JP2011000127A - Method for producing protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing a desired protein by gene recombination technology which is the method for producing the desired protein by the gene recombination technology and by which the desired produced protein can be easily recovered without denaturation.SOLUTION: The method includes: introducing a vector, in which a fused gene containing a gene encoding a multiple pass transmembrane-type protein and a desired gene is combined, into virus particle-producing host cells to express the fused gene in the host cells; producing the desired protein in a form fused to the virus particles and the multiple pass transmembrane-type protein; and recovering the virus particles fused to the desired protein.

Description

  The present invention relates to a method for producing a desired protein by a gene recombination technique.

  Genome analysis is progressing, and the sequence analysis at the primary level is almost completed for human genome sequences, but it must be said that the functional analysis of each gene is far away. In other words, as the possibility of not having the number of genes as expected has begun to be discussed, it has become clear that in order to discuss the function, nothing can be discussed only by gene sequence information. The function of the cloned gene must be analyzed using a recombinant protein, but the protein obtained by the expression system in Escherichia coli is usually insoluble. It is a well-known fact that changes are accompanied. Up to now, the reality is that we have tried to match somehow by using a secretory expression system or using a refolding step. The reality is that we have been researching how to find the conditions to return to the original natural structure. Naturally, it is expected that a natural structure will be obtained when animal cells are used, but the problem is that the amount of expression obtained is too small and it takes too long to select a recombinant, that is, cytotoxicity due to antibiotics, etc. This selection condition is complicated and time-consuming, and is difficult to accept in a highly competitive world.

  Unlike the sugar chain structure derived from animal cells, the baculovirus expression system is simple but has a sugar chain structure and various technical improvements (Bac-To-Bac (registered trademark) baculovirus expression system, GibcoBRl, Patent Literature 1 and Patent Literature 2), and since recombination technology can be easily performed, has attracted much attention. To date, a secretory protein expression system has been devised (Non-patent Document 1), or a gene to be inserted before a gene that encodes a virus original protein (particularly a surface membrane protein) is fused (Non-Patent Document 1). Various ideas such as ˜3) have been made. However, it is expected that secretory proteins and the like can be obtained in a desired state. However, when a membrane protein is obtained, denaturation of the protein occurs under the solubilization condition treatment in the purification process. Alternatively, there is also provided a methodology for providing a simple purification step using a flag attached to a tag for the purification step and providing a simple purification step as a guide. There is no change in the situation in which it is unknown how much the tags other than the original protein can maintain the natural structure.

  Furthermore, the operations for purifying proteins produced by gene recombination techniques from cell culture supernatants and cell debris include various conventional methods such as ammonium sulfate precipitation, salting out, various chromatographies and electrophoresis. These purification methods are carried out in combination, but these purification methods are complicated in operation and yield is low. Further, as described above, the protein may be denatured during the purification process.

U.S. Pat.No. 5,674,908 U.S. Pat.No. 4,981,797

Protein Expr. Purif., 14, 8-12 (1998) J. Cell Biol., 143, 1155-1166 (1998) Biotechnology, 13, 1079-1084 (1995)

  Therefore, an object of the present invention is a method for producing a desired protein by a gene recombination technique, and the desired protein produced by the gene recombination technique can be easily and without being denatured. It is to provide a protein production method.

  As a result of intensive research, the inventors of the present application expressed a desired gene in a virus particle by expressing a fusion gene of a gene encoding a desired protein and a gene encoding a protein constituting the virus particle in a host cell. The virus particles are recovered in a form bound to the protein, and if necessary, the desired protein is recovered from the recovered virus particles, and the desired protein is purified easily and without denaturation. As a result, the present invention has been completed.

  That is, the present invention incorporates a fusion gene containing a gene encoding a protein constituting a virus particle and a desired gene into a vector, introduces the vector into a host cell, and expresses the fusion gene in the host cell, Provided is a method for producing a protein by a gene recombination technique, which comprises producing a desired protein in a form fused to a virus particle and recovering the virus particle fused with the desired protein. The present invention also introduces a vector in which a fusion gene containing a gene encoding a multi-transmembrane protein and a desired gene is introduced into a host cell that produces virus particles, and the fusion is carried out in the host cell. Gene recombination comprising expressing a gene, producing a desired protein in a form fused with the viral particle and the multi-transmembrane protein, and recovering the viral particle fused with the desired protein Provide protein production methods by technology.

  INDUSTRIAL APPLICABILITY According to the present invention, there has been provided a novel method for producing a desired protein by a gene recombination technique capable of recovering the produced desired protein easily and without denaturation. According to the method of the present invention, since a desired protein is produced as a fusion protein with a large virus particle, it can be purified very easily by centrifugation or the like.

  In the first method of the present invention, a fusion gene comprising a gene encoding a protein constituting a virus particle and a desired gene is incorporated into a vector, the vector is introduced into a host cell, and the fusion gene is introduced into the host cell. It is expressed, and the desired protein is produced in a form fused to the virus particle, and the virus particle fused with the desired protein is recovered.

  Here, examples of the protein constituting the virus particle include a coat protein constituting the envelope of the virus. Specifically, gp64 can be mentioned as a coat protein of baculovirus, but is not limited to this, and any protein can be used as long as it is incorporated as a component in a virus particle formed in a host cell. It may be a protein.

  Among these, a protein constituting a virus particle of baculovirus is particularly preferable, and gp64 that is a coat protein of baculovirus is particularly preferable. gp64 itself is a well-known protein, and its amino acid sequence and gene sequence encoding the same are also known, and are described in, for example, GenBank Accession No. L22858. Baculovirus has a promoter that is strongly expressed in insect cells, and baculovirus vectors using this promoter and insect cells such as silkworms that are hosts thereof are commercially available and widely used. Has been established. When a gene encoding a desired protein is incorporated into a baculovirus vector and expressed in an insect host cell, usually the gene encoding the desired protein is first introduced into an E. coli cell containing bacmid DNA and helper plasmid DNA. A gene containing a desired protein is incorporated into a bacmid by homologous recombination in E. coli cells, and the bacmid is propagated and then infected with host insect cells. Then, the desired protein is produced together with the baculovirus in the host cell. Bacmids, helper plasmids, and E. coli cells containing these used in this method are also commercially available, and the above method can be easily performed using these commercially available products. Therefore, based on this conventional method, baculovirus particles containing gp64 fused with the desired protein are produced by incorporating the gene encoding the gp64 gene and the desired protein into the baculovirus vector and expressing it in the host insect cell. The In this case, since the insect cell is a eukaryotic cell, unlike the case where the prokaryotic microbial cell is used as a host, the sugar chain is bound to the desired protein to be produced, and there is also an advantage that it is closer to the natural state. Brought about.

  The desired protein is not limited in any way and may be any protein. Preferred examples include fucosyltransferases 1 to 9, N-acetylglucosaminyltransferases I to VI, sialyltransferases, glycosyltransferases such as galactosyltransferases, and glycolipid sulfates that impart sulfate groups to the sugar chain structure. II including the scavenger receptor family including transferases (eg, cerebroside sulfate transferase that synthesizes heparan sulfate N-sulfotransferase and galactosylceramide sulfate), oxidized LDL scavenger receptor, MACRO (Macrophage Receptor with Collagenous Structure), etc. Examples include general type membrane proteins, but are not limited thereto. In addition, the fusion gene containing the gene encoding the protein constituting the virus particle and the desired gene may be a direct link of these two genes, and there is an intervening sequence between them. (However, in this case, the reading frame of the downstream gene needs to match the reading frame of the upstream gene). Alternatively, a fusion gene containing these two genes may be formed in advance and incorporated into a vector, or one of the genes may be incorporated into the vector first, and then the other gene may be incorporated into the vector. A fusion gene may be formed. As described later, a sequence encoding the recognition sequence Leu-Val-Gly-Arg-Pro-Ser of thrombin and the recognition sequence Ile-Glu-Gly-Arg of Factor Xa is interposed between the two genes. If desired, these proteolytic enzymes can be allowed to act in the subsequent purification step to easily separate the desired protein from the virus particles.

  It is preferred that at least the active region of the desired protein is fused to the virus particle in such a way that it is exposed to the outside of the virus particle. By doing so, it is possible to confirm the presence of the desired protein using the immunoassay or the activity of the protein as an index without separating the protein from the virus particles, and it is sufficient if the activity of the desired protein can be used. Etc., it is also possible to use the desired protein in a form fused with the virus particle without separating it from the virus particle. This can be easily done if the structure of the viral particle is known. That is, for example, in baculovirus gp64, it is known that the N-terminus is exposed to the outside of the particle and the C-terminus is exposed to the inside of the particle, so that the desired protein can be fused to the N-terminal side of gp64. In this case, the entire virus particle is exposed. On the other hand, when the desired protein has a transmembrane region, such as human glycosyltransferase, the transmembrane region is highly hydrophobic, so that the transmembrane region is immobilized on the membrane (shell) of the virus particle. It is also possible to produce a protein in which the desired protein is embedded in a viral particle membrane. When the entire desired protein is completely exposed to the outside of the virus particle, the protein may be detached from the virus during centrifugation or the like. If so, it is preferable to produce the protein in such a manner that it is embedded in the virus particle membrane. In this case, the active region of the protein is preferably exposed outside the virus particle. This can also be done easily if the structure of the virus particle and the structure of the desired protein are known. For example, as described above, baculovirus gp64 is known to have an N-terminal exposed outside the particle and a C-terminal exposed inside the particle. On the other hand, human glycosyltransferases are known to be a type II membrane protein family in which an active region is present on the C-terminal side of the transmembrane region. Therefore, by connecting the 5 ′ side of the glycosyltransferase to the 3 ′ downstream side of the gp64 gene so that the N-terminal side of the glycosyltransferase is bound to the C-terminal side of gp64, the N-terminus of the glycosyltransferase is It binds to the C-terminus of gp64 within the virus particle, and its transmembrane region is immobilized on the virus particle membrane, and its active region is produced in a form exposed to the outside of the virus particle. Therefore, when the desired protein has a transmembrane region, the entire gene may be expressed as it is, and operations such as removal of the transmembrane region are unnecessary. Rather, it is preferable that the desired protein is relatively firmly fixed to the virus particle so that the desired protein does not leave the virus particle during a centrifugation operation or the like. It is preferable to have a region. Since gp64 is retained in the virus particle in such a way as to penetrate the membrane of the virus particle, when the desired protein has one transmembrane region, the fusion protein of the virus particle protein and the desired protein has a total of two membranes. It will be fixed to the virus particle in the penetrating region. Thus, it is preferable that the fusion protein of a virus particle protein and a desired protein has a total of two or more transmembrane regions.

  In the second method of the present invention, the fusion gene takes a form in which a gene encoding a transmembrane protein is fused multiple times. As a result, the desired protein is obtained in a form fused to a transmembrane protein multiple times. As described above, since the transmembrane region of the transmembrane protein has high hydrophobicity, the virus particle also penetrates the membrane of the virus particle. Therefore, when a multi-transmembrane protein is expressed in a host cell that produces virus particles, the multi-transmembrane protein is produced in such a manner as to penetrate the viral particle membrane a plurality of times. The desired protein is obtained in a form fused with the multi-transmembrane protein that penetrates the membrane of the virus particle a plurality of times. Since the multiple-transmembrane protein penetrates the membrane of the virus particle a plurality of times, it is difficult for the protein to be detached from the virus particle in the purification step, and thus the desired protein is also difficult to be detached from the virus particle.

  Also in the second method of the present invention, the two types of genes to be fused may be directly linked, or an intervening sequence may exist between each gene (in this case, however, the downstream side gene may be present). The reading frame of the gene must match the reading frame of the upstream gene). Moreover, after linking two types of genes to form a fusion gene, the fusion gene may be incorporated into a vector, or each gene may be incorporated into a vector in sequence to form a fusion gene within the vector. In order to facilitate the multiple transmembrane protein to penetrate the viral particle membrane multiple times, the fusion gene consists of a gene encoding the multiple transmembrane protein from the upstream side and a gene encoding the desired protein. It is preferable to include. If a sequence encoding the recognition sequence Leu-Val-Gly-Arg-Pro-Ser of thrombin or the recognition sequence Ile-Glu-Gly-Arg of Factor Xa is interposed between the two genes, In the purification step, these proteolytic enzymes can be allowed to act to easily separate the desired protein from the transmembrane protein multiple times.

  The multi-transmembrane protein may be any of various known multi-transmembrane proteins, for example, human chemokine receptor (CCR3, CCR4, CCR5, etc., 7-transmembrane type), lysophospholipid receptor Edg family as a body (7-penetration type), in vivo amine (noradrenaline, dopamine, serotonin, histamine) receptors (7-penetration type), prostaglandin receptors (7-penetration type), many Peptide hormone receptor (7-penetration), muscarinic receptor (7-penetration), glutamate receptor (7-penetration), collagen receptor CD36 (2-penetration), scavenger receptor class B (SR -B) (2 times penetration type), phosphatidic acid phosphatase (6 times penetration type), etc. can be mentioned, but it is not limited to these.

  In the second method, the host cell needs to produce virus particles. This is easily achieved by incorporating the fusion gene into the baculovirus vector described above and expressing it in insect cells, thereby producing virus particles in the insect cells simultaneously with the expression of the fusion gene. Can do. Alternatively, the host cell may produce virus particles by separately infecting the host cell with the virus itself or by infecting a vector that produces virus particles.

  Also in the second method of the present invention, it is preferable that at least the active region of the desired protein is fused to the membrane protein multiple times so as to be exposed to the outside of the virus particle. This can also be easily achieved if the structure of the virus particle, the structure of the multiple membrane protein and the structure of the desired protein are known. For example, when the 7-transmembrane human chemokine receptor protein CCR3 is used as the multiple transmembrane protein and human glycosyltransferase is used as the desired protein, CCR3 exposes its C-terminal side inside the viral particle. It penetrates the membrane of the virus particle in the form of CCR3 and human glycosyltransferase so that the transmembrane region of human glycosyltransferase becomes the eighth transmembrane region by connecting the human glycosyltransferase gene downstream of it. The enzyme fusion protein is embedded in the membrane of the virus particle, and the active region of human glycosyltransferase is exposed outside the virus particle.

  In addition, when the number of transmembranes of the multiple transmembrane protein is an even number, the desired protein is preferably a single transmembrane protein of type II transmembrane protein such as human glycosyltransferase. In the case of an odd-numbered transmembrane protein present in a protein, it is preferable to fuse a protein having no transmembrane domain structure as a desired protein.

  In the first and second methods of the present invention, the steps up to the step of producing a fusion protein in the host cell can be easily performed based on a conventional method using a commercially available kit including a baculovirus vector, a host insect cell and an E. coli cell. It can be carried out.

  After the virus particle is produced in the host cell in the form of the desired protein or a fusion form of the transmembrane protein and the desired protein multiple times, the virus particle is separated. In general, since the virus comes out in the cell culture supernatant, the virus particles can be easily separated by centrifuging the cell culture supernatant. In this case, the centrifugation can be easily separated from other various components in the culture supernatant by performing the centrifugation for about 30 to 120 minutes at an acceleration of about 9,000 to 100,000 g. Since the virus particles are much larger than other various proteins contained in the culture supernatant, they can be easily separated only by centrifugation. Therefore, it is not necessary to go through various complicated operations as in the conventional method, and there is no possibility that the protein is denatured. If the virus does not appear in the culture supernatant, the cells are crushed and the virus particles are recovered from the crushed material. This can also be easily performed by combining centrifugation at different accelerations 2 to 3 times. it can. Further, since the desired protein is exposed on the virus surface, an antibody against the desired protein can be prepared by immunizing a mouse or the like using the collected virus as an antigen.

  When at least the active region of the desired protein is exposed to the outside of the virus particle, the recovered virus particle itself has the activity of the desired protein. Etc., the virus particles recovered without separating the desired protein from the virus particles can be used as they are for the desired purpose.

  Moreover, in a method for obtaining an expressed protein in other cells, it is not easy to separate the protein in the cell from the expressed protein. Even if the expressed protein is secreted and released into the culture solution, it must be separated from the protein in the culture solution. Since the method of the present invention collects virus particles, it can be easily separated from proteins in cells and culture medium. That is, by obtaining a virus, it is possible to obtain a highly expressed protein as compared with a general expression system. Furthermore, when the desired protein is a transmembrane protein, the state fixed to the virus envelope membrane may maintain the natural three-dimensional structure at the time of transmembrane.

  Furthermore, in order to purify the desired protein from the virus particles, the baculovirus envelope can be dissolved with a weak surfactant and separated from the nucleocapsid (the core of baculovirus).

  For example, a buffer solution containing a surfactant (Triton X-100, Tweens, non-dead, deoxycholic acid, cholic acid, lyso PC, etc., final concentration of about 0.05 to 1.0%) is added to the baculovirus particles and stirred. Or dissolve the envelope by sonication. Thereafter, this solution is centrifuged for about 30 to 120 minutes at an acceleration of about 9,000 to 100,000 g. The nucleocapsid is present in the precipitate fraction and the desired protein bound on the envelope is present in the supernatant after centrifugation.

  At this stage, it can be purified mainly to the desired protein and the envelope protein (gp64) present in the envelope. When further purification is required, it can be purified using various columns (gel filtration column, ion exchange column, lectin column, antibody column, etc.).

  In addition, when a desired necessary protein is cut out from the virus particle, it can be cut out by attaching a protease recognition sequence to the exposed part from the virus surface. For example, when using thrombin as the protease to be used, the recognition amino acid sequence is “Leu-Val-Gly-Arg-Pro-Ser”, and when the protease is Factor Xa, the recognition amino acid sequence is “Ile-Glu-Gly-Arg”. The protease that can be inserted and the recognition amino acid sequence that can be inserted are not limited thereto. In a specific treatment method, virus particles are treated with protease, and then the solution is centrifuged at an acceleration of about 9,000 to 100,000 g for about 30 to 120 minutes. Viral particles are present in the precipitate or fraction, and the desired protein excised in the supernatant fraction is present.

  These operations are much simpler and milder than conventional purification operations for insoluble proteins, and there is almost no risk of protein denaturation.

  Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

Reference Example 1 When FUT3 gene, one of fucosyltransferases, is directly expressed α (1,3 / 1,4) fucosyltransferase gene (GenBank Accsession No. X53578, hereinafter referred to as FUT3) is expressed in baculoiurus Introduced and designed to obtain FUT3 protein. The FUT3 gene was cloned from a human gene according to a conventional method. FUT3F1: tcg cat atg gat ccc ctg ggt gca gcc aag added with restriction enzyme NdeI site and FUT3R3 added at restriction enzyme XhoI site: atg ctcgag tca ggt gaa cca agc cgc tat I went. The PCR amplification product of this FUT3 gene and the constructed pFB6A / CCR3 plasmid (see (2) below) were treated with restriction enzymes NdeI and XhoI. These were combined according to a conventional method, introduced into E. coli (DH5α competent cells), seeded on ampicillin-containing LB agar plates, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli and the sequence of the inserted FUT3 gene was confirmed. As a result, the sequence was identical to the previously reported sequence of the FUT3 gene (GenBank Accession No. X53578). The plasmid into which this FUT3 gene was introduced was designated as pFB6A / FUT3.

  In accordance with a conventional method, this FUT3 gene-incorporated donor plasmid (pFB6A / FUT3) is introduced into E. coli DH10Bac cells (GibcoBRl) into which bacmid DNA and helper DNA have already been introduced, and FUT3 is homologously recombined with bacmid DNA. Incorporated. This was done as follows. pFB6A / FUT3 was introduced into competent E. coli DH10Bac cells, seeded on an LB agar medium containing kanamycin, tetracycline, gentamicin, IPTG and Bluo-gal, and cultured at 37 ° C. for about 16 hours. Since E. coli having undergone homologous recombination can be confirmed as white colonies, the white colonies were selected and cultured in an LB medium solution containing kanamycin, tetracycline and gentamicin at 37 ° C. for about 16 hours. Bacmid DNA was purified from 1.5 ml of this E. coli solution according to a conventional method and dissolved in 40 μl of TE.

Add 5 μl of this bacmid DNA solution to 100 μl of Sf-900II culture solution (GibcoBRl), separately mix 6 μl of CellFECTIN reagent (GibcoBRl) and 100 μl of Sf-900II culture solution, It was left at room temperature for 45 minutes. Add 800 μl of Sf900II culture solution to this bacmid DNA / CellFECTIN mixture, add it to insect cell Sf21 cell GibcoBRl, 6-well plate with 9x10 ⁵ cells bound), and culture at 27 ° C for 5 hours did. After 5 hours, this bacmid DNA / CellFECTIN mixture was removed and cultured in an Sf-900II culture solution containing antibiotics for 72 hours at 27 ° C.

  After completion of the culture, the culture solution was collected. This culture solution contains a recombinant baculovirus that produces FUT3. The collected culture solution (800 μl) was added to separately cultured Sf21 cells (T75 flask, subconfluent, 20 ml Sf-900II culture solution containing antibiotics), and cultured at 27 ° C. for 72 hours. After culturing for 72 hours, the cells were detached from the flask and recovered simultaneously with the culture solution. The collected cell suspension was centrifuged at 3000 rpm for 10 minutes to separate into a supernatant and a precipitate. The precipitate was used as a cell fraction, and the supernatant was used as a baculovirus fraction.

  According to a conventional method, confirmation was made by Western blotting using a FUT3 monoclonal antibody (JP-A-8-119999). As a result, FUT3 protein was expressed in Sf21 cells, and three types with different molecular weights were confirmed. However, it was not observed in the baculovirus fraction.

Reference Example 2 Construction of pFB6A / CCR3 mRNA was extracted from human leukocytes by a conventional method, cDNA was prepared, and chemokine receptor CCR3 was cloned. At this time, the portion excluding the stop codon was amplified by PCR reaction, and a restriction enzyme recognition sequence was added to the primer used for cloning. The primers used were CCR3F: tcgcatatgacaacctcactagatacagtt, CCR3R: tgcgaattcaaacacaatagagagttccggctctg. The PCR amplification product of CCR3 gene was treated with restriction enzymes NdeI and EcoRI. The plasmid used for cloning is an improved version of the commercially available baculovirus vector pFastBac donor plasmid (GibcoBRL) so that it can be cloned with NdeI and EcoRI (hereinafter referred to as pFB6A). This pFB6A was also treated with NdeI and EcoRI, and the PCR amplification product of the CCR3 gene treated with the restriction enzyme was bound to this plasmid.

  The plasmid incorporating the PCR amplification product of the CCR3 gene was introduced into E. coli (DH5α competent cells) according to a conventional method, seeded on an ampicillin-containing LB agar plate, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli and the sequence of the inserted CCR3 gene was confirmed. As a result, the sequence of the CCR3 gene that had been reported (GenBank Accession No. AF026535) was confirmed. Therefore, the plasmid into which this CCR3 gene was introduced was designated as pFB6A / CCR3.

Example 1 When FUT3 gene, one of fucose transferases, is fused and expressed behind CCR3 gene The CCR3 gene of the constructed plasmid pFB6A / CCR3 has α (1,3 / 1,4) It was designed to bind the fucosyltransferase gene and obtain a CCR3-FUT3 binding protein. The FUT3 gene used was cloned in Reference Example 1. Primers used for amplification by the PCR reaction were FUT3F added with restriction enzyme EcoRI site: tgcgaattcatggatcccctgggtgcagcc and FUT3R added with restriction enzyme XhoI site: tgtctcgagtcaggtgaaccaagccgctat. The PCR amplification product of this FUT3 gene and the constructed pFB6A / CCR3 plasmid were treated with restriction enzymes EcoRI and XhoI. These were combined according to a conventional method, introduced into E. coli (DH5α competent cells), seeded on ampicillin-containing LB agar plates, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli and the sequence of the inserted FUT3 gene was confirmed. As a result, the sequence was identical to the previously reported sequence of the FUT3 gene (GenBank Accession No. X53578). The plasmid into which this FUT3 gene was introduced was designated as pFB6A / CCR3-FUT3.

  According to a conventional method, this donor plasmid (pFB6A / CCR3-FUT3) in which CCR3 gene and FUT3 gene are combined is introduced into E. coli DH10Bac cells into which bacmid DNA and helper DNA have already been introduced, and CCR3-FUT3 is homologous to bacmid DNA. Incorporated by replacement. This was done as follows. pFB6A / CCR3-FUT3 was introduced into competent E. coli DH10Bac cells, seeded on an LB agar medium containing kanamycin, tetracycline, gentamicin, IPTG and Bluo-gal, and cultured at 37 ° C. for about 16 hours. Since E. coli having undergone homologous recombination can be confirmed as white colonies, the white colonies were selected and cultured in an LB medium solution containing kanamycin, tetracycline and gentamicin at 37 ° C. for about 16 hours. Bacmid DNA was purified from 1.5 ml of this E. coli solution according to a conventional method and dissolved in 40 μl of TE.

This bacmid DNA solution (5 μl) was added to 100 μl of Sf-900II culture solution, and 6 μl of CellFECTIN reagent and 100 μl of Sf-900II culture solution were mixed together and allowed to stand at room temperature for 45 minutes. To this bacmid DNA / CellFECTIN mixed solution, 800 μl of Sf900II culture solution was further added, and this was added to insect cell Sf21 cells (6-well plate to which 9 × 10 ⁵ cells were bound) and cultured at 27 ° C. for 5 hours. After 5 hours, this bacmid DNA / CellFECTIN mixture was removed and cultured in an Sf-900II culture solution containing antibiotics for 72 hours at 27 ° C.

  After completion of the culture, the culture solution was collected. This culture solution contains a recombinant baculovirus that produces CCR3-FUT3. The collected culture solution (800 μl) was added to separately cultured Sf21 cells (T75 flask, subconfluent state, containing 20 ml of Sf-900II culture solution containing antibiotics) and cultured at 27 ° C. for 72 hours. After culturing for 72 hours, the cells were detached from the flask and recovered simultaneously with the culture solution. The collected cell suspension was centrifuged at 3000 rpm for 10 minutes to separate into a supernatant and a precipitate. The precipitate was used as a cell fraction, and the supernatant was used as a baculovirus fraction.

Example 2 Construction of pFB6A / gp64 According to a conventional method, genomic DNA was extracted from baculovirus and the envelope glycoprotein gp64 gene was cloned. At this time, the portion excluding the stop codon was amplified by PCR reaction, and a restriction enzyme recognition sequence was added to the primer used for cloning. The primers used were gp64F with the restriction enzyme NdeI site added: tcgcatatggtaagcgctattgttttatat, and gp64R with the restriction enzyme EcoRI site added: tgcgaattcatattgtctattacggtttct. The PCR amplification product of the gp64 gene was treated with restriction enzymes NdeI and EcoRI. The plasmid used for cloning was pFB6A. This pFB6A was also treated with NdeI and EcoRI, and the PCR amplification product of the gp64 gene treated with the restriction enzyme was bound to this plasmid.

  According to a conventional method, a plasmid incorporating a PCR amplification product of the gp64 gene was introduced into Escherichia coli (DH5α competent cells), seeded on an ampicillin-containing LB agar plate, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli, and the sequence of the inserted gp64 gene was confirmed. As a result, the sequence of the gp64 gene (GenBank Accession No. L22858) in the already reported baculovirus genome sequence was identical. The plasmid into which this gp64 gene was introduced was designated as pFB6A / gp64.

Example 3 When FUT3 gene, one of fucose transferases, is fused and expressed behind gp64 gene
The FUT3 gene was cloned to obtain a gp64-FUT3-binding protein by binding the gp64 gene and the α (1,3 / 1,4) fucosyltransferase gene, which is one of glycosyltransferases. Amplification of the FUT3 gene is shown in Example 3. The PCR amplification product of this FUT3 gene and the plasmid pFB6A were treated with restriction enzymes EcoRI and XhoI, and ligated by a conventional method. The plasmid incorporating the FUT3 gene was introduced into Escherichia coli (DH5α competent cells), seeded on ampicillin-containing LB agar plates and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli and the sequence of the inserted FUT3 gene was confirmed. As a result, the sequence was identical to the previously reported sequence of the FUT3 gene (GenBank Accession No. X53578). The plasmid into which this FUT3 gene was introduced was designated as pFB6A / FUT3.

  Therefore, the constructed plasmid pFB6A / gp64 was treated with restriction enzymes NdeI and EcoRI, and this reaction solution was separated on a low melting point agarose gel to obtain the gp64 gene. Furthermore, in order to incorporate gp64 into the pFB6A / FUT3 plasmid, it was treated with restriction enzymes NdeI and EcoRI. This plasmid was combined with the purified gp64 gene according to a conventional method. The gp64 was introduced into plasmid Escherichia coli (DH5α competent cells), seeded on ampicillin-containing LB agar plates, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli, the sequence of the inserted gp64 gene was confirmed, and it was confirmed that the insertion was performed correctly. The plasmid into which this gp64 gene was introduced was designated as pFB6A / gp64-FUT3.

  According to a conventional method, a donor plasmid (pFB6A / gp64-FUT3) in which this gp64 gene and FUT3 gene are combined is introduced into E. coli DH10Bac cells into which bacmid DNA and helper DNA have already been introduced, and gp64-FUT3 is homologous to the bacmid DNA. Incorporated by replacement. This was done as follows. pFB6A / gp64-FUT3 was introduced into competent E. coli DH10Bac cells, seeded on an LB agar medium containing kanamycin, tetracycline, gentamicin, IPTG and Bluo-gal, and cultured at 37 ° C. for about 16 hours. Since E. coli having undergone homologous recombination can be confirmed as white colonies, the white colonies were selected and cultured in an LB medium solution containing kanamycin, tetracycline and gentamicin at 37 ° C. for about 16 hours. Bacmid DNA was purified from 1.5 ml of this E. coli solution according to a conventional method and dissolved in 40 μl of TE.

This bacmid DNA solution (5 μl) was added to 100 μl of Sf-900II culture solution, and 6 μl of CellFECTIN reagent and 100 μl of Sf-900II culture solution were mixed together and allowed to stand at room temperature for 45 minutes. To this bacmid DNA / CellFECTIN mixed solution, 800 μl of Sf900II culture solution was further added, and this was added to insect cell Sf21 cells (6-well plate to which 9 × 10 ⁵ cells were bound) and cultured at 27 ° C. for 5 hours. After 5 hours, this bacmid DNA / CellFECTIN mixture was removed and cultured in an Sf-900II culture solution containing antibiotics for 72 hours at 27 ° C.

  After completion of the culture, the culture solution was collected. This culture solution contains a recombinant baculovirus that produces gp64-FUT3. The collected culture solution (800 μl) was added to separately cultured Sf21 cells (T75 flask, subconfluent, 20 ml Sf-900II culture solution containing antibiotics), and cultured at 27 ° C. for 72 hours. After culturing for 72 hours, the cells were detached from the flask and recovered simultaneously with the culture solution. The collected cell suspension was centrifuged at 3000 rpm for 10 minutes to separate into a supernatant and a precipitate. The precipitate was used as a cell fraction, and the supernatant was used as a baculovirus fraction.

  According to a conventional method, confirmation was made by Western blotting using a FUT3 monoclonal antibody. As a result, a positive band was detected in recombinant baculovirus-infected Sf21 cells producing gp64-FUT3, but no positive band was observed in non-infected Sf21 cells.

Reference Example 3 Construction of pFB1 / CCR3
In order to construct a binding protein with CCR3, the CCR3 gene was cloned into pFastBac donor plasmid 1 (GibcoBRL, hereinafter referred to as pFB1) in order to construct a plasmid with different sequences of the multiple cloning site (restriction enzyme recognition sequence). did. At this time, the portion excluding the stop codon was amplified by PCR reaction, and a restriction enzyme recognition sequence was added to the primer used for cloning. The primers used were CCR3FE with a restriction enzyme EcoRI site added: tcggaattcatgacaacctcactagataca, and CCR3RS with a restriction enzyme SalI site added: tgcgtcgaccaaacacaatagagagttcc. The PCR amplification product of the CCR3 gene and the pFB1 plasmid were treated with restriction enzymes EcoRI and SalI and ligated by a conventional method.

  The plasmid incorporating the PCR amplification product of the CCR3 gene was introduced into E. coli (DH5α competent cells) according to a conventional method, seeded on an ampicillin-containing LB agar plate, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. From the grown Escherichia coli, the plasmid was extracted and the sequence of the inserted CCR3 gene was confirmed. The sequence was consistent with the previously reported sequence of the CCR3 gene (GenBank Accession No. AF026535). Therefore, the plasmid introduced with this CCR3 gene was designated as pFB1 / CCR3.

Example 3 When the GnTV gene, which is one of galactosamine transferases, is fused and expressed after the CCR3 gene N-acetylglucosaminyl which is one of the glycosyltransferases in the CCR3 gene of the constructed plasmid pFB1 / CCR3 The transferase V gene (GenBank Accsession No. NM002410, hereinafter referred to as GnTV) was bound and the GnTV gene was cloned in order to obtain a gp64-GnTV binding protein. The GnTV gene was cloned from a human gene according to a conventional method. Primers used for amplification by PCR were performed using GnTVF: agagtcgacatggctctcttcactccgtgg to which a restriction enzyme SalI site was added and GnTVRXho: tgactcgagctataggcagtctttgc to which a restriction enzyme XhoI site was added. The PCR amplification product of the GnTV gene and the plasmid pFB1 / CCR3 were treated with restriction enzymes SalI and XhoI. These were combined according to a conventional method, introduced into E. coli (DH5α competent cells), seeded on ampicillin-containing LB agar plates, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli and the sequence of the inserted GnTV gene was confirmed. As a result, the sequence of the GnTV gene (GenBank Accession No. NM002410) already reported was matched. The plasmid introduced with this GnTV gene was designated as pFB1 / CCR3-GnTV.

  According to a conventional method, this donor plasmid (pFB1 / CCR3-GnTV) in which the CCR3 gene and the GnTV gene are combined is introduced into E. coli DH10Bac cells into which bacmid DNA and helper DNA have already been introduced, and CCR3-GnTV is homologous to the bacmid DNA. Incorporated by replacement. Specifically, this was performed as follows. PFB1 / CCR3-GnTV was introduced into competent E. coli DH10Bac cells, seeded on an LB agar medium containing kanamycin, tetracycline, gentamicin, IPTG and Bluo-gal, and cultured at 37 ° C. for about 16 hours. Since E. coli having undergone homologous recombination can be confirmed as white colonies, the white colonies were selected and cultured in an LB medium solution containing kanamycin, tetracycline and gentamicin at 37 ° C. for about 16 hours. Bacmid DNA was purified from 1.5 ml of this E. coli solution according to a conventional method and dissolved in 40 μl of TE.

This bacmid DNA solution (5 μl) was added to 100 μl of Sf-900II culture solution, and 6 μl of CellFECTIN reagent and 100 μl of Sf-900II culture solution were mixed together and allowed to stand at room temperature for 45 minutes. To this bacmid DNA / CellFECTIN mixed solution, 800 μl of Sf900II culture solution was further added, and this was added to insect cell Sf21 cells (6-well plate to which 9 × 10 ⁵ cells were bound) and cultured at 27 ° C. for 5 hours. After 5 hours, this bacmid DNA / CellFECTIN mixture was removed and cultured in an Sf-900II culture solution containing antibiotics for 72 hours at 27 ° C.

  After completion of the culture, the culture solution was collected. This culture solution contains a recombinant baculovirus that produces CCR3-GnTV. The collected culture solution (800 μl) was added to separately cultured Sf21 cells (T75 flask, subconfluent, 20 ml Sf-900II culture solution containing antibiotics), and cultured at 27 ° C. for 72 hours. After culturing for 72 hours, the cells were detached from the flask and recovered simultaneously with the culture solution. The collected cell suspension was centrifuged at 3000 rpm for 10 minutes to separate into a supernatant and a precipitate. The precipitate was used as a cell fraction, and the supernatant was used as a baculovirus fraction.

Example 4 When the GnTV gene, which is one of galactosamine transferases, is fused and expressed behind the gp64 gene
The GnTV gene was cloned in order to obtain a gp64-GnTV binding protein by binding the gp64 gene and N-acetylglucosaminyltransferase V gene, which is one of glycosyltransferases. The GnTV gene was cloned from a human gene according to a conventional method. Primers used for amplification by PCR reaction were GnTVF added with restriction enzyme SalI site: agagtcgacatggctctcttcactccgtgg and GnTVR17 added with restriction enzyme KpnI site: tgaggtaccctataggcagtctttgc.

  The PCR amplification product of this GnTV gene and the plasmid pFB6A / gp64 were treated with restriction enzymes SalI and KpnI. These were combined according to a conventional method, introduced into E. coli (DH5α competent cells), seeded on ampicillin-containing LB agar plates, and cultured at 37 ° C. for about 16 hours. From this plate, a single colony of E. coli was selected, and this E. coli was cultured with shaking in an ampicillin-containing LB culture solution for about 16 hours. A plasmid was extracted from the grown Escherichia coli and the sequence of the inserted GnTV gene was confirmed. As a result, the sequence of the GnTV gene (GenBank Accession No. NM002410) already reported was matched. The plasmid introduced with this GnTV gene was designated as pFB6A / gp64-GnTV.

  According to a conventional method, a donor plasmid (pFB6A / gp64-GnTV) in which this gp64 gene and GnTV gene are combined is introduced into E. coli DH10Bac cells into which bacmid DNA and helper DNA have already been introduced, and gp64-GnTV is homologous to the bacmid DNA. Incorporated by replacement. Specifically, this was performed as follows. pFB6A / gp64-GnTV was introduced into competent E. coli DH10Bac cells, seeded on an LB agar medium containing kanamycin, tetracycline, gentamicin, IPTG and Bluo-gal, and cultured at 37 ° C. for about 16 hours. Since E. coli having undergone homologous recombination can be confirmed as white colonies, the white colonies were selected and cultured in an LB medium solution containing kanamycin, tetracycline and gentamicin at 37 ° C. for about 16 hours. Bacmid DNA was purified from 1.5 ml of this E. coli solution according to a conventional method and dissolved in 40 μl of TE.

This bacmid DNA solution (5 μl) was added to 100 μl of Sf-900II culture solution, and 6 μl of CellFECTIN reagent and 100 μl of Sf-900II culture solution were mixed together and allowed to stand at room temperature for 45 minutes. To this bacmid DNA / CellFECTIN mixed solution, 800 μl of Sf900II culture solution was further added, and this was added to insect cell Sf21 cells (6-well plate to which 9 × 10 ⁵ cells were bound) and cultured at 27 ° C. for 5 hours. After 5 hours, this bacmid DNA / CellFECTIN mixture was removed and cultured in an Sf-900II culture solution containing antibiotics for 72 hours at 27 ° C.

  After completion of the culture, the culture solution was collected. This culture solution contains a recombinant baculovirus that produces gp64-GnTV. The collected culture solution (800 μl) was added to separately cultured Sf21 cells (T75 flask, subconfluent, 20 ml Sf-900II culture solution containing antibiotics), and cultured at 27 ° C. for 72 hours. After culturing for 72 hours, the cells were detached from the flask and recovered simultaneously with the culture solution. The collected cell suspension was centrifuged at 3000 rpm for 10 minutes to separate into a supernatant and a precipitate. The precipitate was used as a cell fraction, and the supernatant was used as a baculovirus fraction.

  According to a conventional method, it was confirmed by Western blotting using an anti-GnTV monoclonal antibody (Japanese Patent Laid-Open No. 11-240900). About 150 kd positive band was detected in recombinant baculovirus-infected Sf21 cells producing gp64-GnTV, but no positive band was observed in uninfected Sf21 cells.

Claims (15)

  A vector in which a fusion gene containing a gene encoding a protein that constitutes a virus particle and a desired gene is introduced into the host cell, the fusion gene is expressed in the host cell, and the desired protein is fused to the virus particle. A method for producing a protein by a gene recombination technique, which comprises recovering the virus particle fused with the desired protein.   The method according to claim 1, wherein the protein constituting the virus particle is a virus coat protein.   The method according to claim 1, wherein the virus is a baculovirus and the host cell is an insect cell.   The method according to claim 3, wherein the protein constituting the virus particle is a baculovirus coat protein gp64.   The method according to any one of claims 1 to 4, wherein at least the active region of the desired protein is fused to the virus particle in a manner that it is exposed to the outside of the virus particle.   The method according to claim 4, wherein the fusion gene comprises a gene encoding a desired protein downstream of the gp64 gene.   The method according to any one of claims 1 to 6, wherein the desired protein is a glycosyltransferase.   The method according to any one of claims 1 to 7, further comprising a step of cleaving and recovering a desired protein from the recovered virus particles.   A vector in which a fusion gene containing a gene encoding a multi-transmembrane protein and a desired gene is introduced into a host cell that produces virus particles, and the fusion gene is expressed in the host cell. A method for producing a protein by a genetic recombination technique, which comprises producing the protein in a form fused with the virus particle and the multi-transmembrane protein, and recovering the virus particle fused with a desired protein. .   The method according to claim 9, wherein the fusion gene comprises a gene encoding a transmembrane protein multiple times from the upstream side and a gene encoding a desired protein.   The method according to claim 10, wherein the virus is a baculovirus and the host cell is an insect cell.   12. The method according to any one of claims 9 to 11, wherein at least the active region of the desired protein is fused to the virus particle in a manner that it is exposed to the outside of the virus particle.   The method according to any one of claims 9 to 12, wherein the multi-transmembrane protein is an odd-number transmembrane protein, and the desired protein does not have a transmembrane region.   The method according to claim 13, wherein the multi-transmembrane protein is a gene encoding the chemokine receptor CCR3.   The method according to any one of claims 9 to 14, further comprising a step of cleaving and recovering a desired protein from the recovered virus particles.