JP2011083255A - Yeast for fermenting ethanol from xylose - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a yeast strain for fermenting ethanol from xylose in high productivity. <P>SOLUTION: The yeast includes characteristics of [a] incorporating xylose into cells even in the presence of glucose by transfer of a gene participating in incorporation of xylose into cells and [b] metabolizing xylulose into xylose-5-phosphate and producing ethanol. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to an ethanol-fermenting yeast having a strong ethanol-fermenting ability from xylose. More specifically, the present invention relates to the above ethanol-fermenting yeast characterized by heat resistance and acid resistance suitable for bioethanol conversion from bamboo or the like.

  In 2030, Japan's gasoline consumption is expected to be 60 million kL, and a new national energy strategy (May 2006) was established to cover 10% of it with ethanol. Therefore, the present inventors aim to produce ethanol from cellulosic biomass that does not compete with food, especially bamboo. Bamboo is a globally unused biomass that is very fast growing and renewable. Bamboo components contain hemicellulose in addition to cellulose, and when saccharified with concentrated sulfuric acid, glucose and xylose are produced at a ratio of 2: 1. Since yeast cannot ferment xylose, it has problems such as poor ethanol yield.

  Non-Patent Document 1 (Van Vleet JH, Jeffries TW, Olsson L. (2008). Deleting the para-nitrophenyl phosphatase (pNPPase), PHO13, in recombinant Saccharomyces cerevisiae improves growth and ethanol production on D-xylose. Metab Eng. Nov; 10 (6): 360-9.) Describes the acquisition of spontaneous mutants from strains that have engineered genes involved in xylose metabolism. However, the method described in Non-Patent Document 1 is not a method using inhibition and recovery from a strain further strengthened in the xylose uptake system. Further, the ethanol fermentability of the strain described in Non-Patent Document 1 is not yet sufficient.

Patent Document 1 (Japanese Patent Application Laid-Open No. 2009-171912) discloses the following characteristics [a] to [e] as ethanol fermentable heterothalism yeast having heat resistance and acid resistance obtained from ethanol fermentable homothalism yeast. Yeasts having are described.
[A] It is ethanol fermentable.
[B] It is heterotalism.
[C] The sporulation rate on the sporulation medium is 0.5% or more.
[D] Germination rate on YPD solid medium is 50% or more.
[E] The specific growth rate in a YPD liquid medium (pH 3.5) under a temperature condition of 35 ° C. is 0.1 to 0.7 h ⁻¹ .

JP 2009-171912 A

Van Vleet JH, Jeffries TW, Olsson L. (2008). Deleting the para-nitrophenyl phosphatase (pNPPase), PHO13, in recombinant Saccharomyces cerevisiae improves growth and ethanol production on D-xylose. Metab Eng. Nov; 10 (6): 360-9.

  This invention made it the subject which should be solved to provide the yeast strain | stump | stock which can be ethanol-fermented in high productivity from xylose.

  As a result of intensive studies to solve the above-mentioned problems, the present inventors are an ethanol-fermenting heterothalism yeast having heat resistance and acid resistance obtained from ethanol-fermenting homothalism yeast, and having a transformation ability that is easy to genetically manipulate. A yeast strain capable of fermenting ethanol from xylose with high productivity by using a high yeast strain as a parent strain, constructing a strain that has both a xylose uptake system and a xylose metabolism system, and isolating the strain with enhanced xylose metabolism The acquisition was successful and the present invention was completed.

That is, according to the present invention, the following invention is provided. (1) A yeast having the following features [a] and [b].
[A] By introducing a gene involved in xylose uptake into cells, xylose can be taken up into cells even in the presence of glucose.
[B] Metabolizes xylose to xylulose-5-phosphate to produce ethanol.

(2) The yeast according to (1), which is heterothalism.
(3) Yeast as described in (1) or (2) which has at least 1 or more of Hxt7 gene, Hxt5 gene, or GXS1 gene as a gene for taking in xylose in a cell also in presence of glucose.
(4) The yeast according to any one of (1) to (3), which has a xylose reductase gene, a xylitol dehydrogenase gene, and a xylulokinase gene as genes for metabolizing xylose to xylulose-5-phosphate.

(5) When YPDX medium containing 70 g / L glucose and 30 g / L xylose is used, ethanol can be fermented with a yield of 70% or more in a culture time of 24 hours or less. (1) to (4) The yeast according to any one of the above.
(6) When YPDX medium containing 70 g / L glucose and 30 g / L xylose is used, ethanol can be fermented with a yield of 80% or more in a culture time of 24 hours or less. (1) to (5) The yeast according to any one of the above.
(7) The yeast according to any one of claims 1 to 6, which belongs to Saccharomyces cerevisiae.
(8) Yeast having receipt number FERM AP-21839 or FERM AP-21840.
(9) Yeast with accession number FERM AP-21838.
(10) A method for producing ethanol from xylose using the yeast according to any one of (1) to (8).

  The yeast of the present invention can ferment ethanol from xylose with high productivity. By using the yeast of the present invention, bioethanol can be produced with high efficiency from cellulosic biomass such as bamboo and other biomass.

Hereinafter, embodiments of the present invention will be described in detail.
The yeast of the present invention is characterized by having the following features [a] and [b].
[A] Xylose can be taken into cells even in the presence of glucose.
[B] Metabolizes xylose to xylulose-5-phosphate to produce ethanol.

  The yeast of the present invention is preferably heterothalism.

  The yeast of the present invention has at least one of the Hxt7 gene, the Hxt5 gene, and the GXS1 gene as a gene for taking xylose into cells even in the presence of glucose in order to take xylose into cells. Preferably it is. The origin of the Hxt7 gene, Hxt5 gene or GXS1 gene is not particularly limited, but preferably a yeast-derived gene can be used, for example, derived from the genus Saccharomyces (such as Saccharomyces cerevisiae) or the genus Candida (such as Candida intermedia). Genes can be used.

The base sequences of Hxt7 gene and Hxt5 gene of Saccharomyces cerevisiae are known, and the base sequences are published in Saccharomyces Genome Database (http://www.yeastgenome.org/).
The base sequence of Candida intermedia GXS1 gene is known, for example, registered in GenBank as Accession Number, AJ875406, and Leandro MJ, Goncalves P, Spencer-Martins I. (2006). Twoglucose / xylose transporter genes from the yeast Candida intermedia: first molecular characterization of a yeast xylose-H + symporter. Biochem J. 395: 543-549.

  As a gene for taking xylose into a cell even in the presence of glucose, each of them may have an Hxt7 gene, an Hxt5 gene, or a GXS1 gene alone. Two or more types of genes may be combined. For example, the Hxt7 gene and the GXS1 gene may be included, the Hxt5 gene and the GXS1 gene may be included, or all of the Hxt7 gene, the Hxt5 gene, and the GXS1 gene may be included.

  The yeast of the present invention preferably has a xylose reductase gene, a xylitol dehydrogenase gene, and a xylulokinase gene as genes for metabolizing xylose to xylulose-5-phosphate. Xylose is produced from xylose by the action of xylose reductase, xylulose is produced from xylitol by the action of xylitol dehydrogenase, and xylulose-5-phosphate is produced from xylulose by the action of xylulokinase.

  The origin of the xylose reductase gene, xylitol dehydrogenase gene and xylulokinase gene used in the present invention is not particularly limited, but preferably a yeast-derived gene can be used, for example, using the gene of the genus Pichia (Pichia stipitis) Can do.

  A yeast having a xylose reductase gene, a xylitol dehydrogenase gene and a xylulokinase gene may be constructed by constructing a recombinant vector having the above gene by gene recombination technology, and introduced into the yeast by gene introduction, or with a yeast having the above gene. You may construct | assemble the yeast which has the said gene by crossing.

  The yeast of the present invention is characterized in that ethanol can be fermented with high productivity from xylose even in the presence of glucose. Preferably, when YPDX medium containing 70 g / L glucose and 30 g / L xylose is used, ethanol can be fermented at a yield of 70% or more (more preferably 80% or more) in a culture time of 24 hours or less.

  The `` yeast '' referred to in the present specification is not particularly limited as long as it has the characteristics listed herein, for example, the genus Saccharomyces, Candida, Torulopsis, Zygosaccharomyces, Schizosaccharomyces, Pichia, Yarrowia, Hansenula, Kluyveromyces, Debaryomyces, Geotrichum, Wickerhamia, Fellomyces, Sporobolomyces, preferably Saccharomyces, more preferably Saccharomyces cerevisiae.

  As used herein, “ethanol fermentability” means a catalytic action capable of producing ethanol aerobically or anaerobically from carbon sources such as carbohydrates and sugars (preferably xylose and glucose).

  As used herein, the term “heterothalism” yeast means that when spore formation is performed after diploid formation, even if each spore is isolated and cultured, conjugation conversion of daughter cells does not occur, and the cells grown from each spore are It means yeast that grows as a haploid clone that does not have sporulation ability.

  Specific examples of the yeast of the present invention described above include NAPX11-55BX and NAPX22, which are yeasts obtained in the following examples. These yeasts are patent organisms of the National Institute of Advanced Industrial Science and Technology, respectively. Deposit number FERM AP-21840 (NAPX11-55BX) and FERM AP-21839 (NAPX22) dated August 26, 2009 to the Deposit Center (Tsukuba Center Chuo 6th Tsukuba City Ibaraki Pref. 305-8586) ).

  In addition, NAM34-4C, which is the yeast strain used in the production of the yeast, is a patent biological deposit center of the National Institute of Advanced Industrial Science and Technology (Tsukuba Center, 1-1-1 East Tsukuba City, Ibaraki Prefecture 305-8586). 6), deposited on August 26, 2009 as receipt number FERM AP-21838.

The main mycological properties of NAPX11-55BX (accession number FERM AP-21840) are as follows.
A Culture and morphological properties (1) Growth state in various media When cultured on a 2% YPD agar medium, the size of vegetative cells is 5-10 μm; the shape is oval; the growth mode is budding; The colony is white and smooth. In a liquid medium, there is no surface growth and it aggregates in the liquid.
(2) B Ascospores do not form by themselves B Physiological and chemical taxonomic properties (1) Optimal growth conditions (pH, temperature): pH, 4.5-6.0; Temperature, 28 ° C-35 ° C.
(2) Growth range (pH, temperature): pH, 3.0 to 7.0; Temperature, 25 ° C to 40 ° C.
C Carbon source assimilation (especially *)
(1) D-xylose +
(2) D-glucose +
(3) D-Mannose +
(4) D-galactose +
(5) D-fructose +
(6) Maltose +
(7) Shoe close +
(8) Cellobiose −
(9) Trehalose +
(9) Soluble starch-
(10) DL-lactate-

The main mycological properties of NAPX22 (accession number FERM AP-21839) are as follows.
A Culture and morphological properties (1) Growth state in various media When cultured on a 2% YPD agar medium, the size of vegetative cells is 5-10 μm; the shape is oval; the growth mode is budding; The colony is white and smooth. In a liquid medium, there is no surface growth and it aggregates in the liquid.
(2) B ascospores alone Physiological and chemical taxonomic properties (1) Optimal growth conditions (pH, temperature): pH, 4.5-6.0; Temperature, 28 ° C-35 ° C.
(2) Growth range (pH, temperature): pH, 3.0 to 7.0; Temperature, 25 ° C to 40 ° C.
C Carbon source assimilation (especially *)
(1) D-xylose +
(2) D-glucose +
(3) D-Mannose +
(4) D-galactose +
(5) D-fructose +
(6) Maltose +
(7) Shoe close +
(8) Cellobiose −
(9) Trehalose +
(9) Soluble starch-
(10) DL-lactate-

The main bacteriological properties of NAM34-4C are as follows.
A Culture and morphological properties (1) Growth state in various media When cultured on a 2% YPD agar medium, the size of vegetative cells is 5-10 μm; the shape is oval; the growth mode is budding; The colony is white and smooth. In a liquid medium, there is no surface growth and it aggregates in the liquid.
(2) B Ascospores do not form by themselves B Physiological and chemical taxonomic properties (1) Optimal growth conditions (pH, temperature): pH, 4.5-6.0; Temperature, 28 ° C-35 ° C.
(2) Growth range (pH, temperature): pH, 3.0 to 7.0; Temperature, 25 ° C to 40 ° C.
C Carbon source assimilation (especially *)
(1) D-xylose-
(2) D-glucose +
(3) D-Mannose +
(4) D-galactose +
(5) D-fructose +
(6) Maltose +
(7) Shoe close +
(8) Cellobiose −
(9) Trehalose +
(9) Soluble starch-
(10) DL-lactate-

  Although the yeast of this invention will not be restrict | limited especially if the yeast which has the said characteristic can be isolate | separated, For example, it can isolate | separate by the method shown in the Example of this specification.

  The yeast of the present invention can be cultured under the yeast medium and culture conditions usually used in this technical field. The carbon source is not particularly limited as long as it is a carbon source that can be assimilated by the yeast of the present invention described above. As the nitrogen source, ammonium salts such as ammonium sulfate, ammonium nitrate, and ammonium acetate, organic substances such as nitrate and peptone, meat extract, corn steep liquor, corn glue tenmeal, cottonseed oil, and defatted soybean can be used. In addition, a small amount of inorganic metals, vitamins, growth promoting factors such as thiamine, yeast extract containing biotin and the like may be added. These medium components may be in concentrations that do not inhibit the growth of the yeast of the present invention, and it is appropriate that the carbon source is usually 0.025 to 5.0% by weight. It is appropriate to use 0.05 to 1% by weight of nitrogen source. The medium is usually adjusted to pH 4.5 to 8.5, preferably pH 5.0 to 7.5, more preferably pH 5.5, and sterilized before use. The culture temperature may be any temperature at which the yeast of the present invention can grow, and is usually 20 to 40 ° C, preferably 30 ° C. When the yeast of the present invention is subjected to liquid culture, it is preferable to perform shaking culture or aeration and agitation culture. Although the culture time varies depending on various culture conditions, 1 to 5 days, preferably 2 to 3 days are suitable for shaking culture or aeration and agitation culture.

  Ethanol can be efficiently produced from xylose by fermentation using the yeast of the present invention. The fermentation reaction can be performed by methods known to those skilled in the art. The concentration of xylose contained in the medium is not particularly limited as long as ethanol can be produced, but is 0.1 to 10%, preferably 0.1% to 5%. The concentration of glucose contained in the medium is 0.1%. -20%, preferably 0.5-15%. The culture temperature can be controlled to 25 ° C to 40 ° C, preferably 27 ° C to 37 ° C, and the pH of the medium is controlled to 3.0 to 7.6, preferably 3.0 to 5.0. Since fermentation proceeds under anaerobic conditions, it is preferable that oxygen is not present. Therefore, an operation for removing oxygen in the system and dissolved oxygen in the medium before fermentation is performed, that is, an operation for blowing nitrogen gas into the medium. It is preferable. The reaction may be performed continuously or batchwise. The culture medium after 1 to 192 hours, preferably 1 to 96 hours, more preferably 8 to 24 hours after the start of culture can be recovered to separate ethanol. The method for separating ethanol is not particularly limited, and a method using distillation or a pervaporation membrane can be used. By further purifying the separated ethanol (for example, purification by distillation or the like), ethanol can be obtained.

  The following examples further illustrate the present invention, but the present invention is not limited to the examples.

(A) Experimental materials and experimental methods (1) Strains and plasmids used
Saccharomyces cerevisiae KF7M has the following genetic background. MATa / MATαHO / HO trp1 / trp1 :: TEFp-ERG25 TDH3p :: TDH3p-BGL1-TRP1 ura3 /: ura3-TDH3p-Xyl1-TDH3p-Xyl2-TDH3p-Xks1). It has TDH3p-Xyl1 TDH3p-Xyl2 TDH3p-Xks1 so that it can be metabolically converted from xylose to xylose-5-phosphate. Xyl1 and Xyl2 are respectively a xylose reductase gene and a xylittle dehydrogenase gene derived from Pichia stipitis, and Xks1 is a xylulokinase gene derived from Saccharomyces cerevisiae. This is a strain isolated as a URA + transformant by the plasmid pIUX1X2XK of a uracil-requiring strain derived from KF7. The plasmid is obtained by adding URA3 TDH3p-Xyl1-TDH3t TDH3p-Xyl2-TDH3t TDH3p-Xks1-TDH3t to pBluescript. KFG4-4B and KFG4-6B are KF7-derived strains described in Japanese Patent Application Laid-Open No. 2009-171912 (Japanese Patent Application No. 2008-015864), and have accession number FERM P-21478 and accession number FERM P-21479, respectively. It is deposited on December 26, 2007 at the Patent Organism Depositary Center of the National Institute of Advanced Industrial Science and Technology (Tsukuba Center Chuo 6th, Tsukuba City, Ibaraki Prefecture 305-8586).

(2) Medium
1 L of YPD medium contains 20 g of bactopeptone, 10 g of bacto yeast extract, and 20 g of glucose. If necessary, adenine and uracil were added at a final concentration of 40 mg / L. For solid media, agar was added at a final concentration of 20 g / L. The pH was adjusted to 5.5 with 1 N HCl solution except in special cases.

  1 L of sporulation medium contains 10 g of potassium acetate and 20 g of agar. The pH was adjusted to 5.5 with 1N HCl solution.

  The LB medium contained 10 g of bactotryptone, 5 g of bacto yeast extract, and 10 g of NaCl per liter of water, and was adjusted to pH 7.2. The SOB medium contained 20 g of bactotryptone, 5 g of bacto yeast extract, 0.5 g of sodium chloride, and 10 ml of 250 mM potassium chloride solution per liter of water, and was adjusted to pH 7.0. The SOC medium was adjusted to contain 10 ml of 2 M magnesium solution (1 M magnesium chloride, 1 M magnesium sulfate) and 10 ml of 2 M glucose solution per liter of SOB medium. To the solid medium, 15 g of agar was added per 1 L of the medium. If necessary, thiamine was added at a final concentration of 5 μg / ml, ampicillin at 50 μg / ml, and kanamycin at 50 μg / ml.

(3) Spore formation method and its test method
The culture was statically cultured at 30 ° C. for 1 day on a YPD solid medium. The grown yeast colonies to be tested were transferred to a sporulation medium with a sterilized toothpick. The culture was allowed to stand at 30 ° C. for 2 to 3 days to form spores.
Samples were taken with a sterile toothpick and suspended in 5 μl of sterile water on a glass slide. Spore formation was observed with an optical microscope (300x, objective lens x20, eyepiece x10, intermediate magnification x1.5, Olympus light microscope BH2), and spore formation was examined.

(4) Mass mating method Yeast cells to be tested were inoculated into a 2 ml YPD liquid medium with a sterilized platinum wire. Furthermore, standard yeast cells (for example, BY4849 (MATα ura3-1 leu2-3,112 trp1-1 his3-11,15 ade2-1 can1-100 rad5-535)) were inoculated into the same medium with a sterilized platinum wire. This mixed 2 ml YPD suspension was incubated at 30 ° C. for several hours. Further, the culture was allowed to stand overnight at 30 ° C.

(5) Judgment judgment
5 μl of the mass mated cell culture solution was taken with a sterilized Pipetman P20 and placed on a slide glass. A cover glass was placed thereon and observed with an optical microscope. A specific diagram of the zygote can be found in, for example, the Yeast Molecular Genetics Experiment Method (Academic Publishing Center, Taiji Oshima, page 11, Figure I-3)

(6) Single cell separation of yeast by micromanipulator A test organism (for example, KF7) was inoculated into a YPD solid medium and left to stand at 30 ° C. for 1 day. The resulting colony was suspended in 2 ml of YPD liquid medium and placed on a 20 ml YPD solid medium with a platinum sterilized flame-sterilized ear. Then, using a micromanipulator (Singer MSM System 200, Singer Instruments, Roadwater, Watchet, Somerset TA23 0RE, UK), single cells with a shape close to an egg shape, which is a typical diploid yeast, were isolated under a microscope. did. By static culture at 30 ° C. for 2 days, colonies that grew from single cells were obtained.

(7) Anatomy of ascospores Cells on the spore formation medium were suspended in 75 μl of 0.15 M potassium phosphate buffer pH 7.5 containing zymolyase20 at a final concentration of 300 μg / ml, and incubated at 30 ° C. for 20 minutes. Thereafter, the spore suspension was taken with a sterilized platinum loop and transferred onto a YPD solid medium. Four spores were dissected into single spores with a micromanipulator and then statically cultured at 30 ° C. for 2 to 3 days.

(8) Used primers
The following primers were used to perform Hxt5 and Hxt7 gene expression even in the presence of glucose.

F-LTKTL (HXT5) and R-TDH3 (HXT5) primers for HXT5 construction.
F-LTKTL (HXT5):
TGTGGATGAATATATGGGCATGGGTTAATTAGTTTTAGGGGGCCGCCAGCTGAAGCTTCG (SEQ ID NO: 1)
R-TDH3 (HXT5): CTTCCAAGGGGCCTTGATGAGCGTTTTCAAGTTCCGACATTTTGTTTGTTTATGTGTGTTTATTCGA (SEQ ID NO: 2)

F-LTKTL (HXT7) and R-TDH3 (HXT7) primers for HXT7 construction.
F-LTKTL (HXT7):
ACATTTGCTTCTGCTGGATAATTTTCAGAGGCAACAAGGAGGCCGCCAGCTGAAGCTTCG (SEQ ID NO: 3)
R-TDH3 (HXT7):
CCACAGGAGTTTGCTCTGCAATAGCAGCGTCTTGTGACATTTTGTTTGTTTATGTGTGTTTATTCGA (SEQ ID NO: 4)

In order to express GXS1 in yeast, the following F-GXS1 (TDH3-NspV) and R-GXS1 (BamH1) primers for GXS1 cassette preparation were prepared.
F-GXS1 (TDH3-NspV):
TTAGTTTCGAATAAACACACATAAACAAACAAAATGGGTTTGGAGGACAATAG (SEQ ID NO: 5)
R-GXS1 (BamH1):
TTTGGATCCTTAAACAGAAGCTTCTTCAGACA (SEQ ID NO: 6)

R-GXS1 + HXT16 and F-pUG6-HXT16-300 primers were used to transfer the GXS1 gene to the Hxt16 site of yeast.
R-GXS1 + HXT16:
TCAATTAAAACTCTTTGGGAACTTCAAAACTTCTTTCCAGTTAAACAGAAGCTTCTTCAGACA (SEQ ID NO: 7)
F-pUG6-HXT16-300:
GTCAGGCAAGGTAGATGATGTAAACAAACGAGGACTTGTAGGCCGCCAGCTGAAGCTTCG (SEQ ID NO: 8)

(9) DNA extraction, PCR, transformation, nucleotide sequence determination Plasmid DNA extraction of E. coli was performed using High Pure Plasmid Isolation Kit according to the attached protocol. Yeast DNA extraction was performed by the following method. The yeast cells (YPD medium, 30 ° C, Abs _{660 nm} = 1.5) are centrifuged (6,000 × g, 2 minutes), and the collected cells are buffered (0.1 M Tris-HCl, pH 8.0, 0.1 M NaCl) And then crushed (2,000 rpm, 2 minutes) using 0.3 mm beads. The supernatant was treated with phenol-chloroform and then centrifuged (1,800 × g, 15 minutes). 1/10 volume of 3M sodium acetate and 0.6 volume of isopropyl alcohol were added to the aqueous layer and centrifuged (2,800 × g, 10 minutes). Precipitate with ethanol and add TE buffer to make a DNA solution. The PCR reaction was performed using a Ready To Go PCR Beads kit (Amersham Pharmacia Biotech Inc).

The transformation of E. coli was performed by the following method using electroporation. E. coli DH10B cultured cells (Abs _{600 nm} = 0.5 to 0.8) were washed with 1 mM HEPES buffer and suspended in 10% glycerol to prepare competent cells. DNA was transferred using Gene Pulser Xcell Electroporation System (2,500 V, Gap: 0.2 cm, 25 μF, 200 Ω). Yeast transformation was performed using the lithium acetate method7 ⁾ .

The nucleotide sequence was determined using Applied Biosystems 3130 Genetic Analyzer and BigDye ^™ Terminator v3.1 Cycle Sequencing Kit.

(B) Results Underlined strains KFG5, KFG4-4B, and KFG4-6B enclosed in gray in FIG. 1 are described in Japanese Patent Application Laid-Open No. 2009-171912 (Japanese Patent Application No. 2008-015864). As P-21480, accession number FERM P-21478 and accession number FERM P-21479, the National Institute of Advanced Industrial Science and Technology's Patent Biological Deposit Center (1-1-1 Tsukuba, Tsukuba City, Ibaraki Pref. 6) was deposited on December 26, 2007. These are practical yeasts with strong ethanol productivity, and have a property that can be combined with heat resistance and acid resistance. Furthermore, NAM34-4C is a strain that has high transformation ability and is easy to genetically manipulate. This strain is boxed in FIG. The construction process will be described with reference to the family tree of FIG.

  The strain KF7-5C produced in constructing the KFG5, KFG4-4B and KFG4-6B strains was multiplied with the laboratory yeast SH6710 to obtain a diploid NAM2. Four spores were formed and the haploid progeny strain NAM2-2B was selected. The content of the selection is a strain having excellent properties of multiplication with good growth. NAM3-15D was selected by backcrossing with this strain and KF7-5C. Such multiplication was further repeated 5 times to obtain NAM11-9C and NAM11-13A. It can be presumed that the diploid NAM15 obtained from this strain has a genetic background very close to the parent strain KF7. Fig. 1 shows the generation time G and specific growth rate µ at Y2.6 medium pH 2.6, 35 ° C, which shows the strength of acid resistance and heat resistance.

  On the other hand, KFG4-6BD was selected from KFG4-6B. It can be estimated that the heat resistance and acid resistance are superior to NAM15 because the generation time in FIG. 1 is 2.2 hours, which is earlier than 3.1 hours of NAM15. A strain that incorporates this good growth property is NAM34-4C. It can be seen that the generation time required for growth is 1.3 hours, which is the fastest. Moreover, as shown in FIG. 2, the transformation ability was higher than BY4841, which is a laboratory yeast.

NAM34-4C was used as a parent strain, and a yeast capable of ethanol fermentation from xylose was constructed (having properties 1 and 2 in FIG. 2 together). The basic gene structure is shown below.
(1) TDH3p-Hxt7 TDH3p-GXS1: Xylose can be taken into cells even in the presence of glucose.
(2) TDH3p-Xyl1 TDH3p-Xyl2 TDH3p-Xks1: It can metabolize xylose to xylulose-5-phosphate even in the presence of glucose.
(3) Spontaneous mutation leading to HEX (High Efficiency of Xylose Metabolism), which is a property with very high utilization of xylose (this property is the greatest feature of the yeast of the present invention)

  If xylose utilization was not sufficient, intracellular xylose worked rather inhibitory. Therefore, xylose cannot be assimilated in (2), growth inhibition occurs in (1) and (2), and strong xylose assimilation occurs only when (1), (2) and (3) are aligned, A high ethanol yield of 71% from xylose was observed (YPX medium containing 35 g / L xylose, pH 5.5, 35 ° C., yield after about 24 hours). In addition, the ethanol yield from glucose and xylose was as high as 84% (YPDX medium containing 4.0 g of 70 g / L glucose and 30 g / L xylose, pH 4.0, yield after 24 hours at 35 ° C.). Such a high yield in a short time of 24 hours has never been reported. In the present invention, the strain NAPX22 having the properties (1) to (3) above was obtained. Also within the scope of the present invention is the haploid strain NAPX11-55BX in the process of obtaining NAPX22. The genetic background of the haploid strain NAPX11-55BX also has the above (1) to (3) like NAPX22.

The procedure for strain construction was as follows.
(1) Production of yeast capable of taking xylose into cells even in the presence of glucose
(a) Construction of a cassette vector for producing gene structures such as TDH3p-Hxt7 and TDH3p-GXS1 (FIG. 3).
A region consisting of loxP-TEFp-Kanmx-TEFt-loxP-TDH3p was constructed in the vector. To change the structure of Hxt7p-Hxt7 to TDH3p-Hxt7, purchase the upstream sequence 40 mer + TEF-p region 20 mer of the Hxt7 structural gene and the 20 mer of TDH3p region 20 mer + the upper 40 mer of the Hxt7 structural gene, and directly after yeast amplification And can be constructed by separating it as a G418 resistant transformant. The nucleotide sequence information was obtained from the yeast genome database. The constructed strain has the potential to transport a large amount of xylose into the cell (FIG. 4, NAM34-7H). Hxt5 can be constructed in the same manner (FIG. 4, NAM34-5H).

(b) Gene structure strain capable of transporting xylose in the presence of glucose TDH3p-Hxt7 and TDH3p-Hxt5 strains were constructed using a cassette vector. When the extracellular xylose concentration decreases, the Hxt7 transport system has a high Km value, so the uptake efficiency becomes extremely poor. In order to solve this problem, GXS1, which has a low Km value of 0.2 mM (FIG. 2), was also cloned as follows. The TDH3p region downstream of NspV and Candida intermedia GXS1 were PCR amplified and cloned into E. coli. Subsequently, GXS1 was integrated into the Hxt16 genetic region (FIG. 4, NAM26-15G2).

  Subsequently, a double strain was constructed by crossing NAM26-15G2 and NAM34-7H as shown in FIG. In this way, a xylose uptake strain was constructed.

(2) Gene structure strain capable of converting xylose into xylulose-5-phosphate A homothalism strain, KF7M, has constructed a strain capable of converting xylose into xylulose-5-phosphate. It has the ability to express XR, XD, and XK constitutively, and a single gene is inserted into the ura3 region (FIG. 6).

  Therefore, the properties of the heterothalism strain were collected as follows using cross-linking. The KF7M spore and NAM11-2C were crossed to obtain one of the four molecules, NAM22-6A. This strain could not obtain 4 molecules by crossing. It was estimated that there was no xylose assimilation and xylose metabolism abnormality occurred. Therefore, a natural mutant that strongly assimilate xylose was isolated (FIG. 5, NAM22-6AX). Four molecules were obtained from the obtained mutant and NAM27-8C. The strain NAM28-4B was further crossed with NAM27-8C to obtain NAM29-1A. This strain had xylose assimilation but extremely low (FIG. 6).

(3) Construction of strains having both xylose metabolism and xylose uptake
A strain obtained by multiplying NAM29-1A and NAPX7-7HG is NAPX11-55B. The growth of this strain is clearly lower compared to the parent strain NAM29-1A (FIG. 6). Therefore, it can be estimated that when the intracellular xylose metabolism is weak, growth inhibition is caused by xylose.

(4) Isolation of strains with enhanced xylose metabolism
When NAPX11-55B was continuously cultured, spontaneous mutants with good growth could be isolated. A strain obtained by separating a single colony is NAPX11-55BX. This proliferation is clearly better than NAM29-1A or NAPX11-55B (FIG. 6). NAPX11-55BX and NAM51-8C were crossed to obtain one of four molecules, NAPX12-10A. The proliferative power was comparable to NAPX11-55BX. Four molecules obtained by multiplying NAPX12-10A and NAPX11-55B are NAPX18-1B and NAPX18-10B, which are strains with good proliferation ability and excellent hybridization. A strain obtained by multiplying both is NAPX22 diploid.

  As a result of the ethanol fermentation test, as shown in FIG. 7, a high ethanol yield of 84% was obtained from glucose and xylose in culture for only about 24 hours. This fermentative power is the highest reported so far. Therefore, NAPX22 and NAPX11-55BX were selected as examples of the yeast strain of the present invention.

  The yeast of the present invention is useful in the field of producing bioethanol from cellulosic biomass and other biomass.

FIG. 1 shows the process of yeast improvement. FIG. 2 shows breeding of a practical yeast that is ethanol-fermented from xylose / glucose. FIG. 3 shows the construction of a cassette that constitutively expresses the gene of interest. FIG. 4 shows xylose uptake systems: Hxt5, Hxt7, GXS1. FIG. 5 shows the improvement of a practical yeast having a xylose metabolic system. FIG. 6 shows the growth curve of the constructed practical yeast in xylose medium. FIG. 7 shows the results of a fermentation test of NAPX22 strain.

Claims (10)

A yeast having the following features [a] and [b].
[A] By introducing a gene involved in xylose uptake into cells, xylose can be taken up into cells even in the presence of glucose.
[B] Metabolizes xylose to xylulose-5-phosphate to produce ethanol. The yeast according to claim 1, which is heterothalism. The yeast according to claim 1 or 2, which has at least one of Hxt7 gene, Hxt5 gene and GXS1 gene as a gene for taking xylose into cells even in the presence of glucose. The yeast according to any one of claims 1 to 3, which comprises a xylose reductase gene, a xylitol dehydrogenase gene and a xylulokinase gene as genes for metabolizing xylose to xylulose-5-phosphate. The ethanol can be fermented at a yield of 70% or more in a culture time of 24 hours or less when using a YPDX medium containing 70 g / L glucose and 30 g / L xylose. yeast. The ethanol can be fermented at a yield of 80% or more in a culture time of 24 hours or less when using a YPDX medium containing 70 g / L glucose and 30 g / L xylose. yeast. The yeast according to any one of claims 1 to 6, which belongs to Saccharomyces cerevisiae. Yeast having the receipt number FERM AP-21839 or FERM AP-21840. Yeast with accession number FERM AP-21838. A method for producing ethanol from xylose using the yeast according to any one of claims 1 to 8.