JP2010178724A - Method for detecting nucleic acid molecule by using gold magnetic particle - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for easily detecting even a nucleic acid molecule having a low molecular weight and difficult to detect by conventional means. <P>SOLUTION: The detection method enables the easy determination of even a low-molecular weight nucleic acid molecule by adopting a method to hybridize an oligonucleotide probe to the target nucleic acid and bonding with gold magnetic fine particles. The method comprises the step to add and mix a probe comprising an oligonucleotide modified with a thiol and labeled with a detectable marker and specifically binding with the target nucleic acid to the test sample solution, the step to add the gold magnetic finer particles to the obtained mixed liquid and bond the probe and the gold magnetic fine particles, the step to recover the gold magnetic fine particle, and the step to measure signal derived from the marker. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for detecting a nucleic acid molecule.

  Conventionally, Northern blotting, Southern blotting, and the like are known as detection methods for nucleic acid molecules. However, these methods have problems such as low detection sensitivity, long detection time, and complicated operation. there were.

  As a method for comprehensively detecting more nucleic acids, a part of a gene is immobilized on a substrate as a probe, labeled cDNA is prepared from RNA to be measured, and then hybridized with a sequence on the substrate for detection. A microarray method (Non-Patent Documents 1 and 2) is known as a real-time PCR method (Non-Patent Documents 3 and 4) as a nucleic acid detection method with higher sensitivity and excellent quantitativeness.

  However, the microarray method also has a problem that it takes a very long time of about 2 days to detect a target nucleic acid molecule.

  In the case of the PCR method, an expensive PCR device is required, and in principle, detection is not possible unless the number of bases is not less than twice the length of the primer used in PCR. For example, when the primer used in PCR is 18 mer, it is necessary to use a special primer as described below in order to detect a nucleic acid having 36 bases or less. For detection of these short nucleic acids, a loop primer of about 50 mer is hybridized with the terminal portion of the target RNA, followed by primer extension reaction, and then real-time PCR reaction is performed using the obtained primer extension product as a template. It is necessary to operate. In this case, for example, in the real-time RT-PCR method, the reverse transcription reaction is first performed by hybridizing a loop primer to the terminal portion of the target RNA, but it is necessary to anneal at a low temperature, and therefore, non-specific There is a possibility that many reverse transcripts derived from hybridization are produced. Therefore, PCR reaction using a more specific primer is required. Such multiple steps are necessary.

  Further, as a method other than the above, gold / iron oxide magnetic composite nanoparticles (hereinafter sometimes referred to as gold magnetic fine particles) and a thiol-modified oligonucleotide probe are bound to each other, and the target nucleic acid molecule is used using the bound product. There is known a method for detecting (Patent Document 1 and Non-Patent Document 5). In this method, an oligonucleotide probe that specifically hybridizes to a target nucleic acid and modified with thiol is bonded in advance to gold magnetic fine particles by binding of thiol and gold. Then, the obtained thiol-modified probe-gold magnetic fine particle conjugate is added to the solution containing the target nucleic acid molecule. Then, a hybrid of the bound product and the target nucleic acid molecule is recovered by a magnet.

  However, in this method, in order to detect the target nucleic acid molecule, it is necessary to dissociate the target nucleic acid molecule from the hybridized product of the collected conjugate and target nucleic acid molecule, and amplify the target molecule. It is necessary to use expensive equipment such as a PCR device.

  Therefore, the development of a method for measuring a nucleic acid molecule, which is relatively simple, does not require the use of expensive equipment, is simple, and does not require the use of a special primer when measuring a low-molecular nucleic acid molecule. It is desired.

JP 2006-263896 A

Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 1995; 270: 467-470 Genomics, gene expression and DNA arrays. Nature 2000; 405: 827-836 A novel method for real time quantitative RT-PCR. Genome Res. 1996; 6: 995-1001 Quantification of mRNA using real-time RT-PCR. Nat. Protocol 2006; 1 (3): 1559-1582

  An object of the present invention is to provide a method for detecting a nucleic acid that can be easily measured even for a low-molecular nucleic acid molecule that has been difficult to measure.

  As a result of diligent research to solve the above problems, the present inventors have adopted a method in which an oligonucleotide probe is hybridized to a target nucleic acid and then bonded to gold magnetic fine particles. It has been found that even a nucleic acid molecule can be easily measured. The present invention has been completed as a result of diligent efforts to develop a quantitatively measurable method and a simpler method based on such knowledge.

That is, the present invention provides the nucleic acid measurement method described in the following section:
Item 1. (1) a step of hybridizing a target nucleic acid with a probe comprising a thiol-modified oligonucleotide that specifically binds to the target nucleic acid;
(2) In the presence of deoxynucleotide triphosphate labeled with a detectable marker, a primer extension reaction is performed using the target nucleic acid as a template and the probe as a primer to obtain a primer extension product labeled with the marker. Process,
(3) A step of binding the marker-labeled primer extension product obtained in step (2) and gold magnetic fine particles,
(4) A step of recovering a conjugate of the gold magnetic fine particles obtained in step (3) and the marker-labeled primer extension product,
(5) A step of removing the gold magnetic fine particles from the conjugate obtained in step (4) to obtain a marker-labeled primer extension product, and (6) a signal derived from the marker-labeled primer extension product obtained in step (5). A method for detecting a target nucleic acid, comprising the step of measuring

Item 2. (1) A step of adding and mixing a probe consisting of an oligonucleotide labeled with a thiol-modified and detectable marker and specifically binding to a target nucleic acid to a test sample solution,
(2) A step of adding gold magnetic fine particles to the mixed solution obtained in the step (1) to bind the probe and gold magnetic fine particles;
(3) recovering gold magnetic fine particles from the solution obtained in step (2),
(4) A step of measuring a marker-derived signal in the reaction solution after recovering the gold magnetic fine particles by the step (3),
(5) Signal [ii] obtained by performing the steps corresponding to the above (1) to (4) using the signal [i] obtained by the step (4) and the test sample solution not containing the target nucleic acid. And (6) a method for detecting the target nucleic acid when the signal [i] is higher than the signal [ii] and determining that the target nucleic acid is present.

  Item 3. Item 3. The method according to Item 2, wherein the reaction time in the step (2) is 2 to 30 minutes.

  Item 4. Item 4. The method according to any one of Items 1 to 3, wherein the marker is a fluorescent component.

According to the nucleic acid detection method of the present invention, even a low-molecular nucleic acid molecule that has been difficult to measure can be easily measured. In addition, in the nucleic acid detection method of the present invention, it is not necessary to use a special primer such as the above loop primer, so a primer (in the present invention, a probe is used as a primer) is used with respect to the end portion of the target nucleic acid molecule. Can be designed for any part.
In addition, in the method using a probe labeled with a detectable marker, nucleic acid molecules can be measured in a short time, and there is no need to use a primer extension reaction, so there is no need to use expensive equipment and enzymes. Also have.

FIG. 1 shows an outline of a nucleic acid detection method using a probe extension reaction. In FIG. 1, the asterisk indicates a marker. FIG. 2 shows an outline of a nucleic acid detection method using a probe labeled with a detectable marker. In FIG. 2, an asterisk indicates a marker. FIG. 3 shows the fluorescence intensity of each sample in Example 1. FIG. 4 shows the change over time in the binding rate in Reference Example 1. FIG. 5 shows the fluorescence intensity of each sample in Example 2. FIG. 6 shows the fluorescence intensity of each sample in Example 3. FIG. 7 shows the fluorescence intensity of each sample in Example 4.

(I) Nucleic Acid Detection Method Using Probe Extension Reaction In one embodiment, the present invention relates to a nucleic acid detection method using a probe extension reaction, that is, (1) a thiol-modified oligonucleotide that is specific to a target nucleic acid. Hybridizing a probe to be bound and a target nucleic acid;
(2) In the presence of deoxynucleotide triphosphate labeled with a detectable marker, a primer extension reaction is performed using the target nucleic acid as a template and the probe as a primer to obtain a primer extension product labeled with the marker. Process,
(3) A step of binding the marker-labeled primer extension product obtained in step (2) and gold magnetic fine particles,
(4) A step of recovering a conjugate of the gold magnetic fine particles obtained in step (3) and the marker-labeled primer extension product,
(5) A step of removing the gold magnetic fine particles from the conjugate obtained in step (4) to obtain a marker-labeled primer extension product, and (6) a signal derived from the marker-labeled primer extension product obtained in step (5). A method for detecting a target nucleic acid is provided. An outline of a nucleic acid detection method using a probe extension reaction is shown in FIG.

(I) -1 Hybridization Step In the method of the present invention, first, a probe comprising a thiol-modified oligonucleotide that specifically binds to a target nucleic acid is hybridized with the target nucleic acid.

  This step can be performed, for example, by adding a solution containing a probe consisting of a thiol-modified oligonucleotide and binding specifically to the target nucleic acid to a test sample solution suspected of the presence of the target nucleic acid, and mixing the solution. it can.

  The reaction temperature at which the probe and the target nucleic acid are hybridized can be appropriately set according to conditions such as the target nucleic acid, the nucleotide sequence of the probe (GC content, etc.), the buffer solution, etc., for example, 4 to 60 ° C., more preferably 20 to It is set in the range of 30 ℃. In a preferred embodiment, the reaction time is 1-60 minutes, more preferably 2-5 minutes.

  The oligonucleotide used as the probe is not particularly limited as long as it specifically binds to the target nucleic acid under the above reaction conditions. The oligonucleotide may be either DNA or RNA. Moreover, in preferable embodiment, the base number of the oligonucleotide used as a probe is 15-50 bases, Preferably, it is 15-36 bases, More preferably, it is 15-18 bases.

  The thiol-modified oligonucleotide is not particularly limited as long as it is a thiol-modified oligonucleotide. Thiol-modified oligonucleotides are known or can be prepared according to known methods.

  The probe may be added in a sufficient amount with respect to the target nucleic acid expected to be present in the test sample. For example, 1 to 50 nanomoles, preferably 1 to 10 nanomoles, with respect to 1 nanomol of the predicted target nucleic acid amount. Added nanomolar.

  In this step, after adding the probe to the sample solution, the stirring may be continued for the above time or may be allowed to stand after addition and mixing.

(I) -2 Primer Extension Step Next, in the presence of deoxynucleotide triphosphate labeled with a detectable marker, a primer extension reaction is performed using the target nucleic acid as a template and the probe as a primer.

  Examples of detectable markers include fluorescent components, radioactive markers, dyes, enzymes and substrates. In the method of the present invention, at least one of deoxynucleotide triphosphates (dATP, dCTP, dGTP, dTTP, dUTP) is labeled. Here, the type of polymerase that can be used and the reaction conditions are not particularly limited and can be appropriately selected. In this embodiment of the present invention, for example, the reaction temperature is preferably set in the range of 30 to 60 ° C., more preferably 37 to 55 ° C., and the reaction time is preferably 5 to 200 minutes, more preferably 30 Set in the range of ~ 200 minutes.

  In this embodiment, since the primer extension reaction is performed in a state in which the gold magnetic fine particles are not bound to the primer, the reaction by the polymerase is performed smoothly, so that a primer extension product labeled with a marker can be obtained by this step. it can.

  Regarding the reaction conditions (buffer solution, additives, etc.) other than those described above for the extension reaction, reaction conditions that are usually employed in this field can be appropriately employed.

(I) -3 Binding step of marker-labeled primer extension product and gold magnetic fine particles Next, the marker-labeled primer extension product obtained in the above (I) -2 and gold magnetic fine particles are bonded.

  In this step, for example, even when a test sample solution containing a primer extension labeled with a marker is added to a magnetic gold microparticle or a suspension thereof, the test sample solution containing a primer extension labeled with a marker is charged with gold. You may carry out by adding a magnetic microparticle or its suspension.

Gold magnetic fine particles used in the present invention are fine particles having a structure in which gold nanoparticles are complexed on the surface of magnetic metal oxide fine particles (γ-Fe ₂ O ₃ , Fe ₃ O _4, etc.). Or it can prepare according to a well-known method. In the method of the present invention, gold magnetic fine particles having various particle diameters can be used as appropriate. For example, those having a secondary particle diameter of 1000 nm or less, preferably 700 nm or less, Usually, those having a particle diameter of 10 nm or less, preferably 7 nm or less, and those having a primary particle size of about 5 to 500 nm, more preferably about 5 to 300 nm can be used. The secondary particle size is the cumulant average particle size obtained from the dynamic light scattering method. The cumulant average particle diameter by dynamic light scattering can be measured by, for example, Zetasizer Nano (registered trademark, manufacturer: Malvern Instruments Ltd.).

  The gold magnetic fine particles bind to the marker-labeled primer extension product due to the binding reaction between the gold particles and thiol.

  The addition amount of the gold magnetic fine particles may be a sufficient amount with respect to the probe added in the step (I) -1, and preferably 0.5 to 0.5 gold equivalent of the gold magnetic particles with respect to 1 nmole of the probe. 10 mg, more preferably 0.5 to 1 mg.

  In this embodiment of the present invention, for example, the reaction temperature is set in the range of 4 to 60 ° C., more preferably 20 to 30 ° C., and the reaction time is 5 to 120 minutes, more preferably 15 to 90 minutes. Set by range.

  The marker-labeled primer extension product obtained by the above step (I) -2 forms a duplex with the target nucleic acid as a template. In one embodiment of the present invention, A heating operation may be performed between step (I) -3 and the marker-labeled primer extension product and the target nucleic acid may be dissociated. Therefore, in the present invention, the marker-labeled primer extension product includes those in the form of a double strand with the target nucleic acid and those in a single strand. When the marker-labeled primer extension product is single-stranded, it can be expected that the binding property to the gold magnetic fine particles is increased in this step.

  Further, in the primer extension reaction of the above step (I) -3, a reducing agent such as dithiothreitol (hereinafter sometimes simply referred to as DTT) is used according to a conventional method. It has an action of dissociating the bond between magnetic fine particles and thiol. Therefore, in the method of adding a probe to which gold magnetic fine particles have been bound in advance to the test sample, even if a primer extension reaction is performed thereafter, the gold magnetic fine particles and the probe are dissociated in this step, so that the target nucleic acid is recovered. It will not be possible. However, in the case of the present invention, the target nucleic acid can be detected without causing the above problem because the binding step of the gold magnetic fine particles and the probe is performed after the extension reaction.

(I) -4 Step of recovering conjugate of gold magnetic fine particle and marker-labeled primer extension product Next, the conjugate of gold magnetic fine particle and marker-labeled primer extension product obtained in (I) -3 is recovered.

  This step is performed by collecting the gold magnetic fine particles with a magnet or the like.

  This step removes marker-labeled deoxynucleotide triphosphate that was not used in the primer extension reaction.

(I) -5 Step of Removing Gold Magnetic Fine Particles from Combined Body Next, an operation of removing the gold magnetic fine particles from the combined body obtained in the above step (I) -4 is performed.

  As an operation in this step, the gold magnetic fine particles and the target nucleic acid are removed by replacing the solution containing the conjugate of the collected gold magnetic fine particles and the marker-labeled primer extension product with an appropriate solvent (such as mercaptoethanol). An operation of eluting the marker-labeled primer extension product from the bound product is exemplified.

  In this embodiment of the present invention, for example, the reaction temperature is set in the range of 4 to 60 ° C., more preferably 20 to 30 ° C., and the reaction time is 5 to 60 minutes, more preferably 10 to 30 minutes. Set by range.

  By this step, the marker can be measured without being affected by the gold magnetic fine particles.

To (I) -6 signal measurement step Finally, measuring the signal derived from the marker-labeled primer extension product obtained by (I) -5. The said measurement can be performed by a well-known method according to the kind of signal.

  Since the marker-labeled deoxynucleotide triphosphate that was not used in the primer extension reaction in the above step (I) -4 has been removed, the signal intensity measured in this step is the amount of the marker-labeled primer extension product. Therefore, it corresponds to the amount of the target nucleic acid in the test sample. By this method, the target nucleic acid in the test sample can be quantitatively measured. In the present embodiment, it is possible to measure a low molecular weight oligonucleotide, which has been difficult to measure conventionally, and further, it is necessary to use a special primer that binds to the end of the target nucleic acid, such as a loop primer. It is possible to design the probe to bind to any part of the target nucleic acid.

(II) Nucleic acid detection method using a probe labeled with a detectable marker In another embodiment, the present invention provides a nucleic acid detection method using a probe labeled with a detectable marker, ie, (1) A step of adding and mixing a probe consisting of an oligonucleotide labeled with a thiol-modified and detectable marker, which specifically binds to a target nucleic acid, into a test sample solution;
(2) A step of adding gold magnetic fine particles to the mixed solution obtained in the step (1) to bind the probe and gold magnetic fine particles;
(3) recovering gold magnetic fine particles from the solution obtained in step (2),
(4) A step of measuring a marker-derived signal in the reaction solution after recovering the gold magnetic fine particles by the step (3),
(5) Signal [ii] obtained by performing the steps corresponding to the above (1) to (4) using the signal [i] obtained by the step (4) and the test sample solution not containing the target nucleic acid. And (6) a method of detecting a target nucleic acid when the signal [i] is higher than the signal [ii] and determining that the target nucleic acid is present. An outline of a nucleic acid detection method using a probe labeled with a detectable marker is shown in FIG.

(II) -1 Probe Addition / Mixing Step Labeled with a Detectable Marker In this embodiment, the target sample solution is first composed of an oligonucleotide labeled with a thiol-modified and detectable marker. A probe that specifically binds to nucleic acid is added and mixed.

  As the probe used in the present embodiment, a thiol-modified oligonucleotide described in the method (I) labeled with a detectable marker can be appropriately used. As the detectable marker, those described above can be used. The amount of probe added is sufficient to hybridize to the target nucleic acid, and the background is sufficiently low (the background is the number of probes remaining in the sample solution that are not hybridized to the target nucleic acid). For example, 0.01 to 2 nmol, more preferably 0.05 to 1 nmol is added to the predicted target nucleic acid amount of 1 nmol.

  The temperature in this step can be appropriately set so that the target nucleic acid and the probe hybridize depending on the conditions such as the target nucleic acid, the nucleotide sequence (GC content, etc.) of the probe, and the buffer solution, but it is preferably 4 to 60 ° C., for example. Is set in the range of 20-30 ° C.

  In this embodiment, the reaction time is 1 to 30 minutes, preferably 2 to 15 minutes, more preferably 2 to 5 minutes. It is preferable to set the reaction time in the above range because qualitative measurement of the target nucleic acid can be performed in a short time.

  When the target nucleic acid is present in the test sample solution, the target nucleic acid and the probe are hybridized by this step. In this step, after adding the probe to the sample solution, the stirring may be continued for the above time or may be allowed to stand after addition and mixing.

(II) -2 Step of adding gold magnetic fine particles Next, gold magnetic fine particles are added to the mixed liquid obtained in the step (II) -1.

  In this step, not only the step of adding gold magnetic fine particles or suspension thereof to the mixed liquid obtained in step (II) -1, but also step (II) -1 to gold magnetic fine particles or suspension thereof. A step of adding the obtained mixed liquid is also included.

  The addition amount of the gold magnetic fine particles may be a sufficient amount with respect to the probe added in the step (II) -1, and is preferably 0.15 to 1 mol of the gold magnetic particles with respect to 1 mol of the probe. 10 mg, preferably 0.15-1.5 mg.

  The reaction temperature is set, for example, in the range of 4 to 40 ° C, more preferably 20 to 30 ° C. The reaction time is preferably set in the range of 2 to 30 minutes, more preferably 2 to 15 minutes, and still more preferably 2 to 5 minutes.

  By setting the reaction time within the above range, the presence or absence of the target nucleic acid in the sample can be determined in a short time.

  In this step, the gold magnetic fine particle binds to the probe due to the binding reaction between the gold particle and thiol, but the target nucleic acid is sterically hindered for the probe hybridized to the target nucleic acid. Therefore, the binding is suppressed.

(II) -3 Step for recovering gold magnetic fine particles Next, gold magnetic fine particles are recovered from the solution obtained in step (II) -2. This step is performed by collecting the gold magnetic fine particles with a magnet or the like.

(II) -4 Marker-Derived Signal Measurement Step Next, a step of measuring a marker-derived signal in the reaction solution after collecting the gold magnetic fine particles in step (II) -3 is performed. The said measurement can be performed by a well-known method according to the kind of signal.

  As described above, when the target nucleic acid is not present in the test sample, it binds to the gold magnetic particles at a higher rate than when the target nucleic acid is present. Therefore, the amount of the probe remaining in the solution after collecting the gold magnetic fine particles is smaller than that in the case where the target nucleic acid is present, and thus the signal intensity is weakened.

(II) -5 Signal comparison step Finally, the signal [i] obtained by the step (II) -4 and a test sample solution not containing the target nucleic acid are used to correspond to the steps (II) -1 to 4 The signal [ii] obtained by performing the step is compared. Then, when the signal [i] is higher than the signal [ii], it is determined that the target nucleic acid is present.

  The standard of the signal intensity difference for determining the presence or absence of the target nucleic acid can be appropriately set in consideration of the difference in the number of bases between the target nucleic acid and the probe, the position where the probe binds to the target nucleic acid, and the like. The method of the present invention includes not only a method of performing the steps corresponding to the steps (II) -1 to 4 using the test sample solution not containing the target nucleic acid after performing the steps (II) -1 to 4. The reference value is set in advance by performing the steps corresponding to steps (II) -1 to 4, and when the signal intensity when the test sample is used exceeds the reference value, the target nucleic acid is Also included is a method of determining that it exists.

  According to the method according to the present embodiment, the target nucleic acid can be detected more easily in a shorter time than in the past. In addition to the short reaction time, the method does not require a PCR reaction or even a primer extension reaction, and thus has an advantage that the measurement can be performed more easily.

  Hereinafter, examples will be described in order to describe the present invention in more detail, but the present invention is not limited to the examples.

Example 1 Nucleic acid detection using probe extension reaction First, use nuclease free water to prepare the following solutions in tubes (5 μl each) (preparing 2 bottles) and heating at 70 ° C for 5 minutes Chilled on ice.

(I) Solution containing 0.1 nmol / μl each of probe and target RNA (ii) Solution containing 0.1 nmol / μl each of non-probe and target RNA (iii) Solution containing 0.1 nmol / μl target RNA The sequence of the nucleic acid is as follows.
probe
5'-SH-GATCGTCGTCCGGTCAAT-3 '(SEQ ID NO: 1)
Non-probe
5'-SH-CCGGTTGCTCTGAGACAT-3 '(SEQ ID NO: 2)
Target RNA
5'- AUAAUUCACUUCAACCACAUUGACCGGACGACGAUC-3 '(SEQ ID NO: 3).

Next, 3 µl of 5x buffer attached to reverse transcriptase SuperScriptIII (Invitrogen), 1.5 µl of 0.1 M DTT, and 1 µl of dNTPs mix (7.5 mM dATP, 7.5 mM dCTP, 7.5 mM dGTP, 1.5 mM dTTP) are added to each tube. Then, 0.5 μl of 40 U / μl RNase Inhibitor (TAKARA) and 3 μl of fluorescent substrate 1 mM Alexa 555 aha d-UTP (Invitrogen) were added. Add 1 μl of nuclease free water to one of the two (i), add 1 μl of 200 U / μl SuperScript III to the remaining one of (i) and (ii), (iii), to a total of 15 μl. It was prepared so that it might become. These tubes were heated using a heat block GENE Engine (BIO RAD) for 5 minutes at 25 ° C (hybridization step), then 3 hours at 46 ° C (primer extension step), and 5 minutes at 95 ° C (inactivation of the enzyme). Reaction) and immediately cooled on ice.

Next, each solution was transferred to an Eppendorf tube and diluted to 1000 μl using a reaction buffer (0.5 M NaCl, 10 mM sodium phosphate buffer (pH 7.0)). Then, 100 μl of gold magnetic particles (prepared to 5 mg / ml as Fe ₃ O ₄ concentration) were washed in advance with sterilized water and magnetically separated (standing for about 1 minute in the presence of a magnet) to remove the supernatant. Then, 300 μl of each of the previously diluted solutions was added, and the gold magnetic particles and the extended probe were bound for 1 hour at room temperature while mixing with a rotary shaker. Thereafter, the complex of the gold magnetic particles and the extended probe was magnetically separated, and the supernatant was removed. Furthermore, the gold magnetic particles to which the elongated probe recovered by the magnetic separation is bound are suspended in 300 μl of 10 mM sodium phosphate buffer, and after the magnetic separation, the supernatant is removed twice to perform the gold magnetic particles. The non-specific adsorbate etc. were removed. Then, after suspending in 300 μl of 20 mM mercaptoethanol, the extended probe was eluted for 15 minutes at room temperature while mixing with a rotary shaker. Then, the gold magnetic particles were removed by magnetic separation, 250 μl of the supernatant was separated into a 96-well plate, and the amount of fluorescence was measured using a fluorescence plate reader Gemini XPS (Molecular Devices).

  The results are shown in FIG. Almost no fluorescence was detected without the enzyme and the probe. Similarly, no fluorescence was detected when a non-specific sequence that did not bind to the target was used for the probe. Only when a probe having a specific sequence capable of binding to a target was used, a fluorescent substrate was incorporated into the probe by an enzyme reaction, and fluorescence could be detected.

Reference Example 1 Comparison of ease of binding of single-stranded DNA and double-stranded DNA to gold magnetic particles
18-mer oligonucleotide DNA (hereinafter referred to as “Capture and Detection (CD) -probe”) whose 5 ′ end is modified with thiol and whose 3 ′ end is modified with a fluorescent molecule N- (3-Fluoranthyl) maleimide (hereinafter referred to as FAM) ) And the double-stranded DNA to which the complementary strand was bound, and the time and amount of binding of the 50-mer DNA containing the complementary strand sequence and the double-stranded DNA to which the CD-probe was bound were bound to the gold magnetic particles. . The oligonucleotide sequences used are as follows.
CD-probe
5'-SH-CCGGTTGCTCTGAGACAT-FAM-3 '(SEQ ID NO: 4)
18mer target
5'- ATGTCTCAGAGCAACCGG -3 '(SEQ ID NO: 5)
50mer target
5'-CATCCCTATTATAAAAATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACT -3 '(SEQ ID NO: 6)
Non-target
5'- AGTCAACCACCAGCTCCCGGTTGCTCTGAGACATTTTTATAATAGGGATG -3 '(SEQ ID NO: 7)
First, the CD-probe and each target were prepared by diluting in a reaction buffer (0.5 M NaCl, 10 mM phosphate buffer) to 10 μM. Each target solution was heated at 70 ° C. for 5 minutes and then rapidly cooled on ice. A CD-probe and each target solution were mixed and diluted with a reaction buffer to prepare as follows.

(1) CD-probe and 18-mer target in 333 nM solution (2) CD-probe and 50-mer target in 333 nM solution (3) CD-probe and 50-mer non-target in 333 nM each (4) A CD-probe solution of 333 nM.

After preparation, the mixture was mixed for 5 minutes at room temperature using a rotary shaker. During this time, 100 μl of gold magnetic particles (prepared to 5 mg / ml as Fe ₃ O ₄ concentration) were washed with sterilized water and magnetically separated (standing for about 1 minute in the presence of a magnet) to remove the supernatant. Then, 300 μl of each of the previous reaction solutions was added and mixed. Thereafter, the gold magnetic particles and the CD-probe were bound for 2 minutes, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes and 60 minutes at room temperature. Then, after magnetic separation of the gold magnetic particles to which the CD-probe was bound, the supernatant was collected and the supernatant was measured for fluorescence. Further, the value obtained was subtracted from the fluorescence amount of the solution before binding to determine the fluorescence amount bound to the particles. The binding rate of the CD-probe bound to the gold magnetic particles was determined from the ratio of the bound fluorescence amount and the fluorescence amount before binding according to the following formula.

Binding rate (%) = (fluorescence before binding−fluorescence after binding) / fluorescence before binding × 100
The amount of fluorescence was measured using a fluorescence plate reader Gemini XPS (Molecular Devices) by separating 250 μl from the sample solution into a 96-well plate.

  The results are shown in FIG. In the absence of target, the CD-probe bound to approximately 90% or more of the particles after 5 minutes. Similarly, since a target having no homology with the probe did not hybridize with the CD-probe, binding to nearly 90% of the particles was observed after 5 minutes. On the other hand, in the 18-mer target, about 80% in 5 minutes, which is slightly lower than that in the single-stranded case, but after 15 minutes, the binding rate was almost the same as that in the single-stranded case. In addition, in the case of the 50 mer target, the binding rate dropped to about 50% after 5 minutes, and even after 15 minutes, a difference was seen compared to 70%, which was 70%. And after 60 minutes, it became clear that 90% or more of the particles could be bound. This revealed that the longer the target sequence to be detected, the longer it takes to bind to the particles.

Example 2 Nucleic Acid Detection Utilizing Difference in Affinity with Gold Magnetic Particles Depending on the Presence or absence of Binding of Probe and Target Nucleic Acid
Using the 18-mer single-stranded oligonucleotide DNA (hereinafter referred to as CD-probe) modified with thiol modification at the 5 'end and the fluorescent molecule FAM at the 3' end and gold magnetic particles, the target nucleic acid (specifically Attempted to detect (target). The sequence of each synthetic nucleic acid is as follows.
CD-probe
5'-SH-CCGGTTGCTCTGAGACAT-FAM-3 '(SEQ ID NO: 8)
target
5'-CATCCCTATTATAAAAATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACT-3 '(SEQ ID NO: 9)
Non-target
5'- AGTCAACCACCAGCTCCCGGTTGCTCTGAGACATTTTTATAATAGGGATG -3 '(SEQ ID NO: 10)
First, a CD-probe, target, or non-target was dissolved in a reaction buffer (0.5 M NaCl, 10 mM sodium phosphate buffer (pH 7.0)) to prepare 10 μM. Among these, the target and non-target solutions were heated at 70 ° C. for 5 minutes and then rapidly cooled on ice. A CD-probe solution and a target or non-target solution were mixed and diluted with reaction buffer to prepare as follows:
(A) CD-probe and target solution of 333 nM each (B) CD-probe and non-target solution of 333 nM each (C) CD-probe solution of 333 nM

After preparation, the mixture was mixed for 5 minutes at room temperature using a rotary shaker. On the other hand, 100 μl of gold magnetic particles (prepared to 5 mg / ml as Fe ₃ O ₄ concentration) were washed in advance with sterilized water and magnetically separated (standing for about 1 minute in the presence of a magnet) to remove the supernatant. Then, 300 μl of each of the previous reaction solutions was added and mixed. While mixing with a rotary shaker, the gold magnetic particles and the CD-probe were bound for 5 minutes at room temperature. Thereafter, the conjugate of the gold magnetic particles and the CD-probe was magnetically separated, 250 μl of the supernatant was dispensed into a 96-well plate, and the amount of fluorescence was measured using a fluorescence plate reader Gemini XPS (Molecular Devices).

  The results are shown in FIG. When a target having a sequence specific to the CD-probe was used, it became difficult to bind to the particles, and much fluorescence remained in the supernatant. However, when a target without a specific sequence was used, the CD-probe bound to the particles quickly, and the amount of fluorescence decreased, as in the case without the target.

Example 3 Nucleic Acid Detection Using Probe Extension Reaction from Nucleic Acid Mixture Examination of whether nucleic acid detection using probe extension reaction is possible when probe-specific target microRNA and its random sequence are mixed as non-target did.

The synthetic nucleic acid sequences used are as follows.
probe
5'-SH-TCAACATCAGTCTGATAA-3 '(SEQ ID NO: 11)
Target micro RNA (miR-21)
5 '-UAGCUUAUCAGACUGAUGUUGA -3' (SEQ ID NO: 12)
Non-targeted micro RNA (mir-21 Random)
5'- UAGCAUCAUGUGGAUUUAGUAC -3 '(SEQ ID NO: 13)
First, a nucleic acid mixture (total volume 5.5 μl) was prepared by adding 0 to 0.5 nmol of target microRNA in a tube containing 0.5 nmol of non-target microRNA. Next, 0.5 nmol (0.5 μl) of the probe was added, heated at 70 ° C. for 5 minutes, and then rapidly cooled on ice.

  In each tube, 3 µl of 5x buffer attached to reverse transcriptase SuperScriptIII (Invitrogen), 1.5 µl of 0.1 M DTT, 1 µl of dNTPs mix (7.5 mM dATP, 7.5 mM dCTP, 7.5 mM dGTP), 40 U / µl RNase 0.5 μl of Inhibitor (TAKARA), 2 μl of fluorescent substrate 1 mM Alexa 555 ahad-UTP (Invitrogen) and 1 μl of 200 U / μl SuperScript III were added to prepare a total of 15 μl. These tubes were heated using a heat block DNA Engine (BIO RAD) for 5 minutes at 25 ° C (hybridization step), then 3 hours at 46 ° C (primer extension step), and 5 minutes at 95 ° C (inactivation of the enzyme). Reaction) and immediately cooled on ice.

Next, the reaction buffer (0.5 M NaCl, 10 mM sodium phosphate buffer (pH 7.0)) was used to dilute to 1000 μl. Then, 100 μl of gold magnetic particles (prepared to 5 mg / ml as Fe ₃ O ₄ concentration) were washed with sterilized water, magnetically separated (standing for about 1 minute in the presence of a magnet), and the supernatant was removed. Then, 300 μl of each of the previously diluted solutions was added, and the gold magnetic particles and the elongated probe were bound to each other for 1 hour at room temperature while mixing with a rotary shaker. Thereafter, the conjugate of the gold magnetic particles and the extended probe was magnetically separated, and the supernatant was removed. Furthermore, the gold magnetic particles to which the elongated probe recovered by the magnetic separation is bound are suspended in 300 μl of 10 mM sodium phosphate buffer, and after the magnetic separation, the supernatant is removed twice to perform the gold magnetic particles. The non-specific adsorbate etc. were removed. Then, after suspending in 300 μl of 20 mM mercaptoethanol, the extended probe was eluted for 15 minutes at room temperature while mixing with a rotary shaker. Then, the gold magnetic particles were removed by magnetic separation, 250 μl of the supernatant was separated into a 96-well plate, and the amount of fluorescence was measured using a fluorescence plate reader Gemini XPS (Molecular Devices).

  The results are shown in FIG. In the absence of the target microRNA, almost no fluorescence was observed, but in the presence of the target, the fluorescence could be detected. Increasing the target amount increased the fluorescence uptake.

Example 4 Nucleic acid detection using difference in affinity with gold magnetic particles from nucleic acid mixture
Specific target from nucleic acid mixture using 18mer single stranded oligonucleotide DNA (hereinafter referred to as CD-probe) modified with thiol modification at 5 'end and fluorescent molecule FAM at 3' end and gold magnetic particles An attempt was made to detect the nucleic acid (target). The synthetic nucleic acid sequences used are as follows.
CD-probe
5'SH-CCGGTTGCTCTGAGACAT -FAM3 '(SEQ ID NO: 8)
target
5'-CATCCCTATTATAAAAATGTCTCAGAGCAACCGGGAGCTGGTGGTTGACT-3 '(SEQ ID NO: 9)
Non-target
5'-CATATTACCACAATTAATTGACCGGACGACGATCTATGGTGGTGACTGCG-3 '(SEQ ID NO: 14)
First, a CD-probe, target, or non-target was dissolved in a reaction buffer (0.5 M NaCl, 10 mM sodium phosphate buffer (pH 7.0)) to prepare 10 pmol / μl. Among these, the target and non-target solutions were heated at 70 ° C. for 5 minutes and then rapidly cooled on ice. Next, 0-20 μl of 10 pmol / μl target was added to a tube containing 10 μmol / μl non-target 20 μl, and the total volume was adjusted to 580 μl with reaction buffer. 20 μl of 10 pmol / μl CD-probe was added to this solution and mixed for 5 minutes at room temperature using a rotary shaker.
During this time, 100 μl of gold magnetic particles (prepared to 5 mg / ml as Fe ₃ O ₄ concentration) were washed with sterilized water and magnetically separated (standing for about 1 minute in the presence of a magnet) to remove the supernatant. . 300 μl of the above reaction solution was added to each of these particles, and the gold magnetic particles and the CD-probe were reacted at room temperature for 5 minutes while mixing with a rotary shaker. Thereafter, the conjugate of the gold magnetic particles and the CD-probe was magnetically separated, 250 μl of the supernatant was dispensed into a 96-well plate, and the amount of fluorescence was measured using a fluorescence plate reader Gemini XPS (Molecular Devices).

  The results are shown in FIG. As the amount of the target increased, the amount of fluorescence increased and the amount of fluorescence increased depending on the amount of target.

  Since the method of the present invention can easily measure a nucleic acid molecule having a lower molecular weight than that which can be measured conventionally, it can be used for water quality inspection, food inspection, medical field (samples such as blood and body fluid collected from a subject). And the like can be used widely. In particular, in the method (II), the measurement can be performed in a shorter time, and it is not necessary to perform a primer extension reaction. Therefore, the method can be used for an inspection outdoors.

  SEQ ID NO: 1 is a probe.

  SEQ ID NO: 2 is a comparative probe that is not complementary to the target.

  SEQ ID NO: 3 is the target.

  SEQ ID NO: 4 is a probe.

  Sequence number 5 is a target.

  Sequence number 6 is a target.

  SEQ ID NO: 7 is a comparative target that is not complementary to the probe.

  SEQ ID NO: 8 is a probe.

  SEQ ID NO: 9 is the target.

  SEQ ID NO: 10 is a comparative target that is not complementary to the probe.

  SEQ ID NO: 11 is a probe.

  Sequence number 12 is a target.

  SEQ ID NO: 13 is a comparative target that is not complementary to the probe.

  SEQ ID NO: 14 is a comparative target that is not complementary to the probe.

Claims (4)

(1) a step of hybridizing a target nucleic acid with a probe comprising a thiol-modified oligonucleotide that specifically binds to the target nucleic acid;
(2) In the presence of deoxynucleotide triphosphate labeled with a detectable marker, a primer extension reaction is performed using the target nucleic acid as a template and the probe as a primer to obtain a primer extension product labeled with the marker. Process,
(3) A step of binding the marker-labeled primer extension product obtained in step (2) and gold magnetic fine particles,
(4) A step of recovering a conjugate of the gold magnetic fine particles obtained in step (3) and the marker-labeled primer extension product,
(5) A step of removing the gold magnetic fine particles from the conjugate obtained in step (4) to obtain a marker-labeled primer extension product, and (6) a signal derived from the marker-labeled primer extension product obtained in step (5). A method for detecting a target nucleic acid, comprising the step of measuring (1) A step of adding and mixing a probe consisting of an oligonucleotide labeled with a thiol-modified and detectable marker and specifically binding to a target nucleic acid to a test sample solution,
(2) A step of adding gold magnetic fine particles to the mixed solution obtained in the step (1) to bind the probe and gold magnetic fine particles;
(3) recovering gold magnetic fine particles from the solution obtained in step (2),
(4) A step of measuring a marker-derived signal in the reaction solution after recovering the gold magnetic fine particles by the step (3),
(5) Signal [ii] obtained by performing the steps corresponding to the above (1) to (4) using the signal [i] obtained by the step (4) and the test sample solution not containing the target nucleic acid. And (6) a method for detecting the target nucleic acid when the signal [i] is higher than the signal [ii] and determining that the target nucleic acid is present.   The method according to claim 2, wherein the reaction time in the step (2) is 2 to 30 minutes.   The method according to claim 1, wherein the marker is a fluorescent component.

Images