JP5613971B2 - Method for detecting pathogenic Listeria monocytogenes - Google Patents

Description

The present invention relates to a method for detecting and identifying Listeria monocytogenes .

  Listeria monocytogenes is widely resident in environments such as animals and soil, and is frequently detected in various foods such as meat and dairy products. However, since Listeria monocytogenes has a low-temperature growth ability and a high salt concentration tolerance (50-kun et al., 2003), it is difficult to prevent secondary contamination in the manufacturing process as well as primary contamination of food. If food is contaminated with this bacteria at a high concentration, it may grow during low-temperature storage of food and cause food poisoning.

Taxonomically, six species are known for Listeria, but only one species of L. monocytogenes is the causative agent of listeriosis, including sepsis, meningitis, infectious mononuclear Cause serious symptoms common to humans and animals such as illness (Ichikun et al., 2003, 2004). One of the pathogenic factors is listiolysin O, a hemolysin produced by L. monocytogenes . L. monocytogenes is an intracellular parasitic bacterium that escapes from the phagosome to the cytoplasm and escapes the bactericidal mechanism and proliferates even if it is phagocytosed by macrophages. Listeriolysin O is involved in escape from the phagosome, but if hlyA, a structural gene, is deleted, it remains in the phagosome without being damaged by the macrophage even if it is phagocytosed by macrophages, Since it is sterilized, it is regarded as the most important pathogenic factor of this bacterium (Sakurai et al., 2002). When infected with this bacterium, adults have strong resistance, and asymptomatic infection and colonization are achieved, but many high-risk groups such as newborns, the elderly, and immunocompromised individuals have developed many listeriosis and are severe The fatality rate in the case of a baby is known to be extremely high at 30%, and it is known that when a fetus is infected in the womb, it can lead to stillbirth and premature birth (Igo et al., 2003, 2004).

  Until now, the occurrence of listeriosis has not been fully understood in Japan, and its source and route are unknown. According to a report of a survey result, 83 cases of listeriosis were confirmed annually, but there were no confirmed cases of food poisoning through foods that were considered problematic in the United States and Europe. However, it was identified that the food poisoning caused by natural cheese in Hokkaido in 2001 was caused by this bacterium, and since foods are distributed worldwide, serious food poisoning like Europe and America will occur in Japan in the future. There is concern about the possibility of doing.

Currently, classification of strains by serotype is the basis of epidemiological analysis, but not all L. monocytogenes are highly pathogenic, and it is detected as a serotype in human cases of infection. / 2a type, 1 / 2b type, and 4b type are almost all (Non-patent Document 1). Therefore, the presence or absence of pathogenicity can also be estimated by classification by serotype.

  However, just because the serotype is the same, not all bacteria have high pathogenicity. For this reason, when food poisoning caused by this bacterium occurs, it is not sufficient to identify the causative food and elucidate the route of infection. Classification by serotype alone is not sufficient, and it is necessary to classify the strain in more detail. .

  When infected with Listeria monocytogenes, it takes a long time to develop and there are individual differences (Issue 50, 2004), so determine whether frequent listeriosis is a mass food poisoning that occurs through the same food It is difficult. Moreover, depending on the strain, classification by serotype may not be possible, and determination of the presence or absence of pathogenicity and follow-up surveys cannot be performed sufficiently only by classification by serotype. From this point of view, detailed classification is necessary.

Under these circumstances, for example, classification by RFLP (see Non-Patent Document 2) and classification by PFGE (see Non-Patent Document 3) have been proposed, but skill is required for the experimental operation, and the operation is complicated and takes a long time. Cost. As a simple and rapid detection method, a primer set for amplifying the hlyA gene by PCR has also been reported (Non-patent Document 4), but it is ineffective for strains not having the hlyA gene, and 100% of L. monocytogenes Cannot be detected. In addition to these methods, many attempts have been made to detect L. monocytogenes by PCR or determine the serotype (Patent Documents 1, 2, Non-Patent Documents 5, 6, 7, etc.) The relationship with highly pathogenic strains is not known.

As described above, at present, there is no method for detecting and identifying a particularly highly pathogenic strain in which human infection is a concern.
JP-A-6-233699 JP 2004-154141 A Nelson, KE. Et al., Whole genome comparisons of serotype 4b and 1 / 2a strains of the food-borne pathogen Listeria monocytogenes reveal new insights into the core genome components of this species, Nucleic Acids Res., 32 (2004), 2386 -95 Fukiko Ueda et al., Comparison of Genomic Structures in the Serovar 1 / 2a Listeria monocytogenes Isolated from Meats and Listeriosis Patients in Japan, Jpn. J. Infect. Dis., 58 (2005), 289-293 Marc Yde, and Annie Genicot, Use of PFGE to characterize clonal relationships among Belgian clinical isolates of Listeria monocytogenes, J Med Microbiol, 53 (2004), 399-402 Lehner, et al., A rapid differentiation of Listeria monocytogenes by use of PCR-SSCP in the listeriolysin O (hlyA) locus, J. Microbiol. Med 34 (1999), 165-171 Rodriguez-Lazaro, D. et al., Simultaneous quantitive detection of Listeria spp. And Listeria monocytogenes using a duplex real-time PCR-based assay, FEMS. Microbiol. Lett., 233 (2004), 257-267 Thomas, EJ G et al., Sensitive and Specific Detection of Listeria monocytogenes in Milk and Ground Beef with the Polymerase Chain Reaction, Appl.Environ.Microbiol., 57 (1991), 2576-2580 Monica K. Borucki and Douglas R. Call, Listeria monocytogenes Serotype Identification by PCR, Journal of Clinical Microbiology, Vol. 41, No. 12 (2003), 5537-5540

The present invention has been made in view of the above-mentioned background art, and an object thereof is to quickly detect, classify and identify Listeria monocytogenes, particularly L. monocytogenes strains having particularly high pathogenicity.

In order to achieve the above object, the present inventors have determined the nucleotide sequences of a plurality of genes considered to be related to pathogenicity in L. monocytogenes and clinically derived L. monocytogenes strains isolated from various foods and environments. By determining and comparing these sequences, single-base substitutions (base sequences) specific to clinical strains were found. Then, PCR (PCR-RT) using a primer set and a probe DNA for molecular biological detection methods such as a cycle probe method (TaqMan (trade name) probe method) capable of specifically detecting this single base substitution As a result, the above-mentioned problems have been solved.

  According to the present invention, by using a single nucleotide polymorphism of a gene, it is possible to quickly detect and identify Listeria monocytogenes that is presumed to be highly pathogenic. Also provided are a primer set and a chimeric probe for the cycling probe method that can specifically detect and identify genotype groups of serotype 1 / 2a type and serotype 4b type that are estimated to be particularly pathogenic. By performing real-time PCR by SNP detection method using this primer set and chimera probe, environment such as specimens such as various foods, raw milk and fresh seafood, raw meat and other Ready-To-Eat foods, drinking water and drainage L. monocytogenes detected from water, and L. monocytogenes strains of the same genotype as clinical strains that are presumed to be highly pathogenic are specifically detected, and contamination by L. monocytogenes is easily and quickly determined. it can. Further, according to the above classification, the source of infection and the elucidation of the infection route can be more accurately and quickly performed.

The present invention relates to a method for detecting and identifying Listeria monocytogenes considered to be highly pathogenic, and relates to a primer for nucleic acid amplification for detecting a characteristic single nucleotide polymorphism of the bacterium by PCR and a detection Provide a probe.

Listeria monocytogenes (hereinafter referred to as “ Listeria monocytogenes ”) is involved in the promotion of transcription of pathogenic genes encoded by the same pathogenic gene locus prfA as hlyA, in addition to hlyA, which is the structural gene of hemolysin, listeriolysin O. prfA, plcC encoding phosphatidylinositol-specific phospholipase C, an important enzyme for escaping from the intracellular bactericidal mechanism, mpl encoding a metalloprotease necessary for activation of phospholipase C, escape from cells AscctA, which encodes a protein necessary for association with actin necessary for oxidase, plcB, which encodes phosphatidylcholine-specific phospholipase C, inlA, which encodes an internalinA molecule necessary for entry into cells, and peptidoglycan degrading enzyme Iap to code, stress And the like clpC encoding the CLAC ATPase indicating an important role in sexual.

  According to the serotype classification, there are strains of Listeria such as 1 / 2a type, 1 / 2b type, 1 / 2c type, 3a type, 3b type, 3c type, 4b type, 4e type, etc. Most cases detected from human infection cases are 1 / 2a, 1 / 2b and 4b. By the way, the present inventors have examined the base sequences of the above-mentioned pathogenic factors in detail for clinically derived strains and food environment-derived strains. As a result, detailed classification is possible for the hlyA gene, the clpC gene, the inlA gene and the plcA gene. A characteristic single nucleotide substitution (single nucleotide polymorphism: SNP) was found. The presence or absence of pathogenicity cannot be determined only by classification by serotype, and by classifying this characteristic single base substitution, it became possible to estimate the pathogenicity of Listeria monocytogenes.

  That is, the present invention detects a single base substitution characteristic of clinical strains in the hlyA gene, clpC gene, inlA gene, and plcA gene, so that the Listeria monocytogenes to be detected has the same high pathogenicity as clinical strains. It is possible to determine that it has. Moreover, in clinical strains that are presumed to be highly pathogenic, even if they belong to the same serotype, there are polymorphisms in which the base sequences of these genes are partially different. For this reason, in order to determine an accurate infection route, it is necessary to analyze these polymorphisms, and the present invention makes it possible to make a determination in consideration of these polymorphisms. And this invention provides the primer set for nucleic acid amplification used for this determination, and the probe for a detection.

  Single base substitution sites are different in each gene and are grouped by single base substitution sites. 5 to 18 show gene regions including single base substitution sites found in each gene for each group. For example, in the hlyA gene, a single base substitution is observed between 1126-1527 bases from the start codon of the hlyA gene, and the single base substitution between these groups is represented by 9 groups (groups 1 to 9 as shown in FIGS. 9 groups of single nucleotide polymorphisms: polymorphic groups). In the clpC gene, a single base substitution was observed between bases 489 to 1124 of the clpC gene, and the single base substitution during this period was performed in 14 groups (14 groups) of groups 1 to 14 as shown in FIG. 2 and FIGS. Group). In the inlA gene, a single base substitution was observed between 1192 to 1799 bases of the inlA gene, and the single base substitution during this period was performed in 17 groups (groups of 17 groups) as shown in FIG. 3 and FIGS. Group). In the plcA gene, a single base substitution is observed between 153-865 bases from the start codon of the plcA gene, and the single base substitution during this period is represented by 21 groups (groups 1 to 21 as shown in FIGS. 4 and 12-14). 21 groups of polymorphic groups). These base sequences are shown in SEQ ID NOs: 20 to 80, respectively. SEQ ID NOs: 20-28 are the 1126-1527 base portion of the hlyA gene, SEQ ID NOs: 29-42 are the 489-1124 base portions of the clpC gene, SEQ ID NOs: 43-59 are the 1192-1799 base portions of the inlA gene, 60-80 shows the 153-865 base part of the plcA gene. Each gene is shown in the order of the polymorphism group.

  Clinical strains that are presumed to be highly pathogenic are classified into either group by gene. According to the study by the present inventors, in the classification by single nucleotide polymorphisms in the four genes, the clinical strains are classified into 12 groups from A to L as shown in Table 1. As understood from this table, it is understood that even if the serotype is the same, the group to which the serotype belongs is different, and it is not sufficient to distinguish the serotype alone. On the other hand, there are strains classified into the same single nucleotide polymorphism in four genes, and those having the same gene sequence as strains belonging to these groups as seen in Group D and Group I have many clinical cases. It should be noted that it is highly pathogenic. If attention is paid to two genes, hlyA and plcA, it is understood that the polymorphism classification and serotype classification in these genes are almost the same. For example, it can be said that polymorphism group 5 in hlyA and polymorphism group 16 in plcA are serotype 1 / 2a, and polymorphism group 3 in hlyA is almost serotype 4b. From this table, strains whose serotype is 1 / 2a and hlyA gene is classified into polymorphism group 5 or plcA gene is classified into polymorphism group 16, or serotype is 4b type and hlyA gene is polymorphism group It can be said that the strain classified into 3 has higher pathogenicity than other polymorphism groups. Thus, pathogenicity can also be estimated from a combination of a serotype and a polymorphism in a specific gene.

On the other hand, when focusing on the hlyA gene and the clpC gene, although the serotypes are different, the groups A to E belonging to the same polymorphism group in the two genes have a large number of detected cases, and the pathogenicity Is estimated to be high. In addition, when serotypes are added to these polymorphism classifications, it can be said that the single nucleotide polymorphisms in the hlyA gene and the clpC gene and the D and E groups that match in the serotype are more pathogenic. Next, focusing on the hlyA gene and the plcA gene, the groups I to L belong to the same polymorphism group, and since the number of detected cases is large, it can be estimated that these are also highly pathogenic. Of course, the groups I to L are all serotype 1 / 2a, but if it is judged that the polymorphism group of hlyA gene is 5 and the polymorphism group of plcA gene is 16, the serotype is considered. Soon, it is estimated that pathogenicity is high.

  Thus, the pathogenicity of the strain can be estimated by knowing the polymorphism group to which the strain to be examined belongs. In other words, if the strain detected in the food is, for example, the polymorphism group in the hlyA gene is 3 and the polymorphism group in clpC is 13, even if it has not been clinically detected so far, it is somewhat pathogenic. Can be judged to be high. In particular, when the determination is made in consideration of the serotype, the estimation of the pathogenicity is further increased, and the pathogenicity can be easily estimated by combining with one single nucleotide polymorphism (or two or more single nucleotide polymorphisms). become able to. Further, if a probe capable of specifically detecting strains belonging to groups D and I shown in Table 1 is used, it is possible to selectively detect only strains to which attention should be paid when pathogenicity is particularly high. Thus, when a highly pathogenic strain is detected, the possibility of food poisoning caused by Listeria monocytogenes is determined. On the other hand, even if it is detected that it is serotype 1 / 2a type or 4b type, if it is not these genotypes, there is a possibility that it is not a causative bacterium of food poisoning. If a polymorphism group or a classification including a serotype is used, more detailed identification of bacteria can be performed, so that an accurate infection source and infection route can be traced.

  By the way, if the single base substitution in each gene is unique in each classified group, the above object can be achieved by detecting the single base substitution. That is, if only a specific single base substitution can be detected and classified into each group, it can be easily determined that the pathogenicity is high only by detecting the single base substitution. 15-19, only the single base substitution site was extracted from the base sequence of each gene and summarized. 15 shows the hlyA gene, FIG. 16 shows the clpC gene, FIG. 17 shows the inlA gene, and FIGS. 18 and 19 show the plc gene. In addition, the row | line | column of each figure shows the polymorphism group, and the column of each figure has shown the base number from the beginning in the base sequence shown in FIGS. 5-14 (In addition, the "base number" shown below is This means the base number.)

  Here, the case where the clinical strain groups I to L (serotype 1 / 2a type) estimated to have high pathogenicity in the above will be described as an example. This group belongs to the polymorphism group 5 based on the hlyA gene and the polymorphism group 16 based on the plcA gene, but there is no polymorphism group belonging to this group in other clinical strains. Therefore, if it can be detected that the hlyA gene belongs to group 5 or the plcA gene belongs to group 16, it can be estimated that the strain is highly pathogenic. Thus, looking at the single base substitution site shown in FIG. 15, the base (G) at the base number 258 is different from the bases of other polymorphic groups and is specific to this group. Therefore, when this base is detected as a single base substitution site, it is judged that it belongs to the clinical strain group I to L group. That is, it can be said that the 258th base (G) is a single base substitution specific to the single nucleotide polymorphism group 5 of the hlyA gene. In addition to the base, the base number 153 base (C) and 318 base (G) are also single base substitutions specific to polymorphism group 5, and these single base substitutions are detected. This makes it possible to detect clinical strain groups I to L (serotype 1 / 2a type). In this way, a single base substitution moiety is selected that makes it possible to detect only any group.

  The polymorphism group may be determined by a combination of single-base substitutions at a plurality of positions on the same gene. For example, if three bases of the base number 37 (p) of the base number 37 of the plcA gene and the base number 100 (A) and the base number 226 of the base number (C) are detected, the polymorphism group 10 of the plcA gene Can be determined. Thus, the target polymorphism group can also be detected by combining two or more single nucleotide substitution sites on the same gene.

  Next, the case where the clinical strain group D group estimated to be highly pathogenic is determined. This group belongs to polymorphism group 3 in the hlyA gene, polymorphism group 13 in the clpC gene, polymorphism group 14 in the inlA gene, and polymorphism group 8 in the plcA gene. However, when the single base substitution site of the clpC gene shown in FIG. 16 is seen, single base substitution specific to the polymorphism group 13 cannot be found. Therefore, considering combinations that can detect only the polymorphism group 13 in the clpC gene as much as possible, the base (T) at the base number 106 of the clpC gene is detected from the single base substitution site shown in FIG. If the second base (A) is detected, only polymorphism groups 10, 11, and 13 can be detected. Next, looking at the single base substitution sites shown in FIGS. 18 and 19, it is understood that, for example, group 8 can be detected by detecting the base (C) at base number 226 of the plcA gene. Therefore, if all three single base substitutions are detected, it can be detected that they belong to clinical strain group D.

  Further, as understood from Table 1, the polymorphism group 8 may be detected in the plcA gene, and the polymorphism group 14 may be detected in inlA. For this purpose, the base 226th base (C) of the inlA gene may be detected and the base 159th base (T) of the inlA gene may be detected. Thus, you may make it detect combining the specific single base substitution part in a some gene.

  Alternatively, it is conceivable to find a base to be detected as follows. Based on Table 1, the clinical strain group D serotype is type 4b. On the other hand, it has been found that the polymorphism group 13 in the clpC gene includes a large number of strains whose serotype is 1 / 2b (see Table 3 below). Therefore, a group including the polymorphism group 13 in the clpC gene is detected by the above method, and in other genes excluding the clpC gene, a single base capable of detecting a polymorphism group whose serotype does not include the ½b type Replacement may be detected.

  Tables 2 to 5 are classification tables based on all polymorphism groups and serotypes of Listeria monocytogenes classified by the present inventors. From these tables, the 1 / 2b type is often found in polymorphism groups 1 and 4 in the hlyA gene, in the polymorphism groups 10 and 12 in the inlA gene, and in the polymorphism groups 8 and 9 in the plcA gene. Among these, in order to contain as few clinical strains as possible, a single base substitution site that does not detect polymorphism groups 10 and 12 in the inlA gene but can detect polymorphism group 14 in the inlA gene from Table 4. May be detected. For this purpose, it is understood that the base number sequence 168th base (T) or 159th base (T) of the inlA gene may be detected. Thus, from the combination of classification by serotype and classification by polymorphism group, a single base substitution site capable of detecting a polymorphism group that is identical to the target clinical strain is determined and detected as a result. A single nucleotide polymorphism site that can exclude strains of other serotypes to the maximum from the strains to be obtained may be determined.

  In the above description, the case where a specific single base substitution site is detected as positive is shown, but detection methods that are negative may be combined. That is, while focusing on a single nucleotide substitution site that detects a plurality of polymorphism groups including the target polymorphism group, a single nucleotide substitution site that can be detected only in other polymorphism groups excluding the target polymorphism group May be targeted. For example, while detecting the base No. 123 (G) of the inlA gene, the base No. 31 (T) of the same gene is detected. According to this, detection of the 123rd base (G) determines that it is one of the polymorphism groups 10 to 17, but the polymorphism group 17 is determined to be negative for the 31st base (T). . Therefore, it is determined by this method that it belongs to the polymorphism group 17. Thus, in the present invention, the single nucleotide polymorphism site that identifies the polymorphism group to which it belongs may be determined by a combination of a positive detection method and a negative detection method.

  Next, the single base substitution site for which the detection target is specified is detected by a known SNP analysis. That is, a DNA fragment (oligonucleotide) containing the single nucleotide site to be detected may be amplified, and the amplified DNA portion may be detected by a cycling probe method (for example, TaqMan (trade name) probe method).

  The probe for amplifying the DNA fragment sandwiching the single nucleotide substitution site to be detected is not particularly limited as long as this object can be achieved. From the viewpoint of the efficiency of PCR amplification, the length is usually designed to be about 10 bp to 150 bp or less. At this time, in the case where multiplex PCR (PCR in which PCR reactions using different primers and probes are performed under the same temperature and time conditions) is required, a base sequence portion having a GC content that has the same annealing temperature is used. It is preferable to use the design. In the present invention, for example, when aiming at the 258th base (G) of the hlyA gene, an oligonucleotide having a base sequence represented by SEQ ID NO: 1 (Forward primer) and a base sequence represented by SEQ ID NO: 2 The oligonucleotide (Reverse primer) which has is illustrated. These primers amplify a region between polymorphism group 5 in the hlyA gene and sandwich the substitution part of the 258th base (G) of the base sequence, and include the 199-217 base part and the 279- base part of the base sequence. It consists of a 297 base part. Of course, the primer for this purpose may be other sequences as long as it can amplify a region sandwiching the substitution part of the 258th base (G) specific to this group 5.

  The cycling probe for detecting the amplified DNA fragment is not particularly limited as long as it has a base sequence that hybridizes with a region sandwiching the single base substitution site to be detected. At this time, the deoxyribonucleotide at the single base substitution site is substituted with a ribonucleotide. Further, the position substituted with ribonucleotide may not be the single base substitution site to be detected, and the adjacent position or several bases including the position may be substituted with ribonucleotide. At this time, when the single base substitution site is (T) or (C), the adjacent adenine deoxyribonucleotide (A) or guanine deoxyribonucleotide (G) is replaced with adenine ribonucleotide or guanine ribonucleotide. Good. This is because the case where the single base substitution site is a purine base of (A) or (G) tends to be cleaved with RNase more reliably, and the RNA itself becomes stable. Further, the 5 ′ end of the cycling probe is labeled with a known fluorescent substance such as FAM, and 3 ′ is labeled with a quenching substance. By these labels, the hybridized RNA portion is cleaved by RNase H and emits strong fluorescence. And it is detected by measuring this fluorescence intensity that it has the target single base substitution site | part. The cycling probe only needs to be able to hybridize with the region containing the single nucleotide substitution site to be detected, and may be either a normal chain or its reverse chain. In addition, when the single-base substitution site is (T) or (C), the single-base substitution site is (A) or (G) in the reverse strand sequence. preferable.

  As these cycling probes, when a region sandwiching the substitution part of the base (G) at the base number 258 is amplified, a chimeric probe having the base sequence shown in SEQ ID NO: 3 is exemplified. This chimera probe is designed by designing the region between the base (G) substitution part, the 250th to the 273rd base part, and substituting the guanine deoxynucleotide of this base (G) with guanine ribonucleotide.

  Further, when detecting the clinical strain group D group, the region sandwiching the base 106 (base T) of the clpC gene and the base 166 (A) may be amplified. In this case, a probe (Forward primer) having the base sequence shown in SEQ ID NO: 4 and a probe (Reverse primer) having the base sequence shown in SEQ ID NO: 5 are exemplified. This Forward primer is designed from the 65-83 base part of the base number of the clpC gene, and the Reverse primer is designed from the base number 179-159 base part. As a cycling probe for detecting this base (T), a chimeric probe having the base sequence shown in SEQ ID NO: 6 is exemplified. This chimera probe is designed by designing a region sandwiching the substitution part of the base (T), the base part of base numbers 105 to 116, and substituting the adenine deoxyribonucleotide adjacent to the base (T) with an adenine ribonucleotide. Is done. A chimeric probe having the base sequence shown in SEQ ID NO: 7 is exemplified as a cycling probe for detecting the 166th base (A) of the inlA gene. This chimera probe is designed by designing the region between the 164th and 174th base parts sandwiching the base (A) substitution part, and substituting the adenine deoxynucleotide of this base (A) with an adenine ribonucleotide.

  Next, as a probe for amplifying a region sandwiching the base 168th base (T) in the inlA gene, for example, a probe (Forward primer) having the base sequence shown in SEQ ID NO: 8 and the base sequence shown in SEQ ID NO: 9 A probe (Reverse primer) having This Forward primer is designed from the base number 100-118 base part in the inlA gene, and the Reverse primer is designed from the base number 197-206 base part. A chimeric probe having the base sequence shown in SEQ ID NO: 10 is exemplified as a cycling probe for detecting the 168th base (T) of the base sequence. This chimera probe is designed with the reverse strand sequence of the 160-170th base portion of the inlA gene, the region sandwiching the base (T) substitution portion, and the adenine deoxynucleotide (A) which is the reverse strand of this base (T) Is substituted with adenine ribonucleotide (A).

  Further, as described above, the strain of the clinical strain group D group can be similarly detected by detecting the 159th base (T) instead of the 168th base (T). For this purpose, amplification is performed using the probe having the base sequence shown in SEQ ID NO: 8 and the probe having the base sequence shown in SEQ ID NO: 9, and then the base sequence shown in SEQ ID NO: 11 (5′-cc (A ) ccatcgcct-3 ′: (A) is a ribonucleotide) and a single base substitution site may be detected. This chimeric probe is prepared by designing a reverse strand sequence of the 151-161st base portion of the inlA gene, and substituting the adenine deoxynucleotide (A) which is the reverse strand of this base (T) with an adenine ribonucleotide.

  However, in the present invention, it is not limited to these primers and probes, but a primer capable of amplifying a region sandwiching a single base substitution portion to be detected and a base sequence capable of hybridizing with the region sandwiching the single base substitution site. In addition, a base probe having a substitution, insertion, or deletion in the oligonucleotide having the base sequence exemplified above is also included.

  In this manner, a nucleic acid amplification probe and a detection cycling probe for detecting single nucleotide polymorphisms in the hlyA gene, clpC gene, inlA gene and plcA gene are designed and prepared. By applying the PCR (RT-PCR) method to the sample using the probe and the cycling probe thus obtained, the classification of bacteria and the presence or absence of pathogenicity are determined.

  The Listeria monocytogenes detection kit of the present invention includes a nucleic acid proliferation probe capable of detecting such a single nucleotide polymorphism and a cycling probe for detecting a single nucleotide substitution. In some cases, various enzymes (eg, a DNA polymerase), RNase for digesting a hybridized RNA portion, a buffer solution, and the like are added.

  In addition, the detection kit detects a specific polymorphism group as described above, and is used for detecting a single nucleotide substitution with one kind of proliferation primer (usually used as a primer set of a forward primer and a reverse primer). A cycling probe may be provided as a set, or two or more types of proliferation probes and a cycling probe may be provided as a set, or two or more cycling probes may be provided for one proliferation probe. For example, for detection of highly pathogenic bacteria (clinical strain groups I to L) in serotype 1 / 2a, a primer set for proliferation of SEQ ID NO: 1 and SEQ ID NO: 2 and a cycling probe of SEQ ID NO: 3 are combined. . For detection of highly pathogenic bacteria (clinical strain group D group) in serotype 4b, a proliferation primer set of SEQ ID NOs: 4, 5, 8, and 9 and a cycling probe of SEQ ID NOs: 6, 7, and 10 are used. Combined.

  Of course, the present invention is not limited to the detection kit described above. In addition to this, if it is judged that it belongs to the same group as the strain isolated as a clinical strain, it is presumed to be pathogenic. For example, it is conceivable to detect the same strain (bacteria No. 122) as the group C shown in Table 1. For this purpose, it is only necessary to detect that the serotype is 1 / 2b and that the plcA gene belongs to the polymorphism group 11. Therefore, after classifying by serotype, using a probe for nucleic acid amplification capable of amplifying the region sandwiching the 204th base (A) of the plcA gene and a cycling probe for detecting the base (A) It is sufficient to detect that the plcA gene is polymorphism group 11. In the present invention, the same technique is used not only for bacterial strains (clinical strains) suspected to be pathogenic, but also for strains having the same gene polymorphism as strains that have been detected only in the environment and foods so far. Can be identified and detected.

  Furthermore, not only the oligonucleotide which consists of a base sequence shown to sequence number 20-80 but the oligopeptide translated from these base sequences is also contained in this invention. If these amino acid sequences are subjected to multiple alignment analysis (for example, using the Clustal W program), it is possible to identify and classify Listeria monocytogenes in the same manner as in the case of the base sequence. As a result, it is presumed that in the clinical strain in which the amino acid sequence is changed by single base substitution and the pathogenicity is presumed to be high, the activity of the protein translated from each gene portion is greatly different. Classification / identification becomes possible by examining the presence or absence of the activity. In addition, by using these translated proteins as antigens and preparing antibodies thereto, it is possible to detect and identify highly pathogenic strains. Various known methods are used for the production of the translated protein, the antibody, and the antigen / antibody detection method. Furthermore, by searching for a codon that is a stop codon from the base sequences shown in SEQ ID NOs: 20 to 80, it is possible to detect and identify a strain having low pathogenicity.

As described above, according to the present invention, identification and detection of Listeria monocytogenes, particularly detection of Listeria monocytogenes presumed to be highly pathogenic, and identification of infection source and infection route can be performed quickly and easily. In this method of detecting a single base substitution site, more detailed bacterial information than serotype can be grasped, and therefore, identification with higher accuracy can be performed.

The detection method of the present invention includes, for example, raw milk and processed products thereof (dairy products such as drinkable milk, cheese, and yogurt), composite cooked food (lunch products, cooked bread), seafood and processed products thereof, vegetable salad, meat and its Applicable to processed foods (ham, sausage, salami, etc.), various foods such as Ready-To-Eat foods, drinking water such as water and soft drinks, drainage and feces and urine samples The
Next, based on an Example, this invention is demonstrated further in detail.

[Design of primer set and probe for cycling probe method PCR]
(1) Determination of base sequences of hlyA, clpC, inlA and plcA genes First, base sequences of each gene were determined for L. monocytogenes isolated from food and environment and clinical. For the determination, 111 isolates from food and the environment and 15 isolates from clinical use were used. These serotype classifications are shown in Table 6.

(I) Primer design and base sequence The primer sets for the internal base sequences of the hlyA, clpC, inlA and plcA genes were used for EDG-e strains (serotype 1 / 2a) and F2365 strains, which are L. monocytogenes with known base sequences. (Serotype 4b) was designed based on the common sequence portion.
(A) hlyA primer set (amplifies the 1070-1558 bp portion of the hlyA gene)
Forward ・ ・ ・ AAATCATCGACGGCAACCT (SEQ ID NO: 12)
Reverse ... ATTTCGGATAAAGCGTGGTG (SEQ ID NO: 13)
(B) clpC primer set (amplifies the 378-1210 bp portion of the clpC gene)
Forward ・ ・ ・ TCTTGGTATTAGTTTGAATAAAGCTC (SEQ ID NO: 14)
Reverse ・ ・ ・ TCAAACGTACTTTAGAACCAGATT (SEQ ID NO: 15)
(C) inlA primer set (amplifies the 1099-1918 bp portion of the inlA gene)
Forward ... TTTTTCTATAATAACAAGGTAAGTGAC (SEQ ID NO: 16)
Reverse ・ ・ ・ CTGTATAGCTATTGGCGCTAT (SEQ ID NO: 17)
(D) plcA primer set (amplifies the 101-920 bp portion of the plcA gene)
Forward ・ ・ ・ ACTGGAATAAGCCAATAAAGAACTC (SEQ ID NO: 18)
Reverse ・ ・ ・ ATTGTTTGTTTTTCGGGGAAGT (SEQ ID NO: 19)

(Ii) Preparation of genomic DNA From the pure culture solution of each strain, it prepared using DNA Tissue Kit (made by QIAGEN).

(Iii) PCR
PCR reaction was performed with the following reaction solution composition.
10 × buffer for Taq DNA polymerase (TaKaRa) 3μl
1 mM dNTPs (TaKaRa) 0.6 μl
20 μmol / μl primer (Forward) 0.6 μl
20 μmol / μl primer (Reverse) 0.6 μl
2 μl of template DNA
5 U / μl TaKaRa ExTaq (TaKaRa) 0.15 μl
The above reaction solution was prepared in a 0.2 ml microtube, sterilized water was added so that the total amount was 30 μl, and PCR was performed using TaKaRa PCR Thermal Cycler or Thermo HyBaid PCR Express under the following conditions.
<Reaction conditions>
Denaturation of DNA: 94 ° C, 30 sec
Annealing: 60 ° C, 30 sec
Extension reaction: 72 ° C, 1 min
After heating at 94 ° C. for 3 minutes, the above reaction was carried out for 30 cycles.
The obtained PCR product was confirmed by agarose gel electrophoresis.

(Iv) Purification of PCR product The PCR product obtained by the above PCR was purified using a QIAquick PCR Purification Kit (manufactured by QIAGEN) according to the attached protocol.

(V) Determination of the base sequence of the PCR product The base sequence analysis of the PCR product after purification was performed by the Sanger method.

(Vi) Nucleotide sequence analysis A multiple alignment of the nucleotide sequences of the strains determined for each gene was created by the ClustalW program, and a phylogenetic tree was created by the neighborhood joining method.
The phylogenetic tree of each gene is as shown in FIGS. 1-4, and the multiple alignment of the base sequences is as shown in FIGS. Moreover, the relationship between the phylogenetic tree and the serotype in each strain is as shown in Tables 2-5.

  Based on the sequence comparison of about 1100-1500 bases of the hlyA gene, this bacterium was classified into 9 groups. The clinical 1 / 2a type 5 strain is classified into the same group as about 1/3 of the same serotype food strain, and the clinical 4b type 6 strain and the clinical 1 / 2b type 2 strain are classified into the same group as all food type 4b strains. It was.

  According to the analysis result of about 500-1100 base part of the clpC gene, this bacterium was classified into 14 groups. The clinical 1 / 2a type 3 strains are classified into 3 groups different from food strains, and 1 out of clinical 4b types is the same group as most food 1 / 2b type strains, 5 strains are about 25% food 1 / 2b and about 25% food 4b strains were classified into the same group.

  The bacterium was classified into 17 groups by sequence comparison of about 1100-1800 bases of the inlA gene. The clinical 4b type 4 strains were classified into the same group as most food 4b type strains, while the other clinical 4b type 3 strains were divided into independent single groups different from the food 4b type strains.

  From the sequence comparison of about 100-800 bases of the plcA gene, the test strains were classified into 21 groups. Five clinical 1 / 2a strains were classified into the same group as about 25% food 1 / 2a strains. Of the clinical 4b strains, 3 strains were divided into the same group with approximately 30% food 4b strain and 2 strains with approximately 70% food 4b strain.

  As a result, the hlyA gene is classified into a total of 22 groups including all clinical strains and environmental strains, the clpC gene is classified into a total of 29 groups, the inlA gene is classified into a total of 27 groups, and the plcA gene is classified into a total of 30 groups. It was done.

Further, all of Listeria (L. monocytogenes) is hlyA was tried subjected this, CLPC, was considered to have a inlA and plcA genes, since the internal base sequence by strains differ, even at the same serotype In some cases, it was classified into different genotypes. This was particularly noticeable in food / environment-derived 1 / 2a strains, which were divided into groups of 4 to 8 genotypes. In addition, food / environment-derived 1 / 2b and 4b strains were each roughly classified into two groups of genotypes.

(2) Specific detection method of highly pathogenic strains by single nucleotide polymorphic analysis As a result of sequence analysis, in the same group, 1/3 serotype 1 / 2a strain and 1 strain 3a, 1 strain 3c type and 2 serotype-incapable strains were included, but clinically derived serotype 1 / 2a type 5 strains were all classified into polymorphism group 5 in hlyA. In order to specifically detect this group, a method was developed in which a sequence containing a specific single nucleotide substitution portion in the determined sequence was amplified by PCR and detected using a fluorescently labeled chimeric probe.

(A) Design of cycling probe technology PCR primer sets and chimeric probes (i) clinical from highly pathogenic strains (serotype 1 / 2a type: clinical strains I ~L Group) A kit for detecting specific base in this group Substitution, that is, a region sandwiching the substitution part of the 258th base (G) of the determined base sequence of hlyA gene group 5 (see FIG. 5) was selected, and primers were designed based on this sequence. Specifically, a forward primer was designed and prepared at base numbers 199 to 217, and a reverse primer was designed from 279 to 297.

        For the detection cycling probe (chimeric probe), the 250-273th base portion is selected as a region sandwiching the substitution portion of the 258th base (G), and the 258th base G ( A probe having the base sequence of SEQ ID NO: 3 was prepared by replacing guanine deoxynucleotide) with guanine ribonucleotide. The 5 ′ end of the probe was fluorescently labeled with FAM, and the 3 ′ end was labeled with Eclipse for quenching.

Table 7 shows primers and probes for detection of base substitution in the hlyA gene for detecting clinical strains I to L groups. The bases in parentheses in the table indicate ribonucleotides.

(Ii) Kit for detection of clinically derived highly pathogenic strain (clinical strain D group) The primer includes a base substitution specific to this group, that is, the 106th base (T) portion of the polymorphism group 13 of the clpC gene. The region to be sandwiched and the region sandwiching the 166th base (A) portion of the polymorphism group 13 were selected, and a probe was designed based on this sequence, and the clpC gene polymorphism groups 10, 11, and 13 were first detected. .

        Since polymorphism group 13 includes about 25% of environmental food-derived serotype 1 / 2b strains, in order to distinguish them from these, base substitution specific to inlA gene polymorphism group 14, ie, inlA gene A region sandwiching the 168th base (T) portion of polymorphism group 14 was selected, and a probe was designed based on this sequence.

        Specifically, a clpC Forward primer (SEQ ID NO: 4) was produced at the base number 65-83 base portion of the clpC gene, and a clpC Reverse primer (SEQ ID NO: 5) was produced at the 179-159 base portion. The cycling probe (chimeric probe) for detecting the base substitution in the clpC gene is designed from the base part of the base number 105-116 as the clpC probe 1 for detecting the 106th base (T) substitution part of the clpC gene, Instead of replacing the base T (thymine deoxynucleotide) at the 106th base substitution site with thymine ribonucleotide, a probe (SEQ ID NO: 6) was prepared in which the 107th A (adenine deoxynucleotide) was replaced with adenine ribonucleotide. In addition, as the clpC probe 2 for detecting the 166th base (T) substitution part of the clpC gene, it is designed from the base part of the base numbers 164 to 174, and the base substitution part 166th base A (adenine deoxynucleotide) is adenine. A probe (SEQ ID NO: 7) replaced with ribonucleotide was prepared. The 5 ′ end of the probe was fluorescently labeled with FAM, and the 3 ′ end was labeled with Eclipse for quenching.

Next, in order to detect single base substitution of the inlA gene, an inlA Forward primer (SEQ ID NO: 8) is prepared at the base number 100-118 base part, and an inlA Reverse primer (SEQ ID NO: 9) is prepared at the 197-206 base part. did. In addition, the cycling probe (chimeric probe) for detection of base substitution in the inlA gene is designed with the reverse strand sequence of the 160-170th base portion, and is the reverse strand of the 168th base T of the single base substitution portion of the sequence. A probe (SEQ ID NO: 10) was prepared in which base A (adenine deoxynucleotide) was replaced with adenine ribonucleotide. The 5 'end of the probe was fluorescently labeled with FAM and the 3' end was labeled with Eclipse for quenching.

Tables 8 and 9 show primers and probes for detecting base substitution in clpC and inlA genes specific for detecting the clinical strain D group. The bases in parentheses in the table indicate ribonucleotides.

[Detection of Listeria monocytogenes]
Next, the strain was identified and detected using the PCR primer set and cycling probe prepared in Example 1.

(1) Detection of clinical strain groups I to L Using the primer sets and cycling probes prepared above, the strains were identified using DNA prepared from the strains of each group of 9 groups of hlyA genotype. The result is shown in FIG. The identification conditions are as follows.
(I) Preparation of genomic DNA It was prepared from a pure culture solution of each strain using a DNA Tissue Kit (QIAGEN).
(Ii) Detection by real-time PCR
PCR reaction was performed with the following reaction solution composition using Cycleave PCR core kit.
(Reaction solution composition)
10 x Cycleave PCR buffer (TaKaRa) 1 μl
2.5 mM dNTP Mixture (TaKaRa) 1.2 μl
25 mM Mg solution 2.0 μl
20μM Forward primer 0.1μl
20μM Reverse primer 0.1μl
Cyclin probe (5 μM) 0.4 μl
TaKaRa ExTaq HS (5U / μl) 0.1μl
Tli RNase HII (200 U / μl) 0.2 μl
Template DNA 0.4 μl
4.5 μl of water
Total 10μl
The reaction solution was prepared in a 0.2 ml microtube and detected by real-time PCR under the following conditions using a Stratagene real-time PCR device MP3000.
<Reaction conditions>
Denaturation of DNA: 95 ° C, 5 sec
Annealing: 50 ° C, 15 sec
Extension reaction: 72 ° C, 20 sec
After heating at 95 ° C. for 30 seconds, the above reaction was performed for 40 cycles.

As a result, only strains of group 5 could be detected by this method. As can be understood from Table 2, food-derived serotype 1 / 2a type (8/24 strain), food-derived serotype 3a type (1/2 strain), food products were positive in this method. The serotype 3c (1/1 strain) derived from food, the serotype-incapable strain (2/6 strain) derived from food, and the serotype 1 / 2a strain (5/5 strain) derived from clinical practice. L. monocytogenes strains classified into the same genotype as clinically derived 1 / 2a strains, even if isolated from the environment and food, have higher pathogenicity than other strains of the same serotype Is estimated.

(2) Detection of clinical strain group D Using the DNA prepared from the strains of each group of clpC genotype 14 group as a template, the detection results by the cycling probe method for detecting base substitution in the clpC gene prepared above are shown in FIG. And FIG. 22 (according to probe 2). FIG. 23 shows the detection results of the inlA gene base substitution detection cycling probe method prepared above using DNA prepared from the strains of each group of 17 inlA genotypes as a template. The detection conditions are the same as above.

        In Listeria monocytogenes of inlA genotype groups 15 and 17, since the purified genomic DNA concentration used as a template was low, the number of cycles in which the fluorescence intensity increased was slower than in groups 8 and 4, but the fluorescence intensity increased from the 29th cycle. Increased and clearly different results were obtained from L. monocytogenes other than these four groups without base substitution, and could be distinguished from other groups as a final decision.

        In the clpC and inlA gene regions, all three specific base substitutions were positive in detection by the cycling probe method. The serotype 4b derived from food (7/22 strain, strain number 3, 6, 7, 14, 15, 16, 28), food-derived serotype 4e type (1/22 strain, strain number 24), clinically derived serotype 1 / 2b type (1/33 strain, strain number 122) Serotype 4b of clinical origin (3/7 strain, strain number 125,129,131). These strains detected by this have the same pathogenicity gene as serotype 4b of clinical origin, and were estimated to be highly pathogenic.

  According to the present invention, a single base substitution that is not present in a low pathogenic strain and is specific for a highly pathogenic strain is detected, thereby detecting a highly pathogenic strain by combination with a serotype can do. Moreover, since classification and identification of strains can be detected with high accuracy, it is possible to quickly identify an infection route and a contamination source when food poisoning occurs. It can also be used for rapid pathogenicity assessment of food isolates, use for epidemiological investigations, and investigation of the distribution of highly pathogenic strains in the environment and their elimination (mainly prevention of secondary contamination).

It is a figure which shows the classification | category tree of Listeria monocytogenes based on the base sequence in an hlyA gene. It is a figure which shows the taxonomic tree of Listeria monocytogenes based on the base sequence in a clpC gene. It is a figure which shows the classification | category tree of Listeria monocytogenes based on the base sequence in an inlA gene. It is a figure which shows the classification | category tree of Listeria monocytogenes based on the base sequence in a plcA gene. It is a figure which shows CLUSTAL W multiple sequence alignment of the 1126-1527 (402 bp) base part of a hlyA gene. It is a figure which shows a part of CLUSTAL W multiple sequence alignment of the 489-1124 (636 bp) base part of a clpC gene. FIG. 7 is a continuation diagram of FIG. 6. FIG. 8 is a continuation diagram of FIG. 7. It is a figure which shows a part of CLUSTAL W multiple sequence alignment of the 1192-1799 (608 bp) base part of an inlA gene. FIG. 10 is a continuation diagram of FIG. 9. FIG. 11 is a continuation diagram of FIG. 10. It is a figure which shows a part of CLUSTAL W multiple sequence alignment of the 153-865 (713 bp) base part of a plcA gene. FIG. 13 is a continuation diagram of FIG. 12. FIG. 14 is a continuation diagram of FIG. 13. It is the figure which took out the single base substitution site | part in the hlyA gene. It is the figure which took out the single base substitution site | part in a clpC gene. It is the figure which took out the single base substitution site | part in an inlA gene. It is the figure which took out the single base substitution site | part in a plcA gene. It is a continuation figure of FIG. It is a figure which shows the detection result which detected the single base substitution in hlyA gene with the probe shown to sequence number 3. It is a figure which shows the detection result which detected the single base substitution in a clpC gene with the probe shown to sequence number 6. It is a figure which shows the detection result which detected the single base substitution in a clpC gene with the probe shown to sequence number 7. It is a figure which shows the detection result which detected the single base substitution in an inlA gene with the probe shown to sequence number 10.

Claims (15)

A method for estimating whether a Listeria monocytogenes to be tested is a pathogenic Listeria monocytogenes,
A method for estimating pathogenic Listeria monocytogenes when the following condition (1) or (2) is satisfied.
(1) The 1383th base of the hlyA gene of Listeria monocytogenes to be tested is G
(2) The 274th base of the plcA gene of the Listeria monocytogenes is C, and the 770th base and the 833rd base are each A. A method for estimating whether a Listeria monocytogenes to be tested is a pathogenic Listeria monocytogenes,
A method for estimating pathogenic Listeria monocytogenes when the following conditions (1) and (2) are satisfied.
(1) The 1383th base of the hlyA gene of Listeria monocytogenes to be tested is G
(2) The 274th base of the plcA gene of the Listeria monocytogenes is C, and the 770th base and the 833rd base are each A. A method for estimating whether a Listeria monocytogenes to be tested is a pathogenic Listeria monocytogenes,
A method for estimating pathogenic Listeria monocytogenes when the following condition (3) or (4) is satisfied.
(3) The 1263rd base of the hlyA gene of Listeria monocytogenes to be tested is C, and the 1377th base is T.
(4) The 508th base, the 654th base and the 961st base of the clpC gene of Listeria monocytogenes to be tested are each A, and the 594th base is T. A method for estimating whether a Listeria monocytogenes to be tested is a pathogenic Listeria monocytogenes,
A method for estimating pathogenic Listeria monocytogenes when the following conditions (3) and (4) are satisfied.
(3) The 1263rd base of the hlyA gene of Listeria monocytogenes to be tested is C, and the 1377th base is T.
(4) The 508th base, the 654th base and the 961st base of the clpC gene of Listeria monocytogenes to be tested are each A, and the 594th base is T.   Furthermore, the method of Claim 3 or 4 estimated as pathogenic Listeria monocytogenes, when the following conditions (5) and / or (6) are satisfy | filled.
(5) The 1278th base, the 1350th base, the 1359th base, and the 1383th base of the inlA gene of Listeria monocytogenes to be tested are all T.
(6) The 378th base of the plcA gene of Listeria monocytogenes to be tested is C, and the 859th base is A. A method for detecting Listeria monocytogenes whose pathogenicity is estimated,
Using a cycling probe comprising a primer that amplifies a region sandwiching the 1383th base of the hlyA gene of the Listeria monocytogenes to be tested and a base sequence represented by SEQ ID NO: 3 from the isolated Listeria monocytogenes to be examined -A detection method for determining pathogenicity when amplification of the hlyA gene that hybridizes with the cycling probe is found as a result of applying PCR. The detection method of Claim 6 using the primer which consists of a base sequence shown by sequence number 1 and sequence number 2. A detection method for determining pathogenicity when the following conditions (7) and (8) are satisfied in a method for detecting Listeria monocytogenes whose pathogenicity is estimated.
(7) Primer, SEQ ID NO: 6 and SEQ ID NO: that amplify a region sandwiching the 594th base and a region sandwiching the 654th base of the Listeria monocytogenes clpC gene to be tested from the isolated Listeria monocytogenes to be tested As a result of applying RT-PCR using a cycling probe consisting of the base sequence shown in 7, amplification of the clpC gene that hybridizes with the cycling probe is observed.
(8) From the isolated Listeria monocytogenes to be examined, a primer that amplifies the region sandwiching the 1359th base of the inlA gene of the Listeria monocytogenes to be examined and the nucleotide sequence represented by SEQ ID NO: 10 or SEQ ID NO: 11 As a result of applying RT-PCR using the cycling probe, amplification of the inlA gene that hybridizes with the cycling probe is observed. The detection method according to claim 8, wherein a primer having a base sequence represented by SEQ ID NO: 4 and SEQ ID NO: 5 is used. The detection method according to claim 8 or 9, wherein a primer comprising the nucleotide sequence represented by SEQ ID NO: 8 and SEQ ID NO: 9 is used. A detection kit for use in the detection method of claim 6,
A primer set consisting of the base sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2,
A detection kit having a cycling probe comprising the base sequence represented by SEQ ID NO: 3. A detection kit for use in the detection method of claim 8,
A primer set consisting of the base sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5,
A detection kit having a cycling probe comprising the nucleotide sequences shown in SEQ ID NO: 6 and SEQ ID NO: 7. A detection kit for use in the detection method of claim 8,
A primer set consisting of the base sequences shown in SEQ ID NO: 8 and SEQ ID NO: 9,
A detection kit having a cycling probe consisting of the base sequence represented by SEQ ID NO: 10. A detection kit for use in the detection method of claim 8,
A primer set consisting of the base sequences shown in SEQ ID NO: 8 and SEQ ID NO: 9,
A detection kit having a cycling probe consisting of the base sequence represented by SEQ ID NO: 11. A detection kit for use in the detection method of claim 8,
A primer set consisting of the base sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5,
A primer set consisting of the base sequences shown in SEQ ID NO: 8 and SEQ ID NO: 9,
A cycling probe consisting of the base sequences shown in SEQ ID NO: 6 and SEQ ID NO: 7,
A test kit having a cycling probe consisting of the base sequence represented by SEQ ID NO: 10 or SEQ ID NO: 11 .