JP2010190823A - Substrate for microarray and microarray - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a substrate for a microarray having excellent operability, capable of securing reliability and reproducibility in hybridization, and suppressing a used amount of a sample solution and a reagent solution. <P>SOLUTION: This plastic substrate used for manufacturing the microarray for bringing a specimen solution into contact with a specimen capturing part, capturing an organism-related substance which is a detection object, and determining existence thereof is described as follows: the specimen capturing part is a plane; a groove encircling the whole outer periphery of the specimen capturing part is provided; a cover installation range is provided on a prescribed position including the specimen capturing part, the groove, and the outer periphery of the groove; assuming that a height from a groove bottom part of a surface in contact with a cover on the outer periphery of the groove is A, and that a height from the groove bottom part of the specimen capturing part is B, in the cover installation range, a relation B&lt;A is satisfied; and when the cover is installed on the cover installation range, a fixed interval is formed between the specimen capturing part and the cover. <P>COPYRIGHT: (C)2010,JPO&amp;INPIT

Description

  The present invention relates to a microarray substrate used in a microarray such as a DNA microarray used in the biochemical field.

  As a method of observing the expression status of a gene at a time when genome analysis progresses, DNA fragments are spotted at high density on a glass slide substrate, and this DNA fragment and a DNA fragment from a specimen are hybridized to obtain a gene sequence. DNA microarrays that observe expression have come to be used.

  As an operation for observing gene expression by a DNA microarray, a fluorescent label is applied to a sample DNA, this DNA solution is brought into contact with the DNA microarray, hybridized with a DNA strand fixed on the DNA microarray, and fluorescently labeled. By observing the state of DNA hybridization, an operation of checking the expression state of each gene is performed. What is necessary for the measurement in this fluorescence is to reduce the measurement error in the operation. Currently, one of the causes of variation in the measurement results in the measurement of gene expression in a DNA microarray is due to variation in hybridization. Variations in hybridization are often due to operational inaccuracies. What is important in the hybridizing operation is to bring a DNA solution to be a specimen uniformly into contact with an area where DNA is fixed. For this purpose, it is necessary to clearly know the area where the DNA is fixed. Therefore, many DNA microarrays having a frame printed on the substrate are commercially available so that the DNA fixing area on the substrate can be easily identified.

A major factor of variation in hybridization is due to non-uniformity of the DNA solution serving as a specimen. The non-uniformity is the non-uniformity of the thickness of the DNA solution serving as a specimen, and the non-uniformity of concentration. The hybridization operation in the DNA microarray is performed by dropping a DNA solution serving as a specimen into an area where DNA is immobilized and covering the cover glass thereon to form a DNA solution serving as a specimen over the entire area where DNA is immobilized. To spread. At this time, the thickness of the DNA solution is biased, and the amount of DNA hybridization reaction is biased in the DNA area. In order to make the thickness of such a DNA solution uniform, a cover glass for hybridization is commercially available in which a protrusion is provided on the cover glass like a clog tooth and the gap between the DNA microarray and the DNA-immobilized surface is constant. Has been. However, even when such a cover glass is used, there arises a disadvantage that the cover glass is displaced during the operation.
Moreover, such a cover glass is produced by bonding glass to a cover glass in the shape of a clog tooth. Glass is easy to break, and the work of attaching glass to a thin cover glass is a laborious work.

As a method for solving the disadvantages of the cover glass method as described above, Patent Document 1 discloses that a fixed gap is secured between the surface of the specimen capturing unit and the cover by providing protrusions on both the substrate body and the cover. A method is disclosed. In this method, the cover glass can be prevented from shifting during operation, and the thickness of the solution during the capture reaction is made uniform, so that the capture reaction in the specimen capture unit and the reaction for detection after the capture reaction are made uniform. It is effective.
However, in this method, it is necessary to provide protrusions on both the substrate body and the cover glass, and the protrusions on the substrate side may interfere with the protrusions provided on the substrate when detected by the scanner. There is a possibility that inconvenience that it is not possible to come out. Further, the method described in Patent Document 1 requires a dedicated cover for the substrate, which increases the cost for manufacturing the cover or procuring the cover.

  In recent years, analysis using large-scale microarrays has progressed, and DNA microarrays in which genes to be detected have been narrowed down have begun to be put into practical use as test microarrays including clinical tests. Since testing microarrays require a reduction in testing costs, it is necessary to reduce the amount of sample solution used and the amount of test reagent solution used. Furthermore, a microarray with a simpler operability is desired.

JP 2004-177345 A

  The object of the present invention is to eliminate the non-uniformity of the DNA solution thickness in hybridization, which is found in conventional glass microarray substrates, to ensure reliability and reproducibility in hybridization, and to An object of the present invention is to provide various microarray substrates, including DNA microarrays that can be applied to microarrays for inspection that suppress the amount used and have excellent operability.

As a result of intensive studies, the inventors have provided a groove around the sample capturing unit in the microarray, and further limited to the sample capturing unit by a structure that secures a constant gap in the sample capturing unit when covered with a cover. It has been found that the sample solution and various detection reagent solutions can be stored, the reaction in the specimen capturing part is uniform and the operability is simple, and the present invention has been completed.
That is, the present invention is as follows.
(1) Forming a specimen capturing part in which a substance that captures biological substances is spot-fixed within a predetermined range of the substrate surface, bringing the specimen capturing part into contact with the specimen capturing part, and capturing the biological substances to be detected A specimen substrate (1) having a flat surface and a groove (2) surrounding the entire outer periphery of the specimen capture section (1), A surface having a cover installation range (3) at a predetermined position including the capture part (1), the groove (2), and the outer periphery of the groove, and in contact with the cover at the outer periphery of the groove (2) in the cover installation range (3) When the height from the groove bottom (5) of (4) is A and the height from the groove bottom (5) of the sample capturing part (1) is B, B <A, and the cover is placed in the cover installation range. It is characterized in that a fixed gap is formed between the specimen capturing part and the cover when installed. Microarray plastic substrate.
(2) The plastic substrate for a microarray according to (1), wherein C ≦ B <A when C = A−B.
(3) The plastic substrate for microarray according to (1) or (2), wherein C is 10 to 200 μm and B / C is 2 to 10.
(4) The plastic substrate for microarray as set forth in any one of (1) to (3), wherein the cover installation range (3) is set by being one step lower than the substrate surface, and the cover is placed therein.
(5) A microarray in which a biological substance or a compound having an affinity for a biological substance is immobilized on the specimen capturing portion of the plastic substrate for microarray according to any one of (1) to (4).

  The plastic substrate for microarray according to the present invention makes it possible to supply microarrays with reduced test reagents and improved operability, and can be applied to testing applications including clinical tests.

It is a schematic plan view of 1st embodiment of the plastic substrate for microarrays of this invention. FIG. 2 is an enlarged schematic view of an end surface of the X-X ′ line cutting part of FIG. 1. FIG. 2 is an enlarged schematic view of an end surface of an X-X ′ line cutting part when a cover is put on the substrate of FIG. 1. It is a schematic plan view of 2nd embodiment of the plastic substrate for microarrays of this invention. FIG. 5 is an enlarged schematic view of an end surface of a Y-Y ′ line cutting part in FIG. 4. FIG. 5 is an enlarged schematic view of an end surface of a Y-Y ′ line cutting portion when a cover is placed on the substrate of FIG. 4. It is a schematic plan view of 3rd embodiment of the plastic substrate for microarrays of this invention. It is an enlarged schematic diagram of the end surface of the Z-Z 'line | wire cutting part of FIG.

Hereinafter, the present invention will be described in detail.
First, the plastic material used for the plastic substrate for microarrays of the present invention is mainly used for the detection method of specimens such as DNA microarrays. Therefore, when fluorescence is used for detection. Preferably does not emit autofluorescence.
Some DNA microarrays require a heating operation such as immersion in boiling water during the operation process. Examples of the resin having no autofluorescence and having heat resistance include fluororesins such as cyclic polyolefin and ETFE.
In recent years, microarrays have a type of detection that does not require fluorescence, and there are detection methods that do not require high-temperature heating in the operation process. In such cases, use a general-purpose resin. Can do. Examples of the versatile resin include polystyrene, polycarbonate, polypropylene, and acrylic resin.

  Next, the overall shape of the microarray plastic substrate of the present invention will be described. As the overall shape of the substrate, the same shape as that of the slide glass is suitable as a shape suitable for the present microarray scanner. The maximum thickness is preferably 0.8 to 1.2 mm, and preferably about 1 mm. If the thickness exceeds the upper limit value or is less than the lower limit value, reading with a microarray scanner may be difficult.

Next, a more detailed description will be given with reference to the drawings.
FIG. 1 is a schematic plan view showing the structure of the first embodiment of the plastic substrate for microarray of the present invention. 2 is an enlarged schematic view of the end surface of the XX ′ line cutting portion of FIG. 1, and FIG. 3 is an enlarged schematic view of the end surface of the XX ′ line cutting portion when covered with a cover in FIG. .
The plastic substrate for microarray has a specimen capturing part (1) that serves as a site for immobilizing DNA or antibodies. This specimen capturing part is a part to which a sample solution or a detection reagent to be examined is supplied. The specimen capturing unit needs to be a plane, and is preferably a plane parallel to the substrate surface. The area and shape are not particularly limited, but are appropriately set depending on the number of spots of the capturing part such as DNA and antibody and the size of the spot. However, it needs to fit in a cover to be placed later.
A groove (2) that is one step down from the sample capturing part is introduced into the entire outer periphery of the sample capturing part in a shape that completely surrounds the sample capturing part. The width of the groove is preferably 0.5 mm to 3 mm. Further, the cover installation range (3) is set in a range including the specimen capturing part, the groove, and the outer periphery of the groove. The outer portion of the groove within the cover installation range is a surface (4) that comes into contact with the cover, and the height A from the groove bottom (5) of the surface (4) that comes into contact with the cover is the groove bottom of the sample capturing section (1). By making it larger than the height B from (5), a gap (7) is formed between the cover and the specimen capturing part as shown in FIG.
By appropriately setting the size of the gap (7) (C = A−B), the solution such as the sample liquid or the reagent supplied to the specimen capturing section is preferentially passed to the specimen capturing section by capillary action. Will stay. If the amount of solution supplied to the specimen capturing unit is determined, the solution can be reliably distributed only to the specimen capturing unit.
The size C of the gap (7) is preferably 10 to 200 μm, and if it is less than the lower limit, it is difficult to ensure a uniform solution layer thickness due to the rigidity of the cover and the accuracy of the cover thickness. When the upper limit is exceeded, the amount of solution required to supply the entire required specimen capturing unit increases, and an unnecessarily large sample solution and reagent amount during the detection reaction are required.
In addition, it is necessary to secure the depth of the groove. If the depth of the groove is shallow, the solution supplied to the specimen capturing part flows into the groove, and further reaches the portion that contacts the cover beyond the groove. In other words, the solution does not extend to the entire specimen capturing section even though a predetermined amount of solution is supplied to the specimen capturing section. The height B from the groove bottom (5) of the specimen capturing part (1) is preferably not less than the size C of the gap (7). Further, B is preferably at least twice as large as C, and is preferably within 10 times considering the thickness and strength of the substrate.

FIG. 4 is a schematic plan view showing the structure of the second embodiment of the plastic substrate for microarray of the present invention. 5 is an enlarged schematic view of the end surface of the YY ′ line cutting portion of FIG. 4, and FIG. 6 is an enlarged schematic view of the end surface of the YY ′ line cutting portion when covered with a cover in FIG. 4. .
The substrate shown in FIG. 4 has a structure in which the cover installation range (3) is one step lower than the substrate surface, and the cover is accommodated therein. With this structure, the cover can be more securely fixed when the cover is put on, and the cover can be prevented from being displaced.

FIG. 7 is a schematic plan view showing the structure of the third embodiment of the plastic substrate for microarray of the present invention. FIG. 8 is an enlarged schematic view of the end surface of the ZZ ′ line cutting part of FIG. 7.
The plastic substrate for microarray of FIG. 7 is obtained by introducing tweezer insertion portions (8) and ventilation grooves (9) into the plastic substrate for microarray of FIG.

  The sample capturing unit is subjected to a surface treatment for immobilizing a sample capture such as a DNA chain or an antibody. Examples of surface treatments for immobilization include coating polymers with functional groups that react with amino groups, carboxyl groups, thiol groups, aldehyde groups, etc., and amino groups, carboxyl groups, thiol groups, aldehyde groups, etc. on the substrate surface. And a method of introducing a functional group that reacts with the.

  The specimen capturing part is preferably hydrophilized, and preferably has hydrophilicity only in the specimen capturing part. When having a hydrophilicity, the solution is supplied and the cover is covered. The sample can be rapidly extended at the specimen capturing part, and the effect of making the amount of solution uniform is great. The degree of hydrophilicity of the specimen capturing part is preferably 70 ° or less in terms of contact angle with water. Examples of the hydrophilic treatment include surface oxidation treatment such as corona discharge treatment and low-temperature plasma treatment. As a method for limiting the hydrophilic treatment to the sample capturing part and introducing a functional group for immobilizing the sample captured substance, there is a method of coating a polymer having a hydrophilic group and a functional group. Examples of the polymer include a compound having a hydrophilic group such as polyethylene glycol and MPC (methacryloyloxyethyl phosphorylcholine) and a copolymer having an active ester group. These polymers have less non-specific adsorption of biological substances such as DNA and proteins, and are suitable as polymers used for coating the specimen capturing part.

  A microarray can be produced by immobilizing a biological substance or a compound having an affinity for the biological substance on the specimen capturing part. Examples of biological substances include nucleic acid chains such as DNA and RNA, proteins, peptides, sugar chains, antibodies, enzymes, cells, and the like. A compound having an affinity for a biological material is a compound having an affinity for a nucleic acid chain, a protein, a peptide, a sugar chain, an antibody, an enzyme, a cell, etc., and is selected from an extract from a living body or a synthetic product. The In immobilizing these biological substances or compounds having affinity with biological substances, the immobilization target is spotted by a microarrayer or the like.

Example 1
The substrate shown in FIG. 7 was used as a design, an injection mold was prepared, and a molded product of the substrate was obtained by injection molding with polystyrene resin. The overall size of the substrate is a slide glass shape with a length of 25 mm, a width of 75 mm, and a thickness of 1 mm. The specimen capturing part (1) is a flat surface and a mirror surface, and the size is 10 mm long and 14 mm wide. The width of the groove (2) surrounding the entire outer periphery of the sample capturing part is 2.5 mm to 3 mm, the height A from the groove bottom part (5) of the surface (4) in contact with the cover is 300 μm, and the groove bottom part of the sample capturing part ( The height B from 5) was 200 μm, and the gap C formed in the specimen capturing part by covering with a cover was 100 μm. Next, surface treatment for DNA strand fixation was performed on the specimen capturing part (1). 2-Methacryloyloxyethyl phosphorylcholine-butyl methacrylate-p-nitrophenyloxycarbonylpolyethylene glycol methacrylate copolymer (poly (MPC-co-BMA-coNPMA) (PMBN) solution is prepared, and this sample is coated on the sample trap. Thus, a treatment for DNA strand immobilization was performed.

<< Comparative Example 1 >>
A molded article of the substrate was obtained by injection molding with polystyrene resin. The entire size of the substrate is a slide glass shape with a length of 25 mm, a width of 75 mm, and a thickness of 1 mm, and the entire surface of the substrate is formed as a single surface. A surface treatment for DNA strand fixation was performed on the substrate surface. 2-Methacryloyloxyethyl phosphorylcholine-butyl methacrylate-p-nitrophenyloxycarbonylpolyethylene glycol methacrylate copolymer (poly (MPC-co-BMA-coNPMA) (PMBN) solution is prepared, and this sample is coated on the sample trap. Thus, a treatment for DNA strand immobilization was performed.

(Production of microarray for performance evaluation of substrates)
A DNA probe was immobilized on the plastic substrate for microarray prepared above. Dissolve the DNA probe (25 bases) of the sequence TGTAAACTCCCGGATTGCCGCTCCCT (SEQ ID NO: 1), which is modified with an amino group at the 5 ′ end, using 0.25 M carbonate buffer (pH 9.0), and add a 10 μM DNA probe solution. Prepared. This solution was spotted on each substrate with a cross-cut pin having a diameter of 500 μm using a pin type spotter (Marks I manufactured by Hitachi Software Engineering). After spotting the DNA probe, the DNA probe was spotted and immobilized by an arrayer. In the plastic substrate for microarray of Example 1, 30 spots were fixed to the whole specimen capturing part (1), and in the plastic substrate for microarray of Comparative Example 1, the length of the center of the substrate was 10 mm and the width was 14 mm. A total of 30 spots were fixed. After immobilization of the DNA probe, a blocking treatment was performed and used for the evaluation experiment below.

(Comparison evaluation of solution volume)
Using the microarray prepared for the performance evaluation, a 35-base DNA fragment solution having a sequence complementary to the DNA probe of the sequence AAGGCGGGAGGGAGCCGCAATCCGGGAGTTTAAAA (SEQ ID NO: 2) having biotin introduced at the 5 ′ end was prepared as described above. The DNA fragment solution is dropped onto the sample capturing part of each microarray that has been immobilized on the DNA probe and covered with a polystyrene cover (dimensions: 21 mm long, 30 mm wide, 0.7 mm thick), and the entire DNA probe spot is covered. The solution was allowed to flow. In this case, the amount of the solution necessary for the solution to be distributed stably was 22 μl for the microarray produced by the plastic substrate for microarray of Example 1, whereas it was produced by the plastic substrate for microarray of Comparative Example 1. In the microarray, the volume was 70 μl.

(Evaluation of signal variation)
After performing hybridization as described above, the alkaline phosphatase-labeled avidin solution is supplied to the DNA probe spot, covered with a polystyrene cover in the same manner as described above, and the avidin solution is allowed to stand, and then the cover is removed and washed. After washing with the preparation buffer, it was dried. Next, a BCIP / NBT solution was supplied, covered with a polystyrene cover in the same manner as described above, a color development reaction was performed, the color development degree at each DNA probe spot was quantified by image processing, and the variations in the color development degree were compared. In the plastic substrate for microarray of Example 1, the CV value indicating variation was 8% to 12%, but in the plastic substrate for microarray of Comparative Example 1, the CV value was 15% to 22%.

  The microarray produced using the plastic substrate for microarrays of the present invention can suppress the amount of sample solution and detection reagent used, suppress variation in detection, and has good operability. By deploying this to microarrays for various tests including clinical tests, it is possible to achieve tests with microarrays that ensure high reliability and achieve low costs.

1 Sample capture part 2 Groove
3 Cover installation range 4 Surface in contact with the cover 5 Groove bottom 6 Cover 7 Gap 8 Tweezer insert 9 Ventilation groove

Claims (5)

Forming a specimen capture part in which a substance that captures biological substances is spot-fixed to a predetermined range on the surface of the substrate, contacting the specimen capture part with the sample solution, and capturing the biological substance for detection purposes A specimen substrate (1) having a flat surface, a groove (2) surrounding the entire outer periphery of the specimen capture section (1), and a specimen capture section (1). 1), a groove (2), and a surface (4) having a cover installation range (3) at a predetermined position including the outer periphery of the groove, and contacting the cover on the outer periphery of the groove (2) in the cover installation range (3) When A is the height from the groove bottom (5) and B is the height from the groove bottom (5) of the specimen capturing part (1), B <A, and the cover is installed in the cover installation range. In this case, a fixed gap is formed between the specimen capturing part and the cover. Plastic substrate for Roarei. 2. The plastic substrate for microarray according to claim 1, wherein C ≦ A <B, wherein C ≦ B <A. 3. The plastic substrate for microarray according to claim 1, wherein C is 10 to 200 [mu] m and B / C is 2 to 10. The plastic substrate for a microarray according to any one of claims 1 to 3, wherein the cover installation range (3) is set by making it one step lower than the substrate surface, and the cover is placed therein. 5. A microarray, wherein a biological material or a compound having an affinity for a biological material is immobilized on the specimen capturing part of the plastic substrate for microarray according to any one of claims 1 to 4.