 sense primer: TATGGTCTGTGTGCTTAGGTCGTGC (SEQ ID NO: 6)
VEGFR1 antisense primer: CTGCTGTTCTCATCCGTTTCTCTGG (SEQ ID NO: 7)
VEGFR2 sense primer: GGAGAATCAGACAACAACCATTGGCG (SEQ ID NO: 8)
VEGFR2 antisense primer: CATCATAAGGCAAGCGTTCACAGCG (SEQ ID NO: 9)
Endoglin sense primer: CCACAGGTGAATACTCCGTCAAG (SEQ ID NO: 10)
Endoglin antisense primer: GCTACTCAGGACAAGATGGTCGTC (SEQ ID NO: 11)
PECAM1 sense primer: GTCATGGCCATGGTCGAGTA (SEQ ID NO: 12)
PECAM1 antisense primer: CTCCTCGGCATCTTGCTGAA (SEQ ID NO: 13)
PCR reaction conditions are as follows.
Reaction solution composition:
Appropriate amount of template DNA
dATP 0.2 mM
dGTP 0.2 mM
dTTP 0.2 mM
dCTP 0.2 mM
Sense Primer 1 μM
Antisense Primer 1 μM
Blend Taq Buffer (Toyobo) 1x Conc
Blend Taq Enzyme (Toyobo) 0.25 unit / 30μL

Reaction cycle:
95 ° C 30 seconds
60 ℃ 30 seconds
72 ° C 30 seconds
30 cycles.

Cell culture
B16 melanoma cells were cultured in Dulbecco's modified Eagle (DMEM) medium containing 10% fetal calf serum (FCS), 50 μg / ml streptomycin, 50 units / ml penicillin at 37 ° C. and 5% CO ₂ . The established mouse vascular endothelial cells are 10% FCS, 1 mM Na-pyruvate, 100 μM non-essential amino acid, 55 μM 2-mercaptoethanol, 50 μg / ml streptomycin, 50 units / ml penicillin, 50 μg / ml heparin, The cells were cultured in Dulbecco's modified Eagle medium containing 20 μg / ml Endothelial cell growth factor (Roche) at 37 ° C. and 5% CO ₂ .

Cancer cell transplantation experiment
The right back of 8-week old male mice was injected subcutaneously with 5 × 10 ⁵ cells of B16 melanoma. Thereafter, the tumor size was measured every two days using a digital caliper. Tumor volume was calculated using the following formula.

Tumor volume = length x width ² x 0.52

Transplantation experiments were performed using 9 control mice (Cre (-); Arf6 (flox / flox)) and 8 Tie2-Arf6-cKO mice.

Immunochemical staining
14 days after subcutaneous injection of B16 melanoma cells, tumors derived from B16 melanoma cells were removed. The tumor was minced and fixed with 4% paraformaldehyde, and then frozen sections were prepared according to a conventional method. Vascular endothelial cells extending into the tumor were stained with rat anti-PECAM1 antibody (MEC13.3, BD pharmingen), biotin-anti-rat secondary antibody (Vector), and streptavidin-HRP (Vector).

Tube formation assay
Growth Factor Reduced Matrigel (BD pharmingen) was packed on a 24-well plate and polymerized at 37 ° C. for 30 minutes. Mouse-derived vascular endothelial cells are seeded on polymerized Matirgel and in the presence or absence of either 50 ng / ml VEGF (Peprotech) or 50 ng / ml HGF in DMEM containing 2% FCS The cells were cultured at 37 ° C. and 5% CO ₂ for 8 hours. The formed tube was observed under a stereomicroscope, and the length of the tube was measured.

result
Although abnormal angiogenesis was observed in Arf6 straight knockout mice, the mice were embryonic lethal and unsuitable for analysis, so an attempt was made to create tissue-specific knockout mice. First, Arf6-floxed mice were prepared according to a conventional method. Tie2-Arf6-cKO was obtained by mating the prepared floxed mouse with a Tie2-Cre mouse. The Tie2-Arf6-cKO mice grew to adulthood, and no morphological or behavioral abnormalities were observed. However, observation of embryos at embryonic day 13.5 showed a decrease in blood vessel density on the head and back (FIG. 2).

Next, the effect of angiogenesis on tumor tissue growth in Tie2-Arf6-cKO mice was examined. The cultured B16 melanoma cells were transplanted subcutaneously on the back of the mouse, and the size of the tumor tissue was quantified. As a result, it was found that tumor growth was suppressed in the Tie2-Arf6-cKO mice compared to the control Arf6-flox / flox mice (FIG. 3). When blood vessels in the tumor tissue were examined by immunostaining, it was found that there were few PECAM1-positive mature blood vessels (Fig. 4). Therefore, growth of tumor tissue by B16 melanoma cells was thought to require Arf6-dependent angiogenesis.
We also examined whether GTP-bound Arf6 is involved in HGF or VEGF-induced angiogenesis. Since tube formation of cultured vascular endothelial cells is generally used as an in vitro test method for angiogenesis, this experimental system was used. In the Arf6-floxed / floxed mouse prepared in this example, the Arf6 gene is deficient in the presence of Cre recombinase. Therefore, by treating the cultured vascular endothelial cells prepared from Arf6-floxed / floxed mice with Cre recombinase-expressing virus (or control virus), vascular endothelial cells lacking Arf6 were prepared, and tube formation by HGF or VEGF was affected. We examined whether it was done (Figure 5). As a result, Arf6 deficiency inhibited tube formation by HGF, but did not inhibit tube formation by VEGF.
To summarize the above results, Arf6 is activated by HGF (conversion to GTP-linked form) and is involved in its angiogenic action, but also activated by VEGF in a short time, but this activation is caused by VEGF. Not considered important for angiogenesis.

  This analysis revealed that Arf6-dependent angiogenesis is required for tumor tissue expansion by mouse-derived B16 melanoma cells. That is, if the activity of Arf6 can be suppressed, it is considered that the tumor growth can be suppressed.

SEQ ID NO: 5: Synthetic DNA
SEQ ID NO: 6: Synthetic DNA
SEQ ID NO: 7: Synthetic DNA
SEQ ID NO: 8: Synthetic DNA
SEQ ID NO: 9: Synthetic DNA
SEQ ID NO: 10: synthetic DNA
SEQ ID NO: 11: synthetic DNA
SEQ ID NO: 12: synthetic DNA
SEQ ID NO: 13: Synthetic DNA

Claims (14)

  A non-human mammal that has lost the function of the Arf6 gene.   2. The non-human mammal according to claim 1, wherein the function of the Arf6 gene is lost in at least one allele on the chromosome.   3. The non-human mammal according to claim 2, which is a transgenic animal having a Cre gene controlled by a promoter of a gene specifically expressed in vascular endothelial cells.   4. The non-human mammal according to claim 3, wherein the promoter of a gene specifically expressed in the vascular endothelial cell is a Tie2 gene promoter.   The non-human mammal according to any one of claims 1 to 4, which is a rodent animal.   A pharmaceutical composition for treating a tumor, comprising an Arf6 inhibitor as an active ingredient.   7. The pharmaceutical composition according to claim 6, wherein the tumor expresses Arf6.   The pharmaceutical composition according to claim 6, wherein the tumor is breast cancer. The pharmaceutical composition according to any one of claims 6 to 8, wherein the Arf6 inhibitor is selected from the following (a) or (b).
(A) Inhibitor of signal transduction via ARF6 protein in tumor cells (b) Inhibitor of Arf6 gene expression A method for examining tumor responsiveness to an angiogenesis inhibitor, comprising the following steps.
(A) a step of transplanting a tumor cell or tumor tissue into the non-human mammal according to any one of claims 1 to 5; and (b) a step of measuring a growth rate of the transplanted tumor cell or tumor tissue.   11. The method according to claim 10, wherein the angiogenesis inhibitor is an Arf6 inhibitor or an HGF inhibitor. A screening method for an antitumor proliferating agent administered in combination with an angiogenesis inhibitor, comprising the following steps. (A) a step of transplanting a tumor cell or tumor tissue to the non-human mammal according to any one of claims 1 to 5; (b) a step of administering a candidate drug to the animal; (c) the transplanted tumor cell; Or measuring the growth rate of tumor tissue   13. The method according to claim 12, wherein the angiogenesis inhibitor is an Arf6 inhibitor or an HGF inhibitor.   A screening method for a therapeutic agent for an Arf6-related disease, comprising a step of administering a candidate drug to the Arf6 gene-deficient animal according to any one of claims 1 to 5.