JP2011167079A - Luciferase derived from firefly - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a luciferase showing higher emission intensity compared with that of a conventional firefly luciferase. <P>SOLUTION: There are disclosed a luciferase derived from Pyrocoelia matsumurai, a luciferase in which maximum emission wavelength at pH 8 is 560 nm, and a luciferase having 24.4 times or more emission intensity than that produced by rhodamine 6G. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a firefly-derived luciferase. More specifically, the present invention relates to a luminescent luciferase that emits light with high brightness and a variant thereof cloned from a firefly of the order Arthropoda, Coleoptera, and a luciferase gene that is expressed in a cell, and the luminescence thereof is obtained. The present invention relates to a method for measuring the function of a cell by detecting the above by imaging.

  In order to measure cellular functions such as intracellular signal transduction and gene expression, fluorescent probes such as fluorescent dyes and fluorescent proteins, and luminescent probes using luciferin-luciferase reaction are used. In particular, analysis of gene expression regulation uses luminescence measurement with excellent quantitativeness, which does not cause cell damage due to excitation light and does not cause a problem of self-luminescence. For example, when observing a cell into which a luciferase gene has been introduced, the intensity of luciferase gene expression (specifically, the expression level) can be examined by measuring the amount of light emitted from the cell due to luciferase activity. . The amount of luminescence is measured by first lysing cells to prepare a cell lysate, then adding luciferin, ATP, etc. to the cell lysate and quantifying with a luminometer using a photomultiplier tube. Is called. That is, the amount of luminescence is measured after lysing cells. For this reason, the expression level of the luciferase gene at a certain time point is measured as an average value of the whole cell. As a method for introducing a luminescent gene such as a luciferase gene as a reporter gene, for example, a calcium phosphate method, a lipofectin method, an electroporation method, or the like can be used, and each method is properly used depending on the purpose and the type of cell. By connecting the target DNA fragment upstream or downstream of the luciferase gene to be introduced into the cell and analyzing the expression level of the luciferase, it becomes possible to examine the influence of the DNA fragment on the transcription of the luciferase gene. In addition, by co-expressing a luciferase gene to be introduced into a cell and a target gene, it becomes possible to examine the influence of the gene product on the expression of the luciferase gene.

  In order to analyze the expression level of a luminescent gene over time, it is necessary to measure the amount of luminescence from living cells over time. Such measurement is performed by culturing cells in an incubator equipped with a luminometer and quantifying the amount of luminescence from the whole cell population at regular intervals. Thereby, the expression rhythm etc. with fixed periodicity can be analyzed, and the change with time of the expression level of the luminescent gene in the whole cell can be caught.

  In recent years, in biological and medical research, there is an increasing need for time-dependent observation of dynamic changes using images of living samples. In the research field using fluorescence observation, time lapse or moving image imaging is performed in order to dynamically grasp protein molecule functions in a sample. In the prior art, temporal observation using a fluorescent sample (for example, moving image observation of one protein molecule with a fluorescent molecule attached) is performed.

  On the other hand, when a luminescent sample is used for observation over time, the luminescence intensity of the luminescent sample is extremely small, and it is necessary to observe using a CCD camera equipped with an image intensifier. Recently, a microscope having an optical system for observing a luminescent sample has also been developed (Patent Documents 1 and 2).

  When a luminescent sample with low emission intensity is imaged with a microscope, the exposure time required to capture a clear image becomes long. Such luminescent samples limit the research applications that can be used. For example, if exposure time of 30 minutes is required due to low light emission intensity, even if shooting over time at 30-minute intervals is possible, shooting at shorter intervals or even real-time shooting Impossible. Further, when acquiring an image, it is necessary to acquire and compare a plurality of images in order to focus on the luminescent cells, but when a long exposure time is required due to the low emission intensity, 1 It takes time and effort to acquire only one image.

JP 2006-301599 A International Publication No. 06/088109

  An object of the present invention is to provide a luciferase that exhibits high luminescence intensity compared to conventional firefly luciferases.

  The luciferase of the present invention is characterized in that it is derived from Pyrocoelia matsumurai.

  The luciferase of the present invention is characterized in that the maximum emission wavelength at pH 8 is 560 nm.

  Furthermore, the luciferase of the present invention is characterized by exhibiting a light emission intensity of 24.4 times or more of the light emission intensity of rhodamine 6G.

  According to the present invention, a luciferase having a higher luminescence intensity than that of a conventional firefly luciferase is provided, so that the exposure time required for capturing a luminescent image can be shortened, and the time resolution can be improved as compared with the prior art. Can be observed over time.

It is an emission spectrum in each pH of Okinawa Madokaru Luciferase. It is the figure which plotted Km value of each luciferase. Okinawad firefly luciferase, P. aeruginosa It is a figure which compares the luminescence intensity of a pyralis luciferase and rhodamine 6G. Okinawad firefly luciferase expressed in mammalian cells and P. aeruginosa It is a figure which compares the luminescence intensity of a pyralis luciferase.

  The present invention relates to a luciferase derived from Pyrocoelia matsumurai.

  “Luciferase” generally refers to an enzyme that catalyzes a chemical reaction in which luminescence occurs. A substance that is a substrate for the enzyme is called luciferin. Luminescence occurs when luciferin undergoes a chemical change by the catalytic action of luciferase in the presence of ATP. Currently, luciferases derived from fireflies and bacteria are obtained. The luciferase according to the present invention is also synonymous with the luciferase defined as described above, but is a novel luciferase obtained for the first time from fireflies described later.

  The luciferase according to the present invention is derived from Pyrocoelia matsumurai. The Okinawan firefly is a firefly that belongs to the genus Madbotal of the family Arthropoda elegans Coleoptera. In the context of the present invention, the Okinawan firefly refers in particular to the subspecies Pyrocoelia matsumurai matsumurai that mainly inhabits the main island of Okinawa. Here, “derived from” means that, in addition to wild-type luciferase possessed by Okinawan firefly, a mutant thereof is also included.

  The luciferase according to the present invention has a remarkably high luminescence intensity compared to known luciferases. Therefore, the luciferase according to the present invention has a particularly advantageous effect when used as a reporter for protein imaging. That is, since the luciferase according to the present invention can provide a high amount of luminescence even in a small amount, a protein with a low expression level can be detected well. Further, the luciferase according to the present invention can shorten the exposure time required for detection due to its high emission intensity. For this reason, if the luciferase according to the present invention is used as a reporter for observation over time, the imaging interval can be shortened, and observation near real time becomes possible.

  An example of a luciferase according to the present invention is a luciferase comprising the amino acid sequence shown in SEQ ID NO: 1. The luciferase is obtained from Okinawa Madokata. In the present application, the luciferase is referred to as Okinawa Madoka luciferase or Okinawa Madoka luciferase.

  FIG. 1 shows an emission spectrum of luciferase according to the present invention. As shown in this figure, the maximum emission wavelength at pH 8 of the luciferase according to the present invention is around 560 nm.

  Further, FIG. 3 shows a graph comparing the light emission intensity of Okinawa firefly luciferase with the light emission intensity of other luminescent substances. From this figure, it can be seen that Okinawa firefly luciferase exhibits a light emission intensity that is 24.4 times or more that of Rhodamine 6G. This emission intensity is obtained by accumulating light having a wavelength of 300 nm to 650 nm for 10 seconds. Thus, the luciferase according to the present invention has a higher luminescence intensity than known luminescent substances and conventional firefly luciferases. The luciferase according to the present invention preferably has a light emission intensity of 5 times or more, 10 times or more, 15 times or more, 20 times or more, 21 times or more, 22 times or more, 23 times or more or 24 times or more the light emission intensity by rhodamine 6G. Show.

  The luciferase according to the present invention includes not only a wild-type luciferase obtained from Okinawa butterfly but also a mutant luciferase in which a part of the amino acid sequence of the wild-type luciferase is mutated. Such a mutation may be a mutation that improves the enzymatic activity of luciferase. Such a mutation may be a mutation that improves the experimental operability of the luciferase. For example, when wild-type luciferase exhibits low solubility in mammalian cells, the mutant luciferase according to the present invention may be a luciferase into which a mutation that increases its solubility is introduced. Here, the mutant luciferase means that the amino acid sequence of the luciferase is mutated, for example, amino acid substitution, deletion, and / or the like, as long as the characteristics of the luciferase according to the present invention, that is, high luminescence intensity as compared with the conventional luciferase. Alternatively, it may be a luciferase in which addition or the like has occurred. This mutation is a mutation of one or more amino acids of the amino acid sequence of wild-type luciferase, preferably a mutation of 1 to 20 amino acids of the amino acid sequence of wild-type luciferase, a mutation of 1 to 15 amino acids, 1 to 10 Or 1 to 5 amino acid mutations. Preferably, the amino acid sequence of the mutant luciferase is 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more with respect to the amino acid sequence of the wild-type luciferase, It has 98% or more or 99% or more homology.

  The present invention relates to a nucleic acid comprising a base sequence encoding the luciferase according to the present invention. That is, the nucleic acid is a nucleic acid containing a luciferase gene derived from Okinawa firefly. In the present invention, the nucleic acid refers to, for example, DNA or RNA. In the present invention, the “gene” of luciferase mainly means a region transcribed into mRNA, that is, a structural gene.

  An example of a nucleic acid containing a base sequence encoding luciferase according to the present invention is a nucleic acid containing the base sequence shown in SEQ ID NO: 2. A gene having this sequence has been cloned from Okinawan firefly and encodes wild-type Okinawan firefly luciferase.

  The nucleic acid according to the present invention may be a nucleic acid containing a base sequence of a wild-type luciferase gene or a nucleic acid containing a base sequence of a mutant luciferase gene in which a mutation has occurred. Here, the mutant luciferase gene means that the encoded luciferase exhibits a characteristic of the luciferase according to the present invention, that is, a specific base in the nucleotide sequence, for example, a number, as long as the luciferase exhibits high luminescence intensity compared to the conventional luciferase The gene may have undergone single base substitution, deletion, and / or addition. Moreover, the variation | mutation which a change does not produce in the encoded amino acid sequence is contained in the variation | mutation of a base sequence. That is, the nucleic acid according to the present invention includes a nucleic acid containing a mutant luciferase gene encoding a wild type luciferase.

  An example of such a mutation that does not change the encoded amino acid sequence is a mutation that invalidates the recognition sequence of a specific restriction enzyme present in the gene. Although this mutation prevents the nucleic acid containing the gene from being cleaved by the restriction enzyme, the gene can encode a protein having the same amino acid sequence as before the mutation. Such mutation can be achieved by converting the codons constituting the recognition sequence of the restriction enzyme into synonymous codons of different base sequences. Such a mutation is useful when a restriction enzyme recognition sequence used for gene recombination is present in the gene. In this case, by invalidating the recognition sequence in the gene in advance, the nucleic acid containing the gene can be prevented from being fragmented when treated with a restriction enzyme, and as a result, recombination is facilitated. An example in which the recognition sequence of a specific restriction enzyme is invalidated is the base sequence shown in SEQ ID NO: 3. The base sequence is obtained by invalidating the recognition sequence of BamHI and EcoRI from the base sequence of the Okinawad firefly luciferase gene.

  Another example of a mutation that does not change the encoded amino acid sequence is a mutation that optimizes the codons of the gene for expression in a particular species. The term “optimization” as used herein means that a codon of a gene contained in a nucleic acid is replaced with a codon having a high codon appearance frequency in a specific biological species. When optimization is performed, gene expression in a specific species is increased compared to when optimization is not performed. Since the luciferase gene according to the present invention is obtained from a firefly, it is considered that the optimization effect is higher as the species to which the gene is introduced is taxonomically far from the firefly. In the present invention, specific biological species are, for example, bacterial cells, yeast cells and mammalian cells. Furthermore, mammalian cells are, for example, mouse cells, monkey cells and human cells.

  An example of a nucleic acid containing a base sequence encoding a luciferase with optimized codons according to the present invention is a nucleic acid containing the base sequence shown in SEQ ID NO: 4. The nucleic acid has the BamHI and EcoRI recognition sequences disabled and codon optimized for expression in mammalian cells.

  The nucleic acid according to the present invention includes a nucleic acid containing a base sequence of a luciferase gene to which a Kozak sequence is added. The Kozak sequence is a sequence composed of a start codon and a plurality of base sequences before and after the start codon. It is known that the presence of the Kozak sequence increases the expression level of the gene. In the Kozak sequence, a common sequence is found for each species or group of organisms. The nucleic acid containing the Kozak sequence according to the present invention has a Kozak sequence corresponding to the species into which it is introduced. For example, when introduced into a mammalian cell, the nucleic acid comprises the sequence of gccrccatgg (SEQ ID NO: 5) (r means guanine or adenine) as a Kozak sequence. The luciferase gene that imparts the Kozak sequence may be a wild-type gene, or may be a mutant gene that has been subjected to codon optimization as described above.

The present invention includes vectors containing these nucleic acids. In addition to the nucleic acid encoding luciferase, the vector may include a nucleic acid containing a sequence for regulating expression or a marker gene sequence.
The present invention also includes a luminescent probe. The luminescent probe may contain wild-type luciferase or may contain mutant luciferase. In particular, those modified by a known technique and suitable for use as a luminescent probe are preferred. Furthermore, the present invention can be effectively applied to various uses (imaging, photometry, etc.) related to various samples (in vivo, in vitro) using the luminescent probe.

  The present invention relates to a method for analyzing intracellular functions using the luciferase according to the present invention. The method includes a step of introducing the luciferase according to the present invention into a cell, and a step of detecting luminescence of the luciferase by an imaging device. For example, the function of the expression control region can be examined by introducing the luciferase gene according to the present invention downstream of a specific expression control region in DNA and detecting the expression of luciferase by the presence or absence of luminescence. is there.

  The present invention relates to a method for analyzing intracellular proteins using the luciferase according to the present invention. The method includes a step of introducing a fusion protein comprising a luciferase according to the present invention and a protein to be analyzed into a cell; and a step of detecting luminescence of the luciferase with an imaging device.

  This method includes observation of intracellular localization of a protein to be analyzed, and observation of temporal change in the localization (time lapse). The method also includes not only localization of the protein, but also confirmation of whether or not the protein is expressed. The cell used is not particularly limited, and may be a cell that can be usually used in the field of cell imaging. The protein to be analyzed is not particularly limited, and a protein can be selected according to the purpose of research. The protein may be a protein that is naturally present in the cell used or may be a heterologous or modified protein that is not inherently present in the cell.

  When the fusion protein is introduced into the cell, a known introduction method can be used. One method is to introduce a fusion protein purified outside the cell directly into the cell. For example, the fusion protein can be directly injected into the cell by the microinjection method. Alternatively, cells can be incubated in a culture solution containing the fusion protein, and the fusion protein can be taken into the cell by endocytosis. Another method is a method in which a nucleic acid containing a base sequence encoding a fusion protein is first introduced, and then the fusion protein is expressed in cells. For example, an expression vector containing the nucleic acid can be introduced into cells by the calcium phosphate method, lipofection method, electroporation method or the like, and the fusion protein can be expressed from the expression vector. Here, the gene of the fusion protein is a gene containing the luciferase gene according to the present invention and the gene of the protein to be analyzed, wherein the luciferase gene and the protein gene are linked so as to be normally translated. Has been.

A known detection method can be used for the step of detecting luminescence of luciferase with an imaging device. For example, luciferin, ATP, Mg ²⁺ ions, and the like are appropriately given to cells expressing a fusion protein containing luciferase to cause a luminescence reaction by luciferase, and the generated luminescence can be detected by an imaging device. An imaging apparatus is a microscope provided with a filter for capturing light emission, for example. By using a microscope, it is possible to specify the position of luminescence in the cell and specify the localization of the protein based on this information. In addition, a microscope having a function capable of imaging over time can be used as the imaging apparatus, and observation over time is also possible with this microscope.

[Example 1: Cloning of luciferase gene derived from Okinawan firefly]
1. Materials The larvae of Okinawad firefly (Pyrocoelia matsumurai) collected on the Okinawa main island of Okinawa were used as materials.

2. Extraction of Total RNA and Synthesis of cDNA A light emitter was cut out from firefly larvae using scissors. The collected light emitter and 1 mL of total RNA extraction reagent TRIzol Reagent (Invitrogen) were placed in a Lysing Matrix D tube (MP-Biomedicals), which is a tube containing beads for tissue and cell homogenization. This tube was attached to a tissue cell disruption device FastPrep 24 (MP-Biomedicals) or FastPrep FP100A (MP-Biomedicals), and a firefly light emitter was used as a reagent under conditions of a vibration speed of 6.5 m / s and a vibration time of 45 seconds. It was crushed inside. After completion, the tube was removed from the crusher and placed on ice for 30 minutes. Thereafter, crushing was performed again under the same conditions.

  Next, according to the instructions of the total RNA extraction reagent TRIzol Reagent, the total RNA was separated and purified from the disrupted solution. 100 μl of the obtained mRNA solution was concentrated by precipitation by ethanol precipitation. Next, a full-length cDNA was synthesized from the precipitated and concentrated total RNA using a full-length cDNA synthesis reagent GeneRacer (Invitrogen) according to the manual. 20 μl of the obtained cDNA solution was used as a firefly full-length cDNA library for the following gene experiments.

3. 3. Identification of 5 ′ terminal side of firefly luciferase gene 3-1. Preparation of Primer for RACE (Rapid Amplification of cDNA End) Method The luciferase gene of Okinawan firefly was cloned by PCR (Polymerase chain reaction) method. Primers used for this PCR were prepared as follows based on the amino acid sequence of a luciferase gene derived from a known related organism.

  In order to confirm amino acid regions that are well conserved in firefly luciferase, the amino acid sequences of 10 types of firefly luciferases that have already been released were compared using sequence information analysis software DNASIS Pro (Hitachi Software Engineering Co., Ltd.). The relative organisms used in the comparison were Rampyris noctiluca (registration number CAA61668), Luciola cruciata (registration number P13129), Luciola latero15 (Luciola laQal01)・ Mingrelica (registration number Q26304), Hotaria parvula (registration number AAC37253), Photinus pyralis (registration number BAF48390), Photouris pennsylva tyll vs. Q27757), Piroko area Miyako ( yrocoelia miyako) (registration number AAC37254), it is a Piroko area Alpha (Pyrocoelia rufa) (registration number AAG45439) and Rahagofutarumusu-Obai (Rhagophthalmus ohbai) (registration number BAF34360).

  As a result, it was found that the amino acid sequence of LI-KY-K-G-Q-V (SEQ ID NO: 6) located near the C-terminal 440 residues of firefly luciferase is well conserved. It was. A nucleotide sequence was predicted from codons encoding these nine amino acid sequences, and 12 kinds of firefly luciferase-specific mixed primers used for 5 'terminal RACE PCR were designed. The name and sequence of this primer are as follows (Y, R and N in the primer sequence indicate mixed bases): flexLuc5-ATA (5′-ACY TGR TAN CCY TTA TAT TTA AT-3 ′: SEQ ID NO: 7), flexLuc5-ATG (5′-ACY TGR TAN CCY TTA TAT TTG AT-3 ′: SEQ ID NO: 8), flexLuc5-ATT (5′-ACY TGR TAN CCY TTA TAT TTT AT-3 ′: SEQ ID NO: 9) , FlexLuc5-ACA (5'-ACY TGR TAN CCY TTA TAC TTA AT-3 ': SEQ ID NO: 10), flexLuc5-ACG (5'-ACY TGR TAN CCY TTA TAC TTG AT-3': SEQ ID NO: 11), flexLuc 5-ACT (5′-ACY TGR TAN CCY TTA TAC TTT AT-3 ′: SEQ ID NO: 12), flexLuc5-GTA (5′-ACY TGR TAN CCY TTG TAT TTA AT-3 ′: SEQ ID NO: 13), flexLuc5- GTG (5′-ACY TGR TAN CCY TTG TAT TTG AT-3 ′: SEQ ID NO: 14), flexLuc5-GTT (5′-ACY TGR TAN CCY TTG TAT TTT AT-3 ′: SEQ ID NO: 15), flexLuc5-G 5′-ACY TGR TAN CCY TTG TAC TTA AT-3 ′: SEQ ID NO: 16), flexLuc5-GCG (5′-ACY TGR TAN CCY TTG TAC TTG AT-3 ′: SEQ ID NO: 17), flexLu 5-GCT (5'-ACY TGR TAN CCY TTG TAC TTT AT-3 ': SEQ ID NO: 18). The synthesis of these primers was outsourced to Life Technologies Japan.

3-2.5′-RACE PCR cloning of the 5 ′ end of the firefly luciferase gene Using the firefly full-length cDNA library prepared as described above as a template, 12 kinds of specific mixed primers prepared as described above and GeneRacer 5 ′ Primer (5′-CGA CTG GAG CAC GAG GAC ACT GA-3 ′: SEQ ID NO: 19) and GeneRacer 5 ′ Nested Primer (5′-GGA CAC TGA CAT GGA CTG AAG GAG TA 3 ′: 5′-RACE PCR was performed using SEQ ID NO: 20). The GeneRacer 5 ′ Primer and the GeneRacer 5 ′ Nested Primer included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen) were used. In order to efficiently amplify the luciferase gene by 5′-RACE PCR, nested PCR was carried out in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed using polymerase Ex-Taq (Takara Bio Inc.) according to the manual.

  As the first PCR, the luciferase gene was amplified using 12 kinds of primer pairs consisting of any of the 12 kinds of specific mixed primers prepared as described above and GeneRacer 5 'Primer. Final concentration is 10 × Ex Taq Buffer (20 mM Mg2 + plus), final concentration is 0.2 mM dNTP Mixture (each 2.5 mM), final concentration is 0.05 U / μl TaKaRa Ex Taq (5 U / μl) A 10 μl PCR reaction solution containing one of 12 primers with a final concentration of 1.0 μM and GeneRacer 3 ′ Primer with a final concentration of 0.3 μM was prepared, and 0.2 μl of a firefly full-length cDNA library solution was added thereto. added. The concentration of the firefly full-length cDNA library solution was not quantified. In the PCR reaction, heat denaturation at 94 ° C. for 2 minutes was first performed, and then 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 90 seconds were repeated for 30 cycles. After the PCR reaction, 1 μl of the PCR reaction solution was electrophoresed using a 1% Tris acetate buffer (TAE) agarose gel, and after ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in all 12 reaction solutions, nested PCR reactions were performed as follows using these PCR reaction solutions as templates.

As nested PCR, the luciferase gene was amplified using 4 types of primer pairs consisting of 4 out of 12 kinds of primers used in the first PCR and GeneRacer 3 ′ Nested Primer. Final concentration is 10 × Ex Taq Buffer (20 mM Mg ²⁺ plus), final concentration is 0.2 mM each dNTP Mixture (2.5 mM each), final concentration is 0.005 U / μl TaKaRa Ex Taq (5 U / μl), 10 μl of a PCR reaction solution containing one of 12 kinds of primers with a final concentration of 1.0 μM and GeneRacer 3 ′ Primer with a final concentration of 0.3 μM was prepared, and the first PCR reaction solution was used as a template there. 1.0 μl of a solution diluted 10-fold with sterilized water was added. In the PCR reaction, heat denaturation at 94 ° C. for 2 minutes was first performed, and then 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 90 seconds were repeated for 30 cycles, and finally an extension reaction at 72 ° C. for 5 minutes was performed. After the PCR reaction, 1 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation. The combination conditions of primers that efficiently amplified the gene in the vicinity of about 1.4 kbp were confirmed.

Determination of the base sequence of the gene amplified by 3-3.5′-RACE In order to read the base sequence of the gene amplified by 5′-RACE, the PCR product was purified by gel extraction, subcloning and direct sequencing. Details are shown below.

PCR (final volume 20 μl) was performed with a combination of primers that efficiently amplified the gene in the vicinity of about 1.4 kbp, and the target gene fragment was recovered using a gel extraction technique. Gel extraction was performed according to the manual using Wizard SV Gel and PCR Clean-Up System (Promega Corporation). Subcloning of the PCR product extracted from the gel was performed using the TA cloning technique. TA cloning was performed using pGEM-T Easy Vector System (Promega Corporation) according to the manual. Thereafter, this vector DNA was transformed into E. coli (TOP10 strain or DH5α strain), and insert positive colonies were selected using a blue / white screening technique. The selected colony was subjected to direct colony PCR to confirm that the gene was introduced. For direct colony PCR, M13-F (−29) Primer (5′-CAC GAC GTT GTA AAA CGA C-3 ′: SEQ ID NO: 21) and M13 Reverse (5′-GGA TAA CAA TTT CAC AGG-3 ′: A primer pair consisting of SEQ ID NO: 22) was used. Final concentration of 10 × Ex Taq Buffer (20 mM Mg ²⁺ plus), final concentration of 0.2 mM each dNTP Mixture (2.5 mM each), final concentration 0.05 U / μl TaKaRa Ex Taq (5 U / μl), a 10 μl PCR reaction solution containing a primer pair each having a final concentration of 0.2 μM was prepared, and a small amount of E. coli colony was added thereto as a template. The PCR reaction was first heat-denatured at 94 ° C. for 1 minute, then repeated 25 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 2 minutes, and finally an extension reaction at 72 ° C. for 2 minutes. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation.

  For the PCR reaction solution in which amplification was confirmed, the base sequence of the gene was determined using the direct sequencing method. Excess dNTPs and primers contained in the PCR reaction solution were removed using a PCR product purification kit ExoSAP-IT (GE Healthcare Bioscience) to prepare a template for PCR direct sequencing. Using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), a sequencing reaction solution containing this template was prepared, and a sequencing reaction was performed using a thermal cycler. PCR product purification and sequencing were performed according to the respective manuals. After the sequencing reaction, the reaction product was purified as follows. 2.5 times volume of 100% ethanol was added to the reaction solution, and nucleic acid was precipitated using a centrifuge. Next, after removing the supernatant, 70% ethanol was added to wash the precipitate, and the nucleic acid was precipitated using a centrifuge. Finally, after removing the upper fine, the precipitate was dried. To the purified precipitate, 15 μl of Hi-Di Formatide (Applied Biosystems) was added and dissolved. This solution was heat-denatured at 94 ° C. for 2 minutes and further rapidly cooled on ice to prepare a sample for determining the base sequence. The base sequence of this sample was read using an Applied Biosystems 3130xl genetic analyzer (Applied Biosystems). The base sequence analysis method was performed according to the manual.

  The gene sequence obtained by sequencing was analyzed using the “sequence ligation” function of the sequence information analysis software DNASIS Pro. This sequence was subjected to homology search using a blastx search provided by National Center for Biotechnology Information (hereinafter abbreviated as NCBI), and confirmed to show high homology with the base sequence of known firefly luciferase. The base sequence obtained by the above experiment and analysis was determined to be on the 5 'end side of the novel firefly luciferase gene.

4). Obtaining 3 'Race PCR and full-length cDNA of firefly luciferase gene 4-1.3' Design of primers used for 'Race PCR' Sequence of 5 'terminal untranslated region of firefly luciferase gene obtained in 5' Race PCR experiment Based on the above, a primer used for 3′RACE and a primer used for Nested PCR were prepared. Primer synthesis was outsourced to Life Technologies Japan.

4-2. 3 'Race PCR for obtaining full-length cDNA of firefly luciferase gene
Primer No6 (2/3) -Full-F1 (GACACTAACGCGCTAACATCATTGCAAGA: sequence) prepared from the base sequence of the 5′-terminal untranslated region of the target firefly luciferase using the firefly full-length cDNA library prepared as described above as a template No. 23) and GeneRacer 3 ′ Primer (5′-GCT GTC AAC GAT ACG CTA CGT AAC G-3 ′: SEQ ID NO: 24) and GeneRacer 3 ′ Nested Primer (5′-CGC TAC GTA ACG GCA-3 TGA CAG No. 25) was used to perform 3′-RACE PCR. GeneRacer 3 ′ Primer and GeneRacer 3 ′ Nested Primer used were those included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen). In order to efficiently amplify the luciferase gene by 3′-RACE PCR, a nested PCR was carried out in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed using polymerase Ex-Taq (Takara Bio Inc.) according to the manual.

As the first PCR, the luciferase gene was amplified using a primer pair consisting of a primer prepared from the base sequence of the 5 ′ end side untranslated region and GeneRacer 3 ′ Primer. Final concentration of 10 × Ex Taq Buffer (20 mM Mg ²⁺ plus), final concentration of 0.2 mM each dNTP Mixture (2.5 mM each), final concentration 0.05 U / μl TaKaRa Ex Taq (5 U / μl) and 20 μl of a PCR reaction solution containing primers each having a final concentration of 0.3 μM were prepared, and 0.4 μl of a firefly full-length cDNA library solution was added thereto. The concentration of the firefly full-length cDNA library solution was not quantified. The PCR reaction was first heat-denatured at 94 ° C. for 2 minutes, then repeated 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 2 minutes, and finally an extension reaction at 72 ° C. for 5 minutes. After the PCR reaction, 1 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed, nested PCR reactions were performed using this PCR reaction solution as a template.

As the nested PCR, a luciferase gene was amplified using a primer pair consisting of primer No. 6 (2/3) -Full-F2 (CGCGCTAATACATCATGCAAGAATGGGAAGA: SEQ ID NO: 26) and GeneRacer 3 ′ Nested Primer for Nested PCR. Final concentration of 10 × Ex Taq Buffer (20 mM Mg ²⁺ plus), final concentration of 0.2 mM each dNTP Mixture (2.5 mM each), final concentration 0.05 U / μl TaKaRa Ex Taq (5 U / μl) and 20 μl of a nested PCR reaction solution containing primers each having a final concentration of 0.3 μM were prepared, and 1.0 μl of a solution obtained by diluting the first PCR reaction solution 10-fold with sterile water was added thereto as a template. The PCR reaction was first heat-denatured at 94 ° C. for 2 minutes, then repeated 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 2 minutes, and finally an extension reaction at 72 ° C. for 5 minutes. After the PCR reaction, 1 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation. It was confirmed that the gene was efficiently amplified in the vicinity of about 2 kbp.

Determination of the base sequence of the gene amplified with 4-3.3′-Race In order to read the base sequence of the gene amplified with 3′-RACE, purification of the PCR product by gel extraction, subcloning and direct sequencing were performed. Details are shown below.

PCR (final volume 20 μl) was performed with a combination of primers in which the gene was efficiently amplified in the vicinity of about 2 kbp, and the target gene fragment was recovered using a gel extraction technique. Gel extraction was performed according to the manual using Wizard SV Gel and PCR Clean-Up System (Promega Corporation). Subcloning of the PCR product extracted from the gel was performed using the TA cloning technique. TA cloning was performed using pGEM-T Easy Vector System (Promega Corporation) according to the manual. Thereafter, this vector DNA was transformed into E. coli (TOP10 strain or DH5α strain), and insert positive colonies were selected using a blue / white screening technique. The selected colony was subjected to direct colony PCR to confirm that the gene was introduced. For direct colony PCR, M13-F (−29) Primer (5′-CAC GAC GTT GTA AAA CGA C-3 ′: SEQ ID NO: 21) and M13 Reverse (5′-GGA TAA CAA TTT CAC AGG-3 ′: A primer pair consisting of SEQ ID NO: 22) was used. Final concentration of 10 × Ex Taq Buffer (20 mM Mg ²⁺ plus), final concentration of 0.2 mM each dNTP Mixture (2.5 mM each), final concentration 0.05 U / μl TaKaRa Ex Taq (5 U / μl), a 10 μl PCR reaction solution containing a primer pair each having a final concentration of 0.2 μM was prepared, and a small amount of E. coli colony was added thereto as a template. The PCR reaction was first heat-denatured at 94 ° C. for 1 minute, then repeated 25 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 2 minutes, and finally an extension reaction at 72 ° C. for 2 minutes. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation.

  For the PCR reaction solution in which amplification was confirmed, the base sequence of the gene was determined using the direct sequencing method. Excess dNTPs and primers contained in the PCR reaction solution were removed using a PCR product purification kit ExoSAP-IT (GE Healthcare Bioscience) to prepare a template for PCR direct sequencing. Using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), a sequencing reaction solution containing this template was prepared, and a sequencing reaction was performed using a thermal cycler. Primers used for sequencing were vector primers or gene-specific primers. PCR product purification and sequencing were performed according to the respective manuals. After the sequencing reaction, the reaction product was purified as follows. 2.5 times volume of 100% ethanol was added to the reaction solution, and nucleic acid was precipitated using a centrifuge. Next, after removing the supernatant, 70% ethanol was added to wash the precipitate, and the nucleic acid was precipitated using a centrifuge. Finally, after removing the upper fine, the precipitate was dried. To the purified precipitate, 15 μl of Hi-Di Formatide (Applied Biosystems) was added and dissolved. This solution was heat-denatured at 94 ° C. for 2 minutes and further rapidly cooled on ice to prepare a sample for determining the base sequence. The base sequence of this sample was read using an Applied Biosystems 3130xl genetic analyzer (Applied Biosystems). The base sequence analysis method was performed according to the manual.

  The full-length firefly luciferase gene was obtained by sequencing. The sequence translated into this base sequence (SEQ ID NO: 2) or amino acid (SEQ ID NO: 1) was subjected to homology search using blastx or blastp search provided by NCBI. Each search confirmed high homology with the base sequence of known firefly luciferase. The base sequence obtained by the above experiment and analysis was determined to be the full-length cDNA sequence of the novel firefly luciferase gene.

  Hereinafter, this novel luciferase will be referred to as Okinawa Madokaru Luciferase.

[Example 2: Determination of enzymatic parameters of novel luciferase]
1. Protein expression of a novel firefly luciferase gene The firefly luciferase gene was introduced into a pRSET-B vector (Invitrogen) for protein expression in E. coli. The gene expression vector was constructed according to a standard method as follows.

1-1. Modification of restriction enzyme recognition site of novel firefly luciferase gene According to the base sequence determined as described above, the novel luciferase gene contains restriction enzyme recognition sequences of BamHI and EcoRI. While maintaining the amino acid sequence of luciferase, genetic modification was performed to remove these recognition sequences in these base sequences. This treatment was performed to facilitate the introduction of the luciferase gene described later into an expression vector. The introduction of gene mutation is shown in Taichi Yoshikazu's “Methods for Gene Function Inhibition—From Simple and Reliable Gene Function Analysis to Application to Gene Therapy” (Yodosha, 2001, p. 17-25) Followed the method. The sequence after mutagenesis is the base sequence shown in SEQ ID NO: 3.

1-2. Introduction of a novel firefly luciferase gene into a gene expression vector In order to introduce a luciferase gene between the restriction enzyme sites BamHI and EcoRI of the pRSET-B vector, a primer containing a start codon and a restriction enzyme BamHI recognition sequence GGATCC before it, and Primers containing the codon and the restriction enzyme EcoRI recognition sequence GAATTC behind it were prepared. Using this primer pair, a fragment containing the above-mentioned restriction enzyme recognition sites at both ends of the luciferase gene was amplified. PCR was performed using polymerase KOD-Plis- (Toyobo Co., Ltd.) according to the manual.

10 × PCR Buffer with final concentration of 1 ×, final concentration of 0.2 mM dNTP Mixture (2.5 mM each), final concentration of 1.0 mM MgSO ₄ , final concentration of 0.02 U / μl TOYOBO KOD− Prepare 20 μl of PCR reaction solution containing primer pair (1 U / μl) and final concentration of 0.3 μM respectively, and add 0.4 μl of luciferase gene solution without BamHI and EcoRI recognition sequence as template. It was. In the PCR reaction, after heat denaturation at 94 ° C. for 2 minutes, 94 cycles of 30 ° C., 55 ° C. for 30 seconds and 68 ° C. for 2 minutes were repeated 30 times, and finally, an extension reaction at 68 ° C. for 5 minutes was performed. After the PCR reaction, 1 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was confirmed, this PCR reaction solution was precipitated and concentrated by the usual ethanol precipitation method, 4 μl of 10 × H Buffer for restriction enzyme treatment, restriction enzyme BamHI (Toyobo Co., Ltd.) and restriction enzyme EcoRI (Toyobo Co., Ltd.) 2) each and 32 μl of sterilized deionized water were dissolved, and the mixture was incubated at 37 ° C. for 2 hours for restriction enzyme treatment. Then, this reaction solution was precipitated and concentrated by an ethanol precipitation method and then dissolved in sterilized deionized water. This solution was electrophoresed using 1% TAE agarose gel and stained with ethidium bromide. A gel containing a DNA band confirmed under ultraviolet irradiation was cut out using a knife. DNA was extracted from this excised gel using Wizard (R) SV Gel and PCR Clean-Up System (Promega). These operations were performed according to the manual. Thereafter, using Ligation Pack (Nippon Gene) according to the manual, the extracted DNA was introduced into the pRSET-B vector previously treated with the restriction enzymes BamHI and EcoRI by the same method. This vector DNA was transformed into Escherichia coli JM109 (DE3) strain to form colonies.

Direct colony PCR was performed using the obtained colony as a template to amplify the luciferase gene introduced into pRSET-B. Direct colony PCR was performed using T7 promoter Primer (5′-TAA TAC GAC TCA CTA TAG GG-3 ′: SEQ ID NO: 27) and T7 Reverse Primer (5′-CTA GTT ATT GCT CAG CGG TGG-3 ′: SEQ ID NO: 28). The primer pairs were used. Final concentration of 10 × Ex Taq Buffer (20 mM Mg ²⁺ plus), final concentration of 0.2 mM each dNTP Mixture (2.5 mM each), final concentration 0.05 U / μl TaKaRa Ex Taq (5 U / μl) and 10 μl of a PCR reaction solution containing primers each having a final concentration of 0.2 μM were prepared, and a small amount of E. coli colony was added thereto as a template. The PCR reaction was first heat-denatured at 94 ° C. for 2 minutes, followed by 25 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 2 minutes, and finally an extension reaction at 72 ° C. for 5 minutes. After the PCR reaction, 1 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel. After ethidium bromide staining, the amplified gene band was observed under ultraviolet irradiation.

  For the PCR reaction solution in which amplification was confirmed, the base sequence of the gene was determined using the direct sequencing method. Using PCR product purification kit ExoSAP-IT, excess dNTPs and primers contained in the PCR reaction solution were removed, and a template for PCR direct sequencing was prepared. Using BigDye Terminator v3.1 Cycle Sequencing Kit, a sequencing reaction solution containing this template was prepared, and a sequencing reaction was performed using a thermal cycler. For the sequencing, vector primers or gene-specific primers were used. PCR product purification and sequencing were performed according to the respective manuals. After the sequencing reaction, the reaction product was purified as follows. 2.5 times volume of 100% ethanol was added to the reaction solution, and nucleic acid was precipitated using a centrifuge. Next, after removing the supernatant, 70% ethanol was added to wash the precipitate, and the nucleic acid was precipitated using a centrifuge. Finally, after removing the upper fine, the precipitate was dried. To the purified precipitate, 15 μl of Hi-Di Formatide (Applied Biosystems) was added and dissolved. This solution was heat-denatured at 94 ° C. for 2 minutes and further rapidly cooled on ice to prepare a sample for determining the base sequence. The base sequence of this sample was read using an Applied Biosystems 3130xl genetic analyzer, and it was confirmed that the sample was normally introduced into the gene expression vector pRSET-B.

2. Purification of photoprotein 0.5 μl of luciferase expression vector was added to 50 μl of E. coli solution containing JM109 (DE3), and incubated on ice for 10 minutes, then at 42 ° C. for 1 minute, and finally on ice for 2 minutes. Thereafter, 50 μl of E. coli solution was added to 200 μl of SOC medium. The E. coli / SOC medium mixed solution was incubated at 37 ° C. for 20 minutes with shaking. 100 μl of the incubated sample was streaked on an LB medium plate (containing 100 μg / ml ampicillin) and incubated overnight at 37 ° C. The colonies obtained the next day were picked up and cultured in a 500 ml scale LB medium. The culture was performed at 37 ° C. for 24 hours and at 18 ° C. for 24 hours. After a total of 48 hours of culture, the cells were collected by centrifugation, resuspended in a 0.1 M Tris-HCl solution (pH 8.0), and sonicated. The cell disruption solution was centrifuged (15000 rpm, 10 minutes), the sediment was removed, and the supernatant was recovered. To a column with a bed volume of 2 ml, 500 μl of Ni-Agar suspension and 2 ml of 0.1 M Tris-HCl were added to equilibrate the column. The collected supernatant was added to the column and allowed to fall naturally. All operations until the entire amount of the supernatant passed through the column were performed at 4 ° C. The column was washed with 2 ml of 25 mM imidazole / 0.1 M Tris-HCl solution. 2 ml of 500 mM imidazole / 0.1 M Tris-HCl solution was added to the washed column to elute luciferase. The eluted sample was filtered through a gel filtration column PD-10 (GE Healthcare) and desalted. The desalted sample was ultrafiltered with Vivaspin 6 (Sartorius), and glycerin was added to the concentrated sample to obtain a 50% glycerin solution. Storage was performed at -20 ° C.

3. Measurement of emission spectrum LumiFl SpectroCapture (ATTO) was used as an apparatus for measurement, and 0.1 mM citric acid / 0.1 M Na ₂ HPO ₄ buffer (pH 6.0-8.0) was used with 1 mM D-luciferin, 2 mM ATP and 4 mM. The purified enzyme was added to the solution containing MgCl ₂ at a final concentration between 1 μg / ml and 10 μg / ml, and the emission spectrum was measured when 15 seconds had elapsed after the addition of the enzyme. The measurement results are shown in FIG.

  As shown in FIG. 1, the obtained luciferase has a maximum emission wavelength in the vicinity of 560 nm in an environment of pH 8.0. Further, it was around 563 nm at pH 7.5, around 571 nm at pH 7.0 (and a smaller peak near 610 nm), around 608 nm at pH 6.5, around 612 nm at pH 6.0, and around 613 nm at pH 5.5.

4). Kinetic analysis 4-1. Determination of D-luciferin and ATP concentrations The D-luciferin concentration in the D-luciferin solution and the ATP concentration in the ATP solution were determined as follows.

Using a UV-Visible Spectrometer (Hitachi), the UV-visible absorption spectra of the D-luciferin solution and the ATP solution were measured, and the concentration was calculated from the measurement results and the following ε values.
D-luciferin: λ _max 328 nm, ε18200, pH 5.0
ATP: λ _max 259 nm, ε 15400, pH 7.0.

  Each measurement was performed 10 times, and the average value of absorbance was used for concentration calculation. The following Km value calculation was performed using the D-luciferin solution and the ATP solution thus determined.

4-2. Measurement of Km value for D-luciferin The intensity of luminescence by the obtained luciferase was measured under various D-luciferin concentrations. Based on the measurement results, the Km value for D-luciferin was determined.

D-luciferin was added to 0.1 M Tris-HCl (pH 8.0) to make 12 types of D-luciferin solutions with different concentrations. These solutions contain D-luciferin so that the final concentration of D-luciferin is 0.625, 1.25, 2.5, 5, 10, 20, 40, 80, 160, 320, 480 and 640 μM, respectively. Including. 50 μl of each of these D-luciferin solutions was dispensed into a 96-well microplate. A 0.1 M Tris-HCl (pH 8.0) solution containing various purified luciferases, 4 mM ATP and 8 mM MgSO ₄ was connected to a standard pump of a luminometer, and 50 μl of the solution was added to the wells, and measurement was performed. Luminescence (ATTO) was used for the measurement. The measurement was performed three times for each luciferin concentration.

  The peak intensity of the photon count value obtained was plotted against the luciferin concentration S as the initial velocity V. This plot was subjected to Michaelis-Menten type curve fitting to calculate the Km value. Curve fitting was performed by a non-linear least square method, and Newton's method was used for parameter search.

4-3. Measurement of Km value for ATP The intensity of luminescence by the obtained luciferase was measured under various ATP concentration environments. Based on the measurement results, the Km value for ATP was determined.

ATP was added to 0.1 M Tris-HCl (pH 8.0) to prepare 12 types of ATP solutions with different concentrations. These solutions contain ATP such that the final concentrations of ATP are 5, 10, 20, 40, 80, 160, 320, 480, 640, 800, 1280, 1600 and 1920 μM, respectively. 50 μl of each ATP solution was dispensed into a 96-well microplate. A 0.1M Tris-HCl (pH 8.0) solution containing various purified luciferases, 1 mM D-luciferin, and 8 mM MgSO ₄ was connected to a standard pump of a luminometer, and 50 μl of the solution was added to the wells for measurement. The measurement was performed three times for each ATP concentration.

  The peak intensity of the obtained photon count value was plotted against the ATP concentration S as the initial velocity V. This plot was subjected to Michaelis-Menten type curve fitting to calculate the Km value. Curve fitting was performed by a non-linear least square method, and Newton's method was used for parameter search.

Table 1 shows the Km value for D-luciferin and the Km value for ATP determined as described above. Table 1 also shows the Km values of known luciferases measured in the same manner. GL3 is a known firefly-derived luciferase. ELuc, CBG, and CBR are luciferases derived from known beetles. These known luciferases were used commercially.

  Furthermore, about these results, the figure which plotted the vertical axis | shaft as Km value with respect to ATP and the horizontal axis | shaft as Km value with respect to D-luciferin is shown as FIG.

[Example 3: Measurement of emission intensity]
The luminescence intensity by Okinawa firefly luciferase was compared with the luminescence intensity by known luciferase and rhodamine 6G.

1. Measurement of chemiluminescence with rhodamine 6G Rhodamine 6G was dissolved in a 0.1 M citric acid / 0.2 M Na ₂ HPO ₄ (pH 4.0) solution. The rhodamine 6G solution was centrifuged at 15000 rpm for 1 minute, and the supernatant was recovered. The collected supernatant was diluted 1000 times with 0.1 M citric acid / 0.2 M Na ₂ HPO ₄ solution, and the absorbance of the diluted solution was measured. The measurement was performed with NanoVue (GE Healthcare). The measurement was performed 5 times at 530 nm, and an absorbance of 0.048 was obtained as an average value. As a result of calculating the concentration of the original rhodamine 6G solution using the ε value of rhodamine 6G (1.16 × 10 ⁵ mol ⁻¹ cm ⁻¹ ), it was 414 μM. This solution was diluted with 0.1 M citric acid / 0.2 M Na ₂ HPO ₄ solution (pH 4.0) to prepare a 30 μM diluted solution.

Using this diluted solution, Solution 1 was prepared as shown in Table 2 below.

  Also, bis (2,4,6-trichlorophenyl) oxalate (TCPO) was dissolved in acetonitrile to a final concentration of 3 mM to prepare Solution 2.

  100 μl of Solution 1 was dispensed into a 96-well microplate. Thereto, 50 μl of solution 2 was added using a pump, and measurement was started at the same time, and an integrated value of photon counts for 10 seconds from the addition of solution 2 was obtained. Luminescence (ATTO) was used for the measurement, and light having a wavelength of 300 nm to 650 nm was obtained. The same measurement was performed 10 times.

2. P. Measurement of chemiluminescence by pyralis luciferase and Okinawa botulifer luciferase 0.5 μl of a solution containing a luciferase expression vector is added to 50 μl of a solution containing JM109 (DE3) strain, and then 10 minutes on ice, 1 minute at 42 ° C., 2 minutes on ice Incubated. Thereafter, 50 μl of this E. coli solution was added to 200 μl of SOC medium. The E. coli / SOC medium mixed solution was incubated at 37 ° C. for 20 minutes with shaking. 100 μl of the incubated sample was streaked on an LB medium plate (containing 100 μg / ml ampicillin) and incubated overnight at 37 ° C. On the next day, the resulting colonies were picked up and cultured in a 500 ml scale LB medium. The culture was performed at 37 ° C. for 24 hours and at 18 ° C. for 24 hours. After a total of 48 hours of culture, the cells were collected by centrifugation, resuspended in 0.1 M Tris-HCl solution (pH 8.0) and sonicated. The cell disruption solution was centrifuged (15000 rpm, 10 minutes), the sediment was removed, and the supernatant was collected. To the column with a bed volume of 2 ml, 500 μl of Ni-Agar suspension and 2 ml of 0.1 M Tris-HCl solution were added to equilibrate the column. The collected supernatant was added to the column and allowed to fall naturally. All operations until the entire amount of the supernatant passed through the column were performed at 4 ° C. The column was washed with 2 ml of 25 mM imidazole / 0.1 M Tris-HCl solution. 2 ml of 500 mM imidazole / 0.1 M Tris-HCl solution was added to the washed column to elute luciferase. The eluted sample was filtered through a gel filtration column PD-10 (GE Healthcare) and desalted. The sample after desalting was ultrafiltered with Vivaspin 6 (Sartorius).

The density of the obtained sample was measured by a colorimetric method. Concentrations of pyralis luciferase and Okinawad firefly luciferase were confirmed. The luciferase was diluted in 0.1 M citrate / 0.2 M Na ₂ HPO ₄ (pH 8.0) so that the final concentration was 1 μg / ml.

50 μl of this luciferase solution was dispensed into a 96-well microplate. 50 μl of a solution containing 2 mM D-luciferin, 4 mM ATP, and 8 mM MgSO ₄ /0.1 M Tris-HCl (pH 8.0) was added using a standard pump of a luminometer, and measurement was performed simultaneously with the addition. The integrated value of the photon count for 10 seconds from the addition of the solution was obtained. Luminescence (ATTO) was used for the measurement, and light having a wavelength of 300 nm to 650 nm was obtained. Each measurement was performed 6 times.

3. Measurement results Rhodamine 6G, P.I. FIG. 3 shows the intensity of chemiluminescence by pyralis luciferase and Okinawa firefly luciferase.

  From FIG. 3, it was found that Okinawa firefly luciferase emits light having an intensity 24.4 times that emitted by rhodamine 6G. In addition, Okinawad firefly luciferase has It was found that the light emitted was five times stronger than that emitted by pyralis luciferase.

[Example 4: Expression of Okinawad firefly in mammalian cells]
Okinawa firefly was expressed in HeLa cells, and the luminescence intensity in the cells was measured.

  Two types of expression vectors were prepared for introduction of the Okinawa firefly luciferase gene. A nucleic acid containing the gene obtained by deleting the recognition sequence of BamHI and EcoRI (SEQ ID NO: 3) in the original Okinawa firefly luciferase gene obtained from Okinawad firefly, and the gene optimized for expression in mammalian cells (SEQ ID NO: 4), pcDNA3 Inserted between the BamHI and EcoRI sites of the multiple cloning site of the .1 (+) vector (Invitrogen). For comparison, the known P.I. A nucleic acid containing a gene optimized for expression in mammalian cells with respect to the gene for pyralis luciferase was similarly inserted into the pcDNA3.1 (+) vector.

  The three types of plasmids thus obtained were each transfected into HeLa cells by the lipofection method, and the D-MEM medium was replaced after 24 hours. Immediately before the measurement, D-luciferin was added at a final concentration of 1 mM, and the luminescence intensity was measured using Kronos (ATTO). The result is shown in FIG. In addition, the emitted light intensity shown in FIG. 4 has shown the integrated value for 10 seconds.

  FIG. 4 shows that the emission intensity when expressed in HeLa cells is increased 27-fold by optimizing the codon of Okinawa firefly luciferase. Further, Okinawa codon luciferase after codon optimization is the same as P. pylori after codon optimization. The emission intensity was 3.4 times that of pyraris luciferase.

Claims (9)

  Luciferase derived from Pyrocoelia matsumurai.   The luciferase according to claim 1, wherein the maximum emission wavelength at pH 8 is 560 nm.   The luciferase according to claim 1 or 2, wherein the luciferase exhibits a luminescence intensity of 24.4 times or more of the luminescence intensity by rhodamine 6G.   The luciferase according to any one of claims 1 to 3, comprising the amino acid sequence set forth in SEQ ID NO: 1.   A nucleic acid comprising a base sequence encoding the luciferase according to any one of claims 1 to 4.   6. The nucleic acid of claim 5, wherein the codon of the luciferase gene is optimized for expression in mammals.   The nucleic acid according to claim 5, comprising the base sequence represented by SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. A method for analyzing intracellular functions including the following steps:
A step of introducing the luciferase according to any one of claims 1 to 4 into a cell; and a step of detecting luminescence of the luciferase by an imaging device. A method for analyzing intracellular proteins comprising the following steps:
A step of introducing a fusion protein comprising the luciferase according to any one of claims 1 to 4 into the cell; and a step of detecting luminescence of the luciferase by an imaging device.

Images