JP2011105634A - Collagen synthesis promoter - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a collagen synthesis promotor containing glycylproline of a dipeptide of glycine and proline, a skin external preparation, and a drug composition. <P>SOLUTION: Glycylproline of a dipeptide of glycine and proline includes an effect of promoting the synthesis of collagen which decreases with ageing or diseases. Particularly, the glycylproline promotes the synthesis of type 12 collagen and is effective as a drug composition for preventing or improving skin ageing or ophthalmic diseases in which type 12 collagen participates. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

The present invention relates to a collagen synthesis promoter containing a specific peptide, and also relates to a pharmaceutical composition for preventing or improving skin aging and eye diseases involving type 12 collagen.

Human skin is composed of an epidermis and a dermis layer from the outside. In particular, the dermis layer constituting the inside occupies a volume of 90% or more of the skin and plays a role of supporting the skin. The state of the dermis layer has a great influence on the skin surface and surface morphology. The cause of skin aging, such as skin wrinkles and tarmi, is thought to be largely related to the fact that the dermis becomes thinner and fades.

In order to prevent such skin aging, several attempts have been made to improve the skin condition by using peptides on the skin. For example, it is known that cosmetics containing oligopeptides among peptides prevent skin aging such as suppressing wrinkles (Patent Document 1), and particularly Arg-Gly-Asp-Ser and Two types of peptides, Arg-Gly-Asp, have been reported to act on the stratum corneum of the skin to improve dry skin and prevent skin aging (Patent Document 2).

Furthermore, collagenase degradation products of collagen and gelatin and specific peptides (glycylprolylhydroxyproline, etc.) contained in them are anti-aging and wrinkle-inhibiting effects, cell proliferation promoting effects, collagen production It is described that it has a promoting action (Patent Documents 3 and 4).

However, the effect more than the wrinkle suppression effect of the hydrolyzed collagen and oligopeptide mentioned above was calculated | required.

Collagen is one of the proteins constituting the extracellular matrix, and there are many families depending on the molecular structure and the structure of the aggregate formed. Among them, type 12 collagen does not form a fiber by itself, and is said to be a kind of FACIT collagen that modifies other fibrillar collagen. Type 12 collagen is involved in the structure of type 1 collagen fiber bundles in the dermis and is considered to give strength and flexibility of tissue (Non-patent Document 1). In addition, as a result of examining changes in the interaction of fibroblasts and collagen fibers with aging and ultraviolet irradiation, factors related to adhesion and tissue formation of fibroblasts with collagen fibers decreased due to aging and ultraviolet rays. It was found to be one of the causes of skin firmness and elasticity with aging.

In recent studies, it has been found that the expression of type 12 collagen decreases with aging, the ability to form fiber bundles decreases, the elasticity of the skin decreases, and wrinkles and tarmi occur. However, although a component that enhances type 12 collagen and improves skin elasticity is desired, such a component is not known.

In addition, diseases involving type 12 collagen include eye diseases such as keratoconus, and it has been reported that type 12 collagen is particularly important for cornea regeneration (Non-patent Document 2). In the treatment of keratoconus, there is instillation of riboflavin (Non-patent Document 3), but there are still few clinical trials, and a new therapeutic agent is desired.

There is no known use of peptides as therapeutic agents for such diseases.

JP-A-57-2213 JP-A-2-178207 JP 2000-309521 A Japanese Patent Laid-Open No. 2001-131084

Nishiyama T et al, J Bio Chem 269, 28193-28199 (1994) Cheng EL et al, Curr Eye Res 22, 333-40 (2001) Guttman C, Ophthalmology Times. Nov 1 (2005)

An object of the invention is to provide a collagen synthesis promoter capable of enhancing collagen synthesis, particularly type 12 collagen synthesis.

In order to solve the above-mentioned problems, the present inventors have conducted extensive research on collagen, and as a result, have found that the above object can be achieved by a peptide having a specific structure, and have reached the present invention.

That is, the present invention is as follows.

(1) A collagen synthesis promoter characterized by containing glycylproline.
(2) A type 12 collagen synthesis promoter characterized by containing glycylproline.
(3) A skin external preparation characterized by containing glycylproline.
(4) A pharmaceutical composition for preventing or ameliorating skin aging and / or eye diseases containing glycylproline and involving type 12 collagen.

The present invention is described in detail below.

In the present invention, glycylproline is a dipeptide in which glycine and proline are bonded via an amide bond, and the molecular formula is C ₇ H ₁₂ N ₂ O ₃ . This substance may be used as it is or in a salt state. Examples of the salt include pharmaceutically acceptable acid addition salts and base addition salts. Specifically, examples of the acid addition salt include salts of inorganic acids such as hydrochloric acid, sulfuric acid, and phosphoric acid, and salts of organic acids such as acetic acid, propionic acid, succinic acid, malic acid, tartaric acid, and citric acid. Examples of the base addition salt include metal salts such as sodium salt, potassium salt and calcium salt, and salts of amines such as ammonium and ethanolamine.

Examples of the above-mentioned substances include chemically synthesizing, hydrolyzing proteins such as collagen, separation and purification, and the like. When chemically synthesizing, it can be carried out by a usual synthesis method such as a liquid phase method or a solid phase method. In the case of the solid phase method, L-form amino acids corresponding to the amino acid residues from the C-terminal side (carboxyl terminal side) of the peptide are preferably sequentially bonded to the polymeric solid support by peptide bonds. The peptide thus obtained is cleaved from the polymeric solid support using trifluoromethanesulfonic acid, hydrogen fluoride, etc., and then the amino acid side chain protecting group is removed, and the reverse phase system is removed. It can be purified by a known method using high performance liquid chromatography using a column. Moreover, what is marketed from Sigma-Aldrich Japan Co., Ltd., the peptide research institute, etc. can be used for this substance.

The peptide of the present invention can be purified as necessary by using a well-known purification method such as gel filtration method or reverse phase chromatography method alone or in combination.

The peptide of the present invention can be used for any of foods, quasi drugs, and pharmaceuticals. When used as a skin external preparation, for example, skin lotions, creams, emulsions, gels, aerosols, essences, packs, cleaning agents, bath preparations, foundations, powders, lipsticks, ointments, poultices, etc. Are applicable. Moreover, it can be used as an external preparation applied to the eye such as eye drops or eyewash. When used for oral use, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, and the like. Moreover, it can be used as an injection solution, a suppository or the like. Known dosage forms other than these dosage forms can be used, and may be appropriately selected depending on the application.

When the peptide of the present invention is used for a skin external preparation or an eye drop external preparation, the amount of the peptide can be appropriately selected according to the dosage form, application, etc. It is preferably 0.00001 to 10% by weight, and most preferably 0.0001 to 1% by weight. If the blending amount is less than 0.00001% by weight based on the total amount of the agent, it is difficult to sufficiently exert the effect, which is not preferable. Moreover, even if it mix | blends exceeding 10 weight%, it is unpreferable that the enhancement of the effect corresponding to the increase in the compounding quantity is unlikely. In addition, the addition method may be added in advance or during the production, and may be appropriately selected in consideration of workability.

The peptide of the present invention may be used as it is as a solid or powder, or may be used as a solution, depending on these specific forms. In addition, fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, surfactants, metal soaps, pH adjustments, which are components used in external preparations and pharmaceutical compositions, as long as the effects are not impaired. Components such as agents, preservatives, perfumes, moisturizers, powders, ultraviolet absorbers, thickeners, dyes, antioxidants, whitening agents, chelating agents, and the like can be blended.

When the peptide of the present invention is used other than external preparations, the intake of the peptide can be appropriately selected according to the administration form, purpose of use, age, body weight and the like. Preferably it is 5,000 mg / day, most preferably 1-500 mg / day. It can be administered once to several times a day. Of course, as described above, since the administration method and dosage vary depending on various conditions, an amount smaller than the above-mentioned administration range may be sufficient, or it may be necessary to administer beyond the range. In addition, the method for adding medicinal ingredients in the formulation may be added in advance or during production, and may be appropriately selected in consideration of workability.

The peptide of the present invention may be used as it is in accordance with these specific forms, and may be used as it is, so long as the effect is not impaired, an excipient, a filler, a binder, a wetting agent, a disintegrant, and a surfactant. Further, diluents such as lubricants, dispersants, buffers, fragrances, preservatives, solubilizers, and solvents can be used. Specifically, lactose, sucrose, sorbit, mannitol, starch, precipitated calcium carbonate, heavy magnesium oxide, talc, calcium stearate, magnesium stearate, cellulose or derivatives thereof, amylopectin, polyvinyl alcohol, gelatin, surface activity Agents, water, physiological saline, ethanol, glycerin, propylene glycol, cacao butter, laurin butter, petrolatum, paraffin, higher alcohol and the like.

The glycylproline of the present invention is extremely effective as a collagen synthesis promoter, particularly as a type 12 collagen synthesis promoter.

In order to explain the present invention in detail, formulation examples and experimental examples are given as examples, but the present invention is not limited thereto. In the examples, the part of the amount is part by weight, and% is% by weight.

Formulation Example 1 Lotion [Prescription] 0.5 part of glycylproline Diglycerin 0.5 part 3.1,3-butylene glycol 8.0 part 4. Glycerin 2.0 parts 5. Xanthan gum 0.02 parts 6. Citric acid 0.01 part 7. Sodium citrate 0.1 part 8. Ethanol 5.0 parts 9. Methyl paraoxybenzoate 0.1 part10. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 part11. Perfume appropriate amount 12. Bring the total amount to 100 with purified water.
[Manufacturing method] Components 1 to 7 and 12 and components 8 to 11 are uniformly dissolved, and both are mixed and filtered to obtain a product.

Formulation Example 2 Cream [Prescription] 0.5 part of glycylproline Squalane 5.5 parts 3. Olive oil 3.0 parts 4. Stearic acid 2.0 parts 5. Beeswax 2.0 parts 6. 6. Octyldodecyl myristate 3.5 parts Polyoxyethylene cetyl ether (20E.O.) 3.0 parts 8. Behenyl alcohol 1.5 parts 9. Glyceryl monostearate 2.5 parts 10.1,3-butylene glycol 8.5 parts11. Methyl paraoxybenzoate 0.2 part 12. Ethyl paraoxybenzoate 0.05 part13. Fragrance 0.1 part14. Bring the total amount to 100 with purified water.
[Manufacturing method] Components 2 to 9 are heated and dissolved and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 10-12 and 14 are heated and dissolved and mixed, and kept at 75 ° C. to form an aqueous phase. Add the aqueous phase to the oil phase, cool while stirring, add component 13 at 45 ° C, then 1 dissolved in a small amount of 14, and further cool to 30 ° C to make the product.

Formulation Example 3 Emulsion [Prescription] Glycylproline 0.05 part Squalane 5.0 parts Olive oil 5.0 parts 4. Jojoba oil 5.0 parts 5. Cetanol 1.5 parts 6. 6. Glycerol monostearate 2.0 parts Polyoxyethylene cetyl ether (20E.O.) 3.0 parts 8. 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 parts Propylene glycol 1.0 part10. Glycerin 2.0 parts11. Methyl paraoxybenzoate 0.2 part 12. Fragrance 0.1 part13. Bring the total amount to 100 with purified water.
[Manufacturing method] Components 2 to 8 are dissolved by heating and mixed, and kept at 70 ° C to obtain an oil phase. Ingredients 9 to 11 and 13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The oily phase is added to the oil phase, emulsified, and cooled with stirring. At 45 ° C., component 12 and then 1 dissolved in a small amount of 13 are added, and further cooled to 30 ° C. to obtain a product.

Formulation Example 4 Gel [Prescription] 0.1 part of glycylproline Ethanol 5.0 parts 3. Methyl paraoxybenzoate 0.1 part 4. Polyoxyethylene hydrogenated castor oil (60 EO) 0.1 part Perfume appropriate amount 6.1,3-butylene glycol 5.0 parts 7. Glycerin 5.0 parts 8. Xanthan gum 0.1 part 9. Carboxyvinyl polymer 0.2 part10. Potassium hydroxide 0.2 part11. Bring the total amount to 100 with purified water.
[Production method] Components 2 to 5 and components 1 and 6 to 11 are uniformly dissolved, and both are mixed and filtered to obtain a product.

Formulation Example 5 Ointment [Prescription] 0.2 part of glycylproline 2. 2.0 parts of polyoxyethylene cetyl ether (30E.O.) 3. Glycerol monostearate 10.0 parts 4. Liquid paraffin 5.0 parts 5. Cetanol 6.0 parts 6. 6. Methyl paraoxybenzoate 0.1 part Propylene glycol 10.0 parts 8. Bring the total amount to 100 with purified water.
[Manufacturing method] Components 2 to 5 are dissolved by heating and mixed, and kept at 70 ° C to obtain an oil phase. It heat-dissolves and mixes with the components 6-8, and it maintains at 75 degreeC and makes it an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and 1 dissolved in a small amount of 8 is added at 45 ° C., and further cooled to 30 ° C. to obtain a product.

Formulation Example 6 Pack [Prescription] 0.01 part of glycylproline 2. 1 part polyvinyl alcohol Ethanol 5.0 parts 4.1,3-butylene glycol 8.0 parts 5. Methyl paraoxybenzoate 0.2 part 6. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 part 7. Citric acid 0.1 part 8. Sodium citrate 0.3 part 9. Perfume appropriate amount10. Bring the total amount to 100 with purified water.
[Production method] Components 1 to 10 are uniformly dissolved to obtain a product.

Formulation Example 7 Foundation [Prescription] 0.1 part of glycylproline Stearic acid 2.4 parts 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 part 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 parts 5. Cetanol 1.0 part 6. 6. Purified lanolin 2.0 parts Liquid paraffin 3.0 parts 8. 6. Isopropyl myristate 6.5 parts 9. Butyl paraoxybenzoate 0.1 part10. Sodium carboxymethylcellulose 0.1 part11. Bentonite 0.5 part12. Propylene glycol 4.0 parts13. Triethanolamine 1.1 parts14. Methyl paraoxybenzoate 0.2 part15. Titanium dioxide 8.0 parts 16. Talc 4.0 part 17. Bengala 1.0 part 18. Yellow iron oxide 2.0 parts 19. Perfume proper amount20. Bring the total amount to 100 with purified water.
[Manufacturing method] Components 2 to 9 are heated and dissolved and kept at 80 ° C to obtain an oil phase. Swell component 10 well with component 20, then add components 11-14 and mix uniformly. To this, components 15 to 18 pulverized and mixed with a pulverizer are added, and the mixture is stirred with a homomixer and kept at 75 ° C. to obtain an aqueous phase. The oil phase is added to the aqueous phase with stirring, cooled, and component 19 and then 1 dissolved in a small amount of 20 are added at 45 ° C., and cooled to 30 ° C. with stirring to give a product.

Formulation Example 8 Bath preparation [prescription] 0.005 part of glycylproline Sodium bicarbonate 50.0 parts 3. Yellow 202 No. 4 Perfume appropriate amount 5. Bring the total amount to 100 with sodium sulfate.
[Production method] Components 1 to 5 are uniformly mixed to obtain a product.

Formulation Example 9 Granule [Prescription] Glycylproline 5.0 parts Reduced maltose syrup 35.0 parts Microcrystalline cellulose 60.0 parts [Manufacturing method] An appropriate amount of 70 w / w% ethanol is added to components 1 to 3, kneaded, extruded, granulated, and dried to obtain granules. The granule is used internally at 1 g.

Formulation Example 10 Eye drops [Prescription] 1.0 part of glycylproline 2. Sodium chondroitin sulfate 0.50 parts Boric acid 0.13 parts 4. 0.75 parts of borax 5. d-Camphor 0.005 part 6. Sodium chloride appropriate amount 7.1 N-hydrochloric acid aqueous solution appropriate amount 8.1 N-sodium hydroxide aqueous solution appropriate amount 9. Bring the total amount to 100 with purified water.
[Production Method] Components 1 to 9 are mixed to obtain a clear eye drop having a pH of 7.4.

Next, experimental examples will be given to explain the effects of the present invention in detail.

Experimental Example 1 A serum-free DMEM medium containing the peptide of the present invention at a concentration of 1 μg / mL was added to NB1RGB cells that were confluent in a type 12 collagen synthesis test, and cultured for 24 hours. To positive subjects, 1 ng / mL of TGF-β1 was added. Thereafter, the expression level of type 12 collagen mRNA was measured by RT-PCR based on the total RNA extracted from NB1RGB cells. For the RT-PCR method, SYBR ™ RT-PCR Kit (Invitrogen) was used. After initial denaturation at 95 ° C. for 2 minutes, the PCR reaction was carried out for 40 cycles at 95 ° C. for 20 seconds and 60 ° C. for 15 seconds as 1 cycle. Further, β-actin was used as an internal standard. For other operations, the expression level of type 12 collagen was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, in accordance with a predetermined method. The primers used for measuring the expression level of each gene are as follows.

Primer set CAGTGTGCCAGCATCCCATA for type 12 collagen (SEQ ID NO: 1)
AGCACTGGGCACTTAGAAAAATGT (SEQ ID NO: 2)
Primer set CACTCTCCCAGCCCTTCCTCC for β-actin (SEQ ID NO: 3)
GTGTTGCGCGTACAGGTCTTTG (SEQ ID NO: 4)

Table 1 shows changes in the cells to which the peptide of the present invention was added. As a result, the mRNA expression of type 12 collagen was increased by the addition of the peptide of the present invention.

Experimental Example 2 Wrinkle Formation Inhibition Test Glycylproline was dissolved in 20% by weight 1,3-butylene glycol aqueous solution so as to be 0.5%, and used as a sample (glycylproline preparation). The test was applied to the faces of 10 subjects (24 to 55 years old) for 1 month and used. As a comparative example, a 20 wt% 1,3-butylene glycol aqueous solution was used (control preparation). The wrinkle score was evaluated with the naked eye for each subject before and after the use test, and the average value before and after use was determined.

(Wrinkle score)
The score was given according to the degree of wrinkles.
1: No wrinkles 2: Slightly wrinkled 3: Wrinkled 4: Very wrinkled 5: Significant wrinkled

The test results are shown in Table 2. As a result, the peptide of the present invention showed an excellent wrinkle formation inhibitory effect.

According to the same use test, the lotion of Formulation Example 1 showed an excellent skin aging effect.

Glycylproline has the effect of promoting collagen synthesis that decreases with age or disease. In particular, the synthesis of type 12 collagen can be promoted to provide a pharmaceutical composition for preventing or improving skin aging and eye diseases involving type 12 collagen.

Claims (4)

A collagen synthesis promoter comprising glycylproline. A type 12 collagen synthesis promoter comprising glycylproline. An external preparation for skin comprising glycylproline. A pharmaceutical composition for preventing or ameliorating skin aging and / or eye diseases containing glycylproline and involving type 12 collagen.