JP2010263873A - Primer set for detecting listeria bacteria - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for specifically and quickly detecting and identifying the particularly virulent strain Listeria monocytogenes. <P>SOLUTION: Through classifying according to the single-nucleotide polymorphisms of hlyA gene, inlA gene, clpC gene and plcA gene, found in Listeria monocytogenes, and detecting a plurality of single-nucleotide polymorphisms, consisting of identified combinations classifiable according to the specific single-nucleotide permutations within the single-nucleotide polymorphism of each gene, the virulent strain belonging to the same group as the strain found in the clinical strain can be detected. In order to do this, PCR is applied, using, for example, a primer set comprising a primer having a specific base sequence and a primer having a specific base sequence. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

The present invention relates to a primer set used for detection of Listeria monocytogenes .

  Listeria monocytogenes is widely resident in environments such as animals and soil, and is frequently detected in various foods such as meat and dairy products. However, since Listeria monocytogenes has a low-temperature growth ability and a high salt concentration tolerance (50-kun et al., 2003), it is difficult to prevent secondary contamination in the manufacturing process as well as primary contamination of food. If food is contaminated with this bacteria at a high concentration, it may proliferate during cold storage of food and cause food poisoning.

Taxonomically, six species of Listeria are known, but only one species of L. monocytogenes is the cause of listeriosis. When infected with this bacterium, adults have strong resistance, and asymptomatic infection and colonization are achieved, but many high-risk groups such as newborns, the elderly, and immunocompromised individuals have developed many listeriosis and are severe The fatality rate in the case of a baby is known to be extremely high at 30%, and it is known that when a fetus is infected in the womb, it can lead to stillbirth and premature birth (Igo et al., 2003, 2004).

  When infected with Listeria monocytogenes, it takes a long time to develop, and there are individual differences (Ichigo-kun, 2004), so determine whether frequent listeriosis is a mass food poisoning that occurs through the same food It is difficult. Moreover, depending on the strain, classification by serotype may not be possible, and determination of the presence or absence of pathogenicity and follow-up surveys cannot be performed sufficiently only by classification by serotype. From this point of view, detailed classification is necessary.

For example, classification by RFLP (see Non-Patent Document 1) and classification by PFGE (see Non-Patent Document 2) have been proposed as methods for identifying and classifying Listeria monocytogenes. However, experiments require skill and are complicated. Takes a long time. As a simple and rapid detection method, a primer set for amplifying the hlyA gene by PCR has also been reported (Non-patent Document 3), but it is ineffective for strains that do not have a target internal base sequence, and is 100% There is a report that L. monocytogenes cannot be detected (Non-patent Document 4). In addition to these methods, many attempts have been made to detect L. monocytogenes by PCR or determine the serotype (Patent Documents 1, 2, Non-Patent Documents 5, 6, 7, etc.) The relationship with highly pathogenic strains is not known.

  As a method for amplifying the inlA gene, gene amplification kits targeting different internal base sequences are commercially available from Takara Bio Inc. and ABI (Applied Biosystems). However, there was a high possibility that related bacteria other than Listeria were also detected.

Under such circumstances, the present inventors have proposed a method for rapidly detecting L. monocytogenes and classifying and identifying including pathogenicity, and filed a patent application as Japanese Patent Application No. 2006-144723. (Patent Literature 3, Non-Patent Literature 8). This method is a method of classifying using the characteristic single nucleotide substitution (single nucleotide polymorphism: SNP) found in the hlyA gene, clpC gene, inlA gene, and plcA gene, respectively (multi locus sequence typing (MLST)). Law).

  In the MLST method, grouping is performed according to the characteristic single nucleotide substitution types found in the hlyA gene, the clpC gene, the inlA gene, and the plcA gene. So far, the types in the hlyA gene have been classified into nine groups from Group 1 to Group 9 (see Patent Document 3 and FIG. 1), and the types in the clpC gene have been classified into 14 groups from Group 1 to Group 14 (the same document, FIG. 1). 2), the types in the inlA gene are classified into 17 groups of groups 1 to 17 (see the same document, FIG. 3), and the types in the plcA gene are classified into groups 1 to 21 (see the same document, FIG. 4). Has been revealed.

Among these, clinical strains estimated to be highly pathogenic ( L. monocytogenes isolated from clinical practice) are classified into 12 groups of groups A to L as shown in Table 1 of Patent Document 1. Classification (see Table 1 of the same document). Therefore, if the detected single base substitution type (group) in the hlyA gene, clpC gene, inlA gene, and plcA gene in Listeria monocytogenes matches the groups A to L shown in Table 1 of the same literature. It can be inferred that the detected bacteria are highly pathogenic. In addition, at this time, it is also possible to judge by taking into account the classification by the serotype that has been used conventionally, but when taking into account the classification by serotype, the strain that can be inferred to be highly pathogenic, It is classified into 12 groups of the groups A to L (see the same document, Table 1).

  That is, the pathogenicity of the detected Listeria monocytogenes can be estimated by detecting the characteristic single base substitution (SNP) in the above four genes and examining the type by the single base substitution.

JP-A-6-233699 JP 2004-154141 A JP 2007-31660 A

Fukiko Ueda et al., Comparison of Genomic Structures in the Serovar 1 / 2a Listeria monocytogenes Isolated from Meats and Listeriosis Patients in Japan, Jpn. J. Infect. Dis., 58 (2005), 289-293 Marc Yde, and Annie Genicot, Use of PFGE to characterize clonal relationships among Belgian clinical isolates of Listeria monocytogenes, J Med Microbiol, 53 (2004), 399-402 Lehner, et al., A rapid differentiation of Listeria monocytogenes by use of PCR-SSCP in the listeriolysin O (hlyA) locus, J. Microbiol. Med 34 (1999), 165-171 Shigenobu Igo, Shigeki Yamamoto, Soichi Makino et al., 2003 Study on Health of Food-Derived Listeria Bacteria 2002 Summary and Research Report Rodriguez-Lazaro, D. et al., Simultaneous quantitive detection of Listeria spp. And Listeria monocytogenes using a duplex real-time PCR-based assay, FEMS. Microbiol. Lett., 233 (2004), 257-267 Thomas, E. J. G et al., Sensitive and Specific Detection of Listeria monocytogenes in Milk and Ground Beef with the Polymerase Chain Reaction, Appl.Environ.Microbiol., 57 (1991), 2576-2580 Monica K. Borucki and Douglas R. Call, Listeria monocytogenes Serotype Identification by PCR, Journal of Clinical Microbiology, Vol. 41, No. 12 (2003), 5537-5540 Ken-ichi Honjoh, Kumiko Fujihara et al., Subtyping of Listera monocytogenes Based on Nucleotide Polymorphism in the clpC, inlA, hlyA, and plcA Genes and Rapid Identification of L. monocytogenes Genetically Similar to Clinical Isolates, Food Sci. Technolo. , 14 (6), 557-564, 2008

  The inventors of the present application subsequently conducted an additional investigation on clinically derived or food / environment-derived Listeria, and also by combining primers having a specific nucleotide sequence found based on the nucleotide sequence of the hlyA gene. The inventors have found that only Listeria can be specifically detected, and have completed the present invention.

  In the present invention, a primer set consisting of a primer having the base sequence shown in SEQ ID NO: 1 and a primer having any one of the base sequences shown in SEQ ID NOS: 12-16 and 18-20 (primer set Nos. 1 to 1 in Table 8). 5 or 7-9), or a primer set (primer set No. 12 in Table 8) comprising a primer having the base sequence shown in SEQ ID NO: 11 and a primer having the base sequence shown in SEQ ID NO: 4 The PCR method (PCT-RT) method is applied.

These primers are conserved in all tested L. monocytogenes and are related bacteria L. ivanovii and L. In seeligeri , it was found from the base sequence of the region with many SNPs. When the primer having the base sequence represented by SEQ ID NO: 1 is used as the forward primer, the primer having any one of the base sequences shown in SEQ ID NOs: 12-16 and 18-20 is used as the reverse primer. When the primer having the base sequence shown by SEQ ID NO: 11 is used as the reverse primer, the primer having the base sequence shown by SEQ ID NO: 4 is used as the forward primer.

According to the present invention, L. monocytogenes can be detected specifically and rapidly.

It is a figure which shows the classification phylogenetic tree of L. monocytogenes based on the base sequence in an hlyA gene. It is a figure which shows CLUSTAL W multiple sequence alignment of the 1126-1527 (402 bp) base part of the hlyA gene in the fungal group newly added to the classification phylogenetic tree. It is a figure which shows the taxonomic tree of L. monocytogenes based on the base sequence in an inlA gene. It is a figure which shows a part of CLUSTAL W multiple sequence alignment of the 1192-1799 (608 bp) base part of the inlA gene in the fungal group newly added to the classification phylogenetic tree. FIG. 5 is a continuation diagram of FIG. 4. It is a figure which shows the taxonomic tree of L. monocytogenes based on the base sequence in a clpC gene. It is a figure which shows CLUSTAL W multiple sequence alignment of the 489-1124 (636 bp) base part of the clpC gene in the fungi group newly added to the classification phylogenetic tree. It is a figure which shows the taxonomic tree of L. monocytogenes based on the base sequence in a plcA gene. It is a figure which shows a part of CLUSTAL W multiple sequence alignment of the 153-865 (713 bp) base part of the plcA gene in the fungal group newly added to the classification phylogenetic tree. FIG. 10 is a continuation diagram of FIG. 9. It is a figure which shows the classification phylogenetic tree of MLST57 group. (A) (b) is an increase curve of the fluorescence intensity in the detection of L. monocytogenes (part) using the primer set 7, wherein (a) shows an integral value and (b) shows a differential value. (C) is an electrophoretogram after completion of RT-PCR. The numbers listed at the bottom of (c) are strain Nos. It is. (A) (b) is an increase curve of the fluorescence intensity in the detection of L. monocytogenes (remainder) using the primer set 7, wherein (a) shows an integral value and (b) shows a differential value. (C) is an electrophoretogram after completion of RT-PCR. The numbers listed at the bottom of (c) are strain Nos. It is. (A) (b) is an increase curve of the fluorescence intensity in the detection of bacteria other than L. monocytogenes using the primer set 7, wherein (a) shows an integrated value and (b) shows a differential value. (C) is an electrophoretogram after completion of RT-PCR. The numbers listed at the bottom of (c) are strain Nos. It is. (A) is an increase curve (integral value) of fluorescence intensity in the detection of L. monocytogenes (part) using a Takara Bio kit, and (b) is an electrophoretic diagram after completion of RT-PCR. The numbers listed at the bottom of (b) are strain No. It is. (A) is an increase curve (integral value) of fluorescence intensity in detection of L. monocytogenes (part) using a Takara Bio kit, and (b) and (c) are electrophoretic diagrams after completion of RT-PCR. . (B) The numbers described at the bottom of (c) are the strain No. It is. (A) is an increase curve (integrated value) of fluorescence intensity in the detection of bacteria other than L. monocytogenes using a kit of Takara Bio Inc., and (b) is an electrophoretic diagram after completion of RT-PCR. The numbers listed at the bottom of (b) are strain No. It is. (A) is an increase curve (integral value) of fluorescence intensity in detection of L. monocytogenes (part) using an ABI kit, and (c) is an electrophoretic diagram after completion of RT-PCR. The numbers listed at the bottom of (b) are strain No. It is. (A) is an increase curve (integral value) of fluorescence intensity in the detection of L. monocytogenes (remainder) using an ABI kit, and (b) and (c) are electrophoretic diagrams after completion of RT-PCR. (B) The numbers described at the bottom of (c) are the strain No. It is. (A) is an increase curve (integral value) of fluorescence intensity in the detection of bacteria other than L. monocytogenes using an ABI kit, and (b) is an electrophoretogram after completion of RT-PCR. The numbers listed at the bottom of (b) are strain No. It is.

In order to amplify a characteristic single nucleotide mutation in the hlyA gene of Listeria monocytogenes when detecting L. monocytogenes (hereinafter sometimes referred to only as “Listeria monocytogenes”), A primer set comprising a primer having the base sequence shown in FIG. 5 and a primer having any one of the base sequences shown in SEQ ID NOS: 12-16 and 18-20, or a primer having the base sequence shown in SEQ ID NO: 11 and shown in SEQ ID NO: 4 It is characterized in that a primer set comprising a primer having a base sequence is used. That is, although the point that amplifies the hlyA gene of Listeria monocytogenes using the primer set of the present invention is different from the method described in Patent Document 3, the method for classifying and identifying Listeria monocytogenes detected is based on the idea in the patent literature. Is not different. Therefore, a characteristic single nucleotide substitution type (grouping) in clpC gene, inlA gene, and plcA gene, including hlyA gene amplified using the primer set of the present invention, is disclosed in Japanese Patent Application Laid-Open No. 2007-31660. In the present invention, the description of Japanese Patent Application Laid-Open No. 2007-31660 is incorporated in the present invention.

  In the present invention, for the amplification of the hlyA gene, a primer comprising a primer having a base sequence shown in SEQ ID NO: 1 (forward) and a primer having a base sequence shown in any one of SEQ ID NOS: 12-16 and 18-20 (reverse) Primer set (primer set No. 1-5 and 7-9) or a primer set (primer set) comprising a primer (reverse) having the base sequence shown in SEQ ID NO: 11 and a primer (forward) having the base sequence shown in SEQ ID NO: 4 No. 12) is used. Among these, the primer set of the primer (forward) which has the base sequence shown by sequence number 1 shown in primer set 7 and the primer (reverse) which has the base sequence shown by sequence number 8 is used preferably. Escherichia coli O157, which is a causative agent of food poisoning, is not detected, and can be detected in a wide range of DNA concentrations (0.0001 to 100 ng / ml).

  Next, the present invention will be described in detail based on the following examples.

[Classification of Listeria monocytogenes]
Based on the following method, Listeria monocytogenes (clinical strain) and 90 Listeria monocytogenes (food / environment-derived strain) isolated from food / environment were newly analyzed based on the following methods: hlyA gene, clpC gene, inlA gene, plcA Groups were made for each single base substitution of the gene.

(Determination of L. monocytogenes hlyA gene partial nucleotide sequence)
The test strain is statically cultured overnight at 37 ° C with 5 ml of TSB, 1 ml of the culture is centrifuged at 5,100 xg for 10 minutes, collected, and then attached using DNA Tissue Kit (Qiagen). The genomic DNA was prepared according to the above.

Common to L. monocytogenes EDG-e strains (serotype 1 / 2a) and F2365 (serotype 4b) that have already been determined as the primers used for PCR to amplify the internal base sequence of the hlyA gene F2-R2 primer set (F2: AAATCATCGACGGCAACCT (SEQ ID NO: 1), R2: ATTTCGGATAAAGCGTGGTG (SEQ ID NO: 11)) prepared from a high base sequence portion was used. This primer set is for amplifying 1070-1558 base pairs of the hlyA gene. The F2 primer and the R2 primer are the same as the primers used in Patent Document 3, respectively. Amplification was performed by heat denaturation (95 ° C., 1 min) followed by 35 cycles of 95 ° C., 30 sec → 55 ° C., 30 sec → 72 ° C., 60 sec. The size of the PCR product was confirmed by agarose gel electrophoresis and then purified with a commercially available PCR product purification kit. The base sequence was determined by requesting Biomatrix Laboratories (Nagayama City, Chiba Prefecture).

(Classification of hlyA gene)
As a result of the determination of the base sequence, the group in the hlyA gene was categorized into a total of 14 groups, an increase of 5 groups from 9 groups disclosed in Patent Document 3. Table 1 shows the groupings in the hlyA gene. In Table 1, 126 strains (strain numbers 40, 41, 43, 72, and 116 are omitted) shown in Patent Document 3, and 66 strains (strain numbers 132 to 197) newly grouped this time. The results of grouping again for all 192 shares are shown. The phylogenetic tree (by Neighbor joining method) is shown in FIG. Moreover, the arrangement | sequence part (1126-1527bp) containing SNP of 5 groups (groups 10-14) added was shown in FIG. 2 and arrangement number 21-25 (each corresponding to groups 10-14).

  Similarly to the hlyA gene, in accordance with the method described in Patent Document 3, grouping was also performed for each single base substitution of the inlA gene, the clpC gene, and the plcA gene. The results are shown in Tables 2 to 4, respectively. As a result, the inlA gene increased from the previous 17 groups to 27 groups, the clpC gene increased from the previous 14 groups to 17 groups, and the plcA gene increased from the previous 21 groups to 30 groups. FIG. 3 shows the phylogenetic tree of the newly grouped inlA gene. The sequence portion (1192-1799 bp) containing 11 groups of SNPs added in the inlA gene is shown in FIGS. 4-5 and SEQ ID NOs: 26-35 (groups respectively). 18-27). The phylogenetic tree of the clpC gene regrouped is shown in FIG. 6, and the sequence portion (489-1124 bp) containing 3 groups of SNPs added in the clpC gene is shown in FIG. 7 and SEQ ID NOs: 36 to 38 (groups 15 to 17). Moreover, the phylogenetic tree in the newly grouped plcA gene is shown in FIG. 8, and the base sequences (153-865 bp) containing 9 groups of SNPs added in the plcA gene are shown in FIGS. 9-10 and SEQ ID NOs: 39-47 ( Each corresponding to groups 22-30).

  From these results, MLST of 192 clinical and food / environmental stocks separated so far was classified into 57 groups as shown in Table 5 and FIG. Table 6 and Table 7 show the attributes of each strain. From the viewpoint of serotype classification of these strains, food / environmental strains were classified into 17 groups and clinical strains were classified into 8 groups in serotype 1 / 2a. Of these, food / environmental strains were not concentrated in a specific group, but 4 out of 11 clinical strains were grouped into MLST group 45, and MLST group 45 was relatively highly pathogenic. By analogy. On the other hand, in serotype 1 / 2b, food / environmental strains were classified into 11 groups and clinical strains were classified into 5 groups. Of these, food / environmental strains were grouped into MLST groups 4 and 13, but clinical strains were not categorized into specific groups. In serotype 4b, both food / environmental strains and clinical strains were classified into MLST group 7 groups, most of which were classified into MLST groups 22 and 24.

  Therefore, if it is determined that the Listeria monocytogenes detected from the sample to be investigated belongs to the MLST groups 22, 24, 45, the Listeria monocytogenes is presumed to be highly pathogenic. On the other hand, if it is judged that it belongs to MLST groups 4 and 13, it is presumed that the Listeria monocytogenes is less likely to be pathogenic.

[Design of a new primer set for hlyA gene detection]
Next, it is conserved in all Listeria monocytogenes tested based on the base sequence determined above, and is calculated from the base sequence of the region with many SNPs in L. ivanovii and L. seeligeri that are related to Listeria monocytogenes. A seed primer was prepared and its detection accuracy was examined. Here, the primer set was designed based on the base sequence of the hlyA gene, which was considered to have the smallest SNP among genotype groups and to easily determine the base sequence of the primer. And PCR reaction was performed by 18 combinations shown in Table 8, and the primer set with the highest detection sensitivity and specificity was selected. The base sequences of the primers used are shown in Table 9 (SEQ ID NOs: 1 to 20).

(Test bacteria and template DNA concentration)
L. monocytogenes No. 4 strain was selected as a test bacterium . The template genomic DNA concentrations were 100 ng / μl, 10 ng / μl, 1.0 ng / μl, 0.1 ng / μl, 0.01 ng / μl, 0.001 ng / μl, 0.0001 ng / μl. Further, E. coli O157 genomic DNA (45 ng / μl) was used for Negative control.

(Real-time PCR conditions)
SYBR Premix Ex Taq (Takara Bio Inc.) was used for the reaction. Real-time PCR (RT-PCR) was performed using the Mx3000P (registered trademark) Real-Time PCR System (STRATAGENE) under the following conditions.

<Reaction solution composition>
2 x SYBR Premix Ex Taq 5.0μl
Forward primer (20 mM) 0.1 μl
Reverse primer (20 mM) 0.1 μl
50 × Rox Reference Dye II 0.2 μl
Template 0.4μl
4.2 μl water
Total 10.0μl
<Reaction conditions> Number of cycles: 35 cycles 10 minutes at 95 ° C.
One cycle was 95 ° C. for 5 sec, 57 ° C. for 15 sec, and 72 ° C. for 10 sec.

Table 10 shows the results of real-time PCR detection using each primer set. Table 10 shows primer set numbers arranged in order from the lowest Ct value (highest detection sensitivity) for each template concentration. In primer sets 6, 10, 11 and 13-18, strong amplification was also observed in Escherichia coli O157 (template DNA concentration: 45 ng / ml), which is a negative control, so these results are not shown in Table 10. In this test, it was shown that the primer set 7 has an average high detection sensitivity at each template concentration. It can be said that this primer set 7 can specifically and highly detect L. monocytogenes . However, each primer set other than primer set 7 (primer sets 1 to 5, 8, 9, 12) can also be used as a primer set for amplifying the hlyA gene. It can be said that these primer sets can also specifically detect L. monocytogenes without detecting E. coli O157 as with primer set 7.

[Comparison with L. monocytogenes commercial PCR kit]
Next, detection comparison was performed between the primer set 7 and a commercially available L. monocytogenes detection kit. For the test bacteria, 49 representatives with different genotypes from the MLST57 group classified this time, one representative strain arbitrarily selected from each group, Listeria bacteria other than L. monocytogenes , and riboprinter system Real-time PCR was performed using the identified strains of Listeria spp. As the template, 1 μl each having a DNA concentration of 5 pg / μl was used. As commercial products, Takara Bio CycleavePCR (registered trademark) L. monocytogenes (inlA gene) Detection Kit and ABI gene amplification kit TaqMan (registered trademark) L. monocytogenes Detection Kit were used. Detection by each kit was performed according to the method attached to each kit. Similarly, 1 μl of each having a DNA concentration of 5 pg / μl was used as a template. Real-time PCR was performed using Mx3000P (registered trademark) Real-Time PCR System (STRATAGENE), and the obtained Ct values for each strain are shown in Tables 11 and 12. Table 11 shows the results for L. monocytogenes , and Table 12 shows the results for other strains. Moreover, the increase curve of the fluorescence intensity in the detection using the primer set 7 and the electrophoresis photograph after completion | finish of reaction are shown to FIGS. Similarly, the results with the Takara Bio kit are shown in FIGS. 15 to 17, and the results with the ABI kit are shown in FIGS. In electrophoresis, 4% gel was used in FIGS. 15 to 17 and 1.5% gel was used in other cases.

All L. monocytogenes strains could be detected using the primer set of the present invention and the Takara Bio and ABI kits. However, new in the case of using the primer set 7 designed, although amplification was observed in L. innocua two strains in Listeria except L. monocytogenes, Listeria other non L. monocytogenes The target product was not amplified in (LIS30, LIS31, LIS33, LIS34, LM40, LM41, LM43) (see FIG. 14). In contrast, in the Takara Bio kit, band amplification was observed in 9 Listeria bacteria other than L. monocytogenes , but amplification was not observed in other LIS33, LIS35, and LM40 strains (see FIG. 17). ). ABI Inc. The kit, L. in Listeria other than monocytogenes but Ct value in L. innocua 1 strain (LIS30) was at 41.48 and 40 cycles or more, other Listeria except L. monocytogenes Then, a rise in fluorescence intensity was observed before 40 cycles. In the ABI kit, bands were not separated because the size of the amplification product of IPC and the target gene was almost the same, and amplification was observed in all strains except L. monocytogenes (see FIG. 20).

From these results, primer set 7 can detect all L. monocytogenes, and the detection rate of Listeria bacteria other than L. monocytogenes is considerably lower than that of commercially available kits, and specificity for L. monocytogenes Was shown to be high.

As described above, by performing RT-PCR using the primer set of the present invention, in particular the primer having the base sequence shown in SEQ ID NO: 1 and the primer set having the base sequence shown in SEQ ID NO: 18, L. Only monocytogenes can be detected with relatively high accuracy.

Claims (2)

A primer set for nucleic acid amplification that amplifies a sequence region sandwiching a specific single base substitution in the hlyA gene of Listeria monocytogenes ,
A primer set comprising a primer having the base sequence shown in SEQ ID NO: 1 and a primer having any one of the base sequences shown in SEQ ID NOS: 12-16 and 18-20, or a primer having the base sequence shown in SEQ ID NO: 11 and SEQ ID NO: A primer set comprising a primer having the base sequence shown in FIG. A primer set for nucleic acid amplification that amplifies a sequence region sandwiching a specific single base substitution in the hlyA gene of Listeria monocytogenes ,
A primer set comprising a primer having a base sequence represented by SEQ ID NO: 1 and a primer having a base sequence represented by SEQ ID NO: 18.