JP2011125333A - Method for selecting gene switch and gene circuit - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an effective method by which a gene switch and a gene circuit can be selected in a short time period, in high selection efficiency with less leakage. <P>SOLUTION: There are provided a method for selecting the gene switch and the gene circuit, wherein an expression vector containing at least a gene sequence encoding thymidine kinase, preferably thymidine kinase originated from human herpes virus, and a promoter sequence operably linked to the gene sequence on the upstream side thereof is used as a selector, and an expression vector used for the method. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a gene switch and a method for selecting a genetic circuit. More specifically, the present invention is characterized in that an expression vector comprising at least a promoter sequence operably linked to a gene sequence encoding thymidine kinase and an upstream thereof is used as a selector. The present invention relates to a method of selecting a gene switch and a gene circuit. The present invention also relates to an expression vector used for the selection method.

  Gene expression control systems are extremely important as basic tools for protein production, metabolic engineering, and synthetic biology. Biotechnology using a gene expression control system is used in various fields such as mass production of useful proteins, metabolic engineering, and whole cell biosensors. Regardless of whether it is a natural product or an artificially created one, there is a need for a technique for producing a gene expression control system having desired characteristics on demand and quickly.

  There are various transcriptional and / or translational control mechanisms and sensor mechanisms in nature. In recent years, gene switches have been reported as gene expression control systems (Non-Patent Documents 1-5). A gene switch is a molecular device that performs expression and non-expression (ON / OFF) conversion of a specific gene with various information as inputs. By integrating various gene switches to construct a gene circuit, an oscillator, a counter, a logic circuit, etc. can be constructed in a cell. In a genetic circuit constructed in a cell, a plurality of gene switch mechanisms work together to establish an integrated function for the first time. For this purpose, all the switches constituting the circuit are required to work with certain characteristics. In order to be able to freely design an arbitrary gene circuit, a large number of gene switches having different functions and characteristics are required.

  For example, gene switches can be applied to mass production of useful proteins. In the production of useful proteins, a technique for forcibly expressing a target protein obtained from a heterologous organism in a host cell such as Escherichia coli is often used. However, many proteins are toxic to host cells. When producing such a protein, the host cells are grown to a sufficient number, and the expression is “induced” as appropriate and forced to be expressed in a timely manner. At this time, the following two conditions are required. That is, (1) the basal expression level when not induced is sufficiently low (i.e., strict, `` leakage '' is small), and (2) sufficient gene expression when expression is induced (ON) It is done (that is, the expression level ratio at ON / OFF is large). In order to achieve this, various promoter systems, such as the pET system (manufactured by Novagen), have been developed, but the search for an optimal gene switch is still ongoing.

  Genetic switches can also be used as a means of metabolic engineering. In metabolic engineering, multiple enzyme genes are expressed simultaneously in a host cell, and a biosynthetic pathway for a target substance is constructed. When aiming for the best results in the constructed artificial biosynthetic pathway, for example, maximizing the yield of end products per biomass, minimizing by-products, etc., finely adjust the expression level of each gene, if possible, independently. It is important to consider and consider. Therefore, a large number of gene switches having desired ON / OFF switching characteristics are required. In particular, when the expression of multiple genes is controlled simultaneously in one cell, the functions required of gene switches are (1) that they are orthogonal to each other, that is, the inducer of one gene switch malfunctions another gene switch. (2) that the expression level of each gene switch can be continuously controlled.

  Gene switches can also be used as biosensors. The cell senses a lot of chemical and / or physical information and expresses appropriate genes accordingly. A cell sensor (Whole Cell Sensor) in which a reporter gene such as green fluorescent protein (GFP) is connected downstream of this “substance sensing” system has been developed. The development of sensors for arbitrary substances (or physical stimuli) is required, for example, by properly modifying them.

  If a large number of gene switches and sensor systems as described above can be created, a complex gene circuit with information integration and / or calculation (judgment) functions can be created by combining them. However, the gene switch included in the gene circuit has a problem of leakage or crosstalk in the electronic circuit, and if it uses a plurality of gene switches at the same time, it does not work correctly. The switch characteristics of gene switches, such as the ON / OFF threshold and dynamic range, can be combined when designing complex genetic circuits (1) to arbitrarily change the response threshold that triggers expression activation, (2) Suppression of expression “leakage” in a non-induced state and (3) assurance of orthogonality with other factors in the cell are strongly required. Designing these requirements de novo for complex genetic circuits is a very difficult task. Therefore, the limit of circuit integration in cell engineering is extremely low. In order to overcome these problems, there is a need for improved gene switches.

  On the other hand, even if it is a complex circuit, it can be regarded as a single gene switch that defines the gene activation state according to the input conditions. That is, the genetic circuit activates the expression of the downstream gene (set) under certain conditions and suppresses otherwise.

  Therefore, in constructing a genetic circuit, if a gene that is in an activated state when gene expression should be ON and / or a state that is in a suppressed state when it should be OFF (ON selection / OFF selection), any It is possible to select and / or acquire genetic circuits having output characteristics. If this ON selection / OFF selection can be performed easily and continuously, various gene switches (or gene circuits) can be rapidly developed. In selecting the function of the gene switch, it is necessary to select both the ON state and the OFF state under various input conditions (Non-Patent Document 6-12). That is, by connecting two markers, the ON selector and the OFF selector, to the output side, that is, the downstream side of the gene circuit, it is possible to select the function of the gene switch or the gene circuit that is an integrated circuit thereof. In molecular genetics, various ON selectors and OFF selectors are known.

  Recently, an attempt has been made to perform the functions of the ON selector and the OFF selector in one gene (Non-patent Documents 10-12). A selector having both functions of an ON selector and an OFF selector is called a dual selector. In the “operon type” selection method that uses independent ON and OFF selectors, there is a problem that gene mutations frequently occur in either selector gene, resulting in frequent false positives. There is no. Although there are few reports of dual selectors for functional selection of gene switches, a system using tetracycline resistance gene tetA (Non-patent Document 10-11), a system using chloramphenicol resistance gene CAT (Non-patent Document 12) A system using a gene that confers antibiotic resistance to cells such as the above, and a system using a chemotaxis gene cheZ of E. coli (Non-patent Document 13) have been reported. The system using tetA utilizes the cell bactericidal mechanism by controlling the transcription of tetA, and performs dual selection by measuring the viability of the cells. The system using cheZ controls the translation of cheZ and performs dual selection based on the presence or absence of cell motility.

  Various selection systems used for ON selection / OFF selection have been developed so far, all of which are so-called selections in which cells can proliferate when the gene circuit introduced into the cells is output correctly Selection is achieved by multiplication. Since such a selection system includes a cell growth process in one selection operation, approximately 12 to 24 hours are required for one selection operation. Therefore, many days are required to select a genetic circuit, particularly a complicated genetic circuit. As described above, the conventional method has a problem that the selection operation takes time and a problem that the selection efficiency depends on the selection condition.

Galvao, TC and de Lorenzo, V, Transcriptional regulators a la carte: engineering new effector specificities in bacterial regulatory proteins.Curr Opin Biotechnol, 17, 34-42 (2006) Lutz, R and Bujard, H, Independent and tight regulation of transcriptional units in Escherichia coli via the LacR / O, the TetR / O and AraC / I1-I2 regulatory elements.Nucleic Acids Res, 25, 1203-10 (1997) Cox, RS 3rd, et al., Programming gene expression with combinatorial promoters. Mol Syst Biol, 3, 145 (2007) Eddy, SR, Noncoding RNA genes., Curr Opin Genet Dev., 9, 695-9 (1999) Garst, AD, Batey RT., A switch in time: Detailing the life of a riboswitch., Biochim Biophys Acta. 1789, 584-91 (2009) Yokobayashi, Y, et al., Directed evolution of a genetic circuit.Proc Natl Acad Sci U S A, 99, 16587-91 (2002) Yokobayashi, Y, et al., A dual selection module for directed evolution of genetic circuits. Nat. Computing, 4, 245-54 (2005) Tang, SY, et al., AraC regulatory protein mutants with altered effector specificity.J AmChem Soc, 130, 5267-71 (2008) Lynch, SA and Gallivan, JP, A flow cytometry-based screen for synthetic riboswitches.Nucleic Acids Res, 37, 184-92 (2009) Nomura, Y and Yokobayashi, Y, Dual selection of a genetic switch by a single selection marker.Biosystems, 90, 115-20 (2007) Muranaka, N, et al., An efficient platform for genetic selection and screening of gene switches in Escherichia coli.Nucleic Acids Res, 37, e39 (2009) Rackham, O and Chin, JW, A network of orthogonal ribosome mRNA pairs. Nat. Chem. Biol., 1,159-66 (2005) Topp, S and Gallivan, JP, Random walks to synthetic riboswitches--a high-throughput selection based on cell motility.Chemiochem, 9, 210-3 (2008)

  The functions of gene switches and biosensors are higher-order molecular functions that are complexly performed by a plurality of elements, and it is extremely difficult to rationally design gene switches having desired functional characteristics. Furthermore, the rational design of genetic circuits that are constructed by combining them is associated with greater difficulty. Therefore, it is necessary to create a large number of gene switch mutants as a library, and select and acquire mutants that function correctly from the library.

  An object of the present invention is to provide an effective method capable of selecting a gene switch or a gene circuit in a short time and having high selection efficiency.

  The present inventors conducted extensive research to solve the above problems, and focused on human herpesvirus-derived thymidine kinase (hsvTK) as a dual selector that functions as both an ON selector and an OFF selector with a single gene. Then, by operating hsvTK on the output side of the gene circuit, that is, on the downstream side, and performing ON selection and / or OFF selection, a gene switch or gene circuit having a desired characteristic and / or function can be obtained at high speed, simply, and I found a way to get it reliably. This new method showed extremely high selection efficiency in selecting gene switches and genetic circuits for both ON selection and OFF selection. By performing ON selection and OFF selection according to the present invention using gene switch activators having different concentrations, gene switches having different response threshold values could be obtained. Further, by performing ON selection and OFF selection according to the present invention using different types of gene activators, it is possible to obtain a gene switch having specificity for the gene activator, that is, switch signal selectivity. did it. The present invention has been completed based on these results.

  That is, the present invention relates to the following gene switch and gene circuit selection methods and expression vectors used in the selection methods.

1. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
Using thymidine kinase deficient cells into which
Wherein when a gene sequence encoding a transcriptional regulator of (f) is a transcriptional repressor is de novo (de novo of A deoxythymidine triphosphate (dTTP) in the absence of a compound that activates the gene switch ) was added to inhibitors of the synthesis pathway recovering viable cells after incubation the cells or, after the incubation the cells by adding a mutagenic nucleoside in the presence of a substance that activates the gene switch Recovering living cells, or when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator, adoxythymidine triphosphate in the presence of a compound that activates the gene switch recovering live cells after activating the denovo synthesis pathway inhibitor of (dTTP) and activating the gene switch Recovering viable cells after incubation the cells by adding a mutagenic nucleoside in the absence of quality,
And a method for selecting a genetic circuit.

2. The method for selecting a gene switch and a gene circuit according to 1., including the following steps (1) to (3)
(1) An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
A step for introducing thymidine kinase deficient cells,
(2) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, the cells are incubated with a mutagenic nucleoside in the presence of a substance that activates the gene switch. Or a mutagenic nucleoside is added to the cell in the absence of a substance that activates the gene switch when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator. Incubating the cells; and
(3) A step of collecting live cells.

3. Following the step (3), the method for selecting a gene switch and gene circuit according to the above 2, further comprising the following steps (4) and (5):
(4) The collected live cells are treated with deoxythymidine triphosphate (dTTP) in the absence of a substance that activates the gene switch when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressor. ) Incubating with an inhibitor of the de novo synthesis pathway, or activating the gene switch if the gene sequence encoding the transcriptional regulator in (f) is a transcriptional activator Adding the inhibitor in the presence of a substance to be incubated and, and
(5) A step of collecting live cells.

4. The method for selecting a gene switch and a gene circuit according to the above 1. comprising the following steps (6) to (8)
(6) An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
A step for introducing thymidine kinase deficient cells,
(7) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressor, deoxythymidine triphosphate (dTTP) is added to the cell in the absence of a substance that activates the gene switch. Incubating with an inhibitor of the de novo synthesis pathway of (2), or activating the gene switch if the gene sequence encoding the transcriptional regulator of (f) is a transcriptional activator Adding the inhibitor to the cell in the presence of a substance to incubate the cell, and
(8) A step of collecting live cells.

5. Following the step (8), further comprising the following steps (9) and (10): 4. The method for selecting a gene switch and gene circuit of the above:
(9) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, the recovered live cells are added with a mutagenic nucleoside in the presence of a substance that activates the gene switch. Incubating step, or if the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator, adding a mutagenic nucleoside in the absence of a substance that activates the gene switch And the process of
(10) A step of collecting live cells.

  6. The method for selecting a gene switch and gene circuit according to any one of 1 to 5 above, wherein the gene sequence encoding thymidine kinase is a gene sequence encoding human herpesvirus-derived thymidine kinase.

  7. The method for selecting a gene switch and gene circuit according to any one of 1 to 6 above, wherein the thymidine kinase-deficient cell is a thymidine kinase-deficient strain of E. coli.

  8. The mutagenic nucleoside is 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one (dP) The method for selecting a gene switch and a genetic circuit according to any one of 1 to 7 above.

  9. The gene according to any one of 1 to 8 above, wherein the de novo synthesis pathway inhibitor of deoxythymidine triphosphate (dTTP) is 5-fluoro-2'-deoxyuridine (5FdU) or a derivative thereof. Selection method of switches and genetic circuits.

  10.The expression vector 1 to 9, wherein the expression vector holding at least the sequences (a) and (b) is an expression vector further comprising a gene sequence encoding a fluorescent protein in addition to the sequences (a) and (b). A method of selecting any one of the gene switches and the genetic circuit.

11. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
In the presence of N-acyl-L-homoserine lactone (AHL) and 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido A gene switch and genetic circuit comprising recovering viable cells after adding [4,5-c] [1,2] oxazin-7-one (dP) and incubating the E. coli strain for 5 to 60 minutes Selection method.

12. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Was used in the absence of N-acyl-L-homoserine lactone (AHL) and 5-fluoro-2'-deoxyuridine (5FdU) was added for 12 hours. A method for selecting a gene switch and a genetic circuit, comprising recovering viable cells after incubation for 20 hours.

13. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
In the presence of N-acyl-L-homoserine lactone (AHL) and 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] Oxazin-7-one (dP) was added and the E. coli strain was incubated for 5 to 60 minutes before harvesting the viable cells and then in the absence of AHL A method for selecting a gene switch and a gene circuit, comprising adding 5-fluoro-2′-deoxyuridine (5FdU) and incubating the E. coli strain for 12 to 20 hours and then recovering living cells.

14. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Was used in the absence of N-acyl-L-homoserine lactone (AHL) and 5-fluoro-2'-deoxyuridine (5FdU) was added for 12 hours. live cells were harvested after 20 hours of incubation from then, in the presence of AHL 6- (β-D-2- deoxyribonucleic - furanosyl) -3,4-dihydro -8H- pyrimido [4,5-c] [ 1,2] A method for selecting a gene switch and a genetic circuit, which comprises adding oxazin-7-one (dP) and incubating the E. coli strain for 5 to 60 minutes and then recovering living cells.

  15. The above-mentioned 11. to 14, wherein the expression vector having at least the sequences (a) and (b) is an expression vector further comprising a gene sequence encoding a fluorescent protein in addition to the sequences (a) and (b). A method of selecting any one of the gene switches and the genetic circuit.

16. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
5-fluoro-2'-deoxyuridine (5FdU) was added in the presence of N-acyl-L-homoserine lactone (AHL) at different concentrations and in the absence of AHL. the viable cells were recovered after 20 hours of incubation the E. coli strain from the 12 hours, then, in the presence of AHL 1/10 the concentration of the concentration 6- (β-D-2- deoxyribonucleic - furanosyl) -3 , 4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one (dP) is added, and the E. coli strain is incubated for 5 to 60 minutes, and then the living cells are collected. To obtain a gene switch and a gene circuit having different sensitivities to AHL.

17. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
5-fluoro-2'-deoxyuridine (5FdU) was added in the presence of different types of N-acyl-L-homoserine lactone (AHL) and in the absence of AHL. the viable cells were recovered after 20 hours of incubation the E. coli strain from the 12 hours, then the type 6 in the presence of different AHL the (β-D-2- deoxyribonucleic - furanosyl) -3,4 by recovering viable cells after incubation for 60 min the E. coli strain from 5 minutes with the addition of dihydro -8H- pyrimido [4,5-c] [1,2] Okizajin-7-one (dP), AHL A method for selecting a gene switch and a gene circuit, comprising obtaining a gene switch and a gene circuit having different specificities.

  18. The method for selecting a gene switch and gene circuit according to 16. or 17. above, wherein the gene switch expression sequence is a gene sequence encoding a LuxR mutant.

  19.The above-mentioned 1.-18, wherein the expression vector retaining at least the sequences (a) and (b) is an expression vector further comprising a gene sequence encoding a fluorescent protein in addition to the sequences (a) and (b). A method of selecting any one of the gene switches and the genetic circuit.

  20. An expression vector comprising at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream thereof, the gene switch and the gene circuit according to any one of 1 to 19 above An expression vector used in the selection method.

  21. An expression vector comprising at least a gene sequence encoding thymidine kinase and a gene sequence encoding a fluorescent protein, and a promoter sequence operably linked to the gene sequence upstream of these gene sequences, wherein 19. An expression vector used in any one of the gene switch and the method for selecting a genetic circuit.

  22. The expression vector according to 21 above, comprising a DNA represented by the nucleotide sequence set forth in SEQ ID NO: 2 or 3 in the sequence listing.

  According to the present invention, a gene switch and a gene characterized in that an expression vector comprising at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream thereof is used as a selector. A circuit selection method can be provided.

  By using the method according to the present invention, selection and acquisition of gene switches and gene circuits having desired characteristics and / or functions can be performed. Since the method according to the present invention, particularly OFF selection, is extremely efficient and rapid, it can be used as a good tool for synthetic biology as a platform for rapidly developing genetic circuits with higher stringency.

  As described above, according to the present invention, selection and acquisition of gene switches and gene circuits can be performed quickly and efficiently.

FIG. 4 is a view showing that the thymidine kinase (TK) -deficient strain of E. coli grows even in the presence of dP, but that its survival rate is significantly reduced by expressing human herpesvirus-derived thymidine kinase (hsvTK). In the figure, “●” represents a TK-deficient E. coli strain (hsvTK +) expressing hsvTK, and “◯” represents a TK-deficient E. coli strain (hsvTK−) not expressing hsvTK. In the figure, the vertical axis represents the viable cell count (Cell Count), and the horizontal axis represents the dP concentration (dP conc.). (Example 1) FIG. 3 is a graph showing that the survival rate of a TK-deficient E. coli strain decreases depending on the concentration dependency of 5FdU, but that the decrease in the survival rate is suppressed by expressing hsvTK. In the figure, “●” represents a TK-deficient E. coli strain (hsvTK +) expressing hsvTK, and “◯” represents a TK-deficient E. coli strain (hsvTK−) not expressing hsvTK. The vertical axis in the figure represents the viable cell count (Cell Count), and the horizontal axis represents the 5FdU concentration (5FdU conc.). (Example 2) TK-deficient E. coli strain expressing hsvTK is a figure showing that it is killed within 5 minutes after the addition of dP (denoted as dP shock in the figure). In the figure, “●” indicates the addition of dP (denoted as + dP in the figure), and “◯” indicates the absence of dP (denoted as no dP in the figure). In the figure, the vertical axis represents the viable cell count (Cell Count), and the horizontal axis represents time (min). (Example 3) It is a figure which shows the schematic diagram of 4 types of gene circuits, and its function. The left panel is a schematic diagram of the genetic circuit. The right panel illustrates the presence or absence of CI protein expression (CI expression) by each genetic circuit with or without the activating substance N-acyl-L-homoserine lactone (AHL). (Example 4) FIG. 4B is a diagram showing a result of confirming that the genetic circuit shown in FIG. 4-A operates as designed. In the figure, each symbol represents the gene circuit shown in FIG. 4-A, “●” represents circuit A, “◯” represents circuit B, “▲” represents circuit C, and “Δ” represents circuit D. Panel (a) shows the results of measuring the expression of GFPuv in the presence of various concentrations of AHL in a TK-deficient E. coli strain in which the gene circuit and a green fluorescent protein (GFPuv) expression plasmid are co-expressed. The vertical axis of panel (a) represents the relative fluorescence intensity (Relative Fluorescence), and the horizontal axis represents the AHL concentration (AHL conc.). Panel (b) shows TK-deficient Escherichia coli co-expressed with the gene circuit and hsvTK expression plasmid, and ON selection was performed by adding 5FdU in the presence of various concentrations of AHL, The counted result is shown. Panel (c) shows that TK-deficient E. coli strains co-expressed with the gene circuit and the hsvTK expression plasmid were subjected to OFF selection by adding dP in the presence of various concentrations of AHL. The result of counting is shown. The vertical axis of panel (b) and panel (c) represents the viable cell count (Cell Count), and the horizontal axis represents the AHL concentration (AHL conc.). (Example 4) It is a schematic diagram explaining the process of dual selection which combined OFF selection and ON selection, and its result. (a) illustrates the outline of the dual selection method using an agar medium, and (b) illustrates the steps of the dual selection method performed in a liquid medium. (c) shows the result of dual selection by the method (a) of mixed cells in which three types of TK-deficient E. coli strains each having three types of genetic circuits are mixed. The result of having measured the ratio of each cell before dual selection, after ON selection, and after dual selection is shown. (Example 5) FIG. 4B is a schematic diagram for explaining a method of identifying the circuit A and the circuit B of the gene circuit shown in FIG. 4-A by PCR. In both circuit A and circuit B, a certain region of the circuit including a part of the CI structural gene is PCR amplified by the same primer set. Circuit A contains the wild type of the CI structural gene, while circuit B contains the deletion mutant of the CI structural gene, so the PCR product (367 bp) using circuit B as a template is a PCR product using circuit A as a template. Its length is shorter than (639bp). This gives two different length bands in the PCR analysis of the mixture of both. The abundance ratio of both is determined from the band intensity ratio. Fig. 4-A Mixing TK-deficient E. coli strain (Switch1) introduced with circuit A of the genetic circuit shown in Fig. 4-A and TK-deficient E. coli strain introduced with circuit B (Switch2). FIG. After each selection step, Switch1 and Switch2 were detected by PCR. In the figure, lane 1 is Switch1, lane 2 is Switch2, lane 3 is a mixed cell, lane 4 is a mixed cell selected OFF, and lane 5 is a result of OFF selected cell selected ON. (Example 7) It is a schematic diagram which shows the gene structure of pTrc-hsvtk used in order to express hsvTK steadily. (Example 1 and Example 3) It is a figure which shows the outline of the process of selecting the gene switch from which the response threshold value (sensitivity) with respect to a gene switch activator differs, and the gene circuit containing this gene switch. In the figure, input indicates a gene switch activator, and output indicates the response of the gene switch. Save means survival, and death means death. (Example 8) By performing ON selection and OFF selection according to the present invention in the presence of various concentrations of AHL, LuxR variants (LuxR variants) having various response thresholds (different sensitivities to AHL) can be obtained from the LuxR mutant group. It is a figure which shows having been able to be selected. In the figure, wt represents wild-type LuxR, and mut1, mut2, mut3, and mut4 all represent LuxR mutants. By performing ON selection and OFF selection according to the present invention in the presence of different types of AHL, various LuxR variants (LuxR variants) having specificity for the type of AHL could be selected from the group of LuxR variants. FIG. In the figure, LuxR wt indicates wild type LuxR, and AHLs indicates the type of AHL. Panel (a) shows the responsiveness of wild-type LuxR to various AHLs and the structural formula of AHL used. Panel (b) shows that the LuxR I58N mutant showing specificity for AHL (3OC8) could be obtained by OFF selection with AHL (3OC6) following ON selection in the presence of AHL (3OC8). Panel (c) shows that LuxR Y62H mutant showing specificity to AHL (3OC6) could be obtained by OFF selection with AHL (3OC8) following ON selection in the presence of AHL (3OC6). Panel (d) shows that LuxR C245W mutants reactive to various AHLs could be obtained by ON selection in the presence of AHL (C8). (Example 9) It is a plasmid map of plasmid pLux-gfp-hsvTK in which the GFP gene and the hsvTK gene are arranged in tandem downstream of the Lux promoter. (Example 10) It is a plasmid map of plasmid pCI-gfp-hsvTK in which GFP gene and hsvTK gene are arranged in tandem downstream of λPR promoter which is CI promoter (CIP). (Example 10) The figure explaining that fluorescence output was observed as a result of the concentration dependence of AHL as a result of introducing pLux-gfp-hsvTK into TK-deficient E. coli strain JW1226 together with pTrc-LuxR and observing fluorescence in the presence of various concentrations of AHL It is. (Example 10) A plasmid (pLux-gfp-hsvTK) that introduces the GFP gene in addition to the hsvTK gene, which is a selector gene, to check the activation status of the promoter in the plasmid based on the presence or absence of GFP expression, functions as an ON selector and an OFF selector. It is a figure explaining what was shown. In TK-deficient Escherichia coli strain JW1226 in which pLux-gfp-hsvTK was introduced together with pTrc-LuxR, the number of viable cells was significantly reduced in the presence of dP due to the expression of hsvTK by the addition of AHL (left panel), while 5FdU and thymidine In the presence, the number of viable bacteria increased significantly (right panel). (Example 10) It is a figure explaining that E. coli strain JW1226 expressing each kinase of hsvTK, E. coli-derived thymidine kinase (ecoTK), and Dropophila nucleoside kinase (DmDNK) showed a decrease in viable cell count dependent on dP concentration. . In E. coli expressing GFP as a negative control, E. coli expressing hsvTK inactive form (hsvTK (E83K)), E. coli introduced with an empty vector (pTrc99a), E. coli expressing the above kinase is a prominent live bacteria. No reduction in viable cell count was observed even in the presence of 10 ³ nM dP indicating a reduction in the number. The vertical axis represents the viable cell count (cell count), and the horizontal axis represents the dP concentration (dP conc.). (Example 11) TK-deficient Escherichia coli strain JW1226 expressing hsvTK, E. coli-derived thymidine kinase (ecoTK), and Dropophila nucleoside kinase (DmDNK) kinases grew higher in 5FdU / dT medium (ON selection medium) compared to negative control. It is a figure explaining having shown efficiency. The vertical axis represents the viable cell count. (Example 11) FIG. 5 is a plasmid map of a plasmid pTrc-hsvTK lite containing a gene encoding a truncated hsvTK lacking the N-terminal 45 amino acids. (Example 12) Both E. coli expressing wild-type hsvTK (referred to as WT in the figure) and E. coli expressing truncated hsvTK lacking the N-terminal 45 amino acids (referred to as lite in the figure) in the presence of dP. It is a figure explaining that survival after 12 hours was not recognized. On the other hand, in the absence of dP, both of these two types of E. coli survived in the same manner as E. coli not expressing hsvTK (referred to as tk- in the figure). The survival of E. coli was performed by measuring turbidity with OD600. (Example 12) Both E. coli expressing wild type hsvTK (referred to as WT in the figure) and E. coli expressing truncated hsvTK lacking the N-terminal 45 amino acids (referred to as lite in the figure) in the presence of 5FdU. It is a figure explaining that the growth after 24 hours was recognized. On the other hand, in E. coli not expressing hsvTK (referred to as tk- in the figure), growth after 24 hours was hardly observed in the presence of 5FdU. The survival of E. coli was performed by measuring turbidity with OD600. (Example 12) It is a plasmid map of plasmid pCI-gfp-hsvTK_fused in which a fusion gene of GFP gene and hsvTK gene is introduced downstream of λPR. (Example 13) It is a figure which shows that the fluorescence signal was observed in colon_bacillus | E._coli which introduce | transduced the plasmid pCI-gfp-hsvTK_fused which introduce | transduced the fusion gene of a GFP gene and hsvTK gene. In the figure, gfp-hsvtk fusion means a transformant introduced with pCI-gfp-hsvTK_fused, and gfp- means E. coli not expressing GFP. (Example 13) It is a figure explaining that the survival after 12 hours was not recognized in the presence of dP in both E. coli constitutively expressing GFP-hsvTK fusion protein and E. coli steadily expressing hsvTK. The survival of E. coli was performed by measuring turbidity with OD600. (Example 13) It is a figure explaining that growth in 24 hours in the presence of 5FdU was observed in both E. coli constitutively expressing the GFP-hsvTK fusion protein and E. coli steadily expressing hsvTK. The survival of E. coli was performed by measuring turbidity with OD600. (Example 13)

  The present invention relates to a gene switch and a gene circuit, characterized in that an expression vector comprising at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream thereof is used as a selector. It relates to the selection method. The present invention also relates to an expression vector used for the selection method.

  The term “gene switch” means a molecule, preferably a protein, that contains a transcription activation domain and has a site to which a substance capable of activating the molecule (activator) binds. Such a molecule is activated by the binding of an activator and changes its function. That is, the binding of the activator affects its binding to the target sequence of the gene switch, and as a result, the expression of the target gene is inhibited or induced. In other words, a “gene switch” is a molecule that contains a transcriptional activation domain and has a site to which a substance capable of activating the molecule binds, and binding to the target sequence causes or cancels the binding to the target sequence. Means a molecule. The term “gene switch expression sequence” means a nucleic acid sequence encoding a gene switch.

  The term “activator of a gene switch” refers to a substance that alters the function of a gene switch by binding to the gene switch, resulting in the regulation of direct or indirect expression of a gene or multiple genes, for example Such a compound is meant. A “gene switch activator” can also be referred to as a “compound that activates a gene switch”. The activator depends on the gene switch. The combination of the gene switch and the activator is, for example, a homoserine lactone sensor derived from Vibrio bacterium and N-acyl-L-homoserine lactone (AHL) receptor protein LuxR and AHL, AraC protein and arabinose, etc. Can be illustrated.

  The term “target sequence of a gene switch” means a nucleic acid sequence located 5 ′ upstream of the translation start of a gene encoding a target gene or an active part thereof, which controls transcription of the target gene. The target sequence of the gene switch has promoter activity. That is, the “target sequence of the gene switch” can be a promoter sequence. Preferably, the regulatory nucleic acid sequence having enhancer activity is indirectly or directly linked to the target sequence of the gene switch. If the gene switch does not act on the target sequence of the gene switch, the target gene is not expressed. That is, the action of the gene switch on the target sequence of the gene switch is regulated by the addition of a gene switch activator, thereby controlling the expression of the target gene. For example, the gene switch LuxR acts on the target sequence Lux promoter by the addition of the activator AHL, and promotes the transcription of the target gene located downstream of the promoter.

  The term “promoter” refers to a region on DNA that determines the transcription start site of a gene and directly regulates its frequency, and is a nucleic acid sequence that initiates transcription upon binding of RNA polymerase. The promoter is appropriately selected depending on the type of host cell to be used. When a bacterium is used as a host, any promoter can be used as long as it can be expressed in a host cell such as Escherichia coli. For example, a Lux promoter can be preferably exemplified. Moreover, promoters derived from Escherichia coli and phages such as λPR promoter, PL promoter, trp promoter, and lac promoter can be exemplified. An artificially designed and modified promoter such as a tac promoter may be used. When yeast is used as a host, the promoter is not particularly limited as long as it can be expressed in yeast, and any promoter may be used. For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, AOX1 promoter and the like can be exemplified. When an animal cell is used as a host, it is preferable that the recombinant vector is autonomously replicable in the cell, and at the same time is composed of a promoter, an RNA splice site, a target gene, a polyadenylation site, and a transcription termination sequence. Moreover, the replication origin may be included if desired. As the promoter, SRα promoter, SV40 promoter, LTR promoter, CMV promoter and the like can be used, and a cytomegalovirus early gene promoter and the like may be used.

  The term “genetic circuit” means a regulatable gene expression system that includes a combination of a nucleic acid sequence encoding a gene switch and a target sequence of the gene switch, allowing gene expression. More specifically, it means a nucleic acid comprising a nucleic acid sequence encoding a gene switch and a transcription / translation regulatory region having a regulatory DNA element such as a promoter on which the gene switch acts.

  In constructing a genetic circuit, select the one that is in the activated state when the gene expression should be ON (ON selection) and / or select the one that is in the suppression state in the situation that should be OFF (OFF selection) Thus, a genetic circuit having an arbitrary output characteristic can be selected / obtained. By continuously performing this ON selection / OFF selection, various gene switches (or gene circuits) can be rapidly developed.

  The term “ON selection” means selecting those that are in an activated state when gene expression should be ON. In other words, the term “ON selection” means selection by removing a gene switch that is OFF (in a repressed state) under conditions where the gene switch is ON (in an activated state). In order to perform ON selection, a gene (ON selector) that “cannot survive if it is not expressed” is placed under the control of the gene switch and gene circuit library to be selected. A gene switch and a gene circuit that cannot be activated under the condition that the gene switch is ON (activated state) and cannot express a downstream ON selector are removed together with the cell into which the gene switch is introduced. That is, in the ON selection, cell death is avoided when the expression of a gene whose expression is regulated by the action of the gene switch and the gene circuit is ON.

  The term “OFF selection” means selecting those that are in a repressed state when gene expression should be OFF. In other words, the term “OFF selection” means a selection that removes a gene switch that permits gene expression, ie, a leaky gene switch, under the condition that the gene switch is OFF (inhibited state). To perform OFF selection, a gene (OFF selector) that causes cell death of a host cell when expressed is placed under the control of a gene switch and a library of gene circuits to be selected. Under the condition that the gene switch is OFF (inhibited state), the gene switch that erroneously expresses the downstream OFF selector and the leaked gene circuit are removed together with the host. That is, in the OFF selection, cell death is avoided when the expression of a gene whose expression is regulated by the action of the gene switch and the gene circuit is OFF.

  The term “dual selection” means to perform a combination of ON selection and OFF selection. Dual selection may be performed only once or multiple times. Preferably, the dual selection is performed a plurality of times in succession. By performing multiple times, a desired gene switch and gene circuit can be obtained from the library of gene switches and gene circuits at a high concentration rate.

  The term “selector” means a means used for selection of a gene switch and a gene circuit having the gene switch, for example, having a gene sequence that is regulated by the action of the gene switch and the gene circuit or the gene sequence An expression vector.

  The term “ON selector” means a means used for ON selection, for example, a gene “a host cell cannot survive unless it is expressed” or an expression vector containing the gene.

  The term “OFF selector” means a means used for OFF selection, and refers to, for example, a gene that “causes cell death when expressed” or an expression vector containing the gene.

  The term “dual selector” means a selector having both an ON selector function and an OFF selector function. Therefore, the dual selector is used for both ON selection and OFF selection.

  The term “expression vector” refers to DNA that carries an external gene to a host cell, in other words, vector DNA that can express a target gene in the host cell. The vector DNA is not particularly limited as long as it can replicate in the host, and is appropriately selected depending on the type of host and intended use. In addition to the vector DNA obtained by extracting naturally occurring DNA, the vector DNA may be a vector DNA in which a part of the DNA other than the part necessary for replication is missing. Representative vector DNAs include, for example, plasmid, bacteriophage and virus-derived vector DNA. Examples of plasmid DNA include Escherichia coli-derived plasmids, Bacillus subtilis-derived plasmids, yeast-derived plasmids, and the like. Examples of bacteriophage DNA include λ phage. Examples of virus-derived vector DNA include vectors derived from animal viruses such as retrovirus, vaccinia virus, adenovirus, papovavirus, SV40, fowlpox virus, and pseudorabies virus, or vectors derived from insect viruses such as baculovirus. Can do. Other examples include vector DNA derived from a transposon, an insertion element, and a yeast chromosome element. Alternatively, vector DNA prepared by combining these, for example, vector DNA (cosmid, phagemid, etc.) prepared by combining plasmid and bacteriophage genetic elements can be exemplified. It is necessary to incorporate the target gene into the vector DNA so that the target gene is expressed, and at least the target gene and a regulatory DNA element such as a promoter are used as constituent elements. In addition to these elements, if desired, gene sequences carrying information on replication and control can be combined and incorporated into vector DNA by a method known per se. Examples of such gene sequences include ribosome binding sequences, terminators, signal sequences, cis elements such as enhancers, splicing signals, and selectable markers (dihydrofolate reductase gene, ampicillin resistance gene, neomycin resistance gene, etc.). One or more kinds of gene sequences selected from these can be incorporated into vector DNA.

  As a method for incorporating a target gene into vector DNA, a genetic engineering technique known per se can be applied. For example, a method is used in which the target gene is treated with an appropriate restriction enzyme, cleaved at a specific site, then mixed with a similarly treated vector DNA, and religated with ligase. Alternatively, a desired vector DNA can be obtained by ligating a suitable linker to a target gene and inserting it into a multicloning site of a vector suitable for the purpose.

  The method of introducing the expression vector into the host cell is not particularly limited as long as it is an introduction method capable of expressing the target gene in the host cell by introducing the vector DNA into the host cell, and known methods appropriately selected according to the species of the host cell. Any of the methods may be used. For example, an electroporation method, a calcium phosphate method, a lipofection method, etc. can be illustrated.

  In the present invention, an expression vector containing at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream thereof is expressed in a thymidine kinase-deficient cell. The thymidine kinase-deficient cells transfected with the expression vector die under conditions that block the de novo dTTP synthesis pathway, but survive when the expression of the gene encoding thymidine kinase contained in the expression vector is induced. Utilizing the survival of thymidine kinase-deficient cells by inducing the expression of a gene encoding thymidine kinase, selection of gene switches and gene circuits arranged to control the expression of the gene encoding thymidine kinase can be performed. (ON selection). On the other hand, the thymidine kinase-deficient cells transfected with the expression vector die in the presence of a mutagenic nucleoside analog when expression of the gene encoding thymidine kinase contained in the expression vector is induced. If the expression of is not induced, it survives. Selection of gene switches and gene circuits arranged to control the expression of the gene encoding thymidine kinase by utilizing the survival of cells lacking thymidine kinase by not inducing the expression of the gene encoding thymidine kinase. Can be implemented (OFF selection).

  To place a gene switch or gene circuit to control the expression of a gene encoding thymidine kinase, it is not necessary to include the expression sequence and the gene switch or gene circuit in the same expression vector. It can be carried out by cotransforming an expression vector containing the expression sequence of the gene to be expressed and an expression vector containing a gene switch or gene circuit into the same cell.

  An expression vector comprising an expression sequence of a gene encoding thymidine kinase includes (a) a gene sequence encoding thymidine kinase, and (b) a promoter sequence operably linked to the sequence upstream of the sequence of (a). It is preferable that the expression vector holds at least. The expression vector comprising a gene switch and a gene circuit is (c) a promoter sequence different from the promoter sequence of (b) above, and a promoter sequence operably linked to a downstream gene switch expression sequence, (d A gene switch expression sequence, (e) a target transcription regulator sequence of a gene switch encoded by the gene switch expression sequence, and (f) a gene to which the target transcription regulator sequence is operably linked, The expression vector preferably retains at least a gene sequence encoding a transcriptional regulatory factor that operates on the promoter sequence of a).

  The term “transcriptional regulator” as used herein means a proteinaceous factor that acts on regulatory DNA elements, more specifically on promoters. Transcriptional regulators can be broadly classified into transcriptional repressors (also called repressors) and transcription activators (also called activators). Transcriptional repressors act on regulatory DNA elements to repress gene transcription and reduce gene expression. Transcriptional activators act on regulatory DNA elements to promote gene transcription and increase gene expression. Either a transcriptional repressing factor or a transcriptional activator can be used in the present invention, but it is preferable to use a transcriptional repressing factor because the transcriptional repressing factor can clearly induce a change in the transcription amount. Any of the known factors can be used as the transcription repressing factor and the transcription activating factor. CI protein can be exemplified as a preferable transcription repressor. CI proteins bind to each promoter region (ie, OL and OR) of promoter PL and promoter PR, and strongly prevent initiation of transcription from each promoter. A λPR promoter can be exemplified as a promoter affected by CI protein.

  The term “gene sequence whose expression is regulated by a transcriptional regulatory factor” means a gene sequence that is arranged downstream of a regulatory DNA element on which the transcriptional regulatory factor acts, and whose expression is promoted or repressed by the action of the transcriptional regulatory factor. Expression of a gene sequence means a series of processes in which gene information is transcribed into mRNA and further translated as an amino acid sequence of a protein encoded by the gene. If the expression is promoted, the protein encoded by the gene is produced and its amount increases. If the expression is suppressed, the protein encoded by the gene is not produced and its amount decreases.

  In the present invention, a gene sequence encoding thymidine kinase is used as a gene sequence whose expression is regulated by a transcriptional regulatory factor.

  Thymidine kinase (hereinafter sometimes abbreviated as TK) is an enzyme that catalyzes phosphorylation of deoxythymidine and plays an important role as a regulator of DNA synthesis. Intracellular supply of deoxythymidine triphosphate (dTTP), a direct precursor of DNA synthesis, is carried by the de novo and salvage pathways. The de novo pathway synthesizes dTTP via deoxythymidine monophosphate (dTMP) synthesis, which is known to stop when 5-fluorouracil is added (Cohen, SS, et al., The Mode of Action of 5-Fluorouracil and Its Derivatives.Proc Natl Acad Sci USA, 44, 1004-12 (1958); Yagil, E, et al., Phosphorolysis of 5-fluoro-2'-deoxyuridine in Escherichia coli and its inhibition by nucleosides. J Bacteriol, 108, 760-4 (1971)). 5-Fluorouracil and its derivatives are metabolized intracellularly to become 5-fluoro-2'-deoxyuridine monophosphate (5FdUMP). 5FdUMP is an inhibitor of dTMP synthase (ThyA), and its presence inhibits intracellular dTMP synthesis. Under this circumstance, cell growth relies on the salvage pathway to synthesize dTTP using exogenous deoxythymidine (dT). If the cells have TK, they can synthesize dTMP from dT via the salvage pathway, but can survive without TK. When TK is introduced into a TK-deficient cell line, its salvage pathway is restored. Using this mechanism, active function selection methods for thymidine kinase and related enzyme activities have been made (Black, ME, et al., Creation of drug-specific herpes simplex virus type1 thymidine kinase mutants for gene therapy. Proc Natl Acad Sci USA, 93, 3525-9 (1996)).

  On the other hand, various nucleoside analogs are known to be activated by intracellular nucleotide metabolizing enzymes to cause cell death. Thymidine kinase, one of the enzymes, has long been studied as a suicide gene for gene therapy. (Black, ME, et al., Identification of important residues within the putative nucleoside binding site of HSV-1 thymidine kinase by random sequence selection: analysis of selected mutants in vitro.Biochemistry, 32, 11618-26 (1993); Dube, DK, et al., Selection of new biologically active molecules from random nucleotide sequences. Gene, 137, 41-7 (1993)).

  The artificial nucleoside analog 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one (dP) is Like other nucleosides, it is incorporated into the genome via the thymidine salvage pathway. Many other toxic nucleosides are chain terminators of chromosomal DNA synthesis, whereas dP is a mutagenic nucleoside that is incorporated into the genome and frequently undergoes genetic variation (Negishi, K, et al., Binding specificities). of the mismatch binding protein, MutS, to oligonucleotides containing modified bases. Nucleic Acids Res Suppl, 221-2 (2001)). Therefore, cells that express thymidine kinase are induced to die by the addition of dP. However, in cells lacking thymidine kinase, no death is induced by the addition of dP. dP's genotoxicity is low, and only after giving 37 μM dP, only 80% of E. coli cell populations die (Negishi, K, et al., Saturation of DNA mismatch repair and error catastrophe by a base analogue in Escherichia coli. Genetics, 161, 1363-71 (2002)). However, cell death can be efficiently induced if the efficiency of lethal mutagenesis can be dramatically increased by sufficiently increasing the efficiency of dP incorporation into the genome.

One aspect of the present invention provides an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
Using thymidine kinase deficient cells into which
In the case where the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, de novo of deoxythymidine triphosphate (dTTP) in the absence of a compound that activates the gene switch. ) was added to inhibitors of the synthesis pathway recovering viable cells after incubation the cells or, after the incubation the cells by adding a mutagenic nucleoside in the presence of a substance that activates the gene switch Recovering living cells, or when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator, adoxythymidine triphosphate in the presence of a compound that activates the gene switch (dTTP) that adds a de novo synthesis pathway inhibitor and then incubates the cells and then recovers live cells or activates a gene switch Absence added mutagenic nucleoside under the recovering viable cells after incubation the cells,
And a method of selecting a genetic circuit.

  The gene sequence encoding thymidine kinase is not particularly limited, and examples thereof include gene sequences encoding thymidine kinase derived from mammalian cells and viruses. Human herpesvirus-derived thymidine kinase, E. coli-derived thymidine kinase, Drosophila ( A gene sequence encoding a nucleoside kinase derived from Drospophila) can be preferably exemplified. More preferably, a gene sequence encoding thymidine kinase (hsvTK) derived from human herpesvirus can be exemplified. In addition to the gene sequence of wild-type thymidine kinase, one or more, for example, 1 to 100, preferably 1 to 30, more preferably 1 to 20, more preferably 1 to 10, in the gene sequence, More preferably, a gene sequence having a mutation such as deletion, substitution, addition or insertion of one to several nucleotides, which encodes a protein exhibiting the same kinase activity as wild-type thymidine kinase, is used. Can do. It is preferred that the kinase activity of the mutant is equivalent or higher compared to the wild type kinase. However, even mutants exhibiting low kinase activity can be used as long as they exhibit functions as an ON selector and an OFF selector according to the present invention. The extent of the mutation in the gene sequence encoding the mutant and the position thereof are particularly limited as long as the gene sequence having the mutation is a gene sequence encoding a protein exhibiting the same kinase activity as the gene sequence of wild-type thymidine kinase. Not. Examples of such mutants include truncated hsvTK that lacks the N-terminal 45 amino acids of hsvTK. Means for introducing mutations are known per se, for example, using site-specific mutagenesis, gene homologous recombination, primer extension, polymerase chain reaction (hereinafter abbreviated as PCR) alone or in appropriate combination. it can. For example, the method described in the book (edited by Sambrook et al., “Molecular Cloning, Laboratory Manual Second Edition”, 1989, Cold Spring Harbor Laboratory; Muramatsu Masami, “Lab Manual Genetic Engineering”, 1988, Maruzen Co., Ltd.) or by modifying those methods.Ulmer technology (Ulmer, KM, `` Science '', 1983, Vol. 219, p.666 -67) can also be used.

  The promoter sequence operably linked to the gene sequence upstream of the gene sequence encoding thymidine kinase has a function of expressing the gene encoding thymidine kinase, and the gene switch or gene circuit gene to be tested The promoter sequence is not particularly limited as long as the product acts on the product, and a known promoter sequence can be used.

  By cloning the gene sequence encoding the thymidine kinase and the promoter sequence into a known expression vector using a known genetic engineering technique, an expression vector used for selecting a gene switch and a gene circuit is created. it can.

  The expression vector having at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the sequence upstream of the gene sequence further includes a gene sequence encoding a fluorescent protein in addition to these sequences. Is preferred. By placing the gene encoding the fluorescent protein in the expression vector, when performing ON selection and OFF selection depending on the presence or absence of expression of the gene encoding thymidine kinase, the activation state of the promoter in the expression vector is changed to the fluorescent protein. It is useful because it can be visually recognized by the presence or absence of the expression of. The gene sequence encoding the fluorescent protein is not particularly limited as long as it encodes a protein capable of emitting fluorescence in the cell, but is not limited to green fluorescent protein (GFP), yellow fluorescent protein (Yellow Fluorescence Protein, YFP), cyan fluorescent protein (CFP), and blue fluorescent protein (CFP), and variants of these fluorescent proteins, such as UV-optimized green fluorescent protein (UV-optimized green fluorescent protein) GFPuv), Enhanced Green Fluorescence Protein (EGFP), Enhanced Yellow Fluorescence Protein (EYFP), Enhanced Cyan Fluorescence Protein (ECFP), and Blue Fluorescent Protein (ECFP) Fluorescence Protein, ECFP). As an expression vector containing a gene sequence encoding thymidine kinase and a gene sequence encoding a fluorescent protein, a plasmid containing an hsvTK gene sequence and a GFP gene sequence can be exemplified. More specifically, it is a plasmid in which an hsvTK gene sequence and a GFP gene sequence are arranged downstream of a lux promoter, and a plasmid represented by the DNA described in SEQ ID NO: 1 in the sequence listing can be exemplified. Moreover, it is a plasmid in which the hsvTK gene sequence and the GFP gene sequence are arranged downstream of the λPR promoter, and a plasmid represented by the DNA described in SEQ ID NO: 2 in the sequence listing can be exemplified.

  The gene sequence encoding thymidine kinase can be fused with the gene sequence encoding the fluorescent protein to form a fusion gene sequence, which can be introduced into an expression vector. As an expression vector into which such a fusion gene sequence is introduced, a plasmid in which a fusion gene sequence in which a GFP gene sequence and an hsvTK gene sequence are fused is arranged downstream of the λPR promoter, and is described in SEQ ID NO: 3 in the Sequence Listing. Examples include plasmids represented by DNA.

  The cell used in the present invention is not particularly limited as long as it is a cell lacking thymidine kinase. Preferably, cells having a de novo pathway and a salvage pathway, which are deficient in thymidine kinase, are used. Specifically, a TK-deficient strain of E. coli can be preferably exemplified. Since Escherichia coli has a high growth rate, it is useful for a rapid selection method. Thymidine kinase deficient cells can be prepared from normal cells using known genetic engineering techniques.

  In the present invention, the term “cell death” means a state in which cell functions such as proliferation ability are lost in the present invention. For example, when cells such as Escherichia coli are cultured on a solid medium, the state in which the ability to grow from a single cell and form a cell colony (coloni) larger than a certain size that can be visually counted is lost. In the invention, it is called cell death. The term “cell death” includes active cell death (apoptosis) that actively removes unwanted cells and damaged cells caused by physiological or pathological factors, and passive cell death by reaction to external factors. (Necrosis) may also be included.

  The mutagenic nucleoside is not particularly limited as long as it induces cell death by mutating the gene when incorporated into the gene, and may be a naturally occurring mutagenic nucleoside, which is artificially It may be created. Specifically, the artificial nucleoside 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one ( A preferred example is dP). The concentration of the mutagenic nucleoside is not particularly limited as long as it is a concentration that causes mutation in the gene and induces cell death when incorporated into the gene, and can be determined by simple repeated experiments. For example, dP is used at a concentration of 50 nM-1 μM, more preferably 100 nM. The incubation time between the mutagenic nucleoside and the cell is not particularly limited, and can be determined by simple repeated experiments. Since cell death caused by mutagenic nucleoside mutation is induced in a very short time, for example, when dP is used, incubation of dP with cells is performed for 5 minutes to 12 hours, preferably 5 minutes to 60 minutes. More preferably, it may be 5 minutes to 30 minutes, and more preferably 30 minutes.

  An inhibitor of deoxythymidine triphosphate (dTTP) de novo synthesis pathway is not particularly limited as long as it is a compound that can inhibit dTTP production by inhibiting the de novo synthesis pathway. For example, it is involved in the de novo synthesis pathway. Mention may be made of enzyme inhibitors. Specifically, 5-fluorouracil and derivatives thereof can be preferably exemplified. More specifically, 5-fluoro-2′-deoxyuridine (5FdU) can be exemplified. The concentration of 5-fluorouracil and its derivative may be any concentration that can inhibit the de novo synthesis pathway of dTTP, and can be determined by simple repeated experiments. For example, 5FdU is used at a concentration of 10 μg / mL-50 μg / mL, more preferably 20 μg / mL. The incubation time between the dTTP de novo synthesis pathway inhibitor and the cells is not particularly limited, and can be determined by simple repeated experiments. In selection using an inhibitor of the de novo synthesis pathway of dTTP, it takes time to proliferate viable cells, and therefore, time corresponding to the growth rate of the cells to be used is required. For example, when selection is performed using a TK-deficient E. coli strain in the presence of 5FdU, the incubation is performed for 6 hours to 20 hours, preferably 20 hours.

  In the present invention, a gene encoding thymidine kinase can be used as a dual selector that functions as both an ON selector and an OFF selector with a single gene. That is, a gene encoding thymidine kinase can be used to perform both ON selection and OFF selection. In the present invention, both ON selection and OFF selection show extremely high selection efficiency in selection of gene switches and gene circuits. ON selection and OFF selection can be performed independently. Moreover, ON selection and OFF selection can also be implemented in combination. That is, ON selection can be further performed for the gene switch and the gene circuit selected by OFF selection. Conversely, OFF selection can be further performed on the gene switch and gene circuit selected by ON selection. “Properly functioning” in a gene switch means that the promoter function is ON when it should be ON, and OFF otherwise. That is, in order to obtain a gene switch having a desired function, it is preferable to perform two operations of ON selection and OFF selection in succession.

One aspect of the present invention also relates to a gene switch and a method for selecting a genetic circuit including the following steps (1) to (3):
(1) An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
A step for introducing thymidine kinase deficient cells,
(2) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, the cells are incubated with a mutagenic nucleoside in the presence of a substance that activates the gene switch. Or a mutagenic nucleoside is added to the cell in the absence of a substance that activates the gene switch when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator. Incubating the cells; and
(3) A step of collecting live cells.

One embodiment of the present invention can also be a method for selecting a gene switch and a genetic circuit further comprising the following steps (4) and (5) following the steps (1) to (3):
(4) The collected live cells are treated with deoxythymidine triphosphate (dTTP) in the absence of a substance that activates the gene switch when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressor. ) Incubating with an inhibitor of the de novo synthesis pathway, or activating the gene switch if the gene sequence encoding the transcriptional regulator in (f) is a transcriptional activator Adding the inhibitor in the presence of a substance to be incubated and, and
(5) A step of collecting live cells.

One aspect of the present invention also relates to a genetic switch and a method for selecting a genetic circuit, which include the following steps (6) to (8):
(6) An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
A step for introducing thymidine kinase deficient cells,
(7) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressor, deoxythymidine triphosphate (dTTP) is added to the cell in the absence of a substance that activates the gene switch. Incubating with an inhibitor of the de novo synthesis pathway of (2), or activating the gene switch if the gene sequence encoding the transcriptional regulator of (f) is a transcriptional activator Adding the inhibitor to the cell in the presence of a substance to incubate the cell, and
(8) A step of collecting live cells.

One embodiment of the present invention can also be a method for selecting a gene switch and a genetic circuit further comprising the following steps (9) and (10) following the steps (6) to (8):
(9) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, the recovered live cells are added with a mutagenic nucleoside in the presence of a substance that activates the gene switch. Incubating step, or if the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator, adding a mutagenic nucleoside in the absence of a substance that activates the gene switch And the process of
(10) A step of collecting live cells.

A more specific embodiment of the present invention is an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Using the thymidine kinase-deficient E. coli strain obtained by introducing a method of selecting gene switch and genetic circuits comprising recovering viable cells after incubation for 60 min the E. coli strain from 5 minutes with the addition of dP in the presence of AHL About.

A specific embodiment of the present invention also provides an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Using the thymidine kinase-deficient E. coli strain obtained by introducing, in selection of the gene switch and gene circuit comprising recovering viable cells after 20 hours of incubation the E. coli strain 12 hours with the addition of 5FdU in the absence of AHL Regarding the method.

Another specific embodiment of the present invention is an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
A thymidine kinase-deficient E. coli strain into which A was introduced, dP was added in the presence of AHL, the E. coli strain was incubated for 5 to 60 minutes, and then the viable cells were recovered, and then 5FdU was removed in the absence of AHL. The present invention relates to a method for selecting a gene switch and a gene circuit, which comprises recovering viable cells after addition and incubation of the E. coli strain for 12 to 20 hours.

Another specific embodiment of the present invention is an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Using a thymidine kinase-deficient E. coli strain into which 5HdU was added in the absence of AHL and incubating the E. coli strain for 12 to 20 hours, the viable cells were recovered, and then dP was added in the presence of AHL. The present invention relates to a method for selecting a gene switch and a gene circuit, which comprises recovering viable cells after adding and incubating the E. coli strain for 5 to 60 minutes.

  In the method for selecting a gene switch and a genetic circuit according to the present invention, by performing ON selection and OFF selection in the presence of various concentrations of a gene switch activator, different response thresholds for the gene switch activator ( A gene switch having sensitivity) and a gene circuit having the gene switch can be selected. For example, ON selection is performed in the presence and absence of an appropriate concentration of a gene switch activator, and then OFF selection is performed in the presence of a gene switch activator at a concentration 10 or 1/10 of the concentration. By carrying out the above, it is possible to select a gene switch having a different response threshold for a gene switch activator and a gene circuit having the gene switch. Alternatively, OFF selection is performed in the presence of an appropriate concentration of the gene switch activator, and then ON selection is performed in the presence and absence of the gene switch activator at a concentration 10 times or 1/10 of the concentration. By carrying out the above, it is possible to select a gene switch having a different response threshold for a gene switch activator and a gene circuit having the gene switch.

That is, another embodiment of the present invention provides an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
A thymidine kinase-deficient E. coli strain into which 5 is introduced and 5FdU was added in the presence and absence of different concentrations of AHL and the E. coli strain was incubated for 12 to 20 hours, and then viable cells were recovered, By adding dP in the presence of 1/10 concentration of AHL and incubating the E. coli strain for 5 to 60 minutes, and recovering living cells, gene switches and genetic circuits with different sensitivity to AHL can be obtained. The present invention relates to a method for selecting a gene switch and a gene circuit, characterized by acquiring the gene switch.

  In fact, the LuxR mutant library was used as a target for selecting a gene switch, and the TK-deficient E. coli strain into which the library was introduced was incubated with 5FdU in the presence or absence of various concentrations of AHL. Living cells were collected, and subsequently dP was added and incubated in the presence of AHL at a concentration different from that concentration, and living cells were collected.LuxR mutants with different sensitivity to AHL were obtained (Examples). 8).

  Further, in the method for selecting a gene switch and a gene circuit according to the invention, by performing ON selection and OFF selection in the presence of various types of gene switch activators, different specificities for the gene switch activator And a genetic circuit having the gene switch can be selected. For example, by performing ON selection in the presence and absence of one type of AHL, and then performing OFF selection in the presence of another type of AHL, the gene switch activator Gene switches having different specificities and gene circuits having the gene switches can be selected. Alternatively, by performing OFF selection in the presence of one type of AHL, and then performing ON selection in the presence and absence of another type of AHL, the gene switch activator Gene switches having different specificities and gene circuits having the gene switches can be selected. As AHL, N- (3-oxo-hexanoyl) -L-homoserine lactone (N- (3-oxo-hexanoyl) -L-homoserine lactone, abbreviated as 3OC6), N- (3-oxo-octanoyl) -L -Homoserine lactone (N- (3-oxo-octanoyl) -L-homoserine lactone, abbreviated as 3OC8), N- (3-oxo-decanoyl) -L-homoserine lactone (N- (3-oxo-decanoyl)- L-homoserine lactone (abbreviated as 3OC10), N- (3-oxo-dodecanoyl) -L-homoserine lactone (abbreviated as N- (3-oxo-dodecanoyl) -L-homoserine lactone, 3OC12), N-hexanoyl Examples thereof include homoserine lactone (abbreviated as N-hexanoyl-homoserine lactone, C6) and N-octanoyl-homoserine lactone (abbreviated as C8).

That is, still another embodiment of the present invention provides an expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Using a thymidine kinase-deficient E. coli strain into which 5HdU was added in the presence and absence of different types of AHL and the E. coli strain was incubated for 12 to 20 hours, and then the live cells were recovered. To obtain a gene switch and a genetic circuit with different AHL specificity by adding dP in the presence of AHL different from the above type and recovering the living cells after incubation of the E. coli strain for 5 to 60 minutes And a method for selecting a gene switch and a genetic circuit.

  Actually, the LuxR mutant library was used as a target for gene switch selection, and TK-deficient E. coli strains into which the library was introduced were incubated with 5FdU in the presence of various types of AHL, and then the living cells were recovered, followed by In addition, dP was added in the presence of another type of AHL different from the used AHL and incubated to collect viable cells, resulting in a LuxR mutant having specificity for the type of AHL (see Example 9). ).

  Therefore, the method for selecting a gene switch and a gene circuit, characterized in that the gene switch and the gene circuit having different AHL specificities are obtained, may be implemented using the LuxR mutant library as a target for gene switch selection. . In this case, in the selection method, the gene switch expression sequence is a gene sequence encoding a LuxR mutant.

  Gene-switch libraries that can be the target of gene switch and genetic circuit selection methods are constructed using Error-Prone PCR, Leung, DW, et al., A method for random mutagenesis of a defined DNA segment using a modified polymerase chain reaction. Techniques, 1, 11-5 (1989)), saturation mutation introduction method (Miyazaki, K, et al., Exploring nonnatural evolutionary pathways by saturation mutagenesis: Rapid improvement of protein function.J. Mol. Evol , 49, 716-20 (1999)), DNA shuffling (Stemmer, WPC., Rapid evolution of a protein in-vitro by DNA shuffling. Nature, 370, 389-91 (1994)) It can be carried out by an established known random mutagenesis method.

  The present invention also provides an expression vector comprising at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream of the gene sequence, and any one of the gene switch and gene circuit selection methods described above. The present invention relates to an expression vector used for. The expression vector further includes a gene sequence encoding a fluorescent protein in addition to a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream of the gene sequence. obtain. That is, the expression vector of the present invention is an expression vector comprising at least a gene sequence encoding thymidine kinase and a gene sequence encoding a fluorescent protein, and a promoter sequence operably linked to the gene sequence upstream of these gene sequences. Thus, it may be an expression vector used in any of the above gene switch and gene circuit selection methods. An example of such an expression vector is a plasmid vector in which an hsvTK gene sequence and a GFP gene sequence are arranged downstream of the λPR promoter, and the plasmid vector is represented by the DNA described in SEQ ID NO: 2 in the sequence listing. Further, the expression vector of the present invention comprises a fusion gene sequence of a gene sequence encoding thymidine kinase and a gene sequence encoding a fluorescent protein, and a promoter sequence operably linked to the fusion gene sequence upstream of these gene sequences. And an expression vector used in any of the above gene switch and gene circuit selection methods. As such an expression vector, a plasmid vector in which a fusion gene sequence obtained by fusing a GFP gene sequence and an hsvTK gene sequence is arranged downstream of the λPR promoter, and a plasmid represented by the DNA shown in SEQ ID NO: 3 in the sequence listing Examples thereof include an expression vector represented by DNA represented by the nucleotide sequence set forth in SEQ ID NO: 3.

The gene switch and gene circuit selection method according to the present invention are characterized by high selection efficiency, which is an element required for circuit selection. Both OFF selection and ON selection in the method of the present invention show a selection efficiency of 10 ^5-6 . In particular, the selection efficiency of OFF selection is extremely high. In fact, the condition of OFF selection in the method of the present invention, by exposing the cells for 1 hour to dP-containing medium 100 nM, from among 10 ⁶ or more cells in a single operation, the only one correct genetic circuits Cells could be selected (see Example 6). Furthermore, OFF selection does not loosen the output of a slight switch, so it is optimal for the development of a gene switch that suppresses the basal leakage level. In addition, OFF selection is a selection method based on informational death of cells (error catastrophe) due to accumulation of random mutations, and does not attack a specific biochemical action. Therefore, resistance (adaptation on the cell side) hardly occurs. This can provide a robust selection platform.

  The gene switch and the method for selecting a gene circuit according to the present invention are characterized by a quick selection operation, which is another element required of a circuit selector. Especially when OFF is selected, the action time can be shortened to about 5 minutes (see Example 3). This is because the expression of the OFF selector, ie the expression of thymidine kinase in the OFF selection, does not induce cell “growth inhibition”, which is the selection index used in the conventional selection method, but irreversibly causes cell death. This is because the time required for cell growth is not required. Actually, according to the selection method based on the difference in cell growth rate and growth mobility (Non-Patent Documents 6, 7, and 10-13), both ON selection and OFF selection require one operation overnight. Reduction of the selection operation time is a very desirable characteristic for circuit selection in which ON selection and OFF selection are repeated a plurality of times. In particular, when the purpose is to develop a vibration circuit, a switch with a short delay time, or the like, a quick selection method such as the method according to the present invention is essential.

  Thus, the gene switch and gene circuit selection method according to the present invention include, for example, selection of a gene switch for mass production of useful proteins, a gene switch as a metabolic engineering tool, and a gene switch mechanism as a biosensor. Can be used for development.

  EXAMPLES Hereinafter, although an Example is shown and this invention is demonstrated more concretely, this invention is not limited at all by the Example shown below.

  First, materials and methods used in the following examples are briefly described.

  6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one (dP) and 5-fluoro-2 ′ -Deoxyuridine (5FdU) was purchased from Berry & Associates (MI) and Sigma & Aldorich, respectively. Oligonucleotides synthesized by FASMAC Co., Ltd. were used.

  TK-deficient E. coli strain JW1226 is from KEIO collection (Baba, T, et al., Construction of Escherichia coli K-12 in-frame, single-geneknockout mutants: the Keio collection.Mole Syst Biol, 2, 2006 0008 (2006)) obtained. Unless otherwise specified, LB medium (manufactured by Invitrogen) containing 2% (w / v) LB broth was used as the culture medium. Cells were grown at 37 ° C. in glass test tubes.

  The hsvTK expression vector pPL-hsvtk and the GFPuv expression vector pPL-gfpuv were created by pET-hsvtk (Black, ME, et al., Creation of drug-specific herpes simplex virus type 1 thymidine kinase mutants for gene therapy.Proc Natl Acad Sci USA , 93, 3525-9 (1996)), or pGFPuv (Clontech) fused each reading frame downstream of the PL promoter and introduced it into a pACYC184-based plasmid.

  The OFF selection method of gene switch and gene circuit was established.

  First, TK, thymidine monophosphate kinase (Tmk), and nucleotide diphosphate kinase (Ndk) were overexpressed using the mutation frequency in a medium containing a low concentration of dP as an index, as with other nucleoside analogs. We found that the rate limiting of dP incorporation into DNA was the first phosphorylation catalyzed by TK (unpublished data). Next, when several tk genes with different origins were tested, hsvTK showed the highest dP uptake efficiency.

  Using TK-deficient Escherichia coli strain JW1226, human herpesvirus-derived thymidine kinase (hsvTK) was expressed by introducing pTrc-hsvtk (Figure 7), and the relationship between dP concentration and cell viability (viable cell count) was investigated. It was. pTrc-hsvtk is a plasmid in which the hsvTK gene is located downstream of the trc promoter.

First, the JW1226 strain into which pTrc-hsvtk was introduced was cultured overnight at 37 ° C. in 2 mL of LB medium containing 100 μg / mL ampicillin. The culture was then diluted 1000-fold with 1 mL of fresh LB medium containing dP (final concentration 0-100 nM) (10 ⁶ cells / mL) and shaken at 37 ° C. for 12 hours. After culturing, the cells were seeded on LB-agar (1.5% w / v) plates containing ampicillin 100 μg / mL. After incubation at 37 ° C for 12 hours, the number of colonies grown was counted as the number of viable bacteria.

  In the TK-deficient Escherichia coli strain (hsvTK +) in which hsvTK was expressed, the viable cell count was greatly reduced depending on the concentration of dP (FIG. 1). On the other hand, in the TK-deficient E. coli strain (hsvTK-) into which a control plasmid (pTrc99A: vector excluding the structural gene of hsvTK) was introduced instead of hsvTK, there was no decrease in survival rate under all selection conditions tested. It was.

  Thus, it was revealed that only cells expressing hsvTK can be selectively killed by adding a very low concentration (10-100 nM) of dP during the culture of hsvTK +.

  The function of the gene switch or gene circuit set to control the hsvtk gene expression circuit can be selected using the change in the survival rate of TK-deficient cell line in the presence of dP depending on the presence or absence of hsvTK expression. That is, if the downstream hsvtk gene is not expressed because the gene switch or the gene circuit is not activated, the survival rate of the TK-deficient cell line in the presence of dP increases. Therefore, by selecting a TK-deficient cell line having a high survival rate in the presence of dP, it is possible to select an OFF state gene switch or gene circuit that does not express the hsvtk gene.

  Thus, an excellent selection method was established that picked up only the gene switches / circuits in the OFF state.

  The ON selection method of gene switch and gene circuit was established.

  Using TK-deficient E. coli strain JW1226, human herpesvirus-derived thymidine kinase (hsvTK) was expressed by introducing pTrc-hsvtk (Fig. 7), and the relationship between 5FdU concentration and cell viability (viable cell count) was investigated. It was.

First, the JW1226 strain into which pTrc-hsvtk was introduced was diluted with 1 mL of positive selection medium so that OD600 was 0.002 (approximately 10 ⁶ cells / mL), and cultured at 37 ° C. for 12 hours while rotating at 200 rpm. As the positive selection medium, a medium containing Tryptone 2% w / v, NaCl 0.5% w / v, dT 10 μg / mL, adenosine 1 μg / mL, 5FdU 0-25 μg / mL was used. After the culture, a part of the obtained culture was collected and inoculated on an LB plate containing ampicillin, and the number of grown colonies was counted as the number of viable bacteria.

In the TK-deficient E. coli strain (hsvTK-) that did not express hsvTK, the viable cell count decreased as the 5FdU concentration increased (FIG. 2). On the other hand, the TK-deficient Escherichia coli strain (hsvTK +) in which hsvTK was expressed showed a gradual decline compared to hsvTK-. When the 5FdU concentration was 25 μg / mL, hsvTK + showed a survival rate 4.8 × 10 ⁷ times that of hsvTK−.

  Thus, it was confirmed that the survival rate of the TK-deficient Escherichia coli strain in the presence of 5FdU significantly changes depending on whether hsvTK is expressed.

  It is possible to select the function of the gene switch and gene circuit set to control the hsvtk gene expression circuit by using the change in the survival rate of TK-deficient cell line in the presence of 5FdU depending on the presence or absence of hsvTK expression. That is, when a gene switch or gene circuit is activated to induce downstream expression of hsvTK, the survival rate of a TK-deficient cell line in the presence of 5FdU increases. Therefore, by selecting a TK-deficient cell line that has a high survival rate in the presence of 5FdU, it is possible to select an ON-state gene switch or a genetic circuit that can induce the expression of hsvTK.

  Thus, the selection method which picks up only the gene switch and gene circuit which are in the ON state using TK deficient cells into which the hsvtk gene was introduced was established.

  The speed of the OFF selection method established in Example 1 was examined.

First, TK-deficient cells in which hsvTK was constantly expressed by introduction of pTrc-hsvtk (FIG. 7) were cultured with shaking at 37 ° C. at 200 rpm until the OD reached 0.05 (approximately 3 × 10 ⁷ cells / mL). . 1 mL each was collected, dP was added (final concentration 1 μM), and the culture was continued at 37 ° C. After 5, 30, and 60 minutes, 20 μL (approximately 10 ⁶ cells) was collected, inoculated on an LB plate containing ampicillin, and the number of grown colonies was counted as the number of viable bacteria.

  In the samples given dP shock, the viable cell count was almost zero at any action time (FIG. 3). On the other hand, when dP shock was not given, the number of viable bacteria increased. From this, it was found that the OFF selection can be completed with an operation within 5 minutes at the longest.

  The effectiveness of the gene switch and gene circuit OFF selection method and ON selection method established in Examples 1 and 2 was verified using a gene circuit model.

  First, four gene circuits were created (Fig. 4-A). The circuit A and the circuit B are circuits that input N-acyl-L-homoserine lactone (AHL) and output it as a repressor protein CI. CI is an expression regulator and suppresses protein expression under the PL promoter. Therefore, this circuit expresses the CI protein if its output state is ON, and strongly suppresses the gene expression under the control of the PL promoter in the cell. In circuit A, the AHL receptor protein LuxR is always expressed by the Trc promoter, and the CI gene arranged downstream of the Lux promoter is expressed according to the concentration of AHL. In circuit B, the AHL receptor protein LuxR is always expressed by the Trc promoter, and the CItruc gene arranged downstream of the Lux promoter is expressed according to the concentration of AHL. The CItruc gene encodes a C-terminal deletion of the CI protein. CItruc has a reduced ability to bind to the target sequence, resulting in a reduced ability to suppress the PL promoter. In these circuits, LuxR and Lux promoter are oriented in the same direction, and there is a strong transcription terminator between them. The circuit C is obtained by removing the ribosome binding site (RBS) of the CI protein from the circuit B, and the translation efficiency of the CI protein is lost. Therefore, circuit C does not express CItruc regardless of the AHL concentration. On the other hand, the circuit D is obtained by removing the transcription terminator downstream of LuxR from the circuit B, and the CItruc gene is constantly expressed by the read-through of the most upstream Trc promoter. For this reason, in circuit D, CItruc is always expressed regardless of the AHL concentration.

  Circuit A and circuit B were prepared by cloning LuxR, transcription terminator, Lux promoter, and full length of CI gene or CItruc into pTrc99a derivative. Circuit C was prepared by removing RBS of the CI protein from circuit B. Circuit D was created by removing the sequence from the transcription terminator of circuit B to the promoter.

  In order to confirm whether the circuits A-D work as designed, these circuits were co-expressed in the TK-deficient E. coli strain JW1226 together with the screening plasmid pPL-gfpuv. PL is a promoter that is suppressed by the CI protein, and emits fluorescence when the expression level of the CI protein is low. That is, when coexisting with circuit A or circuit B, pPL-gfpuv inverts the AHL input and outputs fluorescence. The cells were cultured at 37 ° C. for 12 hours in LB medium containing 100 μg / mL ampicillin and having different AHL concentrations. The cell density (OD600 = 2) of the culture medium was prepared, and the fluorescence value in each AHL medium was measured (Fluoroskan Ascent (Thermo), Excitation filter: 390 nm (half width 20 nm), Fluorescence (Emission) filter : 510 nm (half-width 10 nm)).

  The results are shown in FIG. 4-B panel (a). Cells with circuit C did not depend on the AHL concentration and always showed high fluorescence intensity. Also, cells with circuit D always showed low (background level) fluorescence intensity, independent of AHL concentration. On the other hand, in cells transformed with circuit A and circuit B, the fluorescence intensity of GFPuv decreased depending on the AHL concentration. This is because the expression level of CI protein increased as the AHL concentration increased, and the expression of the gfpuv gene under the PL promoter was suppressed by the action of the CI protein. However, the response threshold for AHL switching was higher in cells with circuit B than in cells with circuit A.

  Using these four gene circuits, the ON selection method established in Example 2 was verified. Specifically, the plasmids having each of these four circuits are co-introduced into the same TK-deficient cells together with the plasmid having the hsvTK gene under the control of the PL promoter, and ON selection is performed in a medium with a different AHL concentration. went.

  The results are shown in panel (b) of Fig. 4-B. In circuit A, the survival rate rapidly decreased at an AHL concentration of 10 nM or more. This is due to the fact that the expression of CI protein is enhanced by LuxR complexed with AHL, and as a result, the expression of hsvTK is effectively suppressed by CI protein and the salvage pathway is not activated. Since panel (a) and panel (b) in FIG. 4-B show similar patterns, it can be seen that the cell viability corresponds 1: 1 with the activation state of hsvTK expression. Circuit B showed similar results to circuit A, but the survival rate with circuit B was particularly high in the high AHL concentration range. This is because CItruc's ability to suppress the expression of hsvTK is lower than that of the wild-type CI protein. In addition, both the circuit A and the circuit B showed a survival rate about 100 times lower than that of the circuit C. This means that the Lux promoter is leaky, meaning that even if the expression of the CI protein is OFF under high AHL conditions, the Lux promoter will express a small amount of the CI protein, and thereby downstream of the CI promoter. This is due to the partial suppression of hsvTK.

  Furthermore, the OFF selection method established in Example 1 was verified using these four gene circuits. Specifically, the plasmids having each of these four circuits are co-introduced into the same TK-deficient cells together with the plasmid having the hsvTK gene under the control of the PL promoter, and OFF selection is performed in media with different AHL concentrations. went.

  The results are shown in FIG. 4-B panel (c). In circuit A and circuit B, the viable cell count increased depending on the AHL concentration. This is because LuxR complexed with AHL increased the expression of CI protein, and as a result, the CI protein effectively suppressed the expression of hsvTK. This is due to survival without being affected.

  From the above results, it was clarified that the created four genetic circuits operate as designed in the OFF selection method and the ON selection method established in Examples 1 and 2.

  The selection of the desired gene switch and gene circuit was examined using the OFF selection method and ON selection method of the gene switch and gene circuit. ON selection and OFF selection were performed using a solid medium. In this study, OFF selection was performed continuously after ON selection (dual selection). The dual selection process and the results are shown in FIG.

Specifically, the gene circuits B, C and D prepared in Example 4 are mixed, and from that, a sufficient amount of CI protein is expressed by adding circuit B, that is, the activation substance AHL, and when AHL is not added We investigated the detection of a circuit that does not express CI protein. First, TK-deficient E. coli strain holding circuit B and pPL-hsvtk (referred to as Switch2 cells), TK-deficient E. coli strain holding circuit C and pPL-hsvtk (referred to as ON cells), and circuit D and pPL-hsvtk. Retained TK-deficient E. coli strains (referred to as OFF cells) were prepared and mixed approximately 1: 1: 1. The cell pool was subjected to ON selection and then OFF selection ((a) of FIG. 5). ON selection, was inoculated mixed cells on LB medium without AHL, was 12 hours at 37 ° C., the cultures of 10μg / mL 5FdU, of 10 [mu] g / mL dT, and 10 [mu] g / mL of uridine This was carried out by inoculating the contained tryptone solid medium and incubating at 37 ° C. for another 20 hours. Colonies that survived and formed by ON selection were collected in LB liquid medium, inoculated into LB medium containing 1 μM AHL, and cultured at 37 ° C. for 3 hours. 20 μL (approximately 10 ⁶ cells) of the culture was collected and subjected to OFF selection. That is, colonies were formed by inoculating LB solid medium containing 100 nM dP and 1 μM AHL. Then, the cell group was collect | recovered and the plasmid was extracted. The extracted plasmid was co-transformed into XL10 Gold with pPL-gfpuv, and the activity of the gene circuit was evaluated by the fluorescence of GFPuv. Transformants were inoculated into solid medium with and without 1 μM AHL. After 12 hours, the selection efficiency was measured by comparing the number of cells expressing GFPuv with the number of cells not expressing on two solid media.

  The first ON selection selected Switch2 cells holding circuit B and ON cells having circuit C. By further selecting OFF, the ON cells having the circuit C almost disappeared, and only the Switch2 cells holding the circuit B were collected ((c) in FIG. 5).

  The selection of the desired gene switch and gene circuit was examined by dual selection using the OFF selection method and ON selection method of the gene switch and gene circuit. OFF selection and ON selection were performed using a liquid medium ((b) of FIG. 5). Performing dual selection in liquid media is an essential requirement for reduced operating time and automation.

  Specifically, the gene circuits B, C and D prepared in Example 4 are mixed, and from that, a sufficient amount of CI protein is expressed by adding circuit B, that is, the activation substance AHL, and when AHL is not added In this study, a circuit that does not express CI protein was concentrated / obtained from a mixture with other circuits (C, D). First, the OFF cells, ON cells, and Switch2 cells prepared in Example 5 were mixed at a ratio of 1000: 1000: 1 or 10000: 10000: 1. ON cells, OFF cells, and Switch2 cells retain circuits C, D, and B and pPL-hsvtk, respectively. These mixed cells were subjected to OFF selection and ON selection. More specifically, the mixed cells are cultured overnight and then diluted in 1 mL LB medium containing 100 μg / mL ampicillin and 30 μg / mL chloramphenicol to achieve a cell density such that the final OD600 is 0.002. Was prepared. OFF selection was performed by incubation for 1 hour in the presence of AHL (1 μM) and dP (100 nM). Next, the cells obtained by OFF selection were collected by centrifugation, washed twice with 1 mL of 0.9% w / v NaCl solution, resuspended in 1 mL of LB medium, and cultured at 37 ° C. for 2 hours. 10 μL was collected, added to 1 mL of positive selection medium not containing AHL, and cultured for 20 hours while rotating at 200 rpm to perform ON selection. Then, the cell group was collect | recovered and the plasmid was extracted. The extracted plasmid was co-transformed into XL10 Gold with pPL-gfpuv, and the activity of the gene circuit was evaluated by the fluorescence of GFPuv. Transformants were inoculated into solid medium with and without 1 μM AHL. After 12 hours, the selection efficiency was measured by comparing the number of cells expressing GFPuv with the number of cells not expressing on two solid media.

The results are shown in Table 1. When OFF cells, ON cells, and Switch2 cells were mixed at a ratio of 1000: 1000: 1, the ratio of Switch2 cells in the mixed cells before dual selection was 0.05%, but after dual selection, 83.6 The concentration rate was 1.67 × 10 ³ times. In addition, when OFF cells, ON cells, and Switch2 cells were mixed at a ratio of 10000: 10000: 1, the ratio of Switch2 cells contained in the mixed cells before dual selection was 0.005%. Was concentrated to 82.0%, and the concentration rate was 1.64 × 10 ⁴ times.

  In the dual selection, the ON selection is performed after the OFF selection is first performed. Even if the order of selection is reversed, the same selection result is obtained (unpublished data).

  Thus, by using OFF selection and ON selection according to the present invention, many non-functional gene switches and gene circuits, that is, functional cell switches and gene circuits that are very slightly contained in OFF cells and ON cells, That is, it was verified that Switch2 cells can be selected with high efficiency and in a short time and can be further concentrated.

  Using the selection and OFF selection methods for gene switches and gene circuits established in Examples 1 and 2, separation selection of gene switches and gene circuits with different output characteristics (applied threshold) was studied by dual selection. .

  Specifically, TK-deficient E. coli strain holding circuit A and pPL-hsvtk (referred to as Switch1 cell), TK-deficient E. coli strain holding switch B and pPL-hsvtk (Switch2 cell) are mixed at a ratio of 1: 1. Then, OFF selection was performed using 10 nM AHL, and then ON selection was performed using 5FdU in the absence of AHL. PCR was performed using the culture solution after each selection process, and the cell ratio including each circuit was measured. As shown in FIG. 6-A, circuit A and circuit B can be distinguished by PCR. In both circuit A and circuit B, a certain region of the circuit including a part of the CI structural gene is PCR amplified by the same primer set. Circuit A contains the wild type of the CI structural gene, while circuit B contains the deletion mutant of the CI structural gene, so the PCR product (367 bp) using circuit B as a template is a PCR product using circuit A as a template. Its length is shorter than (639bp). This gives two different length bands in the PCR of the mixture of both. The abundance ratio of both is determined from the band intensity ratio.

  The results are shown in Fig. 6-B. In the mixed cells before selection, both bands of Switch1 cells and Switch2 cells could be confirmed with almost the same intensity (lane 3 in Fig. 6-B). After the OFF selection, the band of Switch1 cells was darker (lane 4 in Fig. 6-B). Under conditions using 10 nM AHL, Switch1 cells more strictly suppress hsvTK expression than Switch2 cells (FIG. 4-B panel (a)). After the subsequent ON selection, the band intensities of both the Switch1 and Switch2 cells were equivalent to the band intensity after the OFF selection (lane 5 in FIG. 6-B).

  The difference between Switch1 cells and Switch2 cells is the difference in the circuits they hold. The Switch1 cell holds a circuit A containing a gene encoding the full-length CI protein, and the Switch2 cell holds a circuit B containing a gene encoding CItruc. Both circuits act as a genetic circuit that turns ON / OFF the expression of CI protein depending on the concentration of AHL, but the suppression of CI protein expression is higher in circuit A than in circuit B. Switch1 cells retaining circuit A were enriched efficiently.

  Thus, by using OFF selection and ON selection according to the present invention, a gene switch and a gene circuit having a desired characteristic function can be selected.

  The selection of a gene switch having various response thresholds (different sensitivities) to a gene switch activator and a gene circuit having the gene switch was examined. As AHL, N- (3-oxo-hexanoyl) -L-homoserine lactone (N- (3-oxo-hexanoyl) -L-homoserine lactone, abbreviated as 3OC6) and N- (3-oxo-octanoyl) -L -Homoserine lactone (N- (3-oxo-octanoyl) -L-homoserine lactone, abbreviated as 3OC8) was used.

  First, a library in which random mutations were accumulated in the LuxR protein (homoserine lactone sensor derived from vibrio) was constructed using mutant PCR. Using the TK-deficient E. coli strain JW1226 into which these libraries were introduced, ON selection established in Example 2 was performed in the presence of various concentrations of AHL (FIGS. 8 and 9). Next, E. coli that survived by ON selection with each concentration of AHL was seeded in a medium containing AHL at a concentration different from that at the time of ON selection, and OFF selection established in Example 1 was performed (FIGS. 8 and 9). ). Plasmid DNA containing LuxR gene was extracted from the surviving E. coli according to a conventional method. The obtained plasmid DNA and the plasmid having Plux-gfp derived from pACYC were co-introduced into E. coli, and the fluorescence intensity was measured in the presence of various concentrations of AHL.

  As a result, as shown in FIG. 9, LuxR mutants having various response thresholds were obtained reflecting the AHL concentration at the time of ON selection and OFF selection.

  Thus, by performing ON selection and OFF selection according to the present invention in the presence of various concentrations of gene switch activator, the gene switch having different sensitivity to the gene switch activator and the gene switch Can be selected.

  The improvement of the selectivity of the gene switch and gene circuit for the activator was investigated. AHL of various structures was used as an activator. AHL is a molecule used by various gram-negative bacteria for cell-to-cell communication, and various AHLs with different structures such as those with different acyl group lengths and those with different structures around the Oxo group at the 3-position and the lactone ring are known. It has been. In this example, N- (3-oxo-hexanoyl) -L-homoserine lactone (N- (3-oxo-hexanoyl) -L-homoserine lactone, abbreviated as 3OC6), N- (3-oxo-octanoyl) -L-homoserine lactone (N- (3-oxo-octanoyl) -L-homoserine lactone, abbreviated as 3OC8), N- (3-oxo-decanoyl) -L-homoserine lactone (N- (3-oxo-decanoyl) ) -L-homoserine lactone, abbreviated as 3OC10), N- (3-oxo-dodecanoyl) -L-homoserine lactone (abbreviated as N- (3-oxo-dodecanoyl) -L-homoserine lactone, 3OC12), N -Hexanoyl-homoserine lactone (N-hexanoyl-homoserine lactone, abbreviated as C6) and N-octanoyl-homoserine lactone (abbreviated as C8) were used (FIG. 10).

  First, a LuxR mutant library was constructed in the same manner as in Example 8. Using the TK-deficient E. coli strain JW1226 into which these libraries were introduced, ON selection established in Example 2 was performed in the presence of various types of AHL (FIG. 8). Next, E. coli that survived the ON selection with each type of AHL was inoculated on a medium containing a different type of AHL different from the ON selection, and the OFF selection established in Example 1 was performed (FIG. 8). Plasmid DNA containing LuxR gene was extracted from the surviving E. coli according to a conventional method. The obtained plasmid DNA and the plasmid having Plux-gfp derived from pACYC were co-introduced into E. coli, and the fluorescence intensity was measured in the presence of various concentrations of AHL.

  As a result, as shown in FIG. 10, LuxR mutants having various ligand specificities were obtained reflecting the types of AHL at the time of ON selection and OFF selection. Wild-type LuxR protein showed high reactivity at 100 nM to both 3OC6 and 3OC8, but was less reactive to 3OC10 and C6, and even less reactive to 3OC12 and C8 (Figure 10 panel a). ). ON selection in the presence of 3OC8 and OFF selection in the presence of 3OC6 show high reactivity to 3OC8 but low or no reactivity to other types of AHL, i.e. specific for 3OC8 A LuxR mutant I58N having a phenotype was obtained (panel b in FIG. 10). Also, ON selection in the presence of 3OC6 and OFF selection in the presence of 3OC8 show high reactivity to 3OC6 but low or no reactivity to other types of AHL, i.e. to 3OC6. A LuxR mutant Y62H with specificity could be obtained (panel C in FIG. 10). Furthermore, by selecting ON in the presence of C8, a LuxR mutant C245W having almost the same reactivity with all types of AHL examined was obtained (panel d in FIG. 10). It has been reported that the I58N mutation is a mutation found in a homologous protein called TraR, and that the Y62H mutation is a mutation involved in the recognition of the keto group at position 3.

  Thus, by performing ON selection and OFF selection according to the present invention in the presence of various types of gene switch activators, gene switches having different specificities for gene switch activators and the genes A genetic circuit having a switch can be selected.

  In addition to selection of gene switches and gene circuits, improvement of the selectors was examined so that the functions of the selected gene switches and gene circuits could be confirmed.

  A plasmid pLux-gfp-hsvTK in which the GFP gene and the hsvTK gene are arranged in tandem downstream of the Lux promoter was prepared. Specifically, the GFP gene and the hsvTK gene were amplified by PCR and connected by SOEing PCR. The PCR product was inserted through the NcoI-HindIII site of the plasmid plux-hsvTK in which the hsvTK gene was placed downstream of the plasmid lux promoter. The plasmid map of this plasmid is shown in FIG. 11-A, and its sequence is shown in SEQ ID NO: 1. In addition, a plasmid pCI-gfp-hsvTK in which the GFP gene and the hsvTK gene were arranged in tandem downstream of the λPR promoter (CIP) was prepared. Specifically, the GFP gene and the hsvTK gene were amplified by PCR and connected by SOEing PCR. The PCR product was inserted at the NcoI-HindIII site of the plasmid pCI-hsvTK in which the hsvTK gene was placed downstream of the λPR promoter. A plasmid map of this plasmid is shown in FIG. 11-B, and its sequence is shown in SEQ ID NO: 2. In order to examine the function of these selectors, a plasmid pTrc-LuxR containing the LuxR gene downstream of the Trc promoter was prepared. pTrc-LuxR constantly expresses LuxR protein by the action of the Trc promoter.

  First, pLux-gfp-hsvTK was introduced into TK-deficient E. coli strain JW1226 together with pTrc-LuxR, and fluorescence was observed in the presence of various concentrations of AHL.

  As a result, AHL-dependent fluorescence output was observed (FIG. 11-C). In this way, it was observed that LuxR was activated depending on AHL. Similarly, by using pCI-gfp-hsvTK, it is possible to visually check whether AHL-dependent CIP has been activated.

  Next, it was examined whether the cells into which these plasmids were introduced retained the hsvTK selector function, that is, the dP kinase function responsible for the OFF selector function and the dT kinase activity responsible for the ON selector function. The dP kinase function of hsvTK, pLux-hsvTK and pLux-gfp-hsvTK were separately introduced into TK-deficient E. coli strain JW1226 together with pTrc-LuxR, and these transformed cells were cultured separately in 2 mL of LB medium. Each culture solution is inoculated to 1/1000 LB medium containing 1 μM dP with or without AHL, and cultured at 37 ° C for 2 hours. The number of bacteria was measured. In addition, the dT kinase function of hsvTK is that pLux-hsvTK and pLux-gfp-hsvTK were separately introduced into TK-deficient E. coli strain JW1226 together with pTrc-LuxR, and these transformed cells were cultured separately in 2 mL of LB medium. After that, each culture solution was added with 1 mL of TK selection medium (tryptone 2 w / v%, NaCl 0.5 w / v%, thymidine 10 μg / mL, adenosine 1 μg / mL, 5FdU 20 μg, with or without AHL. / mL) was inoculated to 1/1000, cultured at 37 ° C. for 20 hours, seeded on a plate, and the viable cell count was measured.

  As a result, in the cells transfected with pLux-gfp-hsvTK, hsvTK expression due to the addition of AHL rapidly lost the cell proliferation ability in the presence of dP (left panel in Fig. 12), and in the presence of 5FdU and thymidine. On the contrary, it increased. Thus, by using a plasmid in which the GFP gene and the hsvTK gene are arranged in tandem downstream of the Lux promoter, selecting one that does not express this operon in the presence of dP (OFF selection), and 5FdU Those that express this operon in the presence of thymidine can be selected (ON selection).

  By placing a gene encoding a fluorescent protein in the selector plasmid in addition to the selector gene, not only ON selection and OFF selection by the selector gene, but also the activation state of the promoter in the selector plasmid depends on the presence or absence of the expression of the fluorescent protein. It became possible to see.

  Herpesvirus-derived thymidine kinase (hsvTK) is a very excellent dP / dT kinase and can therefore be used as a powerful dual selector for gene switches and gene circuits. In order to search for kinases that can be used as dual selectors other than hsvTK, the function of nucleoside kinases derived from multiple organisms as selectors was evaluated.

First, plasmids were prepared that expressed nucleoside kinases derived from multiple types of organisms. Specifically, the plasmids described below and a negative control plasmid, in which a gene encoding nucleoside kinase was placed downstream of the Trc promoter, were prepared by a conventional method:
(1) a plasmid (pTrc-hsvtk) containing a human herpesvirus-derived thymidine kinase gene,
(2) a plasmid containing a thymidine kinase gene derived from E. coli (pTrc-ecotk),
(3) Drosophila (Drospophila) be from nucleoside kinase (Dmk) gene, a plasmid containing a gene codon-optimized E. coli (pTrc-dmdnk),
(4) a negative control plasmid (pTrc-hsvtk (E83K)) containing a gene encoding an inactive form of hsvTK,
(5) a negative control plasmid containing the GFP gene (pTrc-gfp), and
(6) An empty vector (pTrc-99a) containing no gene under the Trc promoter.

  All genes are expressed in the pTrc vector. Since it is a vector carrying LacI, the pTrc promoter has higher stringency than that of LacP, but it still has leaky expression. In this experiment, without inducer such as IPTG, various kinases were expressed intracellularly by this leakage expression, and the kinase titer was measured.

Evaluation of the OFF selector function of the prepared plasmid was performed. Each plasmid was introduced separately into E. coli strain JW1226. The transformant was inoculated into 2 mL of LB medium and cultured at 37 ° C. for 12 hours. 1 μL of each culture solution was inoculated into 1 mL of LB liquid medium containing dP at a concentration of 0-10 ⁴ nM and cultured at 37 ° C. for 6 hours. Bacteria were collected from the culture by centrifugation and resuspended in fresh LB medium. The suspension was inoculated and cultured in an LB solid medium, and the number of viable bacteria was measured from the number of colonies formed.

  Evaluation of the ON selector function of the prepared plasmid was performed. Each plasmid was introduced separately into E. coli strain JW1226. The transformant was inoculated into 2 mL of LB medium and cultured at 37 ° C. for 12 hours. Inoculate 1 μL of each culture in 1 mL of positive selection medium (tryptone 2 w / v%, deoxythymidine (dT) 10 μg / mL, deoxyadenosine (dA) 1 μg / mL, 5FdU 20 μg / mL or 0 μg / mL) And cultured at 37 ° C. for 24 hours. Bacteria were collected from the culture by centrifugation and resuspended in fresh LB medium. The suspension was inoculated and cultured in an LB solid medium, and the number of viable bacteria was measured from the number of colonies formed.

  As shown in Fig. 13-A, when dP was added to the medium, all of the E. coli expressing hsvTK, E. coli-derived thymidine kinase, and Drospophila nucleoside kinase kinases had a dP concentration-dependent viable count. Showed a reduction. Of these, Escherichia coli expressing hsvTK showed the most remarkable reduction in the number of viable bacteria. At dP concentration of about 10 nM, E. coli expressing thymidine kinase from E. coli and Drosophila nucleoside kinase showed almost no change in viable count, but E. coli expressing hsvTK showed viable count as low as 6-7 orders of magnitude. . This indicates that hsvTK is the most preferred dP kinase as an OFF selector. However, since the dP concentration was sufficiently low under these experimental conditions, there was almost no decrease in the number of viable bacteria in the negative control in which GFP or inactivated hsvTK was expressed. When the dP concentration was sufficiently high, cell death was efficiently induced by expressing thymidine kinase derived from E. coli and nucleoside kinase of Drosophila. Therefore, it was found that these can be used sufficiently for OFF selection.

  On the other hand, as shown in FIG. 13-B, when comparing the growth efficiency in 5FdU / dT medium (ON selective medium), the titers of hsvTK, thymidine kinase from E. coli, and nucleoside kinase of Drospophila as dT kinases I found no big difference. The dT kinase activity of hsvTK is slightly better. Thus, these three types of kinases all showed good functions as ON selectors.

  As described above, it has been shown that hsvTK, E. coli-derived thymidine kinase, and Dropophila nucleoside kinase can all be used as an ON selector and an OFF selector. Of these, hsvTK was found to have the highest function of ON selector and OFF selector.

  hsvTK is an excellent dual selector, but its gene size is a little large (1.1 kb), so a truncated hsvTK (hereinafter referred to as TKlite) that lacks the N-terminal 45 amino acids is aimed at creating a more compact selector with the same function. The gene coding for this was prepared by a conventional method, and its selector function was examined.

  For the preparation of the plasmid pTrc-hsvtk lite containing the TKlite gene, first, primer 1 (SEQ ID NO: 5 in the sequence listing: A fragment of the hsvtk gene having the desired 5 ′ end was amplified by PCR using TTTTCCATGGCCACGCTACTGCGG) and primer 2 (SEQ ID NO: 6 in the sequence listing: TTTTAAGCTTTCAGTTAGCCTCCCCCCAT). Thereafter, column purification was performed, the amplified fragment and a restriction enzyme (NcoI 10 unit / HindIII 10 unit) were mixed, incubated at 37 ° C. for 1 hour, and column purified. In parallel, pTrc-gfp (1 μg) and a restriction enzyme (NcoI 10 unit / HindIII 10 unit) were mixed, incubated at 37 ° C. for 1 hour, and the vector portion was purified by gel extraction. Further SAP treatment was performed for 30 minutes. The above fragment (insert: 100 ng) and pTrc-gfp digest (vector: 100 ng) were ligated. The obtained product was seeded on an LB-Amp plate and cultured. The presence or absence of the target plasmid in the formed colonies was confirmed by colony PCR, the colonies were isolated and cultured, and then the plasmids were recovered. A plasmid map of this plasmid pTrc-hsvtk lite is shown in FIG. 14, and its sequence is shown in SEQ ID NO: 4.

  The OFF selector function of the prepared plasmid pTrc-hsvtk lite was evaluated. As a control, a plasmid containing the wild type hsvTK gene (referred to as pTrc-hsvtk (WT) in this example) and a plasmid containing the GFP gene (referred to as pTrc-gfp) were used. Each plasmid was introduced separately into E. coli strain JW1226. The transformant was inoculated into 2 mL of LB medium and cultured at 37 ° C. for 12 hours. 1 μL of each culture solution was inoculated into 1 mL of LB liquid medium containing no dP or containing 1 μM dP, and cultured at 37 ° C. for 1 hour. 20 μL of the culture solution was collected, mixed with 2 mL of LB medium (without dP addition), and cultured at 37 ° C. for 12 hours. The dP sensitivity was examined by measuring the change in OD600 during culture and examining the change in turbidity of E. coli.

  The ON selector function of the prepared plasmid pTrc-hsvtk lite was evaluated. PTrc-hsvtk (WT) and pTrc-gfp were used as controls. Each plasmid was introduced separately into E. coli strain JW1226. The transformant was inoculated into 2 mL of LB medium and cultured at 37 ° C. for 12 hours. 1 μL of each culture is inoculated into 2 mL of TK selection medium (tryptone 2 w / v%, NaCl 0.5 w / v%, thymidine 10 μg / mL, adenosine 1 μg / mL, 5FdU 20 μg / mL or no addition), and 37 The cells were cultured at 24 ° C. for 24 hours. Changes in OD600 during the culture were measured to examine 5FdU sensitivity.

  As shown in FIG. 15-A, in the presence of dP, neither E. coli expressing TKlite nor E. coli expressing wild-type hsvTK showed an increase in OD after 12 hours. In the absence of dP, both of these two types of E. coli increased OD, as did E. coli not expressing hsvTK. Thus, it was found that by expressing TKlite, cell death due to dP occurs in the same manner as when wild-type hsvTK is expressed. In addition, cytotoxicity due to expression of hsvTK could not be confirmed.

  As shown in FIG. 15-B, in the presence of 5FdU, growth was observed in both E. coli expressing TKlite and E. coli expressing wild type hsvTK. However, the growth rate of E. coli expressing TKlite was found to be slower than that of E. coli expressing wild type hsvTK. This suggests that TKlite has a dT kinase activity, that is, an ON selector function lower than that of wild-type hsvTK.

  From the above results, it was found that TKlite exhibits functions as an ON selector and an OFF selector, like the wild-type full-length hsvTK. Since TKlite is small compared to the full length hsvTK, it has the advantage that the construct size can be reduced when performing more complex selections in combination with other known selectors such as tetA.

  The selector plasmid was improved. In Example 10, a selector plasmid was prepared in which a gene encoding a fluorescent protein was placed in addition to the selector gene. With this plasmid, not only ON selection and OFF selection by the selector gene, but also the activation state of the promoter in the selector plasmid Can be visually recognized by the presence or absence of the expression of the fluorescent protein. Furthermore, a selector plasmid containing a fusion gene of a selector gene and a gene encoding a fluorescent protein was prepared in order to more efficiently select a cis sequence and select a riboswitch and a post-transcriptional regulator.

  First, using the XbaI site before the gfp stop codon of pCI-gfp-hsvtk used in Experiment 10 and the SpeI site immediately before hsvtk, a plasmid containing a fusion gene of the GFP gene and the hsvTK gene was prepared by a conventional method. . A plasmid map of this plasmid pCI-gfp-hsvTK_fused is shown in FIG. 16, and its sequence is shown in SEQ ID NO: 3.

  pCI-gfp-hsvTK_fused was introduced into TK-deficient E. coli strain JW1226, inoculated into LB medium, and cultured at 37 ° C. for 12 hours. 1 μL of each culture solution was inoculated with 2 mL of LB liquid medium containing no dP or 1 μM of dP, and cultured at 37 ° C. for 12 hours. 200 μL of the culture solution was collected, and the fluorescence intensity was measured at Ex485nm / Em527nm. In addition, the cells were collected by centrifugation, and the pellets were photographed under UV irradiation. As a control, a plasmid (pCI-hsvTK) in which the hsvTK gene was arranged downstream of the λPR promoter was used, introduced into JW1226, treated in the same manner, and the fluorescence intensity was measured.

  The OFF selector function of the prepared plasmid was evaluated. Each plasmid was introduced separately into E. coli strain JW1226. The transformant was inoculated into 2 mL of LB medium and cultured at 37 ° C. for 12 hours. 1 μL of each culture solution was inoculated into 2 mL of LB liquid medium containing no dP or containing 1 μM dP, and cultured at 37 ° C. for 1 hour. 20 μL of the culture solution was collected, mixed with 2 mL of LB medium (without dP addition), and cultured at 37 ° C. for 12 hours. The dP sensitivity was examined by measuring the change in OD600 during culture and examining the change in turbidity of E. coli.

  Evaluation of the ON selector function of the prepared plasmid was performed. Each plasmid was introduced separately into E. coli strain JW1226. The transformant was inoculated into 2 mL of LB medium and cultured at 37 ° C. for 12 hours. 1 μL of each culture is inoculated into 2 mL of TK selection medium (tryptone 2 w / v%, NaCl 0.5 w / v%, thymidine 10 μg / mL, adenosine 1 μg / mL, 5FdU 20 μg / mL or no addition), and 37 The cells were cultured at 24 ° C. for 24 hours. Changes in OD600 during the culture were measured to examine 5FdU sensitivity.

  As shown in FIG. 17-A, the fluorescence signal in the transformant into which pCI-gfp-hsvTK_fused was introduced was not so large, but its fluorescence intensity was 5 times that of the one not expressing GFP. It was expensive. Compared with the plasmids pLux-gfp-hsvTK and pCI-gfp-hsvTK (Example 10) in which the GFP gene and the hsvTK gene are arranged in tandem, the fluorescence signal is reduced.

  As shown in FIG. 17-B, both the E. coli constitutively expressing the GFP-hsvTK fusion protein and the E. coli constitutively expressing hsvTK showed a slight increase in OD after 12 hours in the presence of dP. However, in any E. coli, the degree of increase was about 1/200 compared to the case where dP was not added. It became clear that cell death by dP occurred. Thus, it was found that by expressing the GFP-hsvTK fusion protein, cell death due to dP occurs as in the case of expressing hsvTK.

  As shown in FIG. 17-C, both E. coli constitutively expressing the GFP-hsvTK fusion protein and E. coli constitutively expressing hsvTK showed an increase in OD after 24 hours even in the presence of 5FdU. In E. coli expressing the GFP-hsvTK fusion protein, the increase in OD in the presence of 5FdU was slower than in E. coli expressing hsvTK, and the OD was about 1/10 even after 12 hours. After 24 hours, the OD of E. coli expressing the GFP-hsvTK fusion protein was almost the same as the OD of E. coli expressing hsvTK. On the other hand, almost no growth of E. coli not expressing hsvTK was observed after 24 hours in the presence of 5FdU.

  From the above results, it was found that the GFP-hsvTK fusion protein exhibited functions as an ON selector and an OFF selector, like the full-length hsvTK.

  The use of OFF selection using the hsvTK gene according to the present invention as an OFF selector was examined as a stuffer. When cloning huge libraries such as cDNA and metagenomic sources into plasmids, the higher the percentage of those correctly cloned, the better. However, due to vector back ligation and contamination with “unrestricted restriction enzyme” plasmids, there are many cloning artifacts during cloning. In the old days, blue and white selection using the LacZ α subunit has been used as a method for removing cloning artifacts. However, with the increase in the scale of libraries and the automation of processes, restriction sites are now included in the vectors used. Alternatively, a removal method using a toxic protein such as ccdb as a stuffer is used. The usefulness of OFF selection according to the present invention was investigated as a method for removing cloning artifacts.

  First, pTrc-hsvTK was used as a vector, and the NcoI site and HindIII site before and after the open reading frame (ORF) of this hsvTK were used to perform subcloning of the GFP gene by a conventional method. Specifically, 750 ng of pTrc-hsvTK, restriction enzymes NcoI 10 unit and HindIII 20 unit were mixed and incubated at 37 ° C. for 30 minutes. Gel extraction was not performed, and purification was performed by column purification. Thereafter, SAP treatment was performed for 30 minutes to obtain a cut product of pTrc-hsvTK. In parallel with this operation, the gfp part of 750 ng of pTrc-gfp was amplified by PCR and treated with restriction enzymes NcoI 10 unit and HindIII 20 unit for 120 minutes. Gel extraction was performed to obtain the GFP gene except for the PCR template and other DNA. The pTrc-hsvTK digest (vector: 100 ng) and the GFP gene (insert: 50 ng) were ligated. This product was introduced into E. coli strain XL10-Gold KanR (Stratagene). The transformant was seeded on an LB-Amp plate containing no dP, or containing 100 nM dP or 1 μM dP, and cultured at 37 ° C. for 12 hours. The presence or absence of GFP fluorescence in the formed colonies was measured, and the ratio of the number of fluorescent colonies to the number of non-fluorescent colonies was calculated.

  As shown in Table 2, only Escherichia coli seeded in a medium containing dP was correctly inserted. Thus, it was found that only slabs with LB-Amp plates added with a low concentration of dP were selected when hsvTK was correctly excised and replaced with the desired gene, the GFP gene.

  The efficiency of OFF selection using the hsvTK gene according to the present invention as an OFF selector is extremely high. Moreover, the OFF selection according to the present invention has the advantage that hsvTK itself is not toxic and induces cell death only when dP is given. That is, the OFF selection according to the present invention has a great feature in that it can be handled extremely stably, unlike the method of using a compound that always exhibits toxicity such as ccdb. That is, the OFF selection according to the present invention contributes not only as a method of selecting a gene switch but also in improving the quality in automation of plasmid cloning and library construction.

  ADVANTAGE OF THE INVENTION According to this invention, the method which can perform the selection and acquisition of the gene switch and gene circuit which have a desired characteristic and / or function rapidly and with high efficiency can be provided.

  The present invention is a very useful invention that contributes widely to fields such as protein production, metabolic engineering, and synthetic biology.

SEQ ID NO: 1: A designed plasmid DNA (referred to as pLux-gfp-hsvTK) in which a green fluorescent protein (GFP) gene and a human herpesvirus-derived thymidine kinase (hsvTK) gene are arranged in tandem downstream of the Lux promoter.
SEQ ID NO: 2: A designed plasmid DNA (referred to as pCI-gfp-hsvTK) in which a green fluorescent protein (GFP) and a human herpesvirus-derived thymidine kinase (hsvTK) gene are arranged in tandem downstream of the λPR promoter.
SEQ ID NO: 3: Designed plasmid DNA (referred to as pCI-gfp-hsvTK_fused) in which a fusion gene comprising a green fluorescent protein (GFP) gene and a human herpesvirus-derived thymidine kinase (hsvTK) gene is arranged downstream of the λPR promoter.
SEQ ID NO: 4: Designed plasmid DNA (referred to as pTrc-hsvTK lite) containing a gene encoding thymidine kinase derived from truncated human herpesvirus lacking the N-terminal 45 amino acids.
SEQ ID NO: 5: oligonucleotide designed for primer SEQ ID NO: 6: oligonucleotide designed for primer

Claims (22)

An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
Using thymidine kinase deficient cells into which
In the case where the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, de novo of deoxythymidine triphosphate (dTTP) in the absence of a compound that activates the gene switch. After recovering viable cells after incubating the cells with the addition of a synthetic pathway inhibitor, or after incubating the cells with the addition of a mutagenic nucleoside in the presence of a substance that activates the gene switch Recovering living cells, or when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator, adoxythymidine triphosphate in the presence of a compound that activates the gene switch recovering live cells after activating the denovo synthesis pathway inhibitor of (dTTP) and activating the gene switch Recovering viable cells after incubation the cells by adding a mutagenic nucleoside in the absence of quality,
And a method for selecting a genetic circuit. The method for selecting a gene switch and gene circuit according to claim 1, comprising the following steps (1) to (3):
(1) An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
A step for introducing thymidine kinase deficient cells,
(2) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, the cells are incubated with a mutagenic nucleoside in the presence of a substance that activates the gene switch. Or a mutagenic nucleoside is added to the cell in the absence of a substance that activates the gene switch when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator. Incubating the cells; and
(3) A step of collecting live cells. The method for selecting a gene switch and a gene circuit according to claim 2, further comprising the following steps (4) and (5) following the step (3):
(4) The collected live cells are treated with deoxythymidine triphosphate (dTTP) in the absence of a substance that activates the gene switch when the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressor. ) Incubating with an inhibitor of the de novo synthesis pathway, or activating the gene switch if the gene sequence encoding the transcriptional regulator in (f) is a transcriptional activator Adding the inhibitor in the presence of a substance to be incubated and, and
(5) A step of collecting live cells. The method for selecting a gene switch and gene circuit according to claim 1, comprising the following steps (6) to (8):
(6) An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a),
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a transcriptional regulatory factor that operates on the promoter sequence of (a),
A step for introducing thymidine kinase deficient cells,
(7) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressor, deoxythymidine triphosphate (dTTP) is added to the cell in the absence of a substance that activates the gene switch. Incubating with an inhibitor of the de novo synthesis pathway of (2), or activating the gene switch if the gene sequence encoding the transcriptional regulator of (f) is a transcriptional activator Adding the inhibitor to the cell in the presence of a substance to incubate the cell, and
(8) A step of collecting live cells. The method for selecting a gene switch and a gene circuit according to claim 4, further comprising the following steps (9) and (10) following the step (8):
(9) When the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional repressing factor, the recovered live cells are added with a mutagenic nucleoside in the presence of a substance that activates the gene switch. Incubating step, or if the gene sequence encoding the transcriptional regulatory factor of (f) is a transcriptional activator, adding a mutagenic nucleoside in the absence of a substance that activates the gene switch And the process of
(10) A step of collecting live cells. 6. The method for selecting a gene switch and a gene circuit according to any one of claims 1 to 5, wherein the gene sequence encoding thymidine kinase is a gene sequence encoding human herpesvirus-derived thymidine kinase. The method for selecting a gene switch and a gene circuit according to any one of claims 1 to 6, wherein the thymidine kinase-deficient cell is a thymidine kinase-deficient strain of Escherichia coli. The mutagenic nucleoside is 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one (dP) The method for selecting a gene switch and a genetic circuit according to any one of claims 1 to 7. The inhibitor of de novo synthesis pathway of deoxythymidine triphosphate (dTTP) is 5-fluoro-2'-deoxyuridine (5FdU) or a derivative thereof, according to any one of claims 1 to 8. Method for selecting gene switch and gene circuit. The expression vector holding at least the sequences (a) and (b) is an expression vector further comprising a gene sequence encoding a fluorescent protein in addition to the sequences (a) and (b). 2. The method for selecting a gene switch and a gene circuit according to claim 1. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
In the presence of N-acyl-L-homoserine lactone (AHL) and 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido A gene switch and genetic circuit comprising recovering viable cells after adding [4,5-c] [1,2] oxazin-7-one (dP) and incubating the E. coli strain for 5 to 60 minutes Selection method. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Was used in the absence of N-acyl-L-homoserine lactone (AHL) and 5-fluoro-2'-deoxyuridine (5FdU) was added for 12 hours. A method for selecting a gene switch and a genetic circuit, comprising recovering viable cells after incubation for 20 hours. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
In the presence of N-acyl-L-homoserine lactone (AHL) and 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [1,2] Oxazin-7-one (dP) was added and the E. coli strain was incubated for 5 to 60 minutes before harvesting the viable cells and then in the absence of AHL A method for selecting a gene switch and a gene circuit, comprising adding 5-fluoro-2′-deoxyuridine (5FdU) and incubating the E. coli strain for 12 to 20 hours and then recovering living cells. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
Was used in the absence of N-acyl-L-homoserine lactone (AHL) and 5-fluoro-2'-deoxyuridine (5FdU) was added for 12 hours. Viable cells were harvested after 20 hours of incubation, and then 6- (β-D-2-deoxyribo-furanosyl) -3,4-dihydro-8H-pyrimido [4,5-c] [4,5] in the presence of AHL 1,2] A method for selecting a gene switch and a genetic circuit, which comprises adding oxazin-7-one (dP) and incubating the E. coli strain for 5 to 60 minutes and then recovering living cells. The expression vector having at least the sequences (a) and (b) is an expression vector further comprising a gene sequence encoding a fluorescent protein in addition to the sequences (a) and (b). 2. The method for selecting a gene switch and a gene circuit according to claim 1. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
5-fluoro-2'-deoxyuridine (5FdU) was added in the presence of N-acyl-L-homoserine lactone (AHL) at different concentrations and in the absence of AHL. Then, after the E. coli strain was incubated for 12 to 20 hours, the living cells were collected, and then 6- (β-D-2-deoxyribo-furanosyl) -3 in the presence of 1/10 concentration of AHL. , 4-dihydro-8H-pyrimido [4,5-c] [1,2] oxazin-7-one (dP) is added, and the E. coli strain is incubated for 5 to 60 minutes, and then the living cells are collected. To obtain a gene switch and a gene circuit having different sensitivities to AHL. An expression vector having at least the following sequences (a) and (b):
(a) a gene sequence encoding human herpesvirus-derived thymidine kinase,
(b) a promoter sequence operably linked to the sequence upstream of the sequence of (a), which is subjected to the action of the repressor protein CI,
And
An expression vector having at least the following sequences (c) to (f):
(c) a promoter sequence different from the promoter sequence and operably linked to a downstream gene switch expression sequence
(d) the gene switch expression sequence,
(e) a target sequence of a gene switch encoded by the gene switch expression sequence,
(f) a gene sequence in which the target sequence is operably linked and encodes a CI protein that operates on the promoter sequence of (a),
5-fluoro-2'-deoxyuridine (5FdU) was added in the presence of different types of N-acyl-L-homoserine lactone (AHL) and in the absence of AHL. the viable cells were recovered after 20 hours of incubation the E. coli strain from the 12 hours, then the type 6 in the presence of different AHL the (β-D-2- deoxyribonucleic - furanosyl) -3,4 by recovering viable cells after incubation for 60 min the E. coli strain from 5 minutes with the addition of dihydro -8H- pyrimido [4,5-c] [1,2] Okizajin-7-one (dP), AHL A method for selecting a gene switch and a gene circuit, comprising obtaining a gene switch and a gene circuit having different specificities. 18. The method for selecting a gene switch and a gene circuit according to claim 16, wherein the gene switch expression sequence is a gene sequence encoding a LuxR mutant. The expression vector having at least the sequences (a) and (b) is an expression vector further comprising a gene sequence encoding a fluorescent protein in addition to the sequences (a) and (b). 2. The method for selecting a gene switch and a gene circuit according to claim 1. 20. An expression vector comprising at least a gene sequence encoding thymidine kinase and a promoter sequence operably linked to the gene sequence upstream of the gene sequence, and the gene switch and gene according to any one of claims 1 to 19 An expression vector used in a circuit selection method. 20. An expression vector comprising at least a gene sequence encoding thymidine kinase and a gene sequence encoding a fluorescent protein, and a promoter sequence operably linked to the gene sequence upstream of these gene sequences, An expression vector used in the method for selecting a gene switch and a genetic circuit according to any one of the above. The expression vector according to claim 21, which comprises a DNA represented by the nucleotide sequence set forth in SEQ ID NO: 2 or 3 in the sequence listing.