JP2010124803A - Method for selecting target gene of antifungal agent and estimating function thereof - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for searching a new target gene for developing a new antifungal agent and a method for estimating the functions of the target gene. <P>SOLUTION: The method for searching the target gene of antifungal agent includes (1) a process for selecting a candidate gene of the target gene, (2) a process for selecting a gene specifically induced by administration of standard enzyme-based inhibitor as the candidate gene of a reporter gene, (3) a process for constructing a vector to which a promoter of the candidate gene and a marker gene are introduced, (4) a process for preparing a transformant to which the vector is introduced, (5) a process for introducing a deletion destruction or conditional destruction to the transformant, and (6) a process for selecting the target gene of antifungal agent by using difference in growth between the strain before and after the deletion destruction or conditional destruction as an index or (6) a process for estimating the function of the target gene of antifungal agent on the basis of difference in amount of expression of the marker gene between the strain before and after the deletion destruction or conditional destruction. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

The present invention relates to a method for searching for a target gene for developing an inhibitory active substance against fungi, more preferably an infectious fungus to plants or animals, and a method for estimating the function of the searched target gene.

In recent years, eukaryotic fungi (molds) that infect plants and animals including humans have become a major threat. For example, the incidence of mycosis is increasing as a result of an increase in the number of patients with weakness of immunodeficiency, such as patients with acquired immune deficiency syndrome or receiving immunosuppressive treatment. There are currently few antifungal agents, such as amphotericin B and flucytosine, or the azole derivative fluconazole, especially for deep mycoses caused by infection with Candida albicans and Aspergillus fumigatus There are only antifungal agents such as and itraconazole.

Plant-infecting fungi also include leaf lesions (Septoria tritici), scab lesions (Septoria nodorum), various wheat rust diseases (Puccinia recondita, Puccinia graminis), powdery mildew (various species) and stem / rhizome ( stem / stock) wheat fungal pathogens that cause rot (Fusarium spp.). Examples of other particularly harmful plant pathogens include Phytophthora infestans, the causative agent of potato famine, Ophiostoma ulmi, which causes Dutch elm disease, Ustilago maydis, which causes maize smut, and Magnaporthe grisea, which causes rice blast Can be mentioned.

Because fungi are eukaryotes and have similar cellular systems to higher eukaryotes such as higher plants and animals, the species of drugs that are selectively toxic to fungi are limited. In addition, with the emergence of resistant bacteria to known antifungal agents, the demand for development of new antifungal agents is high.

Recent studies on fungal homologous recombination technology have revealed that genes such as ku70, ku80, and ligD are related to non-homologous genetic recombination (see Patent Documents 1 and 2 and Non-Patent Documents 1, 2, and 3). ). Although fungi that have disrupted these genes show the same expression system and growth as the wild type, the frequency of non-homologous recombination is reduced compared to the wild type, and only the target gene, which has been difficult in the past, is efficiently used. Can be destroyed specifically.
To date, we have found genes that have impaired growth in Candida albicans and Aspergillus fumigatus as target genes for antifungal agents, and have found antifungal agents that become more effective as a result of their destruction. A method for estimating the function of a target gene based on the action mechanism of the agent has already been reported (see Patent Document 3 and Non-Patent Document 4).
However, in this method, the function of the gene is estimated based on an increase in the efficacy of the antifungal agent against the microorganism after destruction of the target gene, but in the implementation, the fungus body ( The subsequent growth may be greatly affected by the amount of cells and the storage period of the cells at the time of planting, and as a result, the experimental error is large and there is a problem in reproducibility and accuracy. It is done.
In addition, as a technique using a reporter in a fungus, a reporter that can show an influence on the MAP kinase pathway is constructed and introduced into the fungus, and an antifungal agent that may act on the MAP kinase pathway is introduced into the fungus. A method for screening an antifungal agent (antifungal agent) acting on the MAP kinase pathway by administering a candidate substance and observing the reporter response has been filed (see Patent Document 4).
Patent No. 4050712 JP 2007-300857 JP Special Table 2005-522980 JP 2006-280372 A Ishibashi et al., Proc. Natl. Acad. Sci. USA 103: 14871-14876. 2006 Takahashi et al., Mol. Gen. Genomics 275: 460-470. 2006 Mizutani et al., Fungal Genet. Biol. 45: 878-889. 2008 Hu et al., PLoS Pathog. 3: e42. 2007

As is apparent from the above, development of a new and useful antifungal agent is currently awaited, but it has not yet been met. In other words, in the development of antifungal agents, it is possible to synthesize a drug by clarifying the target gene, but a simple evaluation system for finding a drug for it from the discovery of the target gene is Not established. Currently, it is common to select a drug library consisting of a large number of compound groups, and it is necessary to develop a system that can evaluate a large number of drugs in a small amount at high speed and high efficiency. there were.
An object of the present invention is to provide a means for easily and efficiently finding an optimal gene as a target for an antifungal agent and to provide a means for estimating the function of a found target gene important for the development of an antifungal agent. It is in.

As a result of intensive studies, the present inventors searched for the gene candidates based on specific selection criteria. In addition, a gene whose expression is induced by a reference enzyme system inhibitor administered at a concentration that does not cause lethality but does not cause lethality, that is, when the reference enzyme system of the fungus is partially inhibited Find genes that are specifically induced in expression or fungal genes that are predicted to function in the reference enzyme system by homology analysis with genes from other organisms using specific selection criteria, and report the found genes to reporters A new reporter detection system was constructed by linking a marker gene to the promoter as a gene candidate gene. Then, after introducing the reporter detection system into a fungus, a deletion-disrupted strain or a conditional-disrupted strain of a candidate gene considered to be important for the growth of the fungus is prepared. The target gene of the antifungal agent was found by culturing it in a medium containing a reference enzyme inhibitor at a concentration that allows it to grow at a high concentration, and comparing the growth with a strain prior to deletion disruption or condition disruption cultured under the same conditions. It was convinced that the function of a target gene could be estimated by obtaining and comparing the expression of this marker gene, and came to complete this invention.

That is, the present invention is as follows.
(1) A method for selecting a target gene of an antifungal agent, comprising at least the following steps 1) to 6):
1) a step of selecting candidate genes for the target gene;
2) A step of administering a reference enzyme system inhibitor at a concentration that does not cause lethality to the fungus but does not cause lethality, thereby selecting a fungal gene whose expression is induced as a reporter gene candidate gene;
3) collecting a promoter of a candidate gene for the reporter gene and constructing a vector into which the promoter and a marker gene operably linked thereto are introduced;
4) introducing the vector into a fungus to produce a transformant;
5) a step of introducing deletion disruption or conditional disruption into the candidate gene of the target gene of the transformant; and 6) the obtained deletion disruption strain or conditional disruption strain, As a condition for suppressing the expression of a candidate gene, a culture with a complete medium or a minimal medium or a medium containing a reference enzyme inhibitor at a concentration capable of growing in them, A step of selecting a target gene of an antifungal agent by comparing the growth.
(2) A method for estimating the function of a target gene of an antifungal agent, comprising at least the following steps 1) to 6):
1) selecting a candidate gene for the target gene;
2) A step of administering a reference enzyme system inhibitor at a concentration that does not cause lethality to the fungus but does not cause lethality, thereby selecting a fungal gene whose expression is induced as a reporter gene candidate gene;
3) collecting a promoter of a candidate gene for the reporter gene and constructing a vector into which the promoter and a marker gene operably linked thereto are introduced;
4) introducing the vector into a fungus to produce a transformant;
5) a step of introducing deletion disruption or conditional disruption into the candidate gene of the target gene of the transformant; and 6) the obtained deletion disruption strain or conditional disruption strain, As a condition for suppressing the expression of a candidate gene, a culture with a complete medium or a minimal medium or a medium containing a reference enzyme inhibitor at a concentration capable of growing in them, A step of estimating the function of the target gene of the antifungal agent by comparing the expression level of the marker gene.
(3) The method according to (1) or (2) above, wherein the candidate gene of the target gene is a gene important for the growth of the fungus.
(4) The gene important for growth is a gene corresponding to at least one of the following a) to e), which is a lethal gene or a growth disorder gene for the fungus, The method according to any one of (1) to (3):
a) an ortholog of a gene that has a lethal effect by deletion disruption in a related fungus or a lethal effect by growth conditions, and in which no extra homolog exists in the genome of the fungus;
b) a gene specifically induced by the addition of an existing antifungal agent to the fungus;
c) Orthologs of genes that are lethal by deletional disruption in related fungi, including Aspergillus oryzae, Aspergillus niger, Magnaporthe grisea, Fusarium graminearum ) Is an ortholog that is common to filamentous fungi whose genome has been decoded, and human (Homo sapiens) and plants (Arabidopsis thaliana) have no ortholog;
d) a gene that is highly expressed in solid culture of the fungus;
e) a gene in which an ortholog of a related fungus gives a lethal effect by deletion disruption; and f) its function is predicted by homology search, etc., and the result shows that the fungus has a lethal or growth disorder effect by deletion disruption. The gene that is expected to be given.
(5) The above (1), wherein the marker gene is selected from the group consisting of a β-glucuronidase gene, a β-galactosidase gene, a luciferase gene, a green or red fluorescent protein gene, a drug resistance gene, and an auxotrophic gene. The method in any one of-(4).
(6) The promoter according to any one of (1) to (5) above, wherein the promoter consists of at least part of the base sequence from the translation initiation codon of each candidate gene of the target gene and reporter gene to 1 kb upstream. The method of crab.
(7) The conditional disruption is characterized by replacing the promoter of the candidate gene of the target gene with a promoter capable of controlling expression under specific culture conditions such as thiA promoter, alcA promoter, tetA promoter, or niiA promoter. The method according to any one of (1) to (6) above.
(8) The reference enzyme system inhibitor is one selected from drugs that inhibit energy metabolism, cell wall formation, and cytoskeleton formation, according to any one of (1) to (7) above, Method.
(9) The expression level of the marker gene is measured by measuring the amount of protein encoded by the marker gene, the amount of mRNA, or the fluorescence intensity, according to any one of (1) to (8) above the method of.
(10) A vector used in the method according to any one of (1) to (9) above, wherein a reporter gene candidate gene or a promoter of a selected reporter gene and a marker gene are introduced downstream thereof vector.
(11) A transformant, wherein the vector according to (10) is introduced into a fungus.
(12) a promoter of a fungal gene (reporter gene) whose expression is induced by a reference enzyme system inhibitor administered at a concentration that impairs the growth of the fungus but does not cause lethality, or a gene of another organism Promoter of a fungal gene (reporter gene) predicted to function in a reference enzyme system by homology analysis.

Unlike the conventional technology, the present invention simultaneously searches for a target gene of an antifungal agent and estimates its function using a reporter detection system specific to gene disruption and each function, and indicates the response of the reporter detection system as an index. It is characterized by that. As a result, rather than comparing the difference in growth due to the difference in efficacy of antifungal agents, the function of the target gene is estimated by looking at the color development and fluorescence of the cells, resulting in more accurate and reproducible results. can get.
The present invention makes it possible to screen genes important for growth related to energy metabolism, cell wall formation, and cytoskeleton formation in fungi, that is, genes that are targets of antifungal agents. Furthermore, the use of a reporter detection system makes it possible to estimate the function of a gene targeted by an antifungal agent from the expression level of the marker gene, and the present invention greatly contributes to the development of a useful antifungal agent. .

In the present invention, a method for selecting a gene that is a target of a fungal agent includes at least the following steps 1) to 6).
1) a step of selecting a candidate gene of a target gene, 2) a gene specifically induced by administration of a reference enzyme system inhibitor, or a gene predicted to function in a reference enzyme system by homology analysis, as a reporter gene candidate A step of selecting as a gene, 3) a step of constructing a vector into which the promoter and marker gene of the candidate gene are introduced, 4) a step of producing a transformant by introducing the vector, and 5) a deletion in the transformant. A step of introducing disruption or conditional disruption, 6) a step of selecting a target gene of an antifungal agent using as an index the difference in growth from a strain prior to deletion disruption or conditional disruption.
In addition, the present invention includes a method for estimating the function of a target gene of an antifungal agent, which includes the same steps as in 1) to 5) above and 6) a strain before deletion or conditional destruction. A step of estimating the function of the target gene of the antifungal agent based on the difference in the expression level of the marker gene.
When a reporter gene promoter that has already been identified is used, the step 2) of selecting a reporter gene candidate gene is unnecessary in the method of the present invention.
Hereinafter, these steps will be described in the order of steps.

[Step 1: Selection of Target Gene Candidate Genes]
This step is a step of selecting a candidate gene (hereinafter referred to as “candidate gene”) in order to select a target gene for the antifungal agent to be developed.
Candidate genes can be selected by any standard / method known to those skilled in the art, but should be selected from genes of fungi, particularly infectious fungi, which are judged to be important for the growth of the fungus. Is preferred.
Examples of infectious fungi include infectious fungi such as yeast and eukaryotic filamentous fungi. Examples of yeast include genus Candida that causes candidiasis in humans. Examples of eukaryotic filamentous fungi include Aspergillus. Aspergillus genus, Penicillium genus, Trichoderma genus, Rhizopus genus, Mucor genus, Humicola genus, Magnaporthe genus causing rice blast, Metarhizium ), Neurospora genus, Monascus genus, Acremonium genus, Fusarium genus causing stem / stock rot of wheat, causing gray mold disease in plants Mention may be made of the genus Botrytis and the genus Ustilago which causes corn smut. The genus Aspergillus includes Aspergillus oryzae, Aspergillus sojae, Aspergillus nidulans, Aspergillus niger, Aspergillus niger, Aspergillus sperm Examples include Aspergillus kawachii and Aspergillus fumigatus that cause aspergillosis in humans.

Genes important for the growth of the fungus can be candidates for target genes for developing antifungal agents against the fungus and possibly other fungi. A gene important for the growth of this fungus is selected by searching for an indicator that causes growth inhibition or growth disorder by gene deletion disruption or conditional disruption by any method known to those skilled in the art.
The gene considered to be important for the growth of the fungus can be selected, for example, by conducting the above experiment for the following genes a to f. That is, as a representative example of a gene important for the growth of the fungus, a lethal gene or a growth damage gene for the fungus can be mentioned.
a) Genes that are orthologous to a related fungus that are lethal by deletion disruption or that are lethal by growth conditions, and that have no extra homologue on the genome of the fungus b) Genes specifically induced by the addition of fungal agents c) Orthologues of genes that are lethal by deletion disruption in related fungi, including Aspergillus oryzae, Aspergillus niger, Magnaporce Orthologs are common to filamentous fungi whose genomes have been decoded, such as Magnaporthe grisea and Fusarium graminearum, and genes without orthologs in humans (Homo sapiens) and plants (Arabidopsis thaliana) Genes that are highly expressed in solid culture of the fungi e) orthologs of related fungi Function, etc. Gene f) homology search that gives the effect of death is expected, genes expected to provide the effect of the lethal or growth disorder by deletion destroyed in the fungus from the result

  The gene of a) is an ortholog of a gene that is lethal or has a lethal influence on growth conditions in a related fungus, and is likely to be important for the growth of the fungus. Since there is no gene, it is selected because it is predicted that there is a high possibility that fungal growth will be inhibited if its function is suppressed by targeting the gene. The gene of b) is presumed to be a gene that is induced to escape from the effects of fungal degradation and excretion when a drug is added, and if the function of this induced gene is suppressed, Bacteria are selected because they are thought to be potentially lethal without being escaped from the drug. The gene of c) is an ortholog of a gene that is lethal in closely related fungi or has a lethal effect on growth conditions, and is likely to be important for fungal growth, while orthologs exist in multiple fungi Since there is no ortholog in humans and plants, it is considered to be a target for the development of a broad spectrum antifungal agent specific to fungi. As for the gene of d), since fungal infection occurs on the mucosal surface of animals and solid surfaces such as plant leaves, stems and roots, genes that are highly expressed and induced by growth on solid surfaces are necessary for infection. It is speculated that it is possible to develop an antifungal agent that can prevent infection by suppressing its function. Since the deletion of orthologs of closely related fungi gives a lethal effect, the gene of e) is also considered to be important for the growth of the lethality that is likely to be lethal due to the deletion. Is done. The gene of f) is selected because it is presumed to be important for the growth of the fungus from the result of function prediction based on the sequence information.

If the fungus basically grows multinucleated, in the gene deletion disruption experiment in the fungus, if the deletion strain is obtained as a homokaryon and the growth is similar to the wild strain, It is considered as a gene that does not affect it, that is, it is not important for growth. On the other hand, the deletion strain was obtained as a homokaryon, but at least one of a decrease in growth rate, a change in cell morphology, and an increase in drug sensitivity occurred, and the growth was significantly reduced compared to the wild strain. In some cases, the deleted gene is considered to be a growth-disrupting gene that is not lethal due to deletion but causes growth failure. If the deletion strain cannot be obtained as a homokaryon, that is, it can only be obtained as a heterokaryon, or cannot be obtained as a heterokaryon, the deletion gene may be a lethal gene that has a lethal effect due to the deletion. I think it is expensive. Therefore, it is considered that these lethal genes and growth disorder genes are target candidates for developing antifungal agents.

If the fungus basically grows mononuclear, and the deletion strain is not obtained in the gene deletion experiment in the fungus, the deletion gene is a lethal gene that has a lethal effect due to the deletion. It is highly likely and will be a potential target for developing antifungal agents.

[Step 2: Selection of Reporter Gene Candidate Genes]
The gene (reporter gene) that can be used in the reporter detection system is an extent to which the existing fungus (reference enzyme inhibitor) whose function to be inhibited (action site) has been clarified cannot cause the fungus to be lethal, That is, it is expected to function in the reference enzyme system by analyzing the homology with the gene specifically induced by the fungus when administered to the fungus at a concentration that does not stop but slows growth. You can select from genes. When selecting with a drug, in order to improve the accuracy of function estimation, it is preferable to exclude genes induced by a plurality of reference enzyme inhibitors having different inhibiting functions.
Preferable examples of the reference enzyme system inhibitor include those selected from drugs that inhibit energy metabolism, cell wall formation, and cytoskeleton formation.

A gene induced by a reference enzyme system inhibitor can be examined using any method known to those skilled in the art, such as microarray, RT-PCR, and Northern blot. Examples of such reporter genes include genes related to each pathway related to energy metabolism, cell wall formation, and cytoskeleton formation of the fungus. Genes associated with each of these pathways include the genus Aspergillus (eg, Aspergillus nidulans, Aspergillus oryzae, Aspergillus fumigatus), Neurospora, Magnaporthe, and Fusarium. In the eukaryotic fungi of the present invention such as genus, there are respective orthologous genes, and genes having equivalent functions thereof are also included in each gene related to energy metabolism, cell wall formation, and cytoskeleton formation in the present invention. .

[Step 3: Collection of Reporter Gene Promoter and Construction of Reporter Gene Vector]
An appropriate recombinant vector (reporter gene vector) such as a plasmid vector or a viral vector containing a marker gene operably linked to a reporter gene promoter can be prepared by any method known to those skilled in the art. Can be suitably carried out by transforming a eukaryotic filamentous fungus. “A marker gene operably linked to a promoter of a reporter gene” means that both are bound in a vector so that the marker gene can be expressed by the transcriptional regulatory action of the promoter. As a result of transformation, such a recombinant vector can be integrated into the host genome, or can exist in the cell independently of the genome as a plasmid or the like. Therefore, the present invention was transformed with the recombinant vector comprising the marker gene operably linked to the promoter in the 5 ′ upstream region of the reporter gene related to energy metabolism, cell wall formation, and cytoskeleton formation thus produced. It also relates to the eukaryotic filamentous fungus itself. In addition, the eukaryotic filamentous fungus that serves as a host for such a transformed bacterium may be various auxotrophic strains or restored strains thereof.

In the present specification, the “promoter” means a DNA sequence generally involved in the efficiency of the transcription initiation reaction in eukaryotic cells, and is a DNA region involved in the transcription initiation reaction itself at about 40 base pairs of the transcription initiation position. In addition to a narrowly defined promoter, it means a broadly defined promoter including various DNA elements (promoter proximal sequence and distal sequence (upstream control element)) that affect the efficiency of the transcription initiation reaction. An example of such a promoter is one located within 1 kb upstream from the translation initiation codon of this gene. This region is considered to contain most of the broad promoter sequences. However, the 5 ′ upstream region promoter used in the present invention does not need to contain all such elements. For example, transcription control is also possible for sequences in which a part of the region within 1 kb upstream is deleted, such as the −600 to −1, −400 to −1, and −200 to −1 regions 5 ′ upstream of the above gene. It is believed that the specific cis elements involved are included, and such shorter 5 ′ upstream regions are also included in the promoters of the present invention.

In addition, the measurement sensitivity can be further improved by incorporating such a recombinant vector (or a marker gene operably linked to a reporter gene promoter) into the host genome in multiple copies. Alternatively, detection sensitivity in the reporter system can be improved by tandemizing a promoter or a specific cis element involved in transcriptional control in the promoter in a reporter gene vector.

Furthermore, in the present invention, the promoter in the 5 ′ upstream region is not limited to the promoter sequence in the specific 5 ′ upstream region of the genes listed above, but is substantially the same as those when functionally linked to the marker gene. In the promoter sequence of such a specific 5 ′ upstream region, for example, at a site that does not substantially affect the function as a promoter, such as the end of the sequence, Various modified promoter sequences in which a part of the base sequence, for example, several bases are deleted, substituted or inserted are also included.

Examples of such modified promoter sequences include DNA sequences that can hybridize under stringent conditions with a complementary strand of the promoter sequence in the specific 5 'upstream region. Here, “under stringent conditions” means that the degree of homology between each base sequence is, for example, about 80% or more, preferably about 90% or more, more preferably about 95% or more on the average on the whole, More preferably, the condition means that a hybrid is specifically formed only between base sequences having high homology, such as about 99% or more. Specifically, for example, the conditions include a sodium concentration of 150 to 900 mM, preferably 600 to 900 mM, and pH 6 to 8 at a temperature of 60 to 68 ° C.

The present invention is, for example, a method known in the art such as a method described in Current protocols in molecular biology (edited by Frederick M. Ausubel et al., 1987) or It can carry out according to the method according to it. Moreover, when using a commercially available library, it can carry out according to the method as described in an attached instruction manual.

Promoters in the 5 'upstream region of genes related to each pathway related to energy metabolism, cell wall formation, and cytoskeleton formation, or their modified promoter sequences can be easily prepared by any method known to those skilled in the art. For example, it can be easily cloned from the deposited strain by the method described in the Examples. Alternatively, based on the genomic information of eukaryotic filamentous fungi described in various databases, the 5 'upstream promoters of genes related to each pathway related to energy metabolism, cell wall formation, and cytoskeleton formation are amplified by PCR. And can be used as the promoter.

The recombinant vector in the present invention can appropriately include various elements such as enhancers, marker genes, terminators, and various restriction enzyme sites according to the purpose.

As marker genes in the present invention, those skilled in the art such as β-glucuronidase gene, β-galactosidase gene, luciferase gene, green or red fluorescent protein gene, fusion gene such as EGFP-LacI, drug resistance gene, auxotrophic gene, etc. Any known gene can be used according to its purpose. When the β-glucuronidase gene or β-galactosidase gene is used, the change in the expression level of the protein encoded by the gene is measured by the color reaction of the substrate, and the expression of the gene is used as an index. The amount can be detected. When a luciferase gene or a green or red fluorescent protein gene is used, a change in the expression level of the gene can be detected by measuring the fluorescence emitted by the protein encoded by the gene. Alternatively, the reaction between the protein encoded by the reporter gene and a specific antibody thereto can be detected as an indicator of the change in the expression level of the gene. Furthermore, a CAT assay (radioactivity assay) using the CAT gene as a reporter gene can also be performed.

[Step 4: Preparation of transformant introduced with reporter gene vector]
For example, protoplast-PEG method, electroporation method, Ti-plasmid method, and particle gun, and various improved methods thereof as described in the examples of the present specification, etc. The transformant of the present invention can be easily prepared by transforming the fungus of the present invention with the recombinant vector by a recombination method using various techniques and means well known in the art.

[Step 5: Deletion or conditional destruction of candidate gene of target gene in transformant]
In the transformant thus obtained, conditional destruction of a candidate gene of a target gene, such as a lethal gene or a growth disorder gene, is performed. The growth-disrupting gene may be deleted and destroyed.
Such gene disruption can be performed using various homologous gene recombination techniques known in the art. In this specification, “conditional disruption” refers to a gene that can suppress the expression of the gene under certain specific culture conditions and replace the function of the gene by replacing the promoter of the gene with a promoter capable of controlling expression. Mutation, and can also be expressed separately by the terms “condition-specific suppression” or “condition-specific expression suppression”. For example, as an example of conditional disruption, strains in which the genes of erg11A and erg11B have been conditionally disrupted have been described as conditional mutants (Hu et al., PLoS Pathog. 3: e42. 2007).
As a promoter capable of controlling expression used for conditional disruption, any promoter known to those skilled in the art having such a function can be used.For example, thiA, alcA, tetA, niiA are known (special No. 2004-254670 and Japanese Patent Laid-Open No. 2007-259787, and the above literature).

[Step 6: Selection of target gene of antifungal agent and estimation of its function]
The conditioned disruption or deletion disruption strain thus obtained is cultured in a complete medium or a minimal medium or a medium containing a reference enzyme inhibitor at a concentration at which cells can grow on them, and the parent strain (non- The target gene of the antifungal agent can be selected by comparing the growth with the disrupted strain. Furthermore, the function of the target gene can be estimated based on the origin of the promoter by specifying the promoter that has been activated using the expression level of the marker gene as an index. In the case of a condition-disrupted strain, it is preferable to culture under conditions for suppressing the expression of the candidate gene for the target gene. The expression level of the marker gene can be measured using various techniques and means well known in the art. In this case, it is desirable to perform conditional disruption or deletion disruption of a lethal or growth-damaging gene with a reporter detection system-introduced strain and examine the color development or fluorescence of the bacterial cell.

Furthermore, in the present invention, when the marker gene is a gene that is transcriptionally controlled by a promoter of a reporter gene associated with each pathway related to energy metabolism, cell wall formation, and cytoskeleton formation, changes in the transcription amount thereof are measured. It can also be detected as a change in the mRNA level of the gene. More specifically, examples of methods using PCR include methods known to those skilled in the art such as competitive PCR or real-time PCR (quantitative RT-PCR) and various improved methods thereof. Alternatively, it is also possible to detect changes in the amount of mRNA of a gene related to each pathway related to energy metabolism, cell wall formation, and cytoskeleton formation, using a DNA chip or a microarray using hybrididin.

Hereinafter, the present invention will be specifically described with reference to examples, but the technical scope of the present invention is not limited to these descriptions. Various gene manipulations in the examples were performed according to the methods described in Current protocols in molecular biology (edited by Fredrick M. Ausubel et al., 1987).

Aspergillus oryzae has known genomic information (Machida et al., 2005), has a developed secondary metabolic system compared to other eukaryotic fungi, and has high antifungal resistance. That they are safe to handle, that they can be genetically manipulated, that high-efficiency homologous recombination experiments are available, and that the inventors have applied for patents by decoding the genome in the past. We thought that it would be a good model organism for developing antifungal agents due to the fact that there are no restrictions on the use of genomic information for research purposes.

The genes important for the growth of Aspergillus oryzae were considered to be candidate genes for target genes for developing antifungal agents against eukaryotic filamentous fungi containing Aspergillus oryzae.

The genes important for the growth of Aspergillus oryzae were examined by searching for genes that cause lethality or damage to the growth by deletion disruption or conditional disruption.

Kinds of genes were selected according to the criteria described in the following a to f considered to be important for the growth of Aspergillus oryzae.
a) 84 genes that are orthologs of genes that are lethal by deletion disruption in yeast Saccharomyces cerevisiae or that have a lethal effect depending on growth conditions and that do not have extra homologues on the genome of Aspergillus oryzae b) Aspergillus oryzae 89 genes specifically induced by the addition of existing antifungal agents c) Orthologs of genes that become lethal by deletion disruption in yeast, Aspergillus oryzae, Aspergillus niger , Magnaporthe grisea, Fusarium graminearum, and orthologs are present in all filamentous fungi. Humans (Homo sapiens) and plants (Arabidopsis thaliana) have 33 genes that do not have orthologs d) Aspergillus・ Solid culture using oryzae wheat bran (Tamano et al., 2007) In 26 kinds of genes induced high expression (of which plant (Arabidopsis thaliana) no orthologs in gene 6 present)
e) Eleven genes of Aspergillus oryzae that have lethal effects due to deletional destruction by orthologs of Aspergillus nidulans or Aspergillus fumigatus, which are closely related filamentous eukaryotic fungi f) Homology Eight types of genes whose functions are predicted by searching, etc., and from which the results of Aspergillus oryzae are predicted to give lethal or growth damage effects by deletion disruption

Preparation of DNA fragments for gene deletion disruption Four more genes (AO090005000456 (GenBank Gene ID: 169766099), AO090005000363 (GenBank Gene ID: 169765933), AO090005000301 (GenBank Gene ID: 169765821) from the above 251 genes , AO090005000125 (GenBank Gene ID: 169765533)) were selected to create their deletion disruption. First, a DNA fragment for deletion destruction was prepared. 5 'upstream region (5'-UTR) from the start codon and 5' downstream region (3'-UTR) from the stop codon The upstream region was amplified by PCR using LU primer and LL primer, and the 3 ′ upstream region was amplified by PCR using RU primer and RL primer. In addition, the pyrG auxotrophic marker gene related to uracil synthesis was amplified by PCR using PU and PL primers as a selection marker for deletion-disrupted strains. The sequences of LU, LL, PU, PL, RU, and RL primers for each gene are shown in Table 1 below (SEQ ID NOs: 1 to 24).

After that, 5'-UTR, pyrG, 3'-UTR was mixed and PCR was performed, and the DNA fragment for deletion disruption in which 5'-UTR, pyrG, 3'-UTR were joined in the order of 5'-UTR, pyrG, 3'-UTR was analyzed by Fusion PCR. A schematic diagram is shown in FIG.
Primers (LL, PU, PL, etc.) that anneal to the position to be a junction with adjacent DNA fragments in Fusion PCR when preparing 5'-UTR, pyrG, 3'-UTR DNA fragments used in Fusion PCR In the tail part of (RU), 13 to 18 bases of the terminal sequence of the DNA fragment to be ligated were introduced.

・ 1st PCR
The 5′-UTR, pyrG, and 3′-UTR DNA fragments were amplified by Expand High Fidelity PLUS (Roche Diagnostics) or KOD PLUS, Version 1 (Toyobo). All templates used chromosomal DNA of Aspergillus oryzae wild strain RIB40. Reaction was carried out with the compositions shown in Tables 2 and 3 below.

50 μl of the above reaction mixture was mixed in a 0.2 ml reaction tube and set in the DNA Thermal Cycler, and PCR was performed with the following temperature settings.

94 ° C, 40 seconds, 1 cycle
94 ° C, 15 seconds 63 ° C, 30 seconds 68 ° C, 2 minutes 30 seconds 35 cycles
68 ° C, 2 minutes 30 seconds 4 ° C, ~ O / N 1 cycle

After adding 10 μl of 6 × Loading Buffer to 50 μl of the PCR reaction solution, 30 μl of the sample was electrophoresed in 2 lanes on a 0.7% agarose gel prepared with a comb having a well width of about 1 cm. Cut out the gel containing the desired DNA fragment band and pass 50 μl of Nuclease Free Water twice through the column using the Wizard (registered trademark) SV Gel and PCR Clean-Up System (Promega). And the DNA fragment was purified.

・ Fusion PCR
Purified 5'-UTR, pyrG, 3'-UTR DNA fragments were lined up and run on an agarose gel, and the molar ratio of DNA fragments was 5'-UTR fragment: pyrG fragment: 3'- The DNA fragments were mixed so that the UTR fragment was 1: 3: 1 and the total solution volume of these three DNA fragments was within 12 μl, and Fusion PCR was performed in the reaction system shown in Table 4 below. .

100 μl of the above reaction solution was mixed in a 0.2 ml reaction tube and set in the DNA Thermal Cycler, and PCR was performed with the following temperature settings.
94 ° C, 2 minutes, 1 cycle
94 ° C, 15 seconds 66 ° C, 30 seconds 68 ° C, 6 minutes 35 cycles
68 ° C, 7 minutes 4 ° C, ~ O / N 1 cycle

A 5.0 to 6.0 kb DNA fragment for gene deletion disruption was amplified by fusion PCR. Thereafter, if necessary, rePCR or Nested PCR was performed to obtain a state in which the target DNA fragment was most amplified in the major band and there was almost no non-specifically amplified DNA fragment. In addition, by carrying out the above PCR using two or more tubes, about 20 micrograms of DNA fragments for gene deletion disruption were prepared. The PCR reaction solution was treated with Wizard SV Gel and PCR Clean-Up System to purify the DNA fragment for deletion destruction. Since this DNA fragment is used for transformation, sterilized water was used for DNA elution to prevent contamination.

Transformation Aspergillus oryzae RIB40 ku70 :: ptrA ΔpyrG conidia suspension in a polypeptone-dextrin liquid medium supplemented with 20 mM uridine (4 g dextrin hydrate (Wako Pure Chemicals), 2 g Polypeptone (Nippon Pharmaceutical), 0.2 g casamino acid (Difco), 1 g KH ₂ PO ₄ , 0.2 g NaNO ₃ , 0.2 g MgSO ₄ · 7H ₂ O, pH 6.0), inoculated at 30 ° C for 24 hours with shaking did. After collection using a 17G1 sterilized glass filter, the cells were washed twice with sterilized water and once with sterilized 0.8 M NaCl. After that, the cells were mixed with 30 ml of protoplast solution (0.8 M NaCl, 10 mM NaH ₂ PO ₄ , 100 mg / 30 ml Lysing enzyme (Sigma), 50 mg / 30 ml Cellulase Onozuka R-10 (Yakult Yakuhin), 100 The suspension was transferred to a 50 ml sterilized centrifuge tube containing mg / 30 ml Yatalase (Takara Bio), suspended, and shaken at 30 ° C., 50 rpm for 2.5 hours to carry out a protoplast reaction. The solution was filtered through a sterilized 17G3 glass filter, and the protoplast in the filtrate was centrifuged at 3,000 × g, 4 ° C. for 5 minutes to obtain a precipitate. The protoplasts were washed three times with Solution B (1.2 M Sorbitol, 50 mM CaCl ₂ , 10 mM Tris-HCl, pH 7.5), and centrifuged at 3,000 × g, 4 ° C. for 5 minutes to obtain a precipitate. This protoplast was suspended in 1 ml of Solution B. Transfer 200 μl of the protoplast suspension to a sterile 1.5 ml Eppendorf tube and add 25 μl of Solution C (50% (w / v) PEG # 3350, 50 mM CaCl ₂ , 10 mM Tris-HCl, pH 7.5) to each. 10 μl of each of the above DNA solutions for transformation (20 μg of DNA amount) was added and mixed well, and the mixture was left on ice for 30 minutes. To a 15 ml centrifuge tube, 2 ml of Solution B and 1 ml of Solution C were added and mixed, and protoplast suspension was added and suspended therein. Then, 10 to 25 ml of Czapek-Dox (CD) soft agar minimal medium added with sorbitol warmed to 70 ° C. at a concentration of 1.2 M was added and mixed, and CD with sorbitol added at a concentration of 1.2 M Overlaid on agar medium. Thereafter, the cells were cultured at 30 ° C. until conidia were formed.
Of the cells regenerated after transformation, the conidia of the cells that formed a single colony were isolated and transferred to the entire CD agar medium. Thereafter, the cells were cultured at 30 ° C. until conidia were formed.

Nuclei purification by mononuclear conidia enrichment Mycelium and conidia of Aspergillus oryzae take the form of multinuclei having multiple nuclei, and DNA introduced from outside may be incorporated only into the chromosomes of some nuclei. Therefore, when preparing a deletion-disrupted strain, it is necessary to purify it as a homokaryon in which only the nucleus from which the gene has been deleted and destroyed is present in the cell. At that time, if a mononuclear conidia present in the transformation candidate strain is selected and subcultured, the probability that the strain having only the nucleus in which the target gene has been deleted and destroyed is increased. Therefore, taking advantage of the small size of mononuclear conidia compared to that of polynuclear cells, the mononuclear conidia are concentrated by passing through a membrane filter, and subculture is performed so that colonies are formed from them. Went.
For the method, referring to the method of Hara et al. (2002), the conidia was suspended in a sterilized 0.01% Tween 20 solution, and the ISOPORE ^TM MEMBRANE FILTER (Millipore) having a pore diameter of 5 μm and a diameter of 25 mm set in a filter holder was used. ) Using a syringe. By this operation, a concentrated fraction was prepared in which about 80% of the conidia that passed through consisted of mononuclear conidia. This was diluted appropriately and seeded on a CD agar medium so that one colony was formed from one conidia. Thereafter, the cells were cultured at 30 ° C. until conidia were formed.

Confirmation of the gene deletion disruption strain Confirmation of the gene deletion disruption strain from the transformant was performed by PCR on the genomic DNA of the transformant using the LU and RL primers used in Fusion PCR. A homozygous deletion-destructed strain, a DNA fragment of the same size as that of a wild-type strain was observed only when amplification of a DNA fragment having a size corresponding to the deletion-destructive DNA fragment was observed. Non-deletion-disrupted strains in which pyrG was incorporated into ectopic into the chromosome, and those in which amplification of both of these DNA fragments were observed were designated as hetero-deleted-disrupted strains (FIG. 3).
If a homo-deletion-disrupted strain was obtained and the growth was similar to that of the wild-type strain, the deletion-disrupted gene was determined to be a gene that does not affect growth, that is, is not important for growth. On the other hand, when the homo-deficient disruption strain was weaker than the wild strain, the deletion-disrupted gene was a growth-disrupting gene that was not lethal due to the deletion disruption but caused a growth disorder. If homozygous disruption strains cannot be obtained, that is, they can only be obtained as heterozygous or non-deletion disruption strains, the deletion disruption gene may be lethal due to deletion disruption. Thought it was expensive. It was considered that genes that are highly lethal and growth-disruptive genes are potential targets for developing antifungal agents.
In the case of the deletion disruption of the selected 4 genes, the deletion disruption strains were obtained as homokaryons, but the deletion disruption strains of the AO090005000456 gene and AO090005000125 gene each grew compared to the strain before the gene deletion. Was confirmed to be declining. Based on this, the AO090005000456 gene and AO090005000125 gene have been found to be fungal growth-damaging genes due to growth disruption due to deletion disruption, and they are candidate genes for the development of antifungal agents as important genes for fungal growth. The possibility was considered.

Conditional disruption of genes that are more lethal than deletion disruption <br/> Among genes that are considered important for growth, genes that affect lethality due to their deletion disruption are effective for developing antifungal agents. However, since a deletion-disrupted strain cannot be obtained, functional analysis using the deletion-disrupted strain cannot be performed. Some genes can be predicted by comparative genomic methods such as homology analysis and motif search, but it is not possible to analyze whether the prediction is actually correct by experiments. If the function of a gene considered to be important for growth cannot be clarified, it is difficult to develop a drug for it. Therefore, the expression of the gene was suppressed, and the fungus was grown in a state where the gene did not function sufficiently, that is, it was not lethal but the growth was impaired, and an attempt was made to estimate the function of the gene. A strain in which suppression of expression of the target gene can be controlled is called a condition-disrupted strain.
Genes whose functions are estimated by conditional disruption are considered to be highly likely to be important for growth in deletion disruption experiments among 243 genes selected based on the criteria (a) to (e) above, and humans (Homo sapiens) and plants (Arabidopsis thaliana) are eukaryotic filamentous fungus-free genes that have no orthologues, and 30 genes that have not been clarified in Aspergillus oryzae so far. In addition, it is possible to predict the function by homology search etc. selected based on the above criteria (f), and as a result, it was predicted that Aspergillus oryzae would give lethal or growth disorder effects by deletion disruption. As for the control of 8 genes, lethal disruption of the lethal genes and conditional disruption or deletion disruption of the growth-disrupting genes were conducted as controls for examining whether the function could be correctly clarified by the present function estimation method.
As a conditional disruption method, we replaced the promoter of the gene thought to be important for growth whose function is to be investigated with the thiA gene promoter reported to be capable of artificially suppressing expression suppression by addition of thiamine (Shoji et al., 2005) A method of trying to suppress its expression by adding thiamine was used (FIG. 4). This thiA promoter is regulated by thiamine addition, which is called a riboswitch based on the principle that thiamine directly binds to the promoter region of mRNA, thereby inhibiting splicing at the promoter and consequently preventing correct translation. Yes (Kubodera et al., 2003).
Conditional disruption experiments were conducted in a DNA sequence of about 3 kb, about 1 kb 3 'downstream from the start codon of the target gene and about 2 kb of 5'-UTR, about 5 kb from the start codon to 5'-UTR. A DNA fragment was prepared by replacing the 1 kb DNA sequence with a DNA sequence in which the thiA promoter and the pyrG marker were connected in tandem, and this was introduced into Aspergillus oryzae and homologous recombination was performed.
The DNA fragment for gene condition disruption was prepared by Fusion PCR in the same manner as the preparation of the gene deletion disruption DNA fragment described above. The reaction solution composition, reaction program, and purification of DNA fragments before and after 1st PCR and Fusion PCR were performed in the same way as in the case of gene deletion disruption. The method for preparing DNA fragments was changed from the above case.
1. The pyrG marker DNA fragment is a tandem ligation of the reverse Aspergillus nidulans pyrG marker DNA and the forward thiA promoter of about 1 kb.
2. The 5′-UTR 1.2-1.5 kb DNA fragment was changed to a fragment of the 1.2-1.5 kb DNA region 5 ′ upstream from a position 1 kb back 5 ′ upstream from the start codon.
3. The 3 ′ UTR 1.2-1.5 kb DNA fragment was changed to a 1.2-1.5 kb DNA region fragment 3 ′ downstream from the start codon.
The DNA fragment obtained by linking the pyrG and thiA promoter in 1. above was amplified by PCR using a template previously cloned in such a state as linked to an appropriate vector.
The DNA fragment for gene condition disruption was introduced into a reporter detection system introduction strain of Aspergillus oryzae NS4 ligD :: ptrA pyrG :: sC strain. Transformation, purification, and PCR confirmation of conditionally disrupted nuclei were performed by the methods described above. As a result, about one-third of the genes considered to be lethal to disruption had the effect of condition disruption by addition of thiamine, resulting in growth suppression. However, about the remaining two-thirds of the genes that had undergone conditional destruction, growth suppression as a result of suppression of expression by addition of thiamine was not observed. The most likely cause is the difference in the expression level between the original promoter and the thiA promoter, and the dose response for suppressing protein expression. No level correlation has been found. Although the thiA promoter was not effective for conditional disruption of all genes, some genes for which conditional disruption was effective were applicable to function estimation using a reporter.
The result of conditional disruption of the AO090003000174 gene (GenBank Gene ID: 169769850), which was considered to be highly lethal because a homo-deficient disruption strain was not obtained, is described. 5'-UTR of AO090003000174 gene and a 1.2 kb DNA region 3 'downstream from the start codon, LU primer 5'-ACCGTCTTCATCCGACTGATTCTAGC-3' (SEQ ID NO: 25) and LL primer 5'-AGACAAGCACTGAGGCTCTAGAAGAGTAACGACAATGTC-3 '(SEQ ID NO: 26 ) And RU primer 5'-TGCAACTTGAAACATGGTTGCCACATCTGTGAATCGCAC-3 '(SEQ ID NO: 27) and RL primer 5'-GAGACCAATGCACTTGGCGTAGCAAC-3' (SEQ ID NO: 28), each amplified by PCR using the chromosomal DNA of Aspergillus oryzae as a template. did. In addition, using a plasmid DNA obtained by cloning a DNA fragment tandemly linked to the reverse Aspergillus nidulans pyrG marker DNA and the forward thiA promoter of about 1 kb as a template, the PU primer 5'-ACTCTTCTAGAGCCTCAGTGCTTGTCTACCAGATTAGG-3 '(SEQ ID NO: 29) and PL primer 5'-GTGGCAACCATGTTTCAAGTTGCAATGACTATCATC-3 '(SEQ ID NO: 30), PCR was performed in tandem with a reverse direction Aspergillus nidulans pyrG marker DNA and a forward thiA promoter of about 1 kb. Amplified with Thereafter, these amplified three DNA fragments were ligated as one DNA fragment by Fusion PCR in the same manner as described in Example 2, and NS4 ligD :: ptrA pyrG :: sC strain was transformed therewith. . As a result, AO090003000174 gene conditionally disrupted strains obtained as homokaryons were cultured in a CD soft agar minimal medium added with thiamine at a concentration of 2 μM and a CD soft agar minimal medium not added with thiamine, and the growth was compared. As a result, it was confirmed that when thiamine was added, the growth was reduced. This is considered to be a result of the expression of the AO090003000174 gene being suppressed by the riboswitch described above, and it was confirmed that the AO090003000174 gene is a lethal gene important for the growth of Aspergillus oryzae.

Preparation of reporter detection system for cell system monitoring If the functions of highly lethal and potentially impaired genes cannot be predicted by homology search or motif analysis, the reporter detection system can be used to roughly estimate the function. It was decided to use. This simple function estimation method is to display the function of a gene by the coloration or fluorescence of bacteria. In the case of gonococci introduced with a reporter detection system, if the gene has a high possibility of lethality, the gene is modified so that its expression can be controlled repressively, that is, the gene is conditionally disrupted. Destroy. This allows the function of the gene to be roughly estimated by looking at the response of the reporter due to a decrease or deletion of the function of a gene that is highly lethal and a growth disorder gene, and develops an antifungal agent Important information for getting.
As cell systems for which functional estimation is desired, energy metabolism, cell wall formation, and cytoskeleton formation were used, and a reporter detection system was prepared for this.
The reporter detection system links the DNA fragment of the promoter of a gene that can be used for function estimation as a reporter to the DNA fragment from the start codon to (stop codon) to terminator of GUS or EGFP, and this ligated DNA fragment is Aspergillus. -Made by introducing into Orize. The promoter of a gene that can be used for function estimation as a reporter is a level that does not cause Aspergillus oryzae to die of a drug whose inhibitory function is known (reference enzyme inhibitor), that is, growth is slow but not stopped The concentrations described in Table 5 were administered.

Genes induced by administration of drugs at the concentrations in Table 5 were examined using a microarray carrying probes for all genes on the Aspergillus oryzae genome. Then, by excluding genes induced by any of a plurality of drugs having different inhibiting functions, a gene having a promoter that could be used for function estimation as a reporter was selected. Also, without referring to the microarray data, genes having promoters that could be used for function estimation as reporters were also selected from genes predicted to function in the standard enzyme system from homology analysis. Table 6 below lists the selected genes.

A reporter detection system DNA fragment is prepared by linking the promoter DNA of the gene selected as the reporter listed in Table 6 and the DNA from the start codon to (stop codon) to terminator of GUS or EGFP, and this is introduced into Aspergillus oryzae. Thus, a reporter detection system introduced gonococcus was prepared.
In the case of GUS, this ligation is performed on the tail of the selected gene at the PstI, NotI, or SalI restriction enzyme site of the pNGG plasmid that has already incorporated DNA from the GUS start codon to (stop codon) to the terminator. This was carried out by cloning a restriction enzyme-digested DNA fragment of about 1 kb 5′-UTR amplified with a primer pair having a restriction enzyme site of PstI, NotI, or SalI (FIG. 5).
AO090003000310 (GenBank Gene ID: 169770082), AO090003000174 (GenBank Gene ID: 169769850), AO090005001430 (GenBank Gene ID: 169767769) and the cell wall-forming reporter AO090005000560 (GenBank Gene ID: 169766275) genes Examples are described. Each promoter of AO090003000310, AO090003000174, AO090005001430, AO090005000560 was amplified by PCR using Fwd and Rev primers (SEQ ID NOs: 31 to 38) described in Table 7 below.

The amplified DNA fragments of each promoter were digested with PstI and SalI, and the DNA fragments were subjected to agarose gel electrophoresis together with the pNGG plasmid, which was also digested with PstI and SalI. DNA was extracted into 50 μl of sterile water using SV Gel and PCR Clean-Up System. These were used as an insertion vector and an insertion DNA fragment, respectively. Next, 1 μg of this vector DNA fragment and 1.5 μg of the inserted DNA fragment are ligated using the DNA Ligation kit, Version 1 (Takara Bio), E. coli is transformed with this reaction solution, and the promoter of each reporter gene is cloned. PNGG plasmid was obtained. Next, the prepared reporter introduction vector was cleaved with XcmI at the center of the niaD auxotrophic marker gene, the fragment was subjected to agarose gel electrophoresis, the gel containing this was excised, and Wizard SV Gel and PCR DNA was extracted into 50 μl of sterilized water using Clean-Up System. This was introduced into the Aspergillus oryzae niaD300 strain by the aforementioned transformation method.
Actually, it was confirmed in advance that the Aspergillus oryzae-introduced strain of this reporter detection system DNA fragment functions normally for the purpose of function estimation before performing the function estimation of a lethal or growth-damaged gene (Fig. 6). Confirmation of the operation of the energy metabolism reporters AO090003000310, AO090003000174, AO090005001430 was made by adding each inhibitor to the cell culture medium at a concentration of cresoxime methyl 20 μg / ml, diflumetrim 1 μg / ml, or oligomycin 20 μg / ml, This was done by observing an increase in β-glucuronidase activity. Confirmation of the operation of the cell wall-forming reporter AO090005000560 was performed by adding each inhibitor to the cell culture medium at a concentration of 20 μg / ml fludioxonil and observing an increase in β-glucuronidase activity. The β-glucuronidase activity was measured as follows.

・ Confirmation of reporter response by measuring β-glucuronidase activity <br/> 500 ml flask containing 200 ml of CD minimal liquid medium so that the conidia of the reporter-introduced strain becomes 2 × 10 ⁶ conidia / ml And inoculated under the following conditions.
(Condition 1) Culture at 30 ° C for 24 hours
(Condition 2) After culturing at 30 ° C. for 24 hours, the drug is added at the concentrations shown in Table 5, and further culturing at 30 ° C. for 4 to 8 hours.

The cells were collected with a glass filter, and the collected bacteria were crushed in a mortar until pouring with liquid nitrogen. 1.5 ml Eppendorf tube containing 500 μl Lysis buffer (10 mM EDTA, 0.1% (w / v) Triton X-100, 10 mM 2-mercaptoethanol, 50 mM potassium phosphate, 0.5 mg Sarkosyl, pH 7.0) The powdered cells were transferred and suspended. The mixture was allowed to stand on ice for 30 minutes, and centrifuged at 15,000 × g for 10 minutes at 4 ° C., and the supernatant was used as a crude enzyme solution in the cells.
The protein concentration of the enzyme extract was measured and the protein concentration was measured. Those with high concentrations were diluted so that the protein concentration was 100 μg / 100 μl or less. Thereafter, an enzyme reaction solution was prepared, mixed, and reacted at 37 ° C. for 10 minutes. The composition of the enzyme reaction solution is shown in Table 8 below.

Thereafter, 80 μl Termination solution was added to stop the reaction, and the amount of p-nitorophenol produced by the reaction was measured by absorbance at a wavelength of 415 nm.
Among the solutions used for the above measurements, the composition of Reaction buffer is shown in Table 9 below, the composition of p-nitorophenyl-β-D-glucuronide solution is shown in Table 10 below, and the composition of Termination solution is shown in Table 11 below. .

BCA Protein Assay Reagent Kit (Pierce) was used to measure the protein concentration of the crude enzyme solution in the microbial cell, and the attached manual was followed.

When trying to increase the sensitivity of the prepared reporter detection system, EGFP with higher sensitivity was used for the reporter detection system instead of GUS.
This reporter detection form was created by using primers that have NotI or PstI restriction enzyme sites in the tail of the selected gene at the NotI or PstI restriction enzyme sites of the pEGFP plasmid that incorporates the DNA from the start codon to the stop codon of EGFP. It was carried out by cloning a restriction fragment digested with NotI or PstI of a DNA fragment of about 1 kb of 5′-UTR amplified in pairs (FIG. 7).
Examples of the energy metabolism reporter AO090011000022 (GenBank Gene ID: 169782511) gene and the cytoskeleton formation reporter AO090124000010 (GenBank Gene ID: 169778459) gene will be described. Each promoter of AO090011000022 and AO090124000010 was amplified by PCR using Fwd and Rev primers (SEQ ID NOs: 39 to 42) described in Table 12 below.

The amplified AO090011000022 promoter DNA fragment was digested with NotI, the AO090124000010 promoter DNA fragment was digested with PstI, and the DNA fragment was subjected to agarose gel electrophoresis together with the pEGFP plasmid digested with NotI or PstI. The DNA was excised and extracted into 50 μl of sterilized water using Wizard SV Gel and PCR Clean-Up System. These were used as an insertion vector and an insertion DNA fragment, respectively. Next, 1 μg of this vector DNA fragment and 1.5 μg of the inserted DNA fragment are ligated using the DNA Ligation kit, Version 1 (Takara Bio), E. coli is transformed with this reaction solution, and the promoter of each reporter gene is cloned. PEGFP plasmid was obtained. Next, this prepared reporter introduction vector was cleaved with XcmI at the center of the niaD auxotrophic marker, the fragment was subjected to agarose gel electrophoresis, the gel containing this was excised, and Wizard SV Gel and PCR Clean DNA was extracted into 50 μl of sterile water using -Up System. This was introduced into the Aspergillus oryzae niaD300 strain by the aforementioned transformation method.
It was confirmed in advance that the Aspergillus oryzae-introduced strain of this reporter detection system DNA fragment normally functions for the purpose of function estimation before performing the function estimation of a lethal or growth disorder gene. Confirmation of reporter activity was confirmed by quantitative RT-PCR for the AO090011000022 reporter gene by adding diflumetrim, a drug that acts on the energy metabolism system, to the cell culture medium at a concentration of 1 μg / ml. Confirmation and stepwise addition to the cell culture solution from 0 μg / ml to 1 μg / ml, and observation by fluorescence microscopy that the cells exhibit fluorescence due to EGFP as the diflumetrim concentration increases (FIG. 8). For the AO090124000010 reporter gene, quantitative addition of benomil, a drug that acts on the cytoskeleton formation system, to the cell culture medium at concentrations of 1 μg / ml and 20 μg / ml, and quantitative increase in egfp gene expression associated therewith RT-PCR By adding to the cell culture solution step by step from 0 μg / ml to 10 μg / ml, and observing the cell fluorescence by EGFP as the benomyl concentration increases Performed (FIG. 9).

Estimating the function of a gene considered to be important for growth using a reporter <br/> The estimation of the function of a gene considered important for growth was estimated in the Aspergillus oryzae-introduced strain of the reporter detection system that has been prepared so far Among the genes considered to be important for growth, conditional disruption or deletion disruption was performed on the genes for which conditional disruption was found to be effective, and the reporter response at the time of gene disruption was observed.
First, for the constructed reporter detection system of Table 6, a strain was prepared by introducing a reporter detection system into the NS4 ligD :: ptrA pyrG :: sC strain that can use a pyrG auxotrophic marker for gene disruption. At this time, NS4 ligD :: ptrA pyrG :: sC strain contains any one of the reporter detection systems listed in Table 6, so we estimate three types of cell functions: energy metabolism, cell wall formation, and cytoskeleton formation. Therefore, at least three types of reporter introduced strains were prepared.
AO090009000281 (GenBank Gene ID: 169764582) cytoskeletal reporter AO090124000010 response to gene deletion disruption predicted by homology analysis of amino acid sequence as coding for tubulin (ie, satisfying condition f), and ATPase AO090020000403 (GenBank Gene ID: 169780523) predicted by homology analysis of amino acid sequences as coding for AO090020000403 (GenBank Gene ID: 169780523) of two types of energy metabolic reporters AO090005001430 and AO090003000310 Results are shown. For strains in which the reporter was introduced into the Neisseria gonorrhoeae NS4 ligD :: ptrA pyrG :: sC strain by the method described in Example 4, the deletion disruption of the AO090009000281 gene, the energy metabolism reporters AO090005001430 and AO090003000310 were introduced in the AO090124000010 introduced strain. A strain in which the AO090020000403 gene was conditionally disrupted in each of the introduced strains was prepared in the same manner as described in Example 2. The primer sequences (SEQ ID NOs: 43-54) used are listed in Table 13 below.

When deletion disruption of AO090009000281 gene is carried out in a strain introduced with cytoskeleton-forming reporter AO090124000010, AO090009000281 gene deletion strain grows slower than parent strain before gene deletion and does not respond in parent strain before deletion Fluorescence was emitted in response to low concentrations of benomyl (FIG. 10). This indicates that the AO090009000281 gene is important for growth and may be a target for the development of antifungal agents and may function in the formation of the cytoskeleton. It could be shown in combination with the detection system.
In addition, when the AO090020000403 gene was disrupted under conditions where the energy metabolic reporters AO090005001430 and AO090003000310 were introduced, the cells grew slower than the non-expression-suppressed strain when the AO090020000403 expression was suppressed, Around the cells not seen in the parental strain before destruction, a blue color developed due to the degradation of 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc) by GUS activity ( FIG. 11). This indicates that the AO090020000403 gene is important for growth and may be a target for developing antifungal agents, and may function in energy metabolism. It was possible to show by the combination of.

AO090003000310, AO090003000174, AO090005001430, AO090005000560, AO090011000022, and AO090124000010 promoters produced in the above Examples are reference enzyme inhibitors administered at concentrations that impair growth of the fungus of the present invention but do not cause lethality This is a representative example of a promoter of a fungal gene (reporter gene) whose expression is induced by, or a fungal gene (reporter gene) predicted to function in a reference enzyme system by homology analysis with a gene of another organism. Their base sequences are shown in SEQ ID NOs: 55-60.

AO090003000310 promoter (SEQ ID NO: 55): 5'- atcacattactgttgcccaaaggccaccaaatgcactgtggaggtgtatacttgagtcccgttacctaggaatcgactcaatcaagatatttctacttctcggccgggaaaagtgaaactcatgatgttactaaagtagtacgaagggtatccatattagaagttcggggtctgctgtacgtaaggagttcgtggctgaagaaaatttgcaagggatctgacgtatggagagcccgatagtccgtaactatacgagtgaatcaatcaaagacaatcggttccgagtcgattcggaggtcaagcttcggcatcgcgttgagtcagacgccgttccggtttccaccgaagtcatctgcccgccccttcgtatatttaaaattacacaagccgtatcaatctgtaatatacggtatctcgccgctgaatgacctgattctttctcgggcatagggataatggggagacttttaaattcgcttttacttcagtcgcataaagaatacagcggggttcctttattaaacatcttaattgagattcctaggtgtcgagaggatgttcgcgatggttgcttccatgtaacttcggtgtaacttctagagccttgaaagcttggtccctaagggacccgccaagaaaaccagttccagaatcttggatgtcctttgaaaggcatgttagaatcccgcaaacggatcttagttggtcgtcccggtgtagctcagggtcgttctaattgtcagcctgttctggcgagaagattttgcgccctatgacagtatattgttctcatttggttccggccttattccgatttctgccataagcttcttatccaggactatatatagatagactgtagaggcgtagcttcccaatgtccagtaaacagcaagccttttgtgatcaaagcacgactctttctactactacttcacc ccaagaccattaatcagtttatctaataacgtatactcgg-3 ’

AO090003000174 promoter (SEQ ID NO: 56): 5'- accgaatgactaacagcatgcctaaaggaggaaagcgtcattgaaatgatgaacgggaacccgagacttcagccggggtttcgtcatgagcacgtctcttttggctaggatgaagtgattattggtttctattgattgttaccctaaagaggggctaaagataggcactctctgggggcgatactgcgccacctgggcatttcgacattgtcgttactcttctagagcgtttgctttcacccatgtggtctcgagctcccccggtccggcagcaaaaggtctagccgaaaatgttctccccgcaatttgggtcttggccgcttgaaccaaacaaaatagaacaaaaagagtagactgagatcattcaacgtcaccactttgctgacttttccctctgcccgcataaaccctggagactgattgatcgaattctttgtagaaaaagtaaatacagagggaacatactttggggattgtgtaatggcaaacgaatgtaagacataaataattggtaggcaagctgtcgtttgcagcggtactttcagcctgtcctaaacatagtttgcattcctgcgcctgggcacccacacccacgcactaaaactcatttacacctgcattttgctcctgcatgagacatttcttgactggataccatccgcgcgttatcataatccagagacacacccctttattttcattccgaaaatcgcattttcttgcttctagttggtgcacccgaccggttttcccggaaccacttcgtgcctacatctggggttcggaacaagtcggagaacccacaagaggcattttacacactccagagtccacggttaccaacgctgcctcagcccggtcttcagccccgacatctcccgtcaaactgtggagaagcatatcggagtcgaagactgaaacgccttctggacttacttt gctgtgatcatggctcctgctgaaaacattaatataccccgtgcttccccagtagaaccaggtcctctctacacagatttcttccaacaacaagtcgcaaagcagcgcaacaataactatcactccacatcattaagaaac-3 '

AO090005001430 promoter (SEQ ID NO: 57): 5'- ggcagcagacacggaatctgattctttgatagttccttctttcaaaagctgcttgagccggggaatgctgaggtagccaagtagggatcgtttcgtagaagaggtgaccgttaaatgagtgaaatcacgttcgtaggctgcgagcatggcggaggagactaagtcgttaggtgagacagacagtgccggaggggggtccagatcttcgacagtagcctagatttttttttcatcggtaagtagggaatgacaatagggtctatgcagttgggcgtgtaatgccatcatagagtggtaactaacccctcggtacttgtctgcccacgatgacggggaagtggactgttccgcagtagaagagagcttttcgcgggcaaatgcctcgctgccggtcgaataggaagccatatccactgagtgattcacaggaggggcggcaaaggcgatgaggaggggtacgaagaggggccaactataatgttcaattggcgatagtaacggcgtcaaatcgggacaccaagtattacagggtaaactcggagaaacacggttatgcgagcactaagagcaaacgatacgaggtaaggaggccggttcgtgttttgacaatatcgcaaggtgaggtctgttccaatggacgataaatttatcgattgcggcccacgagagccttagtctccgccctctaagcggatcgggtttggcgccaaccagaagtgggtgagacgataccattcgacgtcattgccggccgctaccgcagtgtcagatctctcttcctttcggttgttcggactgagtcacttgtcattttactatttatactgtcatactgctcctttaacatttttgaatgaagaaaaaagtcggtagttcgagtggttcgtgtcccaactgtttttgtactcattgagataccagttgccctacaagtgggga cgatcttctctatagatatacaacccccagtacgtgcggtctggtcctgtggagacctctcaacttacgataaacccaatattttgacacggctcaactaggaaatccctcgccaag-3 ’

AO090005000560 promoter (SEQ ID NO: 58): 5'- gttgggtgatggcaagtcttagctatttttgaatctgttgagttatcatatttactaaataaaattttcacttttgatcattgttaaaatcactagccatcttttctattcttttccaacaaaccacgctaacttaggcgcttcaaagtgctggcgtagacacactgactgggcttaactagcgctaccaaaaatactacaaaagttcgagacttcaagtgaaccaagtggggttcgagttcccgattcatccaccaagtcaaataaatccgagaacgctgggagattcggaccacggaaaaaatacttttttttttgagaaagagatttgtttcaaatggcatttcgaaacacatttgcatatcagaattcgccaatgaagattgttgtcaatggatgtggactttgacgtgtatgacagtgtggtcttgttagggcaaagggcgggagaaaactcaagcgaggcatacgtatgctccgatatcagatttcgggcaaccacgcaagccgcagtgtcaaccacaaaagtcaagctttgaacgggatccacttctcataggctacaacaatacttttagcgattgttttcagtctccccactgttcatggccaattgacaagcctcggcctgaatgccacgactacggttaggatgtctttgcatcgcatggctggaagcgggccggcaaacataagatgttatgactcgatgcatccaatggccagtgtgcatactttgtatatccatggtttatagtccaacaaacttgggaagaactagtattagcagatctcttgccaagttgccacttccgactgatgggtacgaggcctgtacaaggtccaagatttgtcttactcttatctccgatcagtcaaaattcttatccatctcccagccatatgctttacgttccccgtatgcctatacttatatag tttgtccttgttcatctagcacgtccttagctgcataggttgcctctcttcaatccacccacagtgaccaacaccatccctcggcacaaaactctaac-3 '

AO090011000022 promoter (SEQ ID NO: 59): 5'- ggcgtggagtatgtggtagaaacattatggccacatcaagccttctgttggtgtgtcgagtcattagagagaatccacgacgacgaacaaaaacaaagggatggaggaaatgcgtcacgtgctgcttatctcagcagaatatcgacccttctcttccacacgagaccaacatcgcaaccatcatagcgccctgtctgttctgcagtggccctccttgtacagagcatgttattgtgatgtgaagttcactcgacaccgtgagtaaaacgtgacccatctagtgaagggactcccgattgcgaacatttcggtgttagctcggcgtctcatcccgagagactaccgacgaatcctagattgtccgaccagctggattagggttttcgaaatagaaaatcactaatcgaatcccggttggttctgagatctgcattgtcatcataaatttaagttgcgaacatgatcgcggctgcagtgtacagcacatcctgccctggtgcaggacccggggtacgcggtagaccagagaacatgggggtcgaccaagaaagttaacgacgagattctagcctcctatccgcttgatgccctctaactggttattgtctcagttgatgctcccggggaatcttcgtcgtgctgcaacggggatcctcaacataccctcaacgacaactagtgactcactggttggttcgcaaggatggtgcgtcaatcggggtagactatggctagaacctgggggtaaagcgccagcactacagcccaatctctctccatgcggtgggtgtgtggacaggttgatgggcactccctgagctcgaggctctcgtcgtactcttggcctggctgcgcagtccgttacctataaatatctggacgtcctgtactctcagggaagacagaaagacatcaccgggcttcaatgtgtctactact ctgaatacataccctttccacttgacctatcgcgctgtactctttctcatctgtcagcc-3 ’

AO090124000010 promoter (SEQ ID NO: 60): 5'- ctgcagatgaatcttctactacaacagcggtttggtcgtctgagatccggtaaatcacgaatgttggctttttcgcccctcttccggaacggagttgcttgtaggtggtgatgcattcatccgctatggaaacgctgttaatagctcagttagtaaggagccgggaatgtgtaatgtactaataaagggtggtatatatagcaacataccccgatggcatctacaagagtcaagacggacctgggtaagcgaaagtcttcagggacgaggacgatacataccgacatattgatcgctagaaactgaaataggtcaaagactgataaagtgcttgtctgccaatcactgaatccgataagtgactctcactttatatgatggttctggttaggctgctttattccatagaaaaatgaatgcctaaggaaggctgcgctgatttgcttggcggatacctgcggccgcgcaatccgggatgccgagcaggtataacgaccatgaaccctaactcatcctcattgcgacgcgcaatcaatgttacgaagggtctgttgcctggagatgttattgcgtattcacattcatctacgtcgtgaattcatgatgctatcctgagtatttgggcagcctagactaaaccatttaggcatttacgttattttatctataagtacgttgtagctatcgccatatttgcgaggaagttcgcataccgtggctacctctgatctcatcatttggtctatcgttcttatagttcagtgtcgacagactctatctgtattcgaagctccctgattcggtaggacgatcacatcagatccatc-3 '

The present invention provides a strategy for developing a novel antifungal agent with high efficiency.

Reference (1) Ausubel et al., 1987. Current protocols in molecular biology. John Wiley & Sons, New York.
(2) Hara et al., Biosci. Biotechnol. Biochem. 66: 693-696. 2002
(3) Hu et al., PLoS Pathog. 3: e42. 2007
(4) Ishibashi et al., Proc. Natl. Acad. Sci. USA 103: 14871-14876. 2006
(5) Kubodera et al., FEBS Lett. 555: 516-520. 2003
(6) Machida et al., Nature 438: 1157-1161. 2005
(7) Mizutani et al., Fungal Genet. Biol. 45: 878-889. 2008
(8) Shoji et al., FEMS Microbiol. Lett. 244: 41-46. 2005
(9) Takahashi et al., Mol. Gen. Genomics 275: 460-470. 2006
(10) Tamano et al., Fungal Genet. Biol. 45: 139-151. 2008

The schematic diagram of the outline | summary of the antifungal agent development method invented is shown. A schematic diagram of the preparation of a DNA fragment for gene deletion disruption by fusion PCR is shown. An example of confirmation of gene deletion disruption by PCR is shown. The schematic diagram of the gene condition destruction method is shown. A schematic diagram in which a GUS vector pNGG and a reporter gene promoter are inserted is shown. An example of detection of drug stress response using the color development of cells by GUS activity of an energy metabolism reporter and a cytoskeleton formation reporter as an index is shown. A schematic diagram of inserting an EGFP vector pEGFP and a reporter gene promoter therein is shown. An example of detection of drug stress response using as an index fluorescence display of bacterial cells by EGFP, an energy metabolism reporter using the AO090011000022 gene promoter, is shown. An example of drug stress response detection using as an index fluorescence display of bacterial cells by EGFP, a cytoskeleton-forming reporter using the AO090124000010 gene promoter, is shown. For the AO090009000281 gene, an example is shown in which judgment of the target of antifungal agent development and estimation of its function are simultaneously performed by a combination of gene deletion disruption and a reporter detection system. After pre-culture in CD minimal liquid medium at 30 ° C. for 24 hours, the drug was added and the mixture was cultured for 6 hours and photographed. Regarding the AO090020000403 gene, an example is shown in which judgment of the target of antifungal agent development and estimation of its function are simultaneously performed by a combination of gene condition disruption and a reporter detection system. After culturing on the filter at 30 ° C. for 2 days, the filter was transferred to a medium (containing X-gluc (25 μg / ml)) of non-suppressed or suppressed conditions, cultured at 30 ° C. for 4 days, and photographed.

Claims (12)

A method for selecting a target gene of an antifungal agent, comprising at least the following steps 1) to 6):
1) a step of selecting candidate genes for the target gene;
2) By administering a reference enzyme system inhibitor at a concentration that does not cause lethality to fungi but does not cause lethality, and the expression is induced thereby, or by homology analysis with genes of other organisms Selecting a fungal gene predicted to function in the reference enzyme system as a reporter gene candidate gene;
3) collecting a promoter of a candidate gene for the reporter gene and constructing a vector into which the promoter and a marker gene operably linked thereto are introduced;
4) introducing the vector into a fungus to produce a transformant;
5) a step of introducing deletion disruption or conditional disruption into the candidate gene of the target gene of the transformant; and 6) the obtained deletion disruption strain or conditional disruption strain, As a condition for suppressing the expression of a candidate gene, a culture with a complete medium or a minimal medium or a medium containing a reference enzyme inhibitor at a concentration capable of growing in them, A step of selecting a target gene of an antifungal agent by comparing the growth. A method for estimating the function of a target gene of an antifungal agent, comprising at least the following steps 1) to 6):
1) a step of selecting candidate genes for the target gene;
2) By administering a reference enzyme system inhibitor at a concentration that does not cause lethality to fungi but does not cause lethality, and the expression is induced thereby, or by homology analysis with genes of other organisms Selecting a fungal gene predicted to function in the reference enzyme system as a reporter gene candidate gene;
3) collecting a promoter of a candidate gene for the reporter gene and constructing a vector into which the promoter and a marker gene operably linked thereto are introduced;
4) introducing the vector into a fungus to produce a transformant;
5) a step of introducing deletion disruption or conditional disruption into the candidate gene of the target gene of the transformant; and 6) the obtained deletion disruption strain or conditional disruption strain, As a condition for suppressing the expression of a candidate gene, a culture with a complete medium or a minimal medium or a medium containing a reference enzyme inhibitor at a concentration capable of growing in them, A step of estimating the function of the target gene of the antifungal agent by comparing the expression level of the marker gene. The method according to claim 1 or 2, wherein the target gene candidate gene is a gene important for the growth of the fungus. The gene important for the growth of the fungus is a gene corresponding to any one or more of the following a) to f), which is a lethal gene or a growth disorder gene for the fungus: A method according to any one of claims 1-3.
a) an ortholog of a gene that has a lethal effect by deletion disruption in a related fungus or a lethal effect by growth conditions, and in which no extra homolog exists in the genome of the fungus;
b) a gene specifically induced by the addition of an existing antifungal agent to the fungus;
c) Orthologs of genes that are lethal by deletional disruption in related fungi, including Aspergillus oryzae, Aspergillus niger, Magnaporthe grisea, Fusarium graminearum ) Is an ortholog that is common to filamentous fungi whose genome has been decoded, and human (Homo sapiens) and plants (Arabidopsis thaliana) have no ortholog;
d) a gene that is highly expressed in solid culture of the fungus;
e) a gene in which an ortholog of a related fungus gives a lethal effect by deletion disruption; and f) its function is predicted by homology search, etc., and the result shows that the fungus has a lethal or growth disorder effect by deletion disruption. The gene that is expected to be given.   5. The marker gene according to claim 1, wherein the marker gene is selected from the group consisting of a β-glucuronidase gene, a β-galactosidase gene, a luciferase gene, a green or red fluorescent protein gene, a drug resistance gene, and an auxotrophic gene. The method of crab. The method according to any one of claims 1 to 5, wherein the promoter comprises at least part of a base sequence from the translation initiation codon of each candidate gene of the target gene and reporter gene to 1 kb upstream.   The method according to any one of claims 1 to 6, wherein the conditional disruption is performed by replacing a promoter of a candidate gene of a target gene with a thiA promoter, an alcA promoter, a tetA promoter, or a niiA promoter. The method according to any one of claims 1 to 7, wherein the reference enzyme system inhibitor is selected from drugs that inhibit energy metabolism, cell wall formation, and cytoskeleton formation. The method according to any one of claims 1 to 8, wherein the expression level of the marker gene is measured by measuring the amount of protein encoded by the marker gene, the amount of mRNA, or the fluorescence intensity. A vector used in the method according to any one of claims 1 to 9, wherein a promoter gene of a reporter gene candidate gene or a selected reporter gene and a marker gene are introduced downstream thereof. A transformant, wherein the vector according to claim 10 is introduced into a fungus. Functions in the reference enzyme system by analyzing homology with fungal genes or genes of other organisms whose expression is induced by a reference enzyme inhibitor administered at a concentration that impairs fungal growth but does not cause lethality The promoter of the expected fungal gene.