JP2011015662A - Method for producing mesenchymal cell or cartilage cell, and method for suppressing carcinogenicity - Google Patents

Abstract

PROBLEM TO BE SOLVED: To separate and produce a mesenchymal cell useful in a field of regenerative therapy or the like, and a cartilage cell originated from the mesenchymal cell by a simple operation.SOLUTION: The method for producing the mesenchymal cell or the method for producing the cartilage cell includes introducing a differentiated cell from a pluripotent stem cell, and separating the mesenchymal cell from a culture product of the differentiated cell by utilizing the adhesiveness of the mesenchymal cell. The method for suppressing carcinogenicity includes carrying out the culture in a low-oxygen environment.

Description

  The present invention relates to a mesenchymal system that is highly useful as a material for regenerative medicine from a pluripotent stem cell useful as a model for developmental engineering research, preclinical tests, safety tests, disease research, or regenerative medicine in mammals. The present invention relates to a method for producing cells, a method for producing chondrocytes useful as a model for joint disease or a therapeutic material, and a method for suppressing carcinogenicity, which is a problem common to pluripotent stem cells.

  A stem cell is an undifferentiated cell having multipotency and self-renewal ability. It has also been suggested that stem cells have a tissue repair ability after injury. For this reason, stem cells are expected to be applied to screening of therapeutic substances for various diseases and regenerative medicine.

  Regenerative medicine using mesenchymal stem cells has been developed mainly as a material for regenerative medicine for musculoskeletal disorders (Non-Patent Document 1 and Non-Patent Document 2). Mesenchymal stem cells can be collected from bone marrow, umbilical cord blood, fat, and muscle, but when using mesenchymal stem cells contained in bone marrow, the abundance is about 0.05%. When derived from bone marrow blood, it becomes extremely invasive.When derived from umbilical cord blood, tissue compatibility becomes a problem with the newborn baby who is the donor at the time of transplantation. Therefore, the problem is that the collection rate per mass of the extracted tissue is low, and in the case of muscle tissue, the invasion property to the motor function is high.

  Furthermore, when articular cartilage is damaged by trauma or the like, it is difficult to regenerate normally, causing pain and gait disturbance. Therefore, as a treatment method for cartilage damage, a treatment method using autologous cartilage transplantation has been developed in recent years and has been actually used. However, there are problems that it is necessary to collect cartilage from other sites, and that it is difficult to proliferate the collected chondrocytes outside the body.

Wakiya Shigeyuki, “Present and Future of Articular Cartilage Regeneration”, Pharmaceutical Journal, 2007, Vol. 127, No. 4, p857-863 Ichiro Seki, et al., “Cartilage differentiation of synovial mesenchymal stem cells”, Regenerative medicine (Journal of Regenerative Medicine Society of Japan), Vol. 4, No. 4, p 46-52

  On the other hand, research on pluripotent stem cells, which are more undifferentiated than rare mesenchymal stem cells and can be proliferated semi-permanently in vitro, is being promoted by various research institutes. The pluripotent stem cells reported so far include embryonic stem cells (ES cells) established from embryonic portions of human fertilized eggs, embryonic stem cells (Embryonic) established from gonads of aborted fetuses. Germ Cell (EG cells), pluripotent spermatogonial stem cells (mGS cells) established from the testes of adult mice, induced undifferentiated artificially created by introducing multiple genes simultaneously A stem cell (Induced Pluripotent Stem Cell; iPS cell) is mentioned.

  However, pluripotent stem cells with extremely high undifferentiation cannot be used as resources for model research or regenerative medicine as they are, and it is essential to direct them to cell types according to their purpose (differentiation induction).

  Therefore, in recent years, research aimed at developing a safe and efficient differentiation induction method has been conducted on an international scale.

  However, there are many challenges to clinical applications such as the need to use growth factors and antibodies that are not approved as pharmaceuticals, or many protocols that require the use of cell separation devices that are difficult to control cleanliness. It is left.

  Moreover, there are very few effective methods proposed to date for the problem that differentiation-induced cells become cancerous after transplantation.

  The object of the present invention has been made in view of such a current situation, and is derived from mesenchymal cells and mesenchymal cells that are useful for embryological research, disease research, clinical application, experimental models, etc. in mammals. It is intended to provide a chondrocyte to be differentiated, and a differentiation induction method and a separation method capable of obtaining the cell with high yield.

  As a result of diligent research, the present inventors surprisingly surprisingly, when isolating mesenchymal cells from embryoid bodies, mesenchymal cells differentiated from pluripotent stem cells were put into the incubator under specific conditions. In contrast to the close contact, cells that have differentiated into cells other than mesenchymal cells and undifferentiated cells are found to be floating in the culture medium. The present inventors have found that separation of mesenchymal cells from pluripotent stem cells that had been performed can be performed extremely easily and simply, and the present invention has been completed.

  Furthermore, although regenerative medicine using tissue stem cells centering on mesenchymal stem cells has attracted attention, tissue stem cells, like chondrocytes, have limitations such as tissue invasion and limited number of amplification. As described above, since mesenchymal cells can be separated and cultured from pluripotent stem cells as described above, chondrocytes can be obtained using this, and in addition, pluripotency can be achieved in a hypoxic environment. We found that culturing stem cells can strongly suppress the expression of oncogenes, suppress the expression of genes involved in carcinogenesis in induced pluripotent stem cells such as iPS cells, and solve the problem of canceration of cells. The present invention has been completed.

  Moreover, the leukocyte inhibitory factor-receptor (LIF-LIFR) pathway is a signal essential for the suppression of oncogenic gene expression by culturing in this hypoxic environment and for maintaining the undifferentiated nature of pluripotent stem cells. In combination with the knowledge that the expression of LIFR is suppressed in a hypoxic state and the knowledge that the substrate production ability of chondrocytes is markedly improved under hypoxia, it can be efficiently performed from a pluripotent stem cell with a simple operation. In addition, the inventors have found that chondrocytes with low carcinogenicity can be obtained, and completed the present invention.

  The present invention relates to a mesenchymal cell characterized by inducing a differentiated cell from a pluripotent stem cell and then separating the mesenchymal cell from the culture of the differentiated cell using the adhesion of the mesenchymal cell. It is a manufacturing method.

  The present invention also provides a method for inducing a differentiated cell from a pluripotent stem cell, then separating the mesenchymal cell from the differentiated cell culture using the adhesion of the mesenchymal cell, and then in the presence of a chondrocyte inducing factor. A method for producing chondrocytes, characterized by

  In addition, the present invention induces differentiated cells from pluripotent stem cells, and then separates mesenchymal cells from the differentiated cell culture using the adhesion of mesenchymal cells, and then cultures mesenchymal cells. A method for inhibiting carcinogenesis of pluripotent stem cell-derived cells, characterized in that, in any of the cultures induced to target cells, the culture is performed in a hypoxic environment.

  According to the present invention, mesenchymal cells are produced by a simple method of inducing differentiation of pluripotent stem cells and separating mesenchymal cells from a differentiated cell population by utilizing the difference in cell adhesion. Thus, it is possible to obtain an extremely excellent effect that cells for inducing differentiation into various cells useful for regenerative medicine, which have been limited so far, can be easily provided.

  Further, according to the present invention, mesenchymal cells can be obtained by an extremely simple operation, and therefore chondrocytes can be obtained efficiently based on this, and a method for treating the cause of pain and gait disturbance, particularly cartilage damage. As a result, it is possible to obtain an excellent effect that the problem that the cartilage must be collected from other parts and the problem that it is difficult to proliferate the collected chondrocytes outside the body can be obtained.

  Furthermore, according to the present invention, by culturing mesenchymal cells and the like in a hypoxic environment, carcinogenicity caused by transcription factors expressed in pluripotent stem cells can be suppressed, It has an excellent effect that a safe material for regenerative medicine can be provided.

FIG. 1 shows iPS cells before differentiation induction and mesenchymal cells after differentiation induction, FIG. 1 (a) shows iPS cells, FIG. 1 (b) shows a cell population contained in embryoid bodies after differentiation induction, FIG. 1 (c) shows mesenchymal stem cells isolated according to the present invention. It is a figure which shows the change of a gene expression at the time of adding retinoic acid at each density | concentration. Oct-4 and Nanog are markers for undifferentiated cells, and the progression of differentiation can be measured by the decrease in both genes. PDGFRα is a marker of mesenchymal stem cells, and when it is elevated, the production efficiency of the target cells can be measured. * Indicates that a statistically significant risk difference was observed at 0.05 or less compared to untreated samples. ** Shows that a statistically significant difference was observed at a risk rate of 0.01 or less compared to untreated samples. It is a figure which shows the expression profile of the mesenchymal cell obtained in Example 1, Fig.3 (a) shows the evaluation result by RT-PCR, FIG.3 (b) shows the evaluation result by Western blotting. It is a figure which shows that addition of basicFGF (basic fibroblast growth factor) is effective for the culture | cultivation of the mesenchymal cell induced | guided | derived in Example 1. FIG. The horizontal axis of the figure shows the number of passage operations counted from the time of separation. That is, P + 2 is set after the second passage. The vertical axis of the figure indicates the total number of cells. In the figure, 1 shows the results when cultured with basic FGF added, and 2 shows the results when cultured without basic FGF. It is a figure which shows the result of having performed the histochemical dyeing | staining or immunofluorescent dyeing | staining of the chondrocyte obtained in Example 2. FIG. It is a figure which shows the expression profile by the western blotting method of the chondrocyte obtained in Example 3.

  The most characteristic feature of the present invention is that, in separating mesenchymal cells from embryonic bodies derived from pluripotent stem cells, particularly induced pluripotent stem cells, mesenchymal cells are other than undifferentiated or mesenchymal cells. Compared to differentiated cells, the degree of close contact with the incubator is high, and it has been found that separation of mesenchymal cells can be carried out very easily by using this property.

  Since the obtained mesenchymal cells can be induced to differentiate into various cells, various cells necessary in regenerative medicine can be obtained more easily by using the method of the present invention. is there.

  In the present invention, pluripotent cells that can be used to obtain mesenchymal cells or chondrocytes derived therefrom can be suitably used as long as they can differentiate into mesenchymal cells. Examples thereof include so-called pluripotent cells such as various iPS cells, ES cells, mGS cells, and GS cells (germ stem cells). These pluripotent stem cells may be human cells, may be cells derived from mice, rats, rabbits, goats, sheep, or other mammals. For example, examples of iPS cells include cells into which transcription factors such as Oct3 / 4, Klf4, c-Myc, Tert, Nanog, Oct3 / 4, Sox2, Lin28 have been introduced. Examples of ES cells include RF8 cells, JI cells, CGR8 cells, and MG1.19 cells, and commercially available mouse ES cells include cells derived from 129SV, C57 / BL6, and DBA / 1. Further, examples of human ES cells include KhES-1 cells, KhES-2 cells, and KhES-3 cells, and examples of monkey ES cells include cynomolgus monkey ES cells. Among these, cells capable of forming embryoid bodies are preferable because they can be induced into mesenchymal cells with a higher success rate via embryoid bodies.

  The pluripotent stem cells used in the present invention are preferably positive for alkaline phosphatase activity, Oct-4, Nonog, etc., which are undifferentiated markers, and particularly those in which a plurality of markers are positive.

  The method for producing mesenchymal cells in the present invention is carried out by inducing differentiated cells from pluripotent stem cells and then separating mesenchymal cells from the differentiated cell culture using the adhesion of mesenchymal cells. In addition, after inducing embryoid bodies once as part of the process of inducing differentiated cells from pluripotent stem cells, the embryoid bodies are further cultured, and the adhesion of mesenchymal cells to the obtained differentiated cells is increased. It can also be carried out by separating mesenchymal cells by using them.

The method for producing mesenchymal cells in the present invention comprises the following steps.
[1] Differentiation induction step (step of inducing differentiated cells from pluripotent stem cells)
[2] Separation process (separation process of mesenchymal cells)
In addition to the steps [1] to [2], the method for producing chondrocytes in the present invention includes [3] a chondrocyte induction step (step of inducing chondrocytes from mesenchymal cells).

  Furthermore, the method for inhibiting carcinogenesis of pluripotent stem cell-derived cells of the present invention is a hypoxic culture step (a step of culturing cells in a hypoxic environment), which is performed in any of the steps [1] to [3]. ).

Hereinafter, it demonstrates in order of each process.
Differentiation induction process (induction of differentiated cells from pluripotent stem cells)
In the differentiation induction step, pluripotent stem cells are cultured, the obtained cultured cells are separated for each cell with a cell lysate, and then the cells are separated and further seeded in an incubator to obtain pluripotent stem cells. Embryoid bodies are formed by culturing in a culture solution that does not contain an undifferentiation maintenance factor or a culture solution that contains a differentiation-inducing factor, or by using a culture solution that does not contain an undifferentiation maintenance factor and then performing non-adherent culture Can be implemented.

  For cell detachment, a cell lysate used in tissue or cell culture can be used. For example, in addition to a mixed solution of about 0.25% trypsin and 1 mM EDTA, Triple Express (trade name), Accutase Commercially available products such as (trade name, manufactured by Innovative Cell Technology) can be used. The separation of the dissociated cells can be performed by, for example, centrifugation.

The culture in the culture solution may be performed at normal temperature under normal cell culture conditions, that is, aerobic conditions, for example, in an incubator at 30 to 40 ° C. in the presence of CO ₂ and humidity saturation. It can be carried out by culturing. In the case of via embryoid body formation, it is preferable to use a low adhesion incubator.

  As the culture solution, a culture solution used for tissue or cell culture can be used, and examples thereof include Eagle's minimal medium and Dulbecco's modified Eagle medium. Furthermore, those obtained by adding serum or vitamin A or a derivative thereof or a differentiation-inducing factor such as DMSO or both serum and differentiation-inducing factor to these media can be preferably used.

  In addition, as an incubator used for culturing, it is not particularly necessary to coat the adhesive surface, but in order to obtain more cells, an incubator coated with fibronectin, collagen, gelatin, etc. may be used. . Alternatively, a commercially available coated incubator can be used. Thereby, differentiated cells can be obtained efficiently.

  The culture solution may be filled on the entire surface of the incubator. However, if a preferable range is given by taking a plastic petri dish as an example, the amount of the solution is preferably 2 to 4 mL if the diameter is 35 mm, and 4 if the diameter is 60 mm. ~ 8 mL is desirable. When using a 100 mm diameter thing, about 8-12 mL is desirable.

  As described above, in the method of the present invention, the differentiation-inducing step is performed by separating the mesenchymal cells from the culture of differentiated cells derived from pluripotent stem cells or inducing the differentiated cells once. More preferably, the embryoid body is further cultured after induction. Hereinafter, the differentiation induction process will be described by taking as an example the case of inducing differentiated cells via the embryoid body.

  Embryoid bodies are cultured for 3 to 10 days in Dulbecco's modified Eagle's medium or the like in the low-adhesion incubator as described in the differentiation induction step in the low adhesion culture vessel. Can be formed.

  In the case of inducing differentiated cells via an embryoid body, it can be carried out by precipitating and separating the embryoid body from a culture solution containing the embryoid body, and further seeding and culturing in an incubator. . In the present invention, a differentiated cell population containing mesenchymal cells can be obtained more suitably by adding vitamin A or a derivative thereof to the culture medium in this step.

  Specifically, after confirming that the embryoid body was formed in the culture solution obtained above, the culture solution containing the embryoid body was recovered in a centrifuge tube and left standing, etc. Since it becomes a precipitate and dead cells and cell debris are suspended in the culture solution, the embryoid body can be separated by removing the culture solution.

Vitamin A or a derivative thereof may be added to a culture solution after seeding an embryoid body in an incubator and confirming that the embryoid body is adhered to the incubator. Retinoic acid is particularly preferred, and the amount added is preferably about 10 ⁻⁸ to 10 ⁻⁵ M in the medium, and when retinoic acid is added, it is particularly about 10 ⁻⁶ M. preferable.

  In the present invention, dimethyl sulfoxide can be used instead of vitamin A.

  In addition, as in the case of culturing the cells, the incubator used for culturing does not particularly need to be coated on the adhesive surface. However, when more cells are to be obtained, fibronectin, collagen, gelatin, etc. A coated incubator may be used. Alternatively, a commercially available coated incubator can be used. The culture medium is preferably filled so as to be as shallow as possible, so-called shallow, for example, if the incubator is a culture dish, the culture medium layer is adjusted to be about 0.5 to 2 mm. It is particularly preferred. This induces differentiation of mesenchymal cells from the embryoid body.

[2] Separation process (separation process of mesenchymal cells)
In the separation step, after confirming that various cells including mesenchymal cells have appeared in the incubator, the culture solution is removed, the cells are separated, and the differentiated cells are collected.

  Next, when the sorted cells are cultured in the incubator for a short time, the mesenchymal cells grow in close contact with the incubator, and many of the differentiated cells and undifferentiated cells other than the mesenchymal lineage are incubators. Therefore, the mesenchymal cells can be easily separated by removing the culture medium and washing the incubator. The short-time culture is usually performed for about 30 minutes to 1 hour. For example, it is desirable to separate at a stage where some cells adhere and begin to spread in a spindle shape. When the cells are cultured until they completely extend, other cells may adhere to the cells as a scaffold, so it is desirable to separate them before spreading. In the separation, if the incubator is shaken lightly before removing the culture solution, the separation from undifferentiated cells and the like is easier.

  As the cell detachment solution, the one used when the cells are separated from the cell detachment solution in the differentiation induction step can be preferably used. The reaction of the cell lysate depends on conditions such as the amount of cells, but it may take about 5 minutes. After the reaction, add Dulbecco's modified Eagle's medium supplemented with fetal calf serum to a final concentration of 10% or more. Stop the enzymatic reaction. Differentiated cells can be sorted, for example, by transferring them to a centrifuge tube and centrifuging at 1,500 rpm for 10 minutes.

  Thus, since the mesenchymal cells remain in the incubator, the cells are further cultured in a serum-reduced commercial medium suitable for culturing the mesenchymal stem cell culture, for example, Messenpro RS medium (trade name, manufactured by Invitrogen). Mesenchymal cells can be proliferated, and mesenchymal cells can be more efficiently proliferated by adding about 10 ng / ml to 20 ng / ml of basic fibroblast growth factor (basic FGF) to the culture medium. .

  The cells thus obtained are confirmed to be mesenchymal cells by RT-PCR, in which cDNA is produced by reverse transcriptase using RNA expressed by the cells and the genes specifically expressed in stem cells are measured. can do.

  The reverse transcription reaction is a common method used in the art such as reverse transcriptase, RNase inhibitor, deoxyribonucleoside triphosphate (dNTP) mixture, random primer, and diethylpyrocarboxylic acid (DEPC) treatment. Total RNA extracted from stem cells can be added to water, and a thermal cycler can be used at 37 ° C. for 120 minutes and 85 ° C. for 5 minutes. The PCR conditions were such that, for example, the target DNA was added to a mixed solution of Taq DNA polymerase, dNTP mixed solution, primer and autoclave water, followed by denaturation reaction at 94 ° C. for 2 minutes using a thermal cycler. It can be carried out by repeating the amplification reaction at 30 ° C. for 30 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 30 seconds 30 times.

  At this time, the transcription product is quantitatively observed by using a primer designed so that the PCR product is about 100 bp and mixing the probe with SYBR-Green or fluorescent dye added to the PCR system (Real Time PCR). The following five types of primers can be listed as such primers.

Primer 1
Gene: Mus Musculus Beta-actn
Forward direction: TTCCAGCCTTCCTTCTTG
Reverse direction: GTCACACTTCATGATGGAATTG

Primer 2
Gene: Mus Musculus Flk-1
Forward direction: TGTCGCTCTGTGGTTCTGC
Reverse direction: GAAAATCGCCAGGCAAAC

Primer 3
Gene: Mus Musculus PDGFRα
Forward direction: GTCCTCAGCTGTCTCCTCA
Reverse direction: TAGAGGGTAATAAGAGCTGGC

Primer 4
Gene: Mus Musculus PDGFRβ
Forward direction: TCCACCGTCATCTCTCTCA
Reverse direction: GGATCTCATAGCGTGGCTT

Primer 5
Gene: Mus Musculus Vimentin
Forward: GCCGAGGAATGGTACAAGTC
Reverse direction: GGCATCGTTGTTCCGGTT

  In order to measure genes specifically expressed in stem cells, Western blotting using an antibody against a protein expressed by the cells is effective, and this can be used.

  The Western blot method may be a general method using, for example, 10% acrylamide gel, sodium dodecyl sulfate buffer (SDS buffer), or polyvinylidene difluoride (PVDF) membrane.

  As antibodies used at this time, commercially available anti-recombinant MMP-11 anti-chicken antibody (Abcam), anti-human PDGFRα anti-rabbit antibody (Santa Cruz Biotechnology), anti-human actin anti-goat antibody (Santa) Secondary antibodies include anti-IgY bovine antibody (Santa Cruz Biotechnology), anti-rabbit IgG goat antibody (Santa Cruz Biotechnology), anti-goat IgG anti-donkey antibody (Santa Cruz Biotechnology).

  Mesenchymal cells derived and isolated from pluripotent stem cells by the method of the present invention have the following properties.

1. Cell shape:
Differences in morphological and physiological characteristics can be clarified by comparing undifferentiated pluripotent stem cells with induced mesenchymal cells. Specifically, mesenchymal cells show fibroblast-like morphology and do not form spherical colonies like pluripotent cells. FIG. 1 is a diagram showing photographs of undifferentiated stem cells and cells after induction, FIG. 1 (a) shows iPS cells, FIG. 1 (b) shows a cell population contained in embryoid bodies after differentiation induction, FIG. 1 (c) shows mesenchymal stem cells isolated according to the present invention.

2. Cell surface markers:
PDGFRα and PDGFRβ are receptors for the growth factor PDGF that acts on mesoderm proliferation. If the presence of these mesenchymal markers can be confirmed, it can be confirmed that the cells are mesenchymal cells. Flk-1 (vascular endothelial growth factor receptor) is a marker for endothelial cells, and if Flk-1 is expressed, it is confirmed that the cell is not a mesenchymal cell.

3. Intracellular / intranuclear markers:
Vimentin is a major cytoskeletal protein that is distributed in a variety of cells, including fibroblasts, vascular endothelial cells, smooth muscle cells, striated muscle cells, bone / chondral cells, and nerve sheath cells that make up the connective tissue. If this is expressed, it is confirmed that the cell is not an epithelial cell.
MMP-11 is a mesenchymal cell marker gene, and if it is expressed, it is confirmed to be a mesenchymal cell.

[3] Chondrocyte induction step (induction of chondrocytes from mesenchymal cells)
In the present invention, as a method for producing pluripotent stem cell-derived chondrocytes, a method of culturing the mesenchymal cells obtained in the separation step [2] as a mass and inducing differentiation of the chondrocytes (hereinafter referred to as a mass) A method of inducing differentiation of chondrocytes in the presence of growth factors (hereinafter referred to as planar culture method). Methods are included.

  When using the bulk culture method, the mesenchymal cells obtained in the separation step of [2] can be performed by culturing in the presence of a chondrocyte induction medium so as not to disrupt the cell sedimentation. The culture method can be carried out by seeding the mesenchymal cells obtained in the separation step [2] at a high density on a flat surface and culturing in the presence of a chondrocyte induction medium.

  In any culture method, the culture can be carried out under normal cell culture conditions. For example, fetal bovine serum is added to a Dulbecco's modified Eagle medium to a final concentration of 10% or more. And commercially available products such as Messenpro RS medium can be used.

  As the chondrocyte induction medium, for example, a Dulbecco's modified Eagle medium added with fetal bovine serum in an amount of 1 to 5% in final concentration can be used.

  In addition to antibiotics (penicillin, streptomycin, amphotericin, etc.), ascorbic acid 10 mg / ml, dexamethasone 10 nM, bone morphogenetic protein-2 (BMP-2), transformer growth factor- (TGF-), stem pro chondrocyte differentiation kit (Commercial name, manufactured by Invitrogen), chondrocyte culture medium (trade name, manufactured by Primary Cell), and other commercially available cartilage induction media.

  The amount of the induction medium added to the culture medium is preferably changed according to the number of cells. For example, the induction medium has a ratio of 1 mL to 1,000,000 to 1,500,000 mesenchymal cells. It is desirable to use For counting the number of cells, the obtained cell pellet is suspended in a culture solution and mixed with a pipette, and then a part is separated and mixed with an equal amount of trypan blue solution. This can be carried out by a general procedure such as placing it on a hemocytometer and counting the number of viable cells under an upright microscope.

The above cells may be cultured under normal cell culture conditions. For example, the cells can be cultured by culturing in an incubator or the like at 37 ° C., 5% CO ₂ , and humidity saturation.
Further, in culturing, it is preferable to culture in a hypoxic environment of about 5% because it can further promote differentiation into chondrocytes and can suppress carcinogenicity as described later.

  In the planar culture method, seeding is performed by suspending mesenchymal cells in a culture solution and seeding on a flat surface, such as a 96-well multiplate, on a culture dish with a small bottom area and cell culture. However, it is desirable to induce differentiation of chondrocytes.

  In addition, it is desirable to induce differentiation into chondrocytes once the mesenchymal cells are isolated, but the cells containing the remaining mesenchymal cells are removed from the culture solution in which the embryoid bodies are formed. It can also be cultured in the presence of a cartilage induction medium. In culturing, from the viewpoint of avoiding unnecessary stress such as a rapid change in culture temperature and culture medium pH, it is desirable to culture in a sealed state except for necessary operations such as culture medium exchange.

  The chondrocytes thus obtained were prepared as cDNAs by reverse transcriptase using RNA expressed by the cells, as in the confirmation of the mesenchymal cells, and the genes specifically expressed in the stem cells were It can be confirmed by RT-PCR to be measured, and the implementation conditions can be the same as the conditions in the mesenchymal cells except for the primers used.

The following two types of primers can be used.
Primer 6
Gene: Mus Musculus Aggrecan
Forward direction: GAAGAGCCTCGAATCACC
Reverse direction: CCTCCGTGTGGGTCTCAT

Primer 7
Gene: Mus Musculus type2collagen
Forward direction: GGTTCACATACACTGCCCTG
Reverse direction: TCTGTGATCGGTACTCGATGA

It can also be confirmed by Western blotting, and examples of antibodies include anti-human aggrecan anti-mouse antibody (Millipore) and anti-human type 2 collagen anti-mouse antibody (Daiichi Fine Chemical Co., Ltd.) as primary antibodies. Examples of the secondary antibody include an anti-mouse IgG goat antibody (manufactured by Santa Cruz Biotechnology).
Low oxygen culture process (process of culturing cells in a low oxygen environment)

  The present invention also provides a pluripotent stem cell characterized in that cells are cultured in a hypoxic environment in any step from the differentiation induction step of [1] to the chondrocyte induction step of [3]. This is a method for suppressing the carcinogenicity of a cell derived from the origin.

  The hypoxic culture step of the present invention can be carried out under normal culture conditions except that the amount of oxygen is about 1 to 5% in cell culture, and a concentration of 5% is particularly preferable.

  Further, the hypoxic culture step of the present invention may be performed at the time of culture for various differentiation induction from pluripotent stem cells to chondrocytes, but by performing in the chondrocyte culture step, the final This is preferable because the production amount of chondrocytes as a product is not reduced.

  Furthermore, the suppression of carcinogenicity by the hypoxic culture of the present invention is not limited to the production of chondrocytes from pluripotent stem cells, and various regenerative medical cells such as cardiomyocytes and nerve cells are produced from pluripotent stem cells. Therefore, it can be carried out just by culturing in the low acid environment in the process of inducing differentiation of various target cells from pluripotent stem cells.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the present invention is not limited to the examples. In the following examples, “%” for a liquid or solid indicates weight% unless otherwise specified. Further, “%” for gases such as CO ₂ and O ₂ represents volume%.

Example 1 (Induction of differentiation from iPS cells to mesenchymal cells)
(1) Differentiation induction process As a pluripotent stem cell, the mouse iPS cell line iPS-MEF-Ng-20D-17 produced at Kyoto University and assigned from RIKEN was used.

  Confluent iPS cells were dissociated with a cell lysate, Triple Express (trade name, manufactured by Invitrogen), an equal amount of 10% FCS-DMEM was added, and the mixture was centrifuged at 1,500 rpm for 10 minutes. The supernatant was removed by suction, and the precipitated cells were collected.

Next, add 10 ml of antibiotics (penicillin, streptomycin, amphotericin cocktail, 100-fold concentrated solution, manufactured by Lonza) to a new 10% FCS-DMEM, and carefully suspend with a pipette. Then, after transferring to a 100 mm Petri dish, the cells were cultured in a CO ₂ incubator for 3 days at 37 ° C. and 5% CO ₂ .

  10% FCS-DMEM is obtained by dissolving 4.75 g of Dulbecco's modified Eagle medium (manufactured by Nissui Pharmaceutical Co., Ltd., Dulbecco's modified Eagle medium) in 500 mL of distilled water, autoclaving, and then adding 0.292 g L-glutamine, 10 A 6% aqueous solution of sodium bicarbonate and 50 mL of fetal bovine serum (manufactured by Hyclone Laboratories) were added.

After confirming the formation of the embryoid body, the culture solution containing the embryoid body was collected in a centrifuge tube and allowed to stand at room temperature for about 3 minutes. After removing the culture solution, the suspension was suspended in 10% FCS-DMEM and seeded on a 100 mm cell culture petri dish. The next day, after confirming the adhesive, in a state in which the retinoic acid (Sigma Aldrich) was added 10 ^{over 6} [mu] M, 8 days, 37 ℃, 5% CO 2 , were cultured in an incubator at humidity saturation.

(2) Separation process After 8 days, 0.25% trypsin (manufactured by Invitrogen) and 2 mL of 1 mM EDTA mixed solution are put into a culture dish from which the culture solution has been removed by suction, and the conditions are 37 ° C. and 5% CO _{2 in} a CO ₂ incubator. For 3 minutes.

  After 5 minutes, 2 mL of 10% FCS-DMEM was added to stop the enzyme reaction. After moving to a 15 mL capacity disposable centrifuge tube (Corning, 15 mL capacity), it was centrifuged again at 1,500 rpm for 10 minutes. Since the differentiated cells were precipitated by this operation, the supernatant culture solution was aspirated and removed.

Next, the antibiotic cocktail (penicillin, streptomycin, amphotericin cocktail, 100-fold concentrated solution, manufactured by Lonza) was suspended in 10 mL of 10% FCS-DMEM added to 1-fold, and transferred to a 100 mm Petri dish. The cells were cultured in a CO ₂ incubator at 37 ° C. and 5% CO ₂ for 1 hour.

  After 1 hour, the culture dish was shaken lightly, the culture medium was completely removed, and L-glutamine 0.292 g, 10 mM pyruvic acid was added to 500 mL of the mesenchymal cell culture medium Mesenpro RS medium (trade name, manufactured by Invitrogen). Sodium and antibiotic cocktail (penicillin, streptomycin, amphotericin cocktail, 100-fold concentrated solution, manufactured by Lonza) were added to 1-fold, and sterilized with a bottle-top filter with a pore size of 0.22 μm] newly added 10 ml In addition, baicFGF (manufactured by Millipore) was further cultured for 4 days under the condition that the final concentration was 10 ng / ml.

  As a result, mesenchymal cells were obtained. The morphology of the obtained mesenchymal cells is as shown in FIG. 1b. FIG. 1a shows the morphology of a mouse iPS cell line iPS-MEF-Ng-20D-17 strain obtained from RIKEN used in the present invention.

Moreover, it confirmed as follows that the obtained cell was a mesenchymal cell.
A) Characterization of cells by quantitative RT-PCR method The cells obtained in (2) above were instantaneously frozen in liquid nitrogen and stored in an ultra-low temperature storage at -80 ° C until used for testing. At the time of the inspection, 1 mL of TRIzol (Trizol, trade name, manufactured by Invitrogen) was added and left on ice for 5 minutes. Next, 200 μL of chloroform was added and mixed vigorously, and then allowed to stand at room temperature for 5 minutes. Thereafter, centrifugation was carried out for 10 minutes under the conditions of 15,000 rpm and 4 ° C., and the aqueous layer formed on the TRIzol layer was collected in a 1.5 mL tube.

  Next, 500 μL of 2-propanol was added, and the mixture was vigorously mixed again, and then allowed to stand at room temperature for 10 minutes. This was centrifuged at 15,000 rpm and 4 ° C. for 10 minutes, and the RNA pellet formed at the bottom was added to 25 mL of 75% ethanol (diethyl pyrocarbonate (DEPC) -treated water (manufactured by Wako Pure Chemical Industries)) with ethanol ( (Wako Pure Chemical Industries, Ltd.) 75 mL was added). Furthermore, after centrifuging at 15,000 rpm and 4 ° C. for 5 minutes and removing the supernatant, the RNA pellet was naturally dried and RNase-free water (distilled water, DNase and RNase-free, Wako Pure Chemical Industries, Ltd.) (Manufactured by Kogyo) dissolved in 5 μL.

  The reverse transcription reaction was carried out using a high capacity cDNA reverse transcription kit (Applied Biosystems). After performing reverse transcription according to the attached instruction, 40 μL of TE was added to 10 μL of the reacted solution, and 1 μL of this was used for RT-PCR analysis.

  RT-PCR was performed using primers specific for the sequences of mouse β-actin, Flk-1, PDGFRα, PDGFRβ, and Vimentin genes prepared in advance.

  The sequences of mouse β-actin, Flk-1, PDGFRα, PDGFRβ, and Vimentin gene are disclosed in Entrez Gene (http://www.ncbi.nlm.nih.gov/sites/entrez).

  The PCR reaction solution was prepared using SYBR II Premix EX Tac (registered trademark, manufactured by Takara Bio Inc.), and RT-PCT quantification tube (Microamp Optical 8-Tube Strip, trade name, Applied, manufactured by Biosystems Inc.) ). The PCR reaction was carried out using an RT-PCT system (ABI Prism 7700, manufactured by Applied Biosystems), followed by a denaturation reaction at 95 ° C. for 10 seconds, followed by an amplification reaction at 95 ° C. for 5 seconds and 60 ° C. for 30 seconds. The results were analyzed with Excel.

  When analysis was performed on three samples collected from an independent culture system, the relative expression level when the iPS cell was set to 1 was the embryoid body: 3.27 times that of Flk-1. D = 0.035, mesenchymal cells after separation: 1.04 times, D = 0.37. For PDGFRα, the embryoid body: 48.4 times, S. cerevisiae. D = 0.7, mesenchymal cells after separation: 9.1 times, S.D. D = 3.38. Statistical analysis revealed a significant (p <0.05) increase in expression of PDGFRα, a mesenchymal cell marker, between iPS cells and mesenchymal cells for both genes.

Further, RT-PCR was performed using the mesenchymal cells after separation as a specimen, and expression of PDGFRα, PDGFRβ, and Vimentin as mesenchymal cell markers was observed.
Furthermore, when Western blotting was performed using mesenchymal cells after separation as a specimen, expression of Oct-4, an undifferentiated marker, was lost in addition to significant increases in expression of PDGFRα and MMP-11, which are mesenchymal cell markers. Admitted.

  These results are as shown in FIG. 2. In the figure, a shows the result by RT-PCR, and b shows the result by Western blotting.

From the above results, it was confirmed that the isolated cells were mesenchymal cells.
Example 2 (Induction of chondrocyte differentiation by mass culture method)
From the cells separated in Example 1 (2), or separated in Example 1 (2) and cultured in the Messenpro RS medium containing L-glutamine, antibiotic cocktail, baicFGF and the like used in the separation step, a culture solution was obtained. After removing by suction, 0.25% trypsin-1 mM EDTA was added to the culture dish, and the separated mesenchymal cells were collected in a centrifuge tube and centrifuged at 1,500 rpm for 10 minutes. After aspirating and removing the supernatant culture solution, 1 mL of chondrocyte induction medium was added so as not to disrupt the cell sedimentation. Chondrocyte culture medium (trade name, manufactured by Primary Cell) was used as the chondrocyte induction medium.

  The number of cells was adjusted to 250,000 per centrifuge tube, and 1 mL of induction medium was used per centrifuge tube. For counting the number of cells, the obtained cell pellet was suspended in a culture solution, mixed with a pipette, and then partly separated and mixed with an equal amount of trypan blue solution. This was carried out by a general procedure such as placing it on a hemocytometer and counting the number of viable cells under an upright microscope.

Subsequently, the cells were cultured for 3 weeks in an incubator at 37 ° C., 5% CO ₂ , 5% O ₂ and humidity saturation. During culturing, the door of the incubator was closed and sealed for two days during the culture medium exchange.

Example 3 (Induction of chondrocyte differentiation by planar culture)
Culture from a culture dish of cells separated in Example 1 (2) or cells cultured in Messenpro RS medium containing L-glutamine, antibiotic cocktail, baicFGF and the like used in the separation step. The solution was aspirated and removed, 0.25% trypsin-1 mM EDTA was added to the culture dish, and the dissociated mesenchymal cells were collected in a centrifuge tube and centrifuged at 1,500 rpm for 10 minutes. After aspirating and removing the supernatant culture solution, the cell precipitate was suspended in Messenpro RS medium and seeded in a 96-well multiplate. The number of cells was adjusted to 250,000 per well.

After culturing for 48 hours, 100 μL of chondrocyte induction medium was added. The chondrocyte induction medium is Dulbecco's modified Eagle medium (described in the above-mentioned 、 1), ascorbic acid 10 mg / ml (Sigma Aldrich), dexamethasone 10 nM (Sigma Aldrich), 100 nM BMP-2 (bone) A protein added with a forming protein (manufactured by R & D Systems) and 20 μM TGF-β (transforming growth factor β, manufactured by R & D Systems) was used. The culture was exchanged every 2 days, and the cells were cultured in an incubator at 37 ° C., 5% CO ₂ , 5% O ₂ , humidity saturation for 2 weeks. During culturing, the door of the incubator was closed and sealed for two days during the culture medium exchange.

It was confirmed as follows that the cells thus obtained were chondrocytes.
When analysis was performed on three samples collected from an independent culture system in Example 2, when the iPS cells used in Example 1 were 1, relative expression levels were aggrecan (Aggrecan), which is a cartilage-specific substrate protein. About mesenchymal cells: 0.87 times, S. D = 0.13, chondrocyte: 7.04 times, S.D. D = 0.97. For type II collagen (Type 2 collagen), mesenchymal cells: 0.4 times, D = 0.11, chondrocytes: 2.6 times, S.D. D = 0.27. Statistical analysis showed significant (p <0.05) increased expression in chondrocytes for both genes.

  Moreover, when the expression of aggrecan and type 2 collagen was observed by Western blotting, a marked increase in both proteins was observed. The results of these Western blots are as shown in FIG.

  Furthermore, when the chondrocyte mass obtained in Example 3 was evaluated by histochemical staining and immunofluorescence staining, as shown in FIG. 5, it was positive for safranin O staining, which stains the substrate characteristic of chondrocytes in red. And a site stained red-purple with respect to toluidine blue staining, which stains a substrate specific to the cartilage matrix in red-purple. Furthermore, the expression of aggrecan, type 2 collagen, which is an extracellular matrix specific for chondrocytes, was observed. It is clear from this that the cells obtained are chondrocytes. In FIG. 5, the arrow in the “Toluidine blue staining” diagram indicates a portion that is stained purple-red.

Example 4 (Demonstration of carcinogenesis suppression effect by culture under hypoxic environment)
The mouse iPS cell line iPS-MEF-Ng-20D-17 was suspended in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum described in Example 1, transferred to a 100 mm Petri dish, and then 37 in a CO ₂ incubator. ° C., for 24 hours at 5% CO ₂ conditions.

After 24 hours, the cells were cultured for 24 hours under the conditions of oxygen concentration of 20% (same as in the air) or 5% (hypoxic state referred to in the present invention) at 37 ° C. and 5% CO ₂ .

  When each 3 samples collected from independent culture systems were evaluated using the relative expression level of Eras, a powerful oncogene, as an index, the differentiated cells obtained in the present invention were cultured at an oxygen concentration of 20% in the comparative example. When the mouse iPS cell was 1, the expression level was 0.27 times (SD = 0.076), and a strong expression suppression effect due to hypoxia was observed. Further, when the relative expression level of the undifferentiated state maintenance factor Nanog was compared, the chondrocyte of the present invention was 0.43 times the expression level of the comparative example, and the differentiation induction promoting effect by hypoxia was also observed. .

Claims (3)

  A method for producing a mesenchymal cell, characterized in that differentiated cells are induced from pluripotent stem cells, and then mesenchymal cells are separated from the differentiated cell culture using adhesion of mesenchymal cells.   Differentiated cells are induced from pluripotent stem cells, and then mesenchymal cells are separated from the differentiated cell culture using the adhesion of mesenchymal cells. A method for producing chondrocytes derived from pluripotent stem cells, characterized by   Induced differentiated cells from pluripotent stem cells, then isolated mesenchymal cells from the differentiated cell culture using the adhesion of mesenchymal cells, and then cultured the mesenchymal cells to target cells A method for inhibiting carcinogenesis of pluripotent stem cell-derived cells, characterized in that the culture is performed in a hypoxic environment in any of the cultures induced by