JP2010100548A - Medicine containing new amide derivative - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a medicine containing a compound having excellent stearoyl CoA desaturase-inhibiting actions or a pharmacologically acceptable salt thereof. <P>SOLUTION: The medicine contains the compound having general formula (I) [wherein, R<SP>1</SP>is a hydroxy group, a 1C-6C alkoxy group, a 2C-6C hydroxyalkoxy group or the like; R<SP>2</SP>is a hydroxy group, a 1C-6C alkoxy group, a 2C-6C hydroxyalkoxy group or the like; R<SP>3</SP>is a hydrogen atom or the like; R<SP>4</SP>is a 6C-10C aryl group which may be independently substituted with one to five groups selected from the group A of substituent groups, or the like; V is a group represented by the formula: -NH- or a single bond; W is a group represented by the formula: -NH- or a single bond; T is a group represented by the formula: =C(R<SP>5</SP>)- or a nitrogen atom; and Q is a group represented by the formula: =C(R<SP>6</SP>)- or a nitrogen atom] or a pharmacologically acceptable salt thereof. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention treats and prevents various human diseases associated with stearoyl CoA desaturase such as diabetes, arteriosclerosis, obesity, non-alcoholic steatohepatitis, hyperlipidemia, and hypertension by suppressing the action of stearoyl CoA desaturase. The present invention relates to a pharmaceutical comprising a compound having a specific chemical structure which is effective for pharmacologically or a pharmacologically acceptable salt thereof.

  Acyl-CoA desaturase enzymes catalyze the formation of double bonds with fatty acids that are taken up by cells or produced by intracellular synthesis. In animals, there are four types of acyl-CoA desaturase enzymes that introduce double bonds at the delta-9, delta-6, delta-5, and delta-4 positions of the fatty chain, respectively.

  Stearoyl CoA desaturase (hereinafter also referred to as SCD) is an enzyme that introduces a double bond at the delta-9 position of a saturated fatty acid. In vivo, palmitoyl CoA and stearoyl CoA are mainly converted into palmitoleyl CoA and oleoyl CoA, respectively. These products are used as the main components of phospholipids, triglycerides and cholesterol esters. The ratio of stearic acid to oleic acid affects the fluidity of cell membranes and is considered to be involved in diabetes, obesity, arteriosclerosis, hypertension, neurological diseases, heart diseases, cancer, and aging (Non-patent Document 1).

  Mouse hepatic SCD was highly expressed in leptin-deficient ob / ob mice, which are appetite suppressive hormones, and its expression was suppressed to normal levels by leptin administration. SCD-deficient mice exhibited lower hepatic triglycerides, lower hepatic cholesterol esters, and lower adipose tissue weight than normal mice, and under high fat diet, body weight gain was suppressed and glucose tolerance and insulin sensitivity were increased compared to normal animals. Crossing with ob / ob mice resulted in weight loss, increased metabolism, and normalization of fatty liver (Non-patent Documents 2 and 3).

  In addition, by administering antisense nucleotides to SCD to mice and inhibiting SCD expression and activity, the body weight gain rate, body fat rate, plasma insulin level, blood glucose level are reduced, and fatty acid synthesis, lipid droplets are reduced in the liver. Accumulation decreased (Non-Patent Document 4).

  Based on these experimental results, SCD inhibitors contribute to insulin resistance improvement, hyperglycemia improvement, anti-obesity, liver function improvement, and arteriosclerosis improvement, and have a wide range of effects on the lipid metabolism system, and become a therapeutic drug target. Is inferred.

Heretofore, several compounds having an SCD inhibitory action are known, but all have structures different from the compounds of the present invention. For example, Patent Literature 1 discloses a compound containing a piperidine ring, and Patent Literatures 2 to 5 show compounds containing a piperazine ring.
International Publication No. 2006/034338 Pamphlet International Publication No. 2005/011653 Pamphlet International Publication No. 2005/5011654 Pamphlet US 2005/0119251 gazette International Publication No. 2006/086447 Pamphlet Prog Lipid Res., 1995; 34 (2): 139-150. Science., 2002; 297 (5579): 240-243. Proceedings of the National Academy of Sciences of the United States of America, 2002; 99 (17): 11482-11486. The Journal of Clinical Investigation, 2005; 115 (4): 1030-1038.

  As a result of intensive studies on a compound having an SCD inhibitory action, the inventors have found that a compound having a specific chemical structure has an excellent SCD inhibitory action. In addition, the present inventors have also found that this compound is obesity, obesity, hyperlipidemia, hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, pregnancy A medicament for the prevention and / or treatment of a disease selected from the group consisting of diabetes, polycystic ovary syndrome, arteriosclerosis, atherosclerosis, diabetic arteriosclerosis, fatty liver, and nonalcoholic steatohepatitis The following diseases caused by obesity or due to obesity: hyperlipidemia, hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataracts, gestational diabetes, many Cyst-ovary syndrome, arteriosclerosis, atherosclerosis, diabetic arteriosclerosis, hypertension, cerebrovascular disease, coronary artery disease, fatty liver, respiratory abnormalities, low back pain, osteoarthritis of the knee Gout, and were useful as an active ingredient of a medicament for the treatment and / or prevention of diseases selected from the group consisting of cholelithiasis. The present invention has been completed based on the above findings.

  The present invention relates to (1) general formula (I)

[Where:
R ¹ is a hydroxy group, a C ₁ -C ₆ alkoxy group, a C ₂ -C ₆ hydroxy alkoxy group, a (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkoxy) group, a di- (C ₁ -C ₆ alkyl) amino- (C ₁ -C ₆ alkoxy) group, C ₁ -C ₆ alkoxy group substituted by 4-morpholinyl, (C ₁ -C ₆ alkylthio)-(C ₁ -C ₆ alkoxy) group , (C ₁ -C ₆ alkylsulfinyl)-(C ₁ -C ₆ alkoxy) group, (C ₁ -C ₆ alkylsulfonyl)-(C ₁ -C ₆ alkoxy) group, amino group, mono-C ₁ -C ₆ alkylamino group, di - _(C 1 -C ₆ alkyl) an amino group, a mono _-C 2 -C ₇ alkylcarbonylamino group or a 4-morpholinyl group,
R ² is a hydroxy group, a C ₁ -C ₆ alkoxy group, a C ₂ -C ₆ hydroxy alkoxy group, a (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkoxy) group or a di- (C ₁ -C). ₆ alkyl) amino- (C ₁ -C ₆ alkoxy) group,
R ¹ and R ² do not simultaneously represent a hydroxy group or a C ₁ -C ₆ alkoxy group,
R ³ represents a hydrogen atom, a halogen atom, a C ₁ -C ₆ alkyl group or a hydroxy group,
R ⁴ is a group selected from C ₆ -C ₁₀ aryl group optionally substituted with 1 to 5 groups independently selected from Substituent Group A or 1 to 3 groups independently selected from Substituent Group A And represents an optionally substituted heterocyclic group,
V represents a group represented by the formula —NH— or a single bond,
W represents a group represented by the formula —NH— or a single bond;
V and W do not simultaneously represent a group represented by the formula —NH— or a single bond,
T represents a group represented by the formula = C (R ⁵ )-or a nitrogen atom,
R ⁵ represents a hydrogen atom, a halogen atom or a C ₁ -C ₆ alkyl group,
Q represents a group represented by the formula = C (R ⁶ )-or a nitrogen atom,
R ⁶ represents a hydrogen atom, a halogen atom or a C ₁ -C ₆ alkyl group,
Substituent group A includes a halogen atom, a C ₁ -C ₆ alkyl group, a C ₁ -C ₆ halogenated alkyl group, a C ₁ -C ₆ hydroxyalkyl group, (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkyl) group, C ₁ -C ₆ alkoxy group, C ₁ -C ₆ halogenated alkoxy group, C ₁ -C ₆ alkylthio group, carboxyl group, C ₂ -C ₇ alkylcarbonyl group, C ₂ -C ₇ alkoxycarbonyl group, a nitro group, an amino group, a mono _-C 2 -C ₇ alkylcarbonylamino group, a mono _-C 1 -C ₆ alkylamino group, di - _(C 1 -C ₆ alkyl) amino group, a cyano group, hydroxy group and A group consisting of a carbamoyl group is shown. Or a pharmacologically acceptable salt thereof as an active ingredient.

In the present invention, preferably,
(2) In (1),
A compound wherein R ¹ is a C ₁ -C ₆ alkoxy group, a mono-C ₁ -C ₆ alkylamino group, a di- (C ₁ -C ₆ alkyl) amino group or a 4-morpholinyl group, or a pharmacologically acceptable salt thereof A medicine containing salt as an active ingredient.

(3) In (1),
A pharmaceutical comprising a compound wherein R ¹ is a methoxy group, an ethoxy group, an ethylamino group, a dimethylamino group, a diethylamino group or a 4-morpholinyl group or a pharmacologically acceptable salt thereof as an active ingredient.

(4) In (1),
A pharmaceutical comprising a compound wherein R ¹ is an ethylamino group, a dimethylamino group, a diethylamino group or a 4-morpholinyl group or a pharmacologically acceptable salt thereof as an active ingredient.

(5) In any one item selected from (1) to (4),
A pharmaceutical comprising a compound wherein R ² is a C ₁ -C ₆ alkoxy group or a C ₂ -C ₆ hydroxyalkoxy group or a pharmacologically acceptable salt thereof as an active ingredient.

(6) In any one item selected from (1) to (4),
R ² is medicine containing acceptable salt compound or a pharmacologically a 2-hydroxyethoxy group as an active ingredient.

(7) In any one item selected from (1) to (6),
A pharmaceutical comprising a compound wherein R ³ is a hydrogen atom or a pharmacologically acceptable salt thereof as an active ingredient.

(8) In any one item selected from (1) to (7),
R ⁴ is independently substituted with 1 to 3 groups selected from (halogen atom, C ₁ -C ₆ alkyl group, C ₁ -C ₆ halogenated alkyl group and C ₁ -C ₆ halogenated alkoxy group). Or a pharmacologically acceptable salt thereof as an active ingredient.

(9) In any one item selected from (1) to (7),
Contains, as an active ingredient, a compound or a pharmacologically acceptable salt thereof, wherein R ⁴ is a phenyl group independently substituted with one or two groups selected from (a fluorine atom, a chlorine atom and a trifluoromethyl group) Medicine to do.

(10) In any one item selected from (1) to (7),
R ⁴ is a 3-fluorophenyl group, a 3-chlorophenyl group, a 3-trifluoromethylphenyl group, a 3,4-difluorophenyl group, a 3,5-difluorophenyl group, a 3-chloro-4-fluorophenyl group, 4 -A pharmaceutical comprising a compound which is a fluoro-3-trifluoromethylphenyl group, 3,5-dichlorophenyl group or 3,5-di-trifluoromethylphenyl group or a pharmacologically acceptable salt thereof as an active ingredient.

(11) In any one item selected from (1) to (10),
A pharmaceutical comprising a compound wherein V is a group represented by the formula -NH- and W is a single bond or a pharmacologically acceptable salt thereof as an active ingredient.

(12) In any one item selected from (1) to (11),
A pharmaceutical comprising as an active ingredient a compound wherein T is a nitrogen atom and Q is a group represented by the formula = CH- or a pharmacologically acceptable salt thereof.

(13) In (1),
R ¹ is a C ₁ -C ₆ alkoxy group, a mono-C ₁ -C ₆ alkylamino group, a di- (C ₁ -C ₆ alkyl) amino group or a 4-morpholinyl group, and R ² is C ₁ -C _6. An alkoxy group or a C ₂ -C ₆ hydroxyalkoxy group, R ³ is a hydrogen atom, and R ⁴ is a (halogen atom, C ₁ -C ₆ alkyl group, C ₁ -C ₆ halogenated alkyl group or C _1- A phenyl group which is independently substituted by 1 to 3 groups selected from a group selected from (C ₆ halogenated alkoxy groups), V is a group represented by the formula —NH—, W is a single bond, and T is A pharmaceutical comprising a nitrogen atom and a compound wherein Q is a group represented by the formula = CH- or a pharmacologically acceptable salt thereof as an active ingredient.

(14) In (1),
R ¹ is a methoxy group, ethoxy group, ethylamino group, dimethylamino group, diethylamino group or 4-morpholinyl group, R ² is a 2-hydroxyethoxy group, R ³ is a hydrogen atom, and R ⁴ is ( A phenyl group independently substituted with one or two groups selected from a fluorine atom, a chlorine atom and a trifluoromethyl group, V is a group represented by the formula -NH-, and W is a single bond. A pharmaceutical comprising a compound wherein T is a nitrogen atom and Q is a group represented by the formula = CH- or a pharmacologically acceptable salt thereof as an active ingredient.

(15) In (1),
R ¹ is an ethylamino group, dimethylamino group, diethylamino group or 4-morpholinyl group, R ² is a 2-hydroxyethoxy group, R ³ is a hydrogen atom, R ⁴ is a 3-fluorophenyl group, 3 -Chlorophenyl group, 3-trifluoromethylphenyl group, 3,4-difluorophenyl group, 3,5-difluorophenyl group, 3-chloro-4-fluorophenyl group, 4-fluoro-3-trifluoromethylphenyl group, A 3,5-dichlorophenyl group or a 3,5-di-trifluoromethylphenyl group, V is a group represented by the formula -NH-, W is a single bond, T is a nitrogen atom, and Q is The pharmaceutical which contains the compound which is group represented by Formula = CH-, or its pharmacologically acceptable salt as an active ingredient.

(16) A compound having the general formula (I)
4-dimethylamino-N- [5- (3-fluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide,
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide,
4-dimethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
3- (2-hydroxy-ethoxy) -4-morpholin-4-yl-N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide;
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide, or
N- [5- (3,5-dichlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide or a pharmacological compound thereof A medicine containing an acceptable salt as an active ingredient.

(17) A compound having the general formula (I)
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide,
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide,
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide;
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide, or
N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide or the pharmacology thereof A pharmaceutical comprising a top acceptable salt as an active ingredient.

(18) A compound having the general formula (I)
4-dimethylamino-N- [5- (3-fluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide,
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide,
4-dimethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
3- (2-hydroxy-ethoxy) -4-morpholin-4-yl-N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide;
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide, or
N- [5- (3,5-dichlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide as an active ingredient Contains medicines.

(19) A compound having the general formula (I)
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide,
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide,
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide;
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide, or
N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide is used as the active ingredient. As a medicinal product.

  (20) A medicament comprising the compound according to any one of (1) to (19) or a pharmacologically acceptable salt thereof as an active ingredient.

  (21) The medicament according to (20) for inhibiting stearoyl CoA desaturase.

  (22) The medicament according to (20) for the treatment and / or prevention of a disease caused by increased stearoyl CoA desaturase activity.

  (23) Obesity, obesity, hyperlipidemia, hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome, arteriosclerosis The medicament according to (20) for treatment and / or prevention of infectious disease, atherosclerosis, diabetic arteriosclerosis, fatty liver or nonalcoholic steatohepatitis.

  (24) The following diseases caused by obesity: hyperlipidemia, hypertriglyceridemia, lipid metabolism disorder, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome , Arteriosclerosis, atherosclerosis, diabetic arteriosclerosis, hypertension, cerebrovascular disorder, coronary artery disease, fatty liver, respiratory abnormalities, low back pain, knee osteoarthritis, gout or cholelithiasis and / or The medicament according to (20) for prevention.

  (25) The medicament according to (20) for the treatment and / or prevention of obesity, obesity or hyperlipidemia resulting from obesity, hypertriglyceridemia, diabetes, hypertension or arteriosclerosis.

  (26) The medicament according to (20) for the treatment and / or prevention of obesity or obesity.

  (27) The medicament according to (20) for treating and / or preventing diabetes.

(28) The medicament according to (20) for the treatment and / or prevention of fatty liver or nonalcoholic steatohepatitis,
as well as,
(29) The medicine as described in (20) for the treatment and / or prevention of hyperlipidemia or hypertriglyceridemia can be mentioned.

In the present invention, the “C ₁ -C ₆ alkyl group” is a linear or branched alkyl group having 1 to 6 carbon atoms. For example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, s-butyl, t-butyl, pentyl, isopentyl, 2-methylbutyl, neopentyl, 1-ethylpropyl, hexyl, isohexyl, 4-methylpentyl, 3-methylpentyl 2-methylpentyl, 1-methylpentyl, 3,3-dimethylbutyl, 2,2-dimethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3- A dimethylbutyl, 1-ethylbutyl or 2-ethylbutyl group, preferably a linear or branched alkyl group having 1 to 4 carbon atoms (C ₁ -C ₄ alkyl group), more preferably methyl group, ethyl group, propyl group or an isopropyl group (C ₁ -C ₃ alkyl group), still more preferably a methyl group Is an ethyl group (C ₁ -C ₂ alkyl group), particularly preferably a methyl group.

In the present invention, the “C ₁ -C ₆ alkoxy group” is a group in which the “C ₁ -C ₆ alkyl group” is bonded to an oxygen atom, and is a linear or branched alkoxy group having 1 to 6 carbon atoms. It is. For example, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, s-butoxy, t-butoxy, pentoxy, isopentoxy, 2-methylbutoxy, 1-ethylpropoxy, 2-ethylpropoxy, hexyloxy or 2,3-dimethyl A butoxy group, preferably a linear or branched alkoxy group having 1 to 4 carbon atoms (C ₁ -C ₄ alkoxy group), more preferably a methoxy group, an ethoxy group, a propoxy group or It is an isopropoxy group (C ₁ -C ₃ alkoxy group), more preferably a methoxy group or an ethoxy group (C ₁ -C ₂ alkoxy group), and particularly preferably a methoxy group.

In the present invention, the “C ₁ -C ₆ hydroxyalkyl group” is a group in which one hydroxy group is bonded to a linear or branched alkyl group having 1 to 6 carbon atoms. For example, a hydroxymethyl, hydroxyethyl, hydroxypropyl, hydroxybutyl, hydroxypentyl or hydroxyhexyl group, preferably one hydroxy group is bonded to a linear or branched alkyl group having 2 to 4 carbon atoms More preferably a 2-hydroxyethyl or 3-hydroxypropyl group.

In the present invention, the “C ₂ -C ₆ hydroxyalkoxy group” is a group in which one hydroxy group is bonded to a linear or branched alkoxy group having 2 to 6 carbon atoms. For example, a hydroxyethoxy, hydroxypropoxy, hydroxybutoxy, hydroxypentoxy or hydroxyhexyloxy group, preferably one hydroxy group bonded to a linear or branched alkoxy group having 2 to 4 carbon atoms Group, more preferably a 2-hydroxyethoxy group.

In the present invention, the “(C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkyl) group” means that one “C ₁ -C ₆ alkoxy group” is the above “C ₁ -C ₆ alkyl group”. It is a group bonded to For example, methoxymethyl, ethoxymethyl, propoxymethyl, isopropoxymethyl, butoxymethyl, t-butoxymethyl, 2-methoxyethyl, 2-ethoxyethyl, 2-isopropoxyethyl, 2- (t-butoxy) ethyl, 1- A methoxyethyl group or a 3-isopropoxypropyl group, preferably a group in which one of the “C ₁ -C ₄ alkoxy group” is bonded to the “C ₁ -C ₄ alkyl group” ((C ₁ -C 4 ₄ alkoxy)-(C ₁ -C ₄ alkyl) group, more preferably 2-methoxyethyl group, 2-ethoxyethyl group, 2-propoxyethyl group or 3-methoxypropyl group.

In the present invention, the “(C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkoxy) group” means that one “C ₁ -C ₆ alkoxy group” is the above “C ₁ -C ₆ alkoxy group”. It is a group bonded to. For example, methoxymethoxy, ethoxymethoxy, propoxymethoxy, isopropoxymethoxy, butoxymethoxy, isobutoxymethoxy, s-butoxymethoxy, t-butoxymethoxy, 2-methoxyethoxy, 2-ethoxyethoxy, 2-isopropoxyethoxy, 2- (T-butoxy) ethoxy, 1-methoxyethoxy, 1-ethoxyethoxy, 1- (t-butoxy) ethoxy or 3-isopropoxypropoxy group, preferably one of the above-mentioned “C ₁ -C ₄ alkoxy” Group ”is a group ((C ₁ -C ₄ alkoxy)-(C ₁ -C ₄ alkoxy) group) bonded to the“ C ₁ -C ₄ alkoxy group ”, and more preferably, C ₁ -C ₃ group alkoxy group "is bonded to the" _C 1 -C ₃ alkoxy group "((C ₁ -C ₃ alkoxy ) - (a C ₁ -C ₃ alkoxy) group), more preferably more, a 2-methoxyethoxy group, 2-ethoxyethoxy, 2-propoxyethoxy group, 3-methoxypropoxy group, or 3-ethoxy propoxy group It is.

In the present invention, the “mono-C ₁ -C ₆ alkylamino group” is a group in which one “C ₁ -C ₆ alkyl group” is bonded to an amino group. For example, methylamino, ethylamino, propylamino, isopropylamino, butylamino, isobutylamino, s-butylamino, t-butylamino, pentylamino, isopentylamino, 2-methylbutylamino, neopentylamino, 1-ethyl A propylamino, hexylamino or isohexylamino group, preferably a group in which one of the above-mentioned “C ₁ -C ₄ alkyl groups” is bonded to an amino group (mono-C ₁ -C ₄ alkylamino group) There, more preferably a methylamino group or an ethylamino group (mono--C ₁ -C ₂ alkylamino group), more preferably more, an ethylamino group.

In the present invention, the “di- (C ₁ -C ₆ alkyl) amino group” is a group in which two identical or different “C ₁ -C ₆ alkyl groups” are bonded to an amino group. For example, dimethylamino, diethylamino, dipropylamino, diisopropylamino, dibutylamino, diisobutylamino, dipentylamino, diisopentylamino, dineopentylamino, dihexylamino, N-ethyl-N-methylamino, N-methyl-N -Propylamino, N-isopropyl-N-methylamino, N-butyl-N-methylamino, N-isopentyl-N-methylamino, N-ethyl-N-propylamino or N-ethyl-N-isopropylamino groups And preferably two identical or different “C ₁ -C ₄ alkyl groups” are groups bonded to an amino group (di- (C ₁ -C ₄ alkyl) amino group), more preferably , dimethylamino group, diethylamino group or N- ethyl -N- methylamino group (di- - _(C 1 -C ₂ Alkyl) or an amino group), more preferably more, a dimethylamino group or diethylamino group.

In the present invention, “di- (C ₁ -C ₆ alkyl) amino- (C ₁ -C ₆ alkoxy) group” means that one “di- (C ₁ -C ₆ alkyl) amino group” is “ It is a group bonded to a “C ₁ -C ₆ alkoxy group”. For example, dimethylaminomethoxy, diethylaminomethoxy, dipropylaminomethoxy, N-ethyl-N-methylaminomethoxy, 2- (dimethylamino) ethoxy, 2- (diethylamino) ethoxy, 2- (dipropylamino) ethoxy or 2- (N-ethyl-N-methylamino) ethoxy group, and preferably one of the “di- (C ₁ -C ₄ alkyl) amino groups” is bonded to the “C ₁ -C ₄ alkoxy group”. Group (di- (C ₁ -C ₄ alkyl) amino- (C ₁ -C ₄ alkoxy) group), more preferably dimethylaminomethoxy group, diethylaminomethoxy group, 2- (dimethylamino) ethoxy group Or 2- (diethylamino) ethoxy group.

In the present invention, the “C ₁ -C ₆ alkoxy group monosubstituted by a 4-morpholinyl group” is a group in which one 4-morpholinyl group is bonded to the “C ₁ -C ₆ alkoxy group”. For example, 4-morpholinylmethoxy, 2- (4-morpholinyl) ethoxy or 3- (4-morpholinyl) propoxy group, and preferably one 4-morpholinyl group is the “C ₁ -C ₄ alkoxy”. Group ", more preferably a 2- (4-morpholinyl) ethoxy group.

In the present invention, the “C ₁ -C ₆ alkylthio group” is a group in which the “C ₁ -C ₆ alkyl group” is bonded to a sulfur atom, and is a linear or branched alkylthio group having 1 to 6 carbon atoms. It is. A methylthio, ethylthio, propylthio, isopropylthio, butylthio, isobutylthio, t-butylthio, pentylthio, isopentylthio, neopentylthio or hexylthio group, preferably a straight or branched chain having 1 to 4 carbon atoms an alkylthio group (C ₁ -C ₄ alkylthio group), more preferably a methylthio group or an ethylthio group (C ₁ -C ₂ alkylthio group), even more preferably more, a methylthio group.

In the present invention, the “(C ₁ -C ₆ alkylthio)-(C ₁ -C ₆ alkoxy) group” means that one “C ₁ -C ₆ alkylthio group” is the above “C ₁ -C ₆ alkoxy group”. It is a group bonded to For example, it is a methylthiomethoxy, ethylthiomethoxy, propylthiomethoxy, isopropylthiomethoxy, methylthioethoxy, ethylthioethoxy or methylthiopropoxy group, preferably one said “C ₁ -C ₄ alkylthio” is the above “C _1- C ₄ alkoxy group ”((C ₁ -C ₄ alkylthio)-(C ₁ -C ₄ alkoxy) group), more preferably 2- (methylthio) ethoxy group.

In the present invention, “(C ₁ -C ₆ alkylsulfinyl)-(C ₁ -C ₆ alkoxy) group” is sulfur of the “(C ₁ -C ₆ alkylthio)-(C ₁ -C ₆ alkoxy) group”. It is a group in which one oxygen atom is bonded to an atom. For example, methylsulfinylmethoxy, ethylsulfinylmethoxy, propylsulfinylmethoxy, methylsulfinylethoxy, ethylsulfinylethoxy or methylsulfinylpropoxy group, preferably 2- (methylsulfinyl) ethoxy group.

In the present invention, the “(C ₁ -C ₆ alkylsulfonyl)-(C ₁ -C ₆ alkoxy) group” is the sulfur of the “(C ₁ -C ₆ alkylthio)-(C ₁ -C ₆ alkoxy) group”. A group in which two oxygen atoms are bonded to an atom. For example, methylsulfonylmethoxy, ethylsulfonylmethoxy, propylsulfonylmethoxy, methylsulfonylethoxy, ethylsulfonylethoxy or methylsulfonylpropoxy group, preferably 2- (methylsulfonyl) ethoxy group.

In the present invention, the “C ₂ -C ₇ alkylcarbonyl group” is a group in which the “C ₁ -C ₆ alkyl group” is bonded to a carbonyl group. For example, an acetyl, propionyl, butyryl, isobutyryl, or pentanoyl group, preferably the above-mentioned “C ₁ -C ₄ alkyl group” is a group (C ₂ -C ₅ alkylcarbonyl group) bonded to a carbonyl group, and more An acetyl group or a propionyl group (C ₂ -C ₃ alkylcarbonyl group) is preferable, and an acetyl group is still more preferable.

In the present invention, the “C ₂ -C ₇ alkoxycarbonyl group” is a group in which the “C ₁ -C ₆ alkoxy group” is bonded to a carbonyl group. For example, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, butoxycarbonyl or t-butoxycarbonyl group, and preferably a group (C ₂₎ in which the “C ₁ -C ₄ alkoxy group” is bonded to a carbonyl group. a -C ₅ alkoxycarbonyl group), more preferably a methoxycarbonyl group or an ethoxycarbonyl group (C ₂ -C ₃ alkoxycarbonyl group), further preferably more, a methoxycarbonyl group.

In the present invention, the “mono-C ₂ -C ₇ alkylcarbonylamino group” is a group in which one carbonyl group to which the “C ₁ -C ₆ alkyl group” is bonded is bonded to an amino group. For example, it is an acetamido, ethylcarbonylamino, propylcarbonylamino, isopropylcarbonylamino, butylcarbonylamino, t-butylcarbonylamino or pentylcarbonylamino group, preferably one said “C ₁ -C ₄ alkyl group” Is a group (mono-C ₂ -C ₅ alkylcarbonylamino group) bonded to an amino group, more preferably an acetamido group or an ethylcarbonylamino group (mono-C ₂ -C ₃ alkylcarbonyl). An amino group), and more preferably an acetamide group.

  In the present invention, the “halogen atom” is a fluorine atom, chlorine atom, bromine atom or iodine atom, preferably a fluorine atom, chlorine atom or bromine atom, more preferably a fluorine atom or chlorine atom. is there.

In the present invention, the “C ₁ -C ₆ halogenated alkyl group” is a group in which the same or different 1 to 5 “halogen atoms” are bonded to the “C ₁ -C ₆ alkyl group”. For example, trifluoromethyl, trichloromethyl, difluoromethyl, dibromomethyl, fluoromethyl, 2,2,2-trifluoroethyl, 2,2,2-trichloroethyl, 2-fluoroethyl or pentafluoroethyl group, preferably Is a group (C ₁ -C ₄ halogenated alkyl group) in which the same or different 1 to 5 “halogen atoms” are bonded to the “C ₁ -C ₄ alkyl group”, more preferably the same Or a group (C ₁ -C ₂ halogenated alkyl group) in which 1 to 5 different “halogen atoms” are bonded to the “C ₁ -C ₂ alkyl group”, and more preferably trifluoromethyl. It is a group.

In the present invention, the “C ₁ -C ₆ halogenated alkoxy group” is a group in which the same or different 1 to 5 “halogen atoms” are bonded to the “C ₁ -C ₆ alkoxy group”. For example, trifluoromethoxy, trichloromethoxy, difluoromethoxy, dibromomethoxy, fluoromethoxy, 2,2,2-trifluoroethoxy, 2,2,2-trichloroethoxy, 2-fluoroethoxy or pentafluoroethoxy group, suitable Is a group (C ₁ -C ₄ halogenated alkoxy group) in which the same or different 1 to 5 “halogen atoms” are bonded to the “C ₁ -C ₄ alkoxy group”, and more preferably, 1 to 5 of the same or different “halogen atoms” are groups bonded to the “C ₁ -C ₂ alkoxy group” (C ₁ -C ₂ halogenated alkoxy group), and more preferably trifluoro It is a methoxy group.

In the present invention, the “C ₆ -C ₁₀ aryl group” is an aromatic hydrocarbon group having 6 to 10 carbon atoms. For example, it is a phenyl or naphthyl group, preferably a phenyl group.

  In the present invention, the “heterocyclic group” contains 1 to 3 sulfur atoms, oxygen atoms and / or nitrogen atoms, and may further contain 1 or 2 nitrogen atoms, and the sulfur atom contains 2 oxygen atoms. A 4- to 7-membered heterocyclic group to which atoms may be bonded. For example, a group such as furyl, thienyl, pyrrolyl, azepinyl, pyrazolyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, 1,2,3-oxadiazolyl, triazolyl, tetrazolyl, thiadiazolyl, pyranyl, pyridyl, pyridazinyl, pyrimidinyl or pyrazinyl group An aromatic heterocyclic group "or a tetrahydropyranyl, tetrahydrothienyl, morpholinyl, thiomorpholinyl, pyrrolidinyl, pyrrolinyl, imidazolidinyl, pyrazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, pyrazolidinyl, dioxolanyl or dioxanyl group A “partially or fully reduced saturated heterocyclic group”, wherein the heterocyclic group is a benzene ring (For example, “fused bicyclic spiro group”), such as benzothienyl, benzothiazolyl, benzoxazolyl, isobenzofuranyl, 1,3-dihydroisobenzofuranyl, Quinolyl, 1,3-benzodioxolanyl, 1,4-benzodioxanyl, indolyl, isoindolyl or indolinyl group, preferably an aromatic heterocyclic group, more preferably a pyridyl group Even more preferred is a 3-pyridyl group.

In the present invention, the “C ₆ -C ₁₀ aryl group which may be independently substituted with 1 to 5 groups independently selected from the substituent group A” is 1 independently with a group selected from the substituent group A. Or the above-mentioned “C ₆ -C ₁₀ aryl group” which may be substituted, and preferably (halogen atom, C ₁ -C ₆ alkyl group, C ₁ -C ₆ halogenated alkyl group and C ₁ -C ₆ is 1 to 3 substituted with are phenyl group independently with a group selected from halogenated alkoxy group), more preferably, is selected from (a fluorine atom, a chlorine atom and a trifluoromethyl group) A phenyl group independently substituted with 1 or 2 groups, and even more preferably, a 3-fluorophenyl group, a 3-chlorophenyl group, a 3-trifluoromethylphenyl group, a 3,4-difluorophenyl group, 3, 5 Trifluoromethylphenyl group - difluorophenyl group, 3-chloro-4-fluorophenyl group, 4-fluoro-3-trifluoromethylphenyl group, 3,5-dichlorophenyl group or a 3,5-di.

In the present invention, the “heterocyclic group which may be independently substituted with 1 to 3 groups selected from substituent group A” is independently substituted with 1 to 3 groups selected from substituent group A. The above-mentioned “heterocyclic group” which may be used is preferably represented by (halogen atom, C ₁ -C ₆ alkyl group, C ₁ -C ₆ halogenated alkyl group and C ₁ -C ₆ halogenated alkoxy group). A pyridyl group which is independently substituted with 1 to 3 groups selected from: more preferably (fluorine atom, chlorine atom, methyl group, trifluoromethyl group and trifluoromethoxy group) It is a 3-pyridyl group substituted by one group.

  In the present invention, “V is a group represented by the formula —NH— and W is a single bond” means that “the group represented by the formula —V—C (═O) —W—” is “ A group represented by the formula —NH—C (═O) —.

In the present invention, preferred R ¹ is a C ₁ -C ₆ alkoxy group, a mono-C ₁ -C ₆ alkylamino group, a di- (C ₁ -C ₆ alkyl) amino group or a 4-morpholinyl group, and more Preferred R ¹ is methoxy group, ethoxy group, ethylamino group, dimethylamino group, diethylamino group or 4-morpholinyl group, and even more preferred R ¹ is ethylamino group, dimethylamino group, diethylamino group or 4 -A morpholinyl group.

In the present invention, preferred R ² is a C ₁ -C ₆ alkoxy group or C ₂ -C ₆ hydroxyalkoxy group, and more preferred R ² is a 2-hydroxyethoxy group.

In the present invention, R ³ is preferably a hydrogen atom.

In the present invention, preferred R ⁴ is independently a group selected from (halogen atom, C ₁ -C ₆ alkyl group, C ₁ -C ₆ halogenated alkyl group and C ₁ -C ₆ halogenated alkoxy group). 1 to 3 substituted phenyl groups, more preferably R ⁴ is a phenyl group independently substituted with 1 or 2 groups independently selected from (a fluorine atom, a chlorine atom and a trifluoromethyl group) , and the preferred ^{R 4} even more, 3-fluorophenyl group, a 3-chlorophenyl group, 3-trifluoromethylphenyl group, 3,4-difluorophenyl group, 3,5-difluorophenyl group, 3-chloro - 4-fluorophenyl group, 4-fluoro-3-trifluoromethylphenyl group, 3,5-dichlorophenyl group or 3,5-di-trifluoromethylphenyl group.

  In the present invention, preferred V is a group represented by the formula —NH—.

  In the present invention, preferred W is a single bond.

  In the present invention, preferred T is a nitrogen atom.

In the present invention, preferred R ⁵ is a hydrogen atom.

  In the present invention, Q is preferably a group represented by the formula = CH-.

  The compound having the general formula (I) of the present invention or a pharmacologically acceptable salt thereof has various isomers since an asymmetric carbon atom exists in the molecule. In the compounds of the present invention, these isomers and mixtures of these isomers are all represented by a single formula, that is, the general formula (I). Therefore, the present invention includes all of these isomers and a mixture of these isomers in an arbitrary ratio.

  For the stereoisomers as described above, stereospecific raw material compounds are used, or the compounds according to the present invention are synthesized using asymmetric synthesis or asymmetric induction techniques, or the synthesized compounds according to the present invention Can be obtained by isolation using a conventional optical resolution method or separation method, if desired.

  “Pharmaceutically acceptable salt thereof” refers to a salt that has no significant toxicity and can be used as a medicine. The compound having the general formula (I) of the present invention is reacted with an acid when it has a basic group such as an amino group, and with a base when it has an acidic group such as a carboxyl group. It can be made into a salt by reacting.

Examples of the salt based on the basic group include hydrohalides such as hydrofluoride, hydrochloride, hydrobromide, hydroiodide, nitrate, perchlorate, sulfate, Inorganic acid salts such as phosphates; C ₁ -C ₆ alkyl sulfonates such as methanesulfonate, trifluoromethanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, etc. Organic acid salts such as aryl sulfonate, acetate, malate, fumarate, succinate, citrate, ascorbate, tartrate, succinate, maleate; and glycine salt And amino acid salts such as lysine salts, arginine salts, ornithine salts, glutamates and aspartates.

  On the other hand, examples of the salt based on the acidic group include alkali metal salts such as sodium salt, potassium salt and lithium salt, alkaline earth metal salts such as calcium salt and magnesium salt, metal salts such as aluminum salt and iron salt. Inorganic salts such as ammonium salts, t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucamine salts, guanidine salts, diethylamine salts, triethylamine salts , Dicyclohexylamine salt, N, N′-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzylphenethylamine salt, piperazine salt, tetramethylammonium salt, tris (hydroxymethyl) aminomethane salt, etc. Amine salts such as machine salts; and include glycine salts, lysine salts, arginine salts, ornithine salts, glutamic acid salts, amino acid salts such as aspartate.

  The compound having the general formula (I) of the present invention or a pharmacologically acceptable salt thereof absorbs moisture by being left in the atmosphere or recrystallized, and adsorbs water, or hydrates. Such hydrates are also included in the salts of the present invention.

  The compound having the general formula (I) of the present invention or a pharmacologically acceptable salt thereof may absorb a certain other solvent and become a solvate, and such a solvate is also a solvate of the present invention. Included in the salt.

  Specific examples of the compound having the general formula (I) of the present invention include the compounds shown in the following Tables 1 to 11, but the present invention is not limited to these groups.

In Tables 1 to 11, the meanings of the abbreviations are as follows. That is,
Me represents a methyl group,
Et represents an ethyl group,
Pr represents a normal propyl group,
CH ₂ OMe represents a methoxymethyl group,
CH ₂ CH ₂ SMe represents a 2-methylthioethyl group,
CH ₂ CH ₂ SO ₂ Me represents a 2-methylsulfonylethyl group,
Ph represents a phenyl group,
_3-OCF 3 -Ph represents 3-trifluoromethoxyphenyl group,
3,4-F ₂ -Ph represents a 3,4-difluorophenyl group;
3,5- (CF ₃ ) ₂ -Ph represents a 3,5-di-trifluoromethylphenyl group,
_{4-F-3-CF 3} -Ph represents a 4-fluoro-3-trifluoromethylphenyl group,
Het (A) represents a 2- (4-morpholinyl) ethyl group,
Het (B) represents a 4-morpholinyl group.

  (Table 1)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
1-1 3-F-Ph Me CH ₂ CH ₂ OH
1-2 3-F-Ph Me CH ₂ CH ₂ CH ₂ OH
1-3 3-F-Ph Me CH ₂ CH ₂ OMe
1-4 3-F-Ph Me CH ₂ CH ₂ OEt
1-5 3-F-Ph Me CH ₂ CH ₂ OPr
1-6 3-F-Ph Me CH ₂ CH ₂ CH ₂ OMe
1-7 3-F-Ph Me CH ₂ CH ₂ CH ₂ OEt
1-8 3-F-Ph Me Het (A)
1-9 3-F-Ph Et CH ₂ CH ₂ OH
1-10 3-F-Ph Et CH ₂ CH ₂ CH ₂ OH
1-11 3-F-Ph Et CH ₂ CH ₂ OMe
1-12 3-F-Ph Et CH ₂ CH ₂ OEt
1-13 3-F-Ph Et CH ₂ CH ₂ OPr
1-14 3-F-Ph Et CH ₂ CH ₂ CH ₂ OMe
1-15 3-F-Ph Et CH ₂ CH ₂ CH ₂ OEt
1-16 3-F-Ph CH ₂ CH ₂ OH Me
1-17 3-F-Ph CH ₂ CH ₂ OH Et
1-18 3-F-Ph CH ₂ CH ₂ OH Pr
1-19 3-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-20 3-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-21 3-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-22 3-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-23 3-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-24 3-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-25 3-Cl-Ph Me CH ₂ CH ₂ OH
1-26 3-Cl-Ph Me CH ₂ CH ₂ CH ₂ OH
1-27 3-Cl-Ph Me CH ₂ CH ₂ OMe
1-28 3-Cl-Ph Me CH ₂ CH ₂ OEt
1-29 3-Cl-Ph Me CH ₂ CH ₂ OPr
1-30 3-Cl-Ph Me CH ₂ CH ₂ CH ₂ OMe
1-31 3-Cl-Ph Me CH ₂ CH ₂ CH ₂ OEt
1-32 3-Cl-Ph Me Het (A)
1-33 3-Cl-Ph Et CH ₂ CH ₂ OH
1-34 3-Cl-Ph Et CH ₂ CH ₂ CH ₂ OH
1-35 3-Cl-Ph Et CH ₂ CH ₂ OMe
1-36 3-Cl-Ph Et CH ₂ CH ₂ OEt
1-37 3-Cl-Ph Et CH ₂ CH ₂ OPr
1-38 3-Cl-Ph Et CH ₂ CH ₂ CH ₂ OMe
1-39 3-Cl-Ph Et CH ₂ CH ₂ CH ₂ OEt
1-40 3-Cl-Ph CH ₂ CH ₂ OH Me
1-41 3-Cl-Ph CH ₂ CH ₂ OH Et
1-42 3-Cl-Ph CH ₂ CH ₂ OH Pr
1-43 3-Cl-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-44 3-Cl-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-45 3-Cl-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-46 3-Cl-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-47 3-Cl-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-48 3-Cl-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-49 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
1-50 3-CF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-51 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
1-52 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
1-53 3-CF ₃ -Ph Me CH ₂ CH ₂ OPr
1-54 3-CF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-55 3-CF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-56 3-CF ₃ -Ph Me Het (A)
1-57 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
1-58 3-CF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-59 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
1-60 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
1-61 3-CF ₃ -Ph Et CH ₂ CH ₂ OPr
1-62 3-CF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-63 3-CF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-64 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
1-65 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
1-66 3-CF ₃ -Ph CH ₂ CH ₂ OH Pr
1-67 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-68 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-69 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-70 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-71 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-72 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-73 3-CF ₃ -Ph Me CH ₂ CH ₂ SMe
1-74 3-CF ₃ -Ph Me CH ₂ CH ₂ SOMe
1-75 3-CF ₃ -Ph Me CH ₂ CH ₂ SO ₂ Me
1-76 3-CF ₃ -Ph Et CH ₂ CH ₂ SMe
1-77 3-CF ₃ -Ph Et CH ₂ CH ₂ SOMe
1-78 3-CF ₃ -Ph Et CH ₂ CH ₂ SO ₂ Me
1-79 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ SMe
1-80 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ SOMe
1-81 3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ SO ₂ Me
1-82 3-OCF ₃ -Ph Me CH ₂ CH ₂ OH
1-83 3-OCF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-84 3-OCF ₃ -Ph Me CH ₂ CH ₂ OMe
1-85 3-OCF ₃ -Ph Me CH ₂ CH ₂ OEt
1-86 3-OCF ₃ -Ph Me CH ₂ CH ₂ OPr
1-87 3-OCF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-88 3-OCF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-89 3-OCF ₃ -Ph Me Het (A)
1-90 3-OCF ₃ -Ph Et CH ₂ CH ₂ OH
1-91 3-OCF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-92 3-OCF ₃ -Ph Et CH ₂ CH ₂ OMe
1-93 3-OCF ₃ -Ph Et CH ₂ CH ₂ OEt
1-94 3-OCF ₃ -Ph Et CH ₂ CH ₂ OPr
1-95 3-OCF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-96 3-OCF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-97 3-OCF ₃ -Ph CH ₂ CH ₂ OH Me
1-98 3-OCF ₃ -Ph CH ₂ CH ₂ OH Et
1-99 3-OCF ₃ -Ph CH ₂ CH ₂ OH Pr
1-100 3-OCF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-101 3-OCF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-102 3-OCF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-103 3-OCF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-104 3-OCF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-105 3-OCF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-106 3,4-F ₂ -Ph Me CH ₂ CH ₂ OH
1-107 3,4-F ₂ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-108 3,4-F ₂ -Ph Me CH ₂ CH ₂ OMe
1-109 3,4-F ₂ -Ph Me CH ₂ CH ₂ OEt
1-110 3,4-F ₂ -Ph Me CH ₂ CH ₂ OPr
1-111 3,4-F ₂ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-112 3,4-F ₂ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-113 3,4-F ₂ -Ph Me Het (A)
1-114 3,4-F ₂ -Ph Et CH ₂ CH ₂ OH
1-115 3,4-F ₂ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-116 3,4-F ₂ -Ph Et CH ₂ CH ₂ OMe
1-117 3,4-F ₂ -Ph Et CH ₂ CH ₂ OEt
1-118 3,4-F ₂ -Ph Et CH ₂ CH ₂ OPr
1-119 3,4-F ₂ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-120 3,4-F ₂ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-121 3,4-F ₂ -Ph CH ₂ CH ₂ OH Me
1-122 3,4-F ₂ -Ph CH ₂ CH ₂ OH Et
1-123 3,4-F ₂ -Ph CH ₂ CH ₂ OH Pr
1-124 3,4-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-125 3,4-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-126 3,4-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-127 3,4-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-128 3,4-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-129 3,4-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-130 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
1-131 3-Cl-4-F-Ph Me CH ₂ CH ₂ CH ₂ OH
1-132 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
1-133 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
1-134 3-Cl-4-F-Ph Me CH ₂ CH ₂ OPr
1-135 3-Cl-4-F-Ph Me CH ₂ CH ₂ CH ₂ OMe
1-136 3-Cl-4-F-Ph Me CH ₂ CH ₂ CH ₂ OEt
1-137 3-Cl-4-F-Ph Me Het (A)
1-138 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
1-139 3-Cl-4-F-Ph Et CH ₂ CH ₂ CH ₂ OH
1-140 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
1-141 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
1-142 3-Cl-4-F-Ph Et CH ₂ CH ₂ OPr
1-143 3-Cl-4-F-Ph Et CH ₂ CH ₂ CH ₂ OMe
1-144 3-Cl-4-F-Ph Et CH ₂ CH ₂ CH ₂ OEt
1-145 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
1-146 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
1-147 3-Cl-4-F-Ph CH ₂ CH ₂ OH Pr
1-148 3-Cl-4-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-149 3-Cl-4-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-150 3-Cl-4-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-151 3-Cl-4-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-152 3-Cl-4-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-153 3-Cl-4-F-Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-154 3-F-4-Me-Ph Me CH ₂ CH ₂ OH
1-155 3-F-4-Me-Ph Me CH ₂ CH ₂ OMe
1-156 3-F-4-Me-Ph Me CH ₂ CH ₂ OEt
1-157 3-F-4-Me-Ph Et CH ₂ CH ₂ OH
1-158 3-F-4-Me-Ph Et CH ₂ CH ₂ OMe
1-159 3-F-4-Me-Ph Et CH ₂ CH ₂ OEt
1-160 3-F-4-Me-Ph CH ₂ CH ₂ OH Me
1-161 3-F-4-Me-Ph CH ₂ CH ₂ OH Et
1-162 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
1-163 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-164 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
1-165 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
1-166 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OPr
1-167 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-168 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-169 4-F-3-CF ₃ -Ph Me Het (A)
1-170 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
1-171 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-172 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
1-173 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
1-174 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OPr
1-175 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-176 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-177 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
1-178 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
1-179 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Pr
1-180 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-181 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-182 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-183 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-184 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-185 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-186 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ OH
1-187 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-188 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
1-189 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
1-190 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ OPr
1-191 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-192 3,4-Cl ₂ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-193 3,4-Cl ₂ -Ph Me Het (A)
1-194 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ OH
1-195 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-196 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
1-197 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
1-198 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ OPr
1-199 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-200 3,4-Cl ₂ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-201 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH Me
1-202 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH Et
1-203 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH Pr
1-204 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-205 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-206 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-207 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-208 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-209 3,4-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-210 4-Cl-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
1-211 4-Cl-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
1-212 4-Cl-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
1-213 4-Cl-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
1-214 4-Cl-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
1-215 4-Cl-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
1-216 4-Cl-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
1-217 4-Cl-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
1-218 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
1-219 3,5-F ₂ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-220 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
1-221 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
1-222 3,5-F ₂ -Ph Me CH ₂ CH ₂ OPr
1-223 3,5-F ₂ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-224 3,5-F ₂ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-225 3,5-F ₂ -Ph Me Het (A)
1-226 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
1-227 3,5-F ₂ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-228 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
1-229 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
1-230 3,5-F ₂ -Ph Et CH ₂ CH ₂ OPr
1-231 3,5-F ₂ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-232 3,5-F ₂ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-233 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
1-234 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
1-235 3,5-F ₂ -Ph CH ₂ CH ₂ OH Pr
1-236 3,5-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-237 3,5-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-238 3,5-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-239 3,5-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-240 3,5-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-241 3,5-F ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-242 3-F-5-Cl-Ph Me CH ₂ CH ₂ OH
1-243 3-F-5-Cl-Ph Me CH ₂ CH ₂ OMe
1-244 3-F-5-Cl-Ph Me CH ₂ CH ₂ OEt
1-245 3-F-5-Cl-Ph Et CH ₂ CH ₂ OH
1-246 3-F-5-Cl-Ph Et CH ₂ CH ₂ OMe
1-247 3-F-5-Cl-Ph Et CH ₂ CH ₂ OEt
1-248 3-F-5-Cl-Ph CH ₂ CH ₂ OH Me
1-249 3-F-5-Cl-Ph CH ₂ CH ₂ OH Et
1-250 3-F-5-CF ₃ -Ph Me CH ₂ CH ₂ OH
1-251 3-F-5-CF ₃ -Ph Me CH ₂ CH ₂ OMe
1-252 3-F-5-CF ₃ -Ph Me CH ₂ CH ₂ OEt
1-253 3-F-5-CF ₃ -Ph Et CH ₂ CH ₂ OH
1-254 3-F-5-CF ₃ -Ph Et CH ₂ CH ₂ OMe
1-255 3-F-5-CF ₃ -Ph Et CH ₂ CH ₂ OEt
1-256 3-F-5-CF ₃ -Ph CH ₂ CH ₂ OH Me
1-257 3-F-5-CF ₃ -Ph CH ₂ CH ₂ OH Et
1-258 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
1-259 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-260 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
1-261 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
1-262 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OPr
1-263 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-264 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-265 3,5-Cl ₂ -Ph Me Het (A)
1-266 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
1-267 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-268 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
1-269 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
1-270 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OPr
1-271 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-272 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-273 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
1-274 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
1-275 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Pr
1-276 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-277 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-278 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-279 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-280 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-281 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-282 3-Cl-5-CF ₃ -Ph Me CH ₂ CH ₂ OH
1-283 3-Cl-5-CF ₃ -Ph Me CH ₂ CH ₂ OMe
1-284 3-Cl-5-CF ₃ -Ph Me CH ₂ CH ₂ OEt
1-285 3-Cl-5-CF ₃ -Ph Et CH ₂ CH ₂ OH
1-286 3-Cl-5-CF ₃ -Ph Et CH ₂ CH ₂ OMe
1-287 3-Cl-5-CF ₃ -Ph Et CH ₂ CH ₂ OEt
1-288 3-Cl-5-CF ₃ -Ph CH ₂ CH ₂ OH Me
1-289 3-Cl-5-CF ₃ -Ph CH ₂ CH ₂ OH Et
1-290 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
1-291 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ CH ₂ OH
1-292 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
1-293 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
1-294 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OPr
1-295 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ CH ₂ OMe
1-296 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ CH ₂ OEt
1-297 3,5- (CF ₃ ) ₂ -Ph Me Het (A)
1-298 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
1-299 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ CH ₂ OH
1-300 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
1-301 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
1-302 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OPr
1-303 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ CH ₂ OMe
1-304 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ CH ₂ OEt
1-305 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
1-306 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
1-307 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Pr
1-308 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OH
1-309 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OMe
1-310 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OEt
1-311 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ OPr
1-312 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OMe
1-313 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH CH ₂ CH ₂ CH ₂ OEt
1-314 2,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
1-315 2,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
1-316 2,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
1-317 2,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
1-318 2,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
1-319 2,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
1-320 2,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
1-321 2,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 2)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
2-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
2-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
2-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
2-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
2-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
2-6 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
2-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
2-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
2-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
2-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
2-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
2-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
2-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
2-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
2-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
2-16 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
2-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
2-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
2-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
2-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
2-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
2-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
2-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
2-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
2-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
2-26 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
2-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
2-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
2-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
2-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
2-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
2-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
2-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
2-34 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
2-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
2-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
2-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
2-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
2-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
2-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
2-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
2-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
2-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
2-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
2-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
2-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
2-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
2-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 3)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
3-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
3-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
3-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
3-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
3-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
3-6 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
3-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
3-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
3-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
3-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
3-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
3-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
3-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
3-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
3-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
3-16 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
3-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
3-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
3-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
3-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
3-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
3-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
3-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
3-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
3-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
3-26 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
3-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
3-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
3-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
3-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
3-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
3-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
3-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
3-34 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
3-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
3-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
3-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
3-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
3-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
3-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
3-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
3-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
3-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
3-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
3-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
3-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
3-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
3-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 4)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
4-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
4-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
4-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
4-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
4-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
4-6 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
4-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
4-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
4-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
4-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
4-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
4-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
4-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
4-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
4-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
4-16 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
4-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
4-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
4-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
4-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
4-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
4-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
4-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
4-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
4-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
4-26 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
4-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
4-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
4-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
4-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
4-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
4-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
4-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
4-34 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
4-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
4-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
4-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
4-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
4-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
4-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
4-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
4-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
4-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
4-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
4-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
4-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
4-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
4-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 5)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
5-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
5-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
5-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
5-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
5-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
_{5-6 3-CF 3 -Ph Et CH} 2 CH 2 OEt
5-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
5-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
5-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
5-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
5-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
5-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
5-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
5-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
5-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
5-16 3-Cl-4-F -Ph CH 2 CH 2 OH Et
5-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
5-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
5-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
5-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
5-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
5-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
5-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
5-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
5-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
_{5-26 3,5-F 2 -Ph Me CH} 2 CH 2 OMe
5-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
5-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
5-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
5-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
5-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
5-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
5-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
_{5-34 3,5-Cl 2 -Ph Me CH} 2 CH 2 OMe
5-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
5-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
5-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
5-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
5-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
5-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
5-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
5-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
5-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
5-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
5-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
5-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
5-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
5-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
5-49 Ph Me CH ₂ CH ₂ OH
5-50 Ph Me CH ₂ CH ₂ OMe
5-51 Ph Me CH ₂ CH ₂ OEt
5-52 Ph Et CH ₂ CH ₂ OH
5-53 Ph Et CH ₂ CH ₂ OMe
5-54 Ph Et CH ₂ CH ₂ OEt
5-55 Ph CH ₂ CH ₂ OH Me
5-56 Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 6)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
6-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
6-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
6-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
6-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
6-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
6-6 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
6-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
6-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
6-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
6-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
6-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
6-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
6-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
6-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
6-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
6-16 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
6-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
6-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
6-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
6-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
6-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
6-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
6-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
6-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
6-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
6-26 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
6-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
6-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
6-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
6-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
6-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
6-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
6-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
6-34 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
6-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
6-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
6-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
6-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
6-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
6-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
6-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
6-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
6-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
6-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
6-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
6-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
6-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
6-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 7)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
7-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
7-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
7-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
7-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
7-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
7-6 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
7-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
7-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
7-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
7-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
7-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
7-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
7-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
7-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
7-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
7-16 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
7-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
7-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
7-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
7-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
7-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
7-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
7-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
7-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
7-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
7-26 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
7-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
7-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
7-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
7-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
7-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
7-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
7-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
7-34 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
7-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
7-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
7-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
7-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
7-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
7-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
7-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
7-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
7-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
7-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
7-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
7-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
7-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
7-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 8)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ⁷
―――――――――――――――――――――――――――
8-1 3-CF ₃ -Ph Me CH ₂ CH ₂ OH
8-2 3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
8-3 3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
8-4 3-CF ₃ -Ph Et CH ₂ CH ₂ OH
8-5 3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
8-6 3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
8-7 3-CF ₃ -Ph CH ₂ CH ₂ OH Me
8-8 3-CF ₃ -Ph CH ₂ CH ₂ OH Et
8-9 3-Cl-4-F-Ph Me CH ₂ CH ₂ OH
8-10 3-Cl-4-F-Ph Me CH ₂ CH ₂ OMe
8-11 3-Cl-4-F-Ph Me CH ₂ CH ₂ OEt
8-12 3-Cl-4-F-Ph Et CH ₂ CH ₂ OH
8-13 3-Cl-4-F-Ph Et CH ₂ CH ₂ OMe
8-14 3-Cl-4-F-Ph Et CH ₂ CH ₂ OEt
8-15 3-Cl-4-F-Ph CH ₂ CH ₂ OH Me
8-16 3-Cl-4-F-Ph CH ₂ CH ₂ OH Et
8-17 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OH
8-18 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OMe
8-19 4-F-3-CF ₃ -Ph Me CH ₂ CH ₂ OEt
8-20 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OH
8-21 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OMe
8-22 4-F-3-CF ₃ -Ph Et CH ₂ CH ₂ OEt
8-23 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Me
8-24 4-F-3-CF ₃ -Ph CH ₂ CH ₂ OH Et
8-25 3,5-F ₂ -Ph Me CH ₂ CH ₂ OH
8-26 3,5-F ₂ -Ph Me CH ₂ CH ₂ OMe
8-27 3,5-F ₂ -Ph Me CH ₂ CH ₂ OEt
8-28 3,5-F ₂ -Ph Et CH ₂ CH ₂ OH
8-29 3,5-F ₂ -Ph Et CH ₂ CH ₂ OMe
8-30 3,5-F ₂ -Ph Et CH ₂ CH ₂ OEt
8-31 3,5-F ₂ -Ph CH ₂ CH ₂ OH Me
8-32 3,5-F ₂ -Ph CH ₂ CH ₂ OH Et
8-33 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OH
8-34 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OMe
8-35 3,5-Cl ₂ -Ph Me CH ₂ CH ₂ OEt
8-36 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OH
8-37 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OMe
8-38 3,5-Cl ₂ -Ph Et CH ₂ CH ₂ OEt
8-39 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Me
8-40 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Et
8-41 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OH
8-42 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OMe
8-43 3,5- (CF ₃ ) ₂ -Ph Me CH ₂ CH ₂ OEt
8-44 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OH
8-45 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OMe
8-46 3,5- (CF ₃ ) ₂ -Ph Et CH ₂ CH ₂ OEt
8-47 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Me
8-48 3,5- (CF ₃ ) ₂ -Ph CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――.

  (Table 9)

―――――――――――――――――――――――――――――
Compound number R ⁴ R ³ R ¹⁰ R ⁸ R ⁷
―――――――――――――――――――――――――――――
9-1 3-CF ₃ -Ph H Me Me CH ₂ CH ₂ OH
9-2 3-CF ₃ -Ph H Me Me CH ₂ CH ₂ OMe
9-3 3-CF ₃ -Ph H Me Et CH ₂ CH ₂ OH
9-4 3-CF ₃ -Ph H Me Et CH ₂ CH ₂ OMe
9-5 3-CF ₃ -Ph H Me CH ₂ CH ₂ OH Me
9-6 3-CF ₃ -Ph H Me CH ₂ CH ₂ OH Et
9-7 3-CF ₃ -Ph H Cl Me CH ₂ CH ₂ OH
9-8 3-CF ₃ -Ph H Cl Me CH ₂ CH ₂ OMe
9-9 3-CF ₃ -Ph H Cl Et CH ₂ CH ₂ OH
9-10 3-CF ₃ -Ph H Cl Et CH ₂ CH ₂ OMe
9-11 3-CF ₃ -Ph H Cl CH ₂ CH ₂ OH Me
9-12 3-CF ₃ -Ph H Cl CH ₂ CH ₂ OH Et
9-13 3-CF ₃ -Ph OH H Me CH ₂ CH ₂ OH
9-14 3-CF ₃ -Ph OH H Me CH ₂ CH ₂ OMe
9-15 3-CF ₃ -Ph OH H Et CH ₂ CH ₂ OH
9-16 3-CF ₃ -Ph OH H Et CH ₂ CH ₂ OMe
9-17 3-CF ₃ -Ph OH H CH ₂ CH ₂ OH Me
9-18 3-CF ₃ -Ph OH H CH ₂ CH ₂ OH Et
9-19 3-Cl-4-F-Ph H Me Me CH ₂ CH ₂ OH
9-20 3-Cl-4-F-Ph H Me Me CH ₂ CH ₂ OMe
9-21 3-Cl-4-F-Ph H Me Et CH ₂ CH ₂ OH
9-22 3-Cl-4-F-Ph H Me Et CH ₂ CH ₂ OMe
9-23 3-Cl-4-F-Ph H Me CH ₂ CH ₂ OH Me
9-24 3-Cl-4-F-Ph H Me CH ₂ CH ₂ OH Et
9-25 3-Cl-4-F-Ph H Cl Me CH ₂ CH ₂ OH
9-26 3-Cl-4-F-Ph H Cl Me CH ₂ CH ₂ OMe
9-27 3-Cl-4-F-Ph H Cl Et CH ₂ CH ₂ OH
9-28 3-Cl-4-F-Ph H Cl Et CH ₂ CH ₂ OMe
9-29 3-Cl-4-F-Ph H Cl CH ₂ CH ₂ OH Me
9-30 3-Cl-4-F-Ph H Cl CH ₂ CH ₂ OH Et
9-31 3-Cl-4-F-Ph OH H Me CH ₂ CH ₂ OH
9-32 3-Cl-4-F-Ph OH H Me CH ₂ CH ₂ OMe
9-33 3-Cl-4-F-Ph OH H Et CH ₂ CH ₂ OH
9-34 3-Cl-4-F-Ph OH H Et CH ₂ CH ₂ OMe
9-35 3-Cl-4-F-Ph OH H CH ₂ CH ₂ OH Me
9-36 3-Cl-4-F-Ph OH H CH ₂ CH ₂ OH Et
9-37 4-F-3-CF ₃ -Ph H Me Me CH ₂ CH ₂ OH
9-38 4-F-3-CF ₃ -Ph H Me Me CH ₂ CH ₂ OMe
9-39 4-F-3-CF ₃ -Ph H Me Et CH ₂ CH ₂ OH
9-40 4-F-3-CF ₃ -Ph H Me Et CH ₂ CH ₂ OMe
9-41 4-F-3-CF ₃ -Ph H Me CH ₂ CH ₂ OH Me
9-42 4-F-3-CF ₃ -Ph H Me CH ₂ CH ₂ OH Et
9-43 4-F-3-CF ₃ -Ph H Cl Me CH ₂ CH ₂ OH
9-44 4-F-3-CF ₃ -Ph H Cl Me CH ₂ CH ₂ OMe
9-45 4-F-3-CF ₃ -Ph H Cl Et CH ₂ CH ₂ OH
9-46 4-F-3-CF ₃ -Ph H Cl Et CH ₂ CH ₂ OMe
9-47 4-F-3-CF ₃ -Ph H Cl CH ₂ CH ₂ OH Me
9-48 4-F-3-CF ₃ -Ph H Cl CH ₂ CH ₂ OH Et
9-49 4-F-3-CF ₃ -Ph OH H Me CH ₂ CH ₂ OH
9-50 4-F-3-CF ₃ -Ph OH H Me CH ₂ CH ₂ OMe
9-51 4-F-3-CF ₃ -Ph OH H Et CH ₂ CH ₂ OH
9-52 4-F-3-CF ₃ -Ph OH H Et CH ₂ CH ₂ OMe
9-53 4-F-3-CF ₃ -Ph OH H CH ₂ CH ₂ OH Me
9-54 4-F-3-CF ₃ -Ph OH H CH ₂ CH ₂ OH Et
9-55 3,5-F ₂ -Ph H Me Me CH ₂ CH ₂ OH
9-56 3,5-F ₂ -Ph H Me Me CH ₂ CH ₂ OMe
9-57 3,5-F ₂ -Ph H Me Et CH ₂ CH ₂ OH
9-58 3,5-F ₂ -Ph H Me Et CH ₂ CH ₂ OMe
9-59 3,5-F ₂ -Ph H Me CH ₂ CH ₂ OH Me
9-60 3,5-F ₂ -Ph H Me CH ₂ CH ₂ OH Et
9-61 3,5-F ₂ -Ph H Cl Me CH ₂ CH ₂ OH
9-62 3,5-F ₂ -Ph H Cl Me CH ₂ CH ₂ OMe
9-63 3,5-F ₂ -Ph H Cl Et CH ₂ CH ₂ OH
9-64 3,5-F ₂ -Ph H Cl Et CH ₂ CH ₂ OMe
9-65 3,5-F ₂ -Ph H Cl CH ₂ CH ₂ OH Me
9-66 3,5-F ₂ -Ph H Cl CH ₂ CH ₂ OH Et
9-67 3,5-F ₂ -Ph OH H Me CH ₂ CH ₂ OH
9-68 3,5-F ₂ -Ph OH H Me CH ₂ CH ₂ OMe
9-69 3,5-F ₂ -Ph OH H Et CH ₂ CH ₂ OH
9-70 3,5-F ₂ -Ph OH H Et CH ₂ CH ₂ OMe
9-71 3,5-F ₂ -Ph OH H CH ₂ CH ₂ OH Me
9-72 3,5-F ₂ -Ph OH H CH ₂ CH ₂ OH Et
9-73 3,5-Cl ₂ -Ph H Me Me CH ₂ CH ₂ OH
9-74 3,5-Cl ₂ -Ph H Me Me CH ₂ CH ₂ OMe
9-75 3,5-Cl ₂ -Ph H Me Et CH ₂ CH ₂ OH
9-76 3,5-Cl ₂ -Ph H Me Et CH ₂ CH ₂ OMe
9-77 3,5-Cl ₂ -Ph H Me CH ₂ CH ₂ OH Me
9-78 3,5-Cl ₂ -Ph H Me CH ₂ CH ₂ OH Et
9-79 3,5-Cl ₂ -Ph H Cl Me CH ₂ CH ₂ OH
9-80 3,5-Cl ₂ -Ph H Cl Me CH ₂ CH ₂ OMe
9-81 3,5-Cl ₂ -Ph H Cl Et CH ₂ CH ₂ OH
9-82 3,5-Cl ₂ -Ph H Cl Et CH ₂ CH ₂ OMe
9-83 3,5-Cl ₂ -Ph H Cl CH ₂ CH ₂ OH Me
9-84 3,5-Cl ₂ -Ph H Cl CH ₂ CH ₂ OH Et
9-85 3,5-Cl ₂ -Ph OH H Me CH ₂ CH ₂ OH
9-86 3,5-Cl ₂ -Ph OH H Me CH ₂ CH ₂ OMe
9-87 3,5-Cl ₂ -Ph OH H Et CH ₂ CH ₂ OH
9-88 3,5-Cl ₂ -Ph OH H Et CH ₂ CH ₂ OMe
9-89 3,5-Cl ₂ -Ph OH H CH ₂ CH ₂ OH Me
9-90 3,5-Cl ₂ -Ph OH H CH ₂ CH ₂ OH Et
9-91 3,5- (CF ₃ ) ₂ -Ph H Me Me CH ₂ CH ₂ OH
9-92 3,5- (CF ₃ ) ₂ -Ph H Me Me CH ₂ CH ₂ OMe
9-93 3,5- (CF ₃ ) ₂ -Ph H Me Et CH ₂ CH ₂ OH
9-94 3,5- (CF ₃ ) ₂ -Ph H Me Et CH ₂ CH ₂ OMe
9-95 3,5- (CF ₃ ) ₂ -Ph H Me CH ₂ CH ₂ OH Me
9-96 3,5- (CF ₃ ) ₂ -Ph H Me CH ₂ CH ₂ OH Et
9-97 3,5- (CF ₃ ) ₂ -Ph H Cl Me CH ₂ CH ₂ OH
9-98 3,5- (CF ₃ ) ₂ -Ph H Cl Me CH ₂ CH ₂ OMe
9-99 3,5- (CF ₃ ) ₂ -Ph H Cl Et CH ₂ CH ₂ OH
9-100 3,5- (CF ₃ ) ₂ -Ph H Cl Et CH ₂ CH ₂ OMe
9-101 3,5- (CF ₃ ) ₂ -Ph H Cl CH ₂ CH ₂ OH Me
9-102 3,5- (CF ₃ ) ₂ -Ph H Cl CH ₂ CH ₂ OH Et
9-103 3,5- (CF ₃ ) ₂ -Ph OH H Me CH ₂ CH ₂ OH
9-104 3,5- (CF ₃ ) ₂ -Ph OH H Me CH ₂ CH ₂ OMe
9-105 3,5- (CF ₃ ) ₂ -Ph OH H Et CH ₂ CH ₂ OH
9-106 3,5- (CF ₃ ) ₂ -Ph OH H Et CH ₂ CH ₂ OMe
9-107 3,5- (CF ₃ ) ₂ -Ph OH H CH ₂ CH ₂ OH Me
9-108 3,5- (CF ₃ ) ₂ -Ph OH H CH ₂ CH ₂ OH Et
―――――――――――――――――――――――――――――

  (Table 10)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ¹
―――――――――――――――――――――――――――
10-1 3-F-Ph Me NH ₂
10-2 3-F-Ph Me NHMe
10-3 3-F-Ph Me NHEt
10-4 3-F-Ph Me NHPr
10-5 3-F-Ph Me NMe ₂
10-6 3-F-Ph Me NEt 2
10-7 3-F-Ph Me N (Me) Et
10-8 3-F-Ph Me NHCOMe
10-9 3-F-Ph Me NHCOEt
10-10 3-F-Ph Me Het (B)
10-11 3-F-Ph Et NH ₂
10-12 3-F-Ph Et NHMe
10-13 3-F-Ph Et NHEt
10-14 3-F-Ph Et NHPr
10-15 3-F-Ph Et NMe ₂
10-16 3-F-Ph Et NEt ₂
10-17 3-F-Ph Et N (Me) Et
10-18 3-F-Ph Et NHCOMe
10-19 3-F-Ph Et NHCOEt
10-20 3-F-Ph Et Het (B)
10-21 3-F-Ph CH ₂ CH ₂ OH NH ₂
10-22 3-F-Ph CH ₂ CH ₂ OH NHMe
10-23 3-F-Ph CH ₂ CH ₂ OH NHEt
10-24 3-F-Ph CH ₂ CH ₂ OH NHPr
10-25 3-F-Ph CH ₂ CH ₂ OH NMe ₂
10-26 3-F-Ph CH ₂ CH ₂ OH NEt _{2
10-27 3-F-Ph CH 2} CH 2 OH N (Me) Et
10-28 3-F-Ph CH ₂ CH ₂ OH NHCOMe
10-29 3-F-Ph CH ₂ CH ₂ OH NHCOEt
10-30 3-F-Ph CH ₂ CH ₂ OH Het (B)
10-31 3-Cl-Ph Me NH ₂
10-32 3-Cl-Ph Me NHMe
10-33 3-Cl-Ph Me NHEt
10-34 3-Cl-Ph Me NHPr
10-35 3-Cl-Ph Me NMe ₂
10-36 3-Cl-Ph Me NEt ₂
10-37 3-Cl-Ph Me N (Me) Et
10-38 3-Cl-Ph Me NHCOMe
10-39 3-Cl-Ph Me NHCOEt
10-40 3-Cl-Ph Me Het (B)
10-41 3-Cl-Ph Et NH ₂
10-42 3-Cl-Ph Et NHMe
10-43 3-Cl-Ph Et NHEt
10-44 3-Cl-Ph Et NHPr
10-45 3-Cl-Ph Et NMe ₂
10-46 3-Cl-Ph Et NEt ₂
10-47 3-Cl-Ph Et N (Me) Et
10-48 3-Cl-Ph Et NHCOMe
10-49 3-Cl-Ph Et NHCOEt
10-50 3-Cl-Ph Et Het (B)
_{10-51 3-Cl-Ph CH 2} CH 2 OH NH 2
10-52 3-Cl-Ph CH ₂ CH ₂ OH NHMe
10-53 3-Cl-Ph CH ₂ CH ₂ OH NHEt
10-54 3-Cl-Ph CH ₂ CH ₂ OH NHPr
10-55 3-Cl-Ph CH ₂ CH ₂ OH NMe ₂
10-56 3-Cl-Ph CH ₂ CH ₂ OH NEt ₂
10-57 3-Cl-Ph CH ₂ CH ₂ OH N (Me) Et
10-58 3-Cl-Ph CH ₂ CH ₂ OH NHCOMe
10-59 3-Cl-Ph CH ₂ CH ₂ OH NHCOEt
10-60 3-Cl-Ph CH ₂ CH ₂ OH Het (B)
_{10-61 3-CF 3 -Ph Me NH} 2
10-62 3-CF ₃ -Ph Me NHMe
10-63 3-CF ₃ -Ph Me NHEt
10-64 3-CF ₃ -Ph Me NHPr
10-65 3-CF ₃ -Ph Me NMe ₂
10-66 3-CF ₃ -Ph Me NEt ₂
10-67 3-CF ₃ -Ph Me N (Me) Et
10-68 3-CF ₃ -Ph Me NHCOMe
10-69 3-CF ₃ -Ph Me NHCOEt
10-70 3-CF ₃ -Ph Me Het (B)
10-71 3-CF ₃ -Ph Et NH ₂
10-72 3-CF ₃ -Ph Et NHMe
10-73 3-CF ₃ -Ph Et NHEt
10-74 3-CF ₃ -Ph Et NHPr
10-75 3-CF ₃ -Ph Et NMe ₂
10-76 3-CF ₃ -Ph Et NEt ₂
10-77 3-CF ₃ -Ph Et N (Me) Et
10-78 3-CF ₃ -Ph Et NHCOMe
10-79 3-CF ₃ -Ph Et NHCOEt
10-80 3-CF ₃ -Ph Et Het (B)
10-81 3-CF ₃ -Ph CH ₂ CH ₂ OH NH ₂
10-82 3-CF ₃ -Ph CH ₂ CH ₂ OH NHMe
10-83 3-CF ₃ -Ph CH ₂ CH ₂ OH NHEt
10-84 3-CF ₃ -Ph CH ₂ CH ₂ OH NHPr
10-85 3-CF ₃ -Ph CH ₂ CH ₂ OH NMe ₂
10-86 3-CF ₃ -Ph CH ₂ CH ₂ OH NEt ₂
10-87 3-CF ₃ -Ph CH ₂ CH ₂ OH N (Me) Et
10-88 3-CF ₃ -Ph CH ₂ CH ₂ OH NHCOMe
10-89 3-CF ₃ -Ph CH ₂ CH ₂ OH NHCOEt
10-90 3-CF ₃ -Ph CH ₂ CH ₂ OH Het (B)
10-91 3,5-F ₂ -Ph Me NH ₂
10-92 3,5-F ₂ -Ph Me NHMe
10-93 3,5-F ₂ -Ph Me NHEt
10-94 3,5-F ₂ -Ph Me NHPr
10-95 3,5-F ₂ -Ph Me NMe ₂
10-96 3,5-F ₂ -Ph Me NEt ₂
10-97 3,5-F ₂ -Ph Me N (Me) Et
10-98 3,5-F ₂ -Ph Me NHCOMe
10-99 3,5-F ₂ -Ph Me NHCOEt
10-100 3,5-F ₂ -Ph Me Het (B)
10-101 3,5-F ₂ -Ph Et NH ₂
10-102 3,5-F ₂ -Ph Et NHMe
10-103 3,5-F ₂ -Ph Et NHEt
10-104 3,5-F ₂ -Ph Et NHPr
10-105 3,5-F ₂ -Ph Et NMe ₂
10-106 3,5-F ₂ -Ph Et NEt ₂
10-107 3,5-F ₂ -Ph Et N (Me) Et
10-108 3,5-F ₂ -Ph Et NHCOMe
10-109 3,5-F ₂ -Ph Et NHCOEt
10-110 3,5-F ₂ -Ph Et Het (B)
10-111 3,5-F ₂ -Ph CH ₂ CH ₂ OH NH ₂
10-112 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHMe
10-113 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHEt
10-114 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHPr
10-115 3,5-F ₂ -Ph CH ₂ CH ₂ OH NMe ₂
10-116 3,5-F ₂ -Ph CH ₂ CH ₂ OH NEt ₂
10-117 3,5-F ₂ -Ph CH ₂ CH ₂ OH N (Me) Et
10-118 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHCOMe
10-119 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHCOEt
10-120 3,5-F ₂ -Ph CH ₂ CH ₂ OH Het (B)
10-121 3,5-Cl ₂ -Ph Me NH ₂
10-122 3,5-Cl ₂ -Ph Me NHMe
10-123 3,5-Cl ₂ -Ph Me NHEt
10-124 3,5-Cl ₂ -Ph Me NHPr
10-125 3,5-Cl ₂ -Ph Me NMe ₂
10-126 3,5-Cl ₂ -Ph Me NEt ₂
10-127 3,5-Cl ₂ -Ph Me N (Me) Et
10-128 3,5-Cl ₂ -Ph Me NHCOMe
10-129 3,5-Cl ₂ -Ph Me NHCOEt
10-130 3,5-Cl ₂ -Ph Me Het (B)
10-131 3,5-Cl ₂ -Ph Et NH ₂
10-132 3,5-Cl ₂ -Ph Et NHMe
10-133 3,5-Cl ₂ -Ph Et NHEt
10-134 3,5-Cl ₂ -Ph Et NHPr
10-135 3,5-Cl ₂ -Ph Et NMe ₂
10-136 3,5-Cl ₂ -Ph Et NEt ₂
10-137 3,5-Cl ₂ -Ph Et N (Me) Et
10-138 3,5-Cl ₂ -Ph Et NHCOMe
10-139 3,5-Cl ₂ -Ph Et NHCOEt
10-140 3,5-Cl ₂ -Ph Et Het (B)
10-141 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NH ₂
10-142 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHMe
10-143 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHEt
10-144 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHPr
10-145 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NMe ₂
10-146 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NEt ₂
10-147 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH N (Me) Et
10-148 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHCOMe
10-149 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHCOEt
10-150 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Het (B)
―――――――――――――――――――――――――――.

  (Table 11)

―――――――――――――――――――――――――――
Compound number R ⁴ R ⁸ R ¹
―――――――――――――――――――――――――――
11-1 3-F-Ph Me NH ₂
11-2 3-F-Ph Me NHMe
11-3 3-F-Ph Me NHEt
11-4 3-F-Ph Me NHPr
11-5 3-F-Ph Me NMe ₂
11-6 3-F-Ph Me NEt ₂
11-7 3-F-Ph Me N (Me) Et
11-8 3-F-Ph Me NHCOMe
11-9 3-F-Ph Me NHCOEt
11-10 3-F-Ph Me Het (B)
11-11 3-F-Ph Et NH ₂
11-12 3-F-Ph Et NHMe
11-13 3-F-Ph Et NHEt
11-14 3-F-Ph Et NHPr
11-15 3-F-Ph Et NMe ₂
11-16 3-F-Ph Et NEt ₂
11-17 3-F-Ph Et N (Me) Et
11-18 3-F-Ph Et NHCOMe
11-19 3-F-Ph Et NHCOEt
11-20 3-F-Ph Et Het (B)
11-21 3-F-Ph CH ₂ CH ₂ OH NH ₂
11-22 3-F-Ph CH ₂ CH ₂ OH NHMe
11-23 3-F-Ph CH ₂ CH ₂ OH NHEt
11-24 3-F-Ph CH ₂ CH ₂ OH NHPr
11-25 3-F-Ph CH ₂ CH ₂ OH NMe ₂
11-26 3-F-Ph CH ₂ CH ₂ OH NEt ₂
11-27 3-F-Ph CH ₂ CH ₂ OH N (Me) Et
11-28 3-F-Ph CH ₂ CH ₂ OH NHCOMe
11-29 3-F-Ph CH ₂ CH ₂ OH NHCOEt
11-30 3-F-Ph CH ₂ CH ₂ OH Het (B)
11-31 3-Cl-Ph Me NH ₂
11-32 3-Cl-Ph Me NHMe
11-33 3-Cl-Ph Me NHEt
11-34 3-Cl-Ph Me NHPr
11-35 3-Cl-Ph Me NMe ₂
11-36 3-Cl-Ph Me NEt ₂
11-37 3-Cl-Ph Me N (Me) Et
11-38 3-Cl-Ph Me NHCOMe
11-39 3-Cl-Ph Me NHCOEt
11-40 3-Cl-Ph Me Het (B)
11-41 3-Cl-Ph Et NH ₂
11-42 3-Cl-Ph Et NHMe
11-43 3-Cl-Ph Et NHEt
11-44 3-Cl-Ph Et NHPr
11-45 3-Cl-Ph Et NMe ₂
11-46 3-Cl-Ph Et NEt ₂
11-47 3-Cl-Ph Et N (Me) Et
11-48 3-Cl-Ph Et NHCOMe
11-49 3-Cl-Ph Et NHCOEt
11-50 3-Cl-Ph Et Het (B)
11-51 3-Cl-Ph CH ₂ CH ₂ OH NH ₂
11-52 3-Cl-Ph CH ₂ CH ₂ OH NHMe
11-53 3-Cl-Ph CH ₂ CH ₂ OH NHEt
11-54 3-Cl-Ph CH ₂ CH ₂ OH NHPr
11-55 3-Cl-Ph CH ₂ CH ₂ OH NMe ₂
11-56 3-Cl-Ph CH ₂ CH ₂ OH NEt ₂
11-57 3-Cl-Ph CH ₂ CH ₂ OH N (Me) Et
11-58 3-Cl-Ph CH ₂ CH ₂ OH NHCOMe
11-59 3-Cl-Ph CH ₂ CH ₂ OH NHCOEt
11-60 3-Cl-Ph CH ₂ CH ₂ OH Het (B)
11-61 3-CF ₃ -Ph Me NH ₂
11-62 3-CF ₃ -Ph Me NHMe
11-63 3-CF ₃ -Ph Me NHEt
11-64 3-CF ₃ -Ph Me NHPr
11-65 3-CF ₃ -Ph Me NMe ₂
11-66 3-CF ₃ -Ph Me NEt ₂
11-67 3-CF ₃ -Ph Me N (Me) Et
11-68 3-CF ₃ -Ph Me NHCOMe
11-69 3-CF ₃ -Ph Me NHCOEt
11-70 3-CF ₃ -Ph Me Het (B)
11-71 3-CF ₃ -Ph Et NH ₂
11-72 3-CF ₃ -Ph Et NHMe
11-73 3-CF ₃ -Ph Et NHEt
11-74 3-CF ₃ -Ph Et NHPr
11-75 3-CF ₃ -Ph Et NMe ₂
11-76 3-CF ₃ -Ph Et NEt ₂
11-77 3-CF ₃ -Ph Et N (Me) Et
11-78 3-CF ₃ -Ph Et NHCOMe
11-79 3-CF ₃ -Ph Et NHCOEt
11-80 3-CF ₃ -Ph Et Het (B)
11-81 3-CF ₃ -Ph CH ₂ CH ₂ OH NH ₂
11-82 3-CF ₃ -Ph CH ₂ CH ₂ OH NHMe
11-83 3-CF ₃ -Ph CH ₂ CH ₂ OH NHEt
11-84 3-CF ₃ -Ph CH ₂ CH ₂ OH NHPr
11-85 3-CF ₃ -Ph CH ₂ CH ₂ OH NMe ₂
11-86 3-CF ₃ -Ph CH ₂ CH ₂ OH NEt ₂
11-87 3-CF ₃ -Ph CH ₂ CH ₂ OH N (Me) Et
11-88 3-CF ₃ -Ph CH ₂ CH ₂ OH NHCOMe
11-89 3-CF ₃ -Ph CH ₂ CH ₂ OH NHCOEt
11-90 3-CF ₃ -Ph CH ₂ CH ₂ OH Het (B)
11-91 3,5-F ₂ -Ph Me NH ₂
11-92 3,5-F ₂ -Ph Me NHMe
11-93 3,5-F ₂ -Ph Me NHEt
11-94 3,5-F ₂ -Ph Me NHPr
11-95 3,5-F ₂ -Ph Me NMe ₂
11-96 3,5-F ₂ -Ph Me NEt ₂
11-97 3,5-F ₂ -Ph Me N (Me) Et
11-98 3,5-F ₂ -Ph Me NHCOMe
11-99 3,5-F ₂ -Ph Me NHCOEt
11-100 3,5-F ₂ -Ph Me Het (B)
11-101 3,5-F ₂ -Ph Et NH ₂
11-102 3,5-F ₂ -Ph Et NHMe
11-103 3,5-F ₂ -Ph Et NHEt
11-104 3,5-F ₂ -Ph Et NHPr
11-105 3,5-F ₂ -Ph Et NMe ₂
11-106 3,5-F ₂ -Ph Et NEt ₂
11-107 3,5-F ₂ -Ph Et N (Me) Et
11-108 3,5-F ₂ -Ph Et NHCOMe
11-109 3,5-F ₂ -Ph Et NHCOEt
11-110 3,5-F ₂ -Ph Et Het (B)
11-111 3,5-F ₂ -Ph CH ₂ CH ₂ OH NH ₂
11-112 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHMe
11-113 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHEt
11-114 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHPr
11-115 3,5-F ₂ -Ph CH ₂ CH ₂ OH NMe ₂
11-116 3,5-F ₂ -Ph CH ₂ CH ₂ OH NEt ₂
11-117 3,5-F ₂ -Ph CH ₂ CH ₂ OH N (Me) Et
11-118 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHCOMe
11-119 3,5-F ₂ -Ph CH ₂ CH ₂ OH NHCOEt
11-120 3,5-F ₂ -Ph CH ₂ CH ₂ OH Het (B)
11-121 3,5-Cl ₂ -Ph Me NH ₂
11-122 3,5-Cl ₂ -Ph Me NHMe
11-123 3,5-Cl ₂ -Ph Me NHEt
11-124 3,5-Cl ₂ -Ph Me NHPr
11-125 3,5-Cl ₂ -Ph Me NMe ₂
11-126 3,5-Cl ₂ -Ph Me NEt ₂
11-127 3,5-Cl ₂ -Ph Me N (Me) Et
11-128 3,5-Cl ₂ -Ph Me NHCOMe
11-129 3,5-Cl ₂ -Ph Me NHCOEt
11-130 3,5-Cl ₂ -Ph Me Het (B)
11-131 3,5-Cl ₂ -Ph Et NH ₂
11-132 3,5-Cl ₂ -Ph Et NHMe
11-133 3,5-Cl ₂ -Ph Et NHEt
11-134 3,5-Cl ₂ -Ph Et NHPr
11-135 3,5-Cl ₂ -Ph Et NMe ₂
11-136 3,5-Cl ₂ -Ph Et NEt ₂
11-137 3,5-Cl ₂ -Ph Et N (Me) Et
11-138 3,5-Cl ₂ -Ph Et NHCOMe
11-139 3,5-Cl ₂ -Ph Et NHCOEt
11-140 3,5-Cl ₂ -Ph Et Het (B)
11-141 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NH ₂
11-142 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHMe
11-143 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHEt
11-144 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHPr
11-145 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NMe ₂
11-146 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NEt ₂
11-147 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH N (Me) Et
11-148 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHCOMe
11-149 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH NHCOEt
11-150 3,5-Cl ₂ -Ph CH ₂ CH ₂ OH Het (B)
―――――――――――――――――――――――――――.

  In Table 1 to Table 11, suitable compounds are compound numbers 1-16, 1-17, 1-40, 1-41, 1-44, 1-65, 1-121, 1-122, 1-145, 1-177, 1-178, 1-233, 1-234, 1-273, 1-305, 10-25, 10-53, 10-55, 10-56, 10-83, 10-85, 10- 86, 10-90, 10-113, 10-116, 10-143 or 10-145.

More preferred compounds are
4-dimethylamino-N- [5- (3-fluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-25),
N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-53),
N- [5- (3-chlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-55),
N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-56),
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 10-83),
4-dimethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10-85),
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10-86),
3- (2-hydroxy-ethoxy) -4-morpholin-4-yl-N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10-90),
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-113),
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-116),
N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-143), or
N- [5- (3,5-dichlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-145)
It is.

Even more preferred compounds are
N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-53),
N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-56),
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 10-83),
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10-86),
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-113),
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-116), or
N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-143)
It is.

  The compound having the general formula (I) of the present invention or a pharmacologically acceptable salt thereof has an excellent SCD inhibitory action, and is described below in warm-blooded animals (preferably mammals, including humans). Disease: Obesity, obesity, hyperlipidemia, hypertriglyceridemia, lipid metabolism disorder, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome, arteriosclerosis A disease selected from the group consisting of atherosclerosis, diabetic arteriosclerosis, fatty liver, and nonalcoholic steatohepatitis, or the following diseases caused by obesity: hyperlipidemia, hypertriglyceridemia, Dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome, arteriosclerosis, atherosclerosis, diabetic A medicament for the prevention and / or treatment of a disease selected from the group consisting of arteriosclerosis, hypertension, cerebrovascular disorder, coronary artery disease, fatty liver, respiratory disorder, low back pain, knee osteoarthritis, gout, and cholelithiasis Useful as. Further, the compound having the general formula (I) provided by the present invention or a pharmacologically acceptable salt thereof has an excellent SCD inhibitory action, and is a warm-blooded animal (preferably a mammal, It is useful as an active ingredient of a medicament for the prevention and / or treatment of the above-mentioned diseases. Preferred diseases include those selected from the group consisting of obesity, obesity, hyperlipidemia, hypertriglyceridemia, dyslipidemia, diabetes, arteriosclerosis, fatty liver, and nonalcoholic steatohepatitis, or The following diseases caused by obesity: diseases selected from the group consisting of hyperlipidemia, hypertriglyceridemia, dyslipidemia, diabetes, arteriosclerosis, hypertension, cerebrovascular disease, and coronary artery disease, and more Preferred are obesity, obesity, hyperlipidemia, hypertriglyceridemia, diabetes, fatty liver or nonalcoholic steatohepatitis. Suitably, it can be used as a medicament for the treatment of the above-mentioned diseases.

  The compound having the general formula (I) of the present invention can be produced according to the methods A to P described below.

  The solvent used in the reaction of each step of the following methods A to P is not particularly limited as long as it does not inhibit the reaction and dissolves the starting materials to some extent, and is selected from, for example, the following solvent group. Solvents are hydrocarbons such as pentane, hexane, octane, petroleum ether, ligroin, cyclohexane; formamide, N, N-dimethylformamide, N, N-dimethylacetamide, N-methyl-2-pyrrolidone, N-methyl Amides such as 2-pyrrolidinone and hexamethylphosphoric triamide; ethers such as diethyl ether, diisopropyl ether, tetrahydrofuran, dioxane, dimethoxyethane, diethylene glycol dimethyl ether; methanol, ethanol, n-propanol, i-propanol, n Alcohols such as 2-butanol, 2-butanol, 2-methyl-1-propanol, t-butanol, isoamyl alcohol, diethylene glycol, glycerin, octanol, cyclohexanol, methyl cellosolve Sulfoxides such as dimethyl sulfoxide; sulfones such as sulfolane; nitriles such as acetonitrile, propionitrile, butyronitrile, isobutyronitrile; ethyl formate, ethyl acetate, propyl acetate, butyl acetate, diethyl carbonate Esters such as acetone, methyl ethyl ketone, 4-methyl-2-pentanone, methyl isobutyl ketone, isophorone, cyclohexanone, nitro compounds such as nitroethane and nitrobenzene, dichloromethane, 1,2-dichloroethane, chlorobenzene, Halogenated hydrocarbons such as dichlorobenzene, chloroform, and carbon tetrachloride; aromatic hydrocarbons such as benzene, toluene, and xylene; such as acetic acid, formic acid, propionic acid, butyric acid, and trifluoroacetic acid Carboxylic acids; N-methylmorpholine, triethylamine, tripropylamine, tributylamine, diisopropylethylamine, dicyclohexylamine, N-methylpiperidine, pyridine, 4-pyrrolidinopyridine, picoline, 4- (N, N-dimethylamino) pyridine 2,6-di (t-butyl) -4-methylpyridine, quinoline, N, N-dimethylaniline, N, N-diethylaniline, 1,5-diazabicyclo [4.3.0] non-5-ene (DBN), 1,4-diazabicyclo [2.2.2] octane (DABCO), 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU), amines such as piperidine; water And a mixed solvent thereof.

  The base used in the reaction of each step of the following methods A to P is, for example, alkali metal carbonates such as sodium carbonate, potassium carbonate, lithium carbonate, cesium carbonate; sodium hydrogen carbonate, potassium hydrogen carbonate, lithium hydrogen carbonate Alkali metal hydrogen carbonates such as lithium hydride, sodium hydride, alkali metal hydrides such as potassium hydride; alkali metal water such as sodium hydroxide, potassium hydroxide, barium hydroxide, lithium hydroxide Oxides; inorganic bases such as alkali metal fluorides such as sodium fluoride and potassium fluoride; sodium methoxide, sodium ethoxide, sodium-t-butoxide, potassium methoxide, potassium ethoxide, potassium-t Alkali metal alkoxides such as butoxide and lithium methoxide Xoxides; alkali metal trialkylsiloxides such as sodium trimethylsiloxide, potassium trimethylsiloxide, lithium trimethylsiloxide; mercaptan alkali metals such as methyl mercaptan sodium and ethyl mercaptan sodium; N-methylmorpholine, triethylamine, Tripropylamine, tributylamine, diisopropylethylamine, dicyclohexylamine, N-methylpiperidine, pyridine, 4-pyrrolidinopyridine, picoline, 4- (N, N-dimethylamino) pyridine, 2,6-di (t-butyl) -4-methylpyridine, quinoline, N, N-dimethylaniline, N, N-diethylaniline, 1,5-diazabicyclo [4.3.0] non-5-ene (DBN), 1,4-diazabi (B) Organic bases such as [2.2.2] octane (DABCO), 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU); or butyllithium, lithium diisopropylamide, lithium Organometallic bases such as bis (trimethylsilyl) amide; amino acids such as proline.

  The palladium catalyst used in the reaction of each step of the following method A to method P is, for example, tetrakis (triphenylphosphine) palladium, palladium-activated carbon, palladium (II) acetate, palladium (II) trifluoroacetate, palladium black , Palladium (II) bromide, palladium (II) chloride, palladium (II) iodide, palladium (II) cyanide, palladium (II) nitrate, palladium (II) oxide, palladium (II) sulfate, dichlorobis (acetonitrile) Palladium (II), dichlorobis (benzonitrile) palladium (II), dichloro (1,5-cyclooctadiene) palladium (II), acetylacetone palladium (II), palladium (II) sulfide, dichloro [1,1′-bis (Diphenylphosphino) ferrocene] Indium (II), tris (dibenzylideneacetone) dipalladium (0), tetrakis (acetonitrile) palladium (II) 2-valent palladium catalyst or a zerovalent palladium catalyst, such as tetrafluoroborate or aryl chlorides palladium dimer.

  The condensing agent used in the reaction in each step of the following methods A to P is, for example, O- (7-azabenzotriazol-1-yl) -N, N, N ′, N′-tetramethyluronium hexa Fluorophosphate (HATU), 1-propanephosphonic acid cyclic anhydride (T3P), dicyclohexylcarbodiimide (DCCD), 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (EDCI), isobutyl chloroformate (IBCF) ), 1,1′-carbonylbis-1H-imidazole (CDI), diethyl cyanophosphonate (DEPC), diphenyl phosphate azide (DPPA), N-hydroxysuccinimide, 1-hydroxybenzotriazole, N-hydroxy-5 -Norbornene-2,3-dicarboximide or dipyridi It is a disulfide.

  In the reaction of each step of the following methods A to P, the reaction temperature varies depending on the solvent, starting material, reagent, and the like, and the reaction time varies depending on the solvent, starting material, reagent, reaction temperature, and the like.

  In the reaction of each step of the following methods A to P, after completion of the reaction, each target compound is collected from the reaction mixture according to a conventional method. For example, neutralize the reaction mixture as appropriate, or remove insoluble matter by filtration, add water and an immiscible organic solvent such as ethyl acetate, and separate the organic layer containing the target compound, It can be obtained by washing with water, etc., drying over anhydrous magnesium sulfate, anhydrous sodium sulfate, anhydrous sodium hydrogencarbonate, etc., filtering, and then distilling off the solvent. If necessary, the obtained target compound is eluted with an appropriate eluent by applying a conventional method, for example, recrystallization, reprecipitation, etc., usually using methods commonly used for separation and purification of organic compounds, applying chromatography, and the like. Can be separated and purified. For a target compound insoluble in a solvent, the obtained solid crude product can be purified by washing with a solvent. In addition, the target compound in each step can be directly used in the next reaction without purification.

  Method A is a method for producing a compound having the general formula (IA).

In the present invention, R ¹ , R ² , R ³ , R ⁴ , T and Q are as defined above, and R ^1a , R ^2a , R ^3a and R ^4a are R ¹ , R ² , R ^The amino group, hydroxy group and / or carboxyl group contained as a substituent in the groups ³ and R ⁴ are amino groups, hydroxy groups and / or carboxyl groups which may be protected, R ¹ , R ² , R ³ and R ⁴ are the same groups as defined in the definition of the group.

Step A1 This step is a step of producing a compound having the general formula (IA).

In this step, in the presence of a condensing agent and a base in an inert solvent, a known compound or a compound having the general formula (XIII) easily obtained in the same manner as a known method using a known compound as a starting material After reacting a known compound as a starting material with a compound having the general formula (XIV) which can be easily obtained in the same manner as in the known method, an amino group or a hydroxy group in R ^1a , R ^2a , R ^3a and R ^{4a as required} And / or by removing the protecting group of the carboxyl group.

  The inert solvent used in this step is preferably an amide, and more preferably N, N-dimethylacetamide.

  The condensing agent used in this step is preferably O- (7-azabenzotriazol-1-yl) -N, N, N ′, N′-tetramethyluronium hexafluorophosphate (HATU). .

  The base used in this step is preferably an organic base, and more preferably triethylamine.

  The reaction temperature in this step is usually −40 ° C. to 200 ° C., preferably 0 ° C. to 100 ° C.

  The reaction time in this step is usually 0.5 to 96 hours, preferably 1 to 24 hours.

  Method B is a method for producing a compound having the general formula (IB).

In the present invention, R ¹ , R ² , R ³ , R ⁴ , R ^1a , R ^2a , R ^3a , R ^4a , T and Q are as defined above.

Step B1 This step is a step of producing a compound having the general formula (IB).

In this step, in the presence of a condensing agent and a base in an inert solvent, a known compound or a compound having the general formula (XV) easily obtained in the same manner as a known method using a known compound as a starting material is converted to a known compound or The reaction is carried out in the same manner as in Step A1 of Method A by reacting a known compound with a compound having the general formula (XVI) which can be easily obtained in the same manner as in the known method using a starting material, and then optionally R ^1a , R ^2a , R ^3a and R ^4a are carried out by removing the protecting group of the amino group, hydroxy group and / or carboxyl group.

  Method C is a method for producing a compound having the general formula (IB).

In the present invention, R ¹ , R ² , R ³ , R ⁴ , R ^1a , R ^2a , R ^3a , R ^4a , T and Q are as defined above, and Z is a hydrogen atom, a chlorine atom Represents a bromine atom or an iodine atom.

Step C1 This step is a step of producing a compound having the general formula (XVII).

  When Z represents a chlorine atom, a bromine atom or an iodine atom, this step can be carried out by converting the general formula (XIII) easily obtained in the same manner as in a known method using a known compound or a known compound as a starting material in an inert solvent. In the presence of a copper salt in the presence of a copper salt, such as J. Org. Chem. 1996, 61, 4623. or BMCL 2001, 11, 641-646, etc. It is performed according to the method described in 1.

  In the case where Z represents a hydrogen atom, in this step, the phosphinic acid is a compound having the general formula (XIII) that is easily obtained in the same manner as in a known method using a known compound or a known compound as a starting material in an inert solvent. In the presence of nitrite, it is a step of reacting with sodium nitrite or t-butyl nitrite, for example, according to the method described in J. Med. Chem. 1977, 20, 572, etc.

  The inert solvent used in this step is preferably a nitrile, and more preferably acetonitrile. If necessary, it can be a mixed solvent with water (mixing ratio is 1: 100 to 100: 1, preferably 10: 1 to 1:10).

  The copper salt used in this step is, for example, zero-valent copper or a complex thereof; copper chloride (I), copper bromide (I), copper iodide (I), copper trifluoromethanesulfonate (I), and the like. Or a divalent copper salt such as copper (II) chloride, copper (II) bromide, copper (II) acetate, copper (II) sulfate, or copper (II) iodide. , Preferably a monovalent copper salt or a divalent copper salt, and more preferably copper (II) bromide.

  The reaction temperature in this step is usually −10 ° C. to 60 ° C., preferably 0 ° C. to 30 ° C.

  The reaction time in this step is usually 0.1 hour to 24 hours, preferably 0.5 hour to 2 hours.

Step C2 This step is a step of producing a compound having the general formula (IB) and comprises (i) to (iii).

  (I) This step is performed by reacting a compound having the general formula (XVII) with an organometallic base in an inert solvent.

  The inert solvent used in this step is preferably an ether, and more preferably tetrahydrofuran.

  The organometallic base used in this step is, for example, butyl lithium, lithium diisopropylamide, lithium bis (trimethylsilyl) amide, and preferably butyl lithium.

  The reaction temperature in this step is usually −100 ° C. to 30 ° C., preferably −78 ° C. to −20 ° C.

  The reaction time in this step is usually 0.1 hour to 24 hours, preferably 0.5 hour to 2 hours.

  (Ii) This step is performed by reacting a compound having the general formula (XVI) with a base and phosgene in an inert solvent.

  The inert solvent used in this step is preferably a halogenated hydrocarbon, and more preferably dichloromethane.

  The base used in this step is preferably an organic base, and more preferably triethylamine.

  The phosgene used in this step is, for example, phosgene, diphosgene, or triphosgene, and preferably triphosgene.

  The reaction temperature in this step is usually −20 ° C. to 60 ° C., preferably 0 ° C. to 30 ° C.

  The reaction time in this step is usually 0.1 hour to 24 hours, preferably 0.5 hour to 2 hours.

(Iii) In this step, after reacting the compound obtained in (i) with the compound obtained in (ii) in an inert solvent, R ^1a , R ^2a , R ^3a and R ^{4a are} optionally reacted. The amino group, hydroxy group and / or carboxyl group protecting group is removed.

  The inert solvent used in this step is preferably an ether, and more preferably tetrahydrofuran.

  The reaction temperature in this step is usually −100 ° C. to 100 ° C., preferably −78 ° C. to 30 ° C.

  The reaction time in this step is usually 0.1 hour to 24 hours, preferably 0.5 hour to 2 hours.

  Method D is a method for producing a compound having the general formula (IC).

In the present invention, R ¹ , R ² , R ⁴ , R ^1a , R ^2a , R ^4a , T and Q have the same meaning as described above.

Step D1 This step is a step of producing a compound having the general formula (XIX).

In this step, in the presence of a condensing agent and a base in an inert solvent, a known compound or a compound having the general formula (XVIII) easily obtained in the same manner as a known method using a known compound as a starting material is converted to a known compound or The reaction is carried out in the same manner as in Step A1 of Method A by reacting a known compound with a compound having the general formula (XIV) which can be easily obtained in the same manner as in the known method using a starting material, and optionally R ^1a , R ^2a and R ^4a are carried out by removing the protecting group of the amino group, hydroxy group and / or carboxyl group.

Step D2 This step is a step of producing a compound having the general formula (IC).

  This step is performed by reacting a compound having the general formula (XIX) with a reducing agent in an inert solvent.

  The inert solvent used in this step is preferably an ether or an alcohol, more preferably tetrahydrofuran or methanol, and still more preferably a mixed solvent of tetrahydrofuran and methanol. As needed, it can be set as the mixed solvent with water (mixing ratio is 1: 100-100: 1).

  The reducing agent used in this step is, for example, alkali metal borohydride such as sodium borohydride, lithium borohydride, sodium cyanoborohydride; diisobutylaluminum hydride, lithium aluminum hydride, lithium hydride Aluminum hydride compounds such as ethoxide aluminum; hydride reagents of organic aluminum hydride reducing agents such as sodium tellurium hydride, diisobutylaluminum hydride, sodium bismethoxyethoxyaluminum hydride; or alkali metals such as sodium and lithium Preferred are alkali metal borohydrides, and more preferred is sodium borohydride.

  The reaction temperature in this step is usually 0 ° C. to 80 ° C., preferably 10 ° C. to 30 ° C.

  The reaction time in this step is usually 0.1 hour to 24 hours, preferably 0.5 hour to 2 hours.

In the method E, among the compounds having the general formula (XIII) used in the method A step A1 and the method C step C1, T is a nitrogen atom, and Q is represented by the formula = C (R ⁶ )-. Is a method for producing a compound having the general formula (XXIV).

In the present invention, R ^3a , R ^4a and R ⁶ are as defined above, and X represents a chlorine atom, a bromine atom or an iodine atom.

Step E1 This step is a step of producing a compound having the general formula (XXII).

  In this step, in the presence of a base, a phase transfer catalyst and a palladium catalyst in an inert solvent, a known compound or a compound having the general formula (XX) which can be easily obtained in the same manner as a known method using a known compound as a starting material. In this step, a known compound or a known compound is reacted as a starting material with a compound having the general formula (XXI) which can be easily obtained in the same manner as in the known method. For example, J. Org. Chem. 1996, 61, 2604- This is performed according to the method described in 2605 and the like.

  The inert solvent used in this step is preferably an amide, and more preferably N, N-dimethylformamide. If necessary, it can be a mixed solvent with water.

  The base used in this step is preferably an alkali metal hydrogen carbonate, and more preferably sodium hydrogen carbonate.

  The phase transfer catalyst used in this step is, for example, tetrabutylammonium chloride (TBACl), tetrabutylammonium bromide, or tetrabutylammonium iodide, and preferably TBACl.

  The palladium catalyst used in this step is preferably palladium (II) acetate.

  The reaction temperature in this step is usually 0 ° C. to 160 ° C., preferably 20 ° C. to 60 ° C.

  The reaction time in this step is usually 0.1 to 96 hours, preferably 0.5 to 12 hours.

Step E2 This step is a step of producing a compound having the general formula (XXIII).

  This step is a step of reacting a compound having the general formula (XXII) with a halogenating agent in an inert solvent in the presence or absence (preferably in the presence) of a base. Am. Chem. Soc. 2004, 126, 4790-4791, etc.

  The inert solvent used in this step is preferably a halogenated hydrocarbon, and more preferably dichloromethane.

  The base used in this step is preferably an amino acid, and more preferably proline.

  The halogenating agent used in this step is a chlorinating agent, brominating agent or iodinating agent. For example, hydrochloric acid, chlorine, phosphorus trichloride, phosphorus pentachloride, phosphorus oxychloride, oxalyl chloride, thionyl chloride, Toluenesulfonic acid chloride, sulfonyl chloride, N-chlorosuccinimide, trimethylsilyl chloride, odorous acid, bromine, phosphorus tribromide, phosphorus pentabromide, phosphorus oxybromide, oxalyl bromide, thionyl bromide, toluenesulfonic acid chloride, chloride Sulfonyl, N-bromosuccinimide, or trimethylsilyl bromide, preferably N-chlorosuccinimide, trimethylsilyl chloride, N-bromosuccinimide, or trimethylsilyl bromide.

  The reaction temperature in this step is usually −20 ° C. to 140 ° C., preferably 0 ° C. to 60 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 6 hours.

Step E3 This step is a step of producing a compound having the general formula (XXIV).

  This step is a step of reacting a compound having the general formula (XXIII) with thiourea in an inert solvent. For example, according to the method described in Russian J. Org. Chem. 2004, 40, 383-389, etc. Done.

  The inert solvent used in this step is preferably an alcohol, and more preferably ethanol.

  The reaction temperature in this step is usually 0 ° C. to 160 ° C., preferably 20 ° C. to 100 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 6 hours.

Method F is a group represented by the formula = C (R ⁵ )-in the compound having general formula (XIII) used in Method A, Step A1 and Method C, Step C1, and Q is This is a method for producing a compound having the general formula (XXVIII) which is a nitrogen atom.

In the present invention, R ^3a , R ^4a and R ⁵ have the same meaning as described above.

Step F1 This step is a step of producing a compound having the general formula (XXVII).

  In this step, in the presence of a condensing agent and a base in an inert solvent, a known compound or a compound having the general formula (XXV) easily obtained in the same manner as a known method using a known compound as a starting material is converted into a known compound or The reaction is carried out by reacting a known compound as a starting material with a compound having the general formula (XXVI) which can be easily obtained in the same manner as in the known method.

  The inert solvent used in this step is preferably an amide, and more preferably N, N-dimethylacetamide.

  The condensing agent used in this step is preferably 1-propanephosphonic acid cyclic anhydride (T3P).

  The base used in this step is preferably an organic base, and more preferably triethylamine.

  The reaction temperature in this step is usually −20 ° C. to 160 ° C., preferably 0 ° C. to 60 ° C.

  The reaction time in this step is usually 0.5 to 96 hours, preferably 1 to 24 hours.

Step F2 This step is a step of producing a compound having the general formula (XXVIII).

  This step is performed by reacting a compound having the general formula (XXVII) with an acid in an inert solvent.

  The inert solvent used in this step is preferably an aromatic hydrocarbon, and more preferably toluene.

  Examples of the acid used in this step include hydrogen halides such as hydrogen chloride gas or hydrogen bromide gas; mineral acids such as sulfuric acid, methyl sulfate, hydrobromic acid or hydrochloric acid; methanesulfonic acid, p- Organic sulfonic acids such as toluenesulfonic acid, camphorsulfonic acid or trifluoromethanesulfonic acid; carboxylic acids such as acetic acid, formic acid or trifluoroacetic acid; aluminum chloride, zinc chloride, tin tetrachloride, titanium trichloride, boron trifluoride, Lewis acids such as boron tribromide; or acidic ion exchange resins, preferably mineral acids, and more preferably sulfuric acid.

  The reaction temperature in this step is usually 0 ° C. to 200 ° C., preferably 20 ° C. to 120 ° C.

  The reaction time in this step is usually 0.1 to 96 hours, preferably 0.5 to 12 hours.

  Method G includes the general formula (XXX) in which T is a nitrogen atom and Q is a nitrogen atom among the compounds having the general formula (XIII) used in Method A, Step A1 and Method C, Step C1. It is the method of manufacturing the compound which has.

In the present invention, R ^3a and R ^4a have the same meaning as described above.

Step G1 This step is a step of producing a compound having the general formula (XXIX).

  In this step, in the presence of a condensing agent and a base in an inert solvent, a known compound or a compound having the general formula (XXV) easily obtained in the same manner as a known method using a known compound as a starting material is converted to thiosemicarbazide. By making it react, it carries out similarly to 1st F1 process of the said F method.

Step G2 This step is a step of producing a compound having the general formula (XXX).

  This step is carried out in the same manner as in Step F2 of Method F above, by reacting a compound having the general formula (XXIX) with an acid in an inert solvent.

Method H is a method for producing a compound having the general formula (XXXVI) in which R ^3a is a hydrogen atom among the compounds having the general formula (XIII) used in the above-mentioned Method A, Step A1 and Step C, Step C1. It is.

In the present invention, R ^4a , T, Q and Z are as defined above.

Step H1 This step is a step of producing a compound having the general formula (XXXIII).

  In this step, in the presence of an organometallic reagent in an inert solvent, a known compound or a compound having the general formula (XXXI) that can be easily obtained in the same manner as a known method using a known compound as a starting material This is a step of reacting a compound with a compound having the general formula (XXXII) that can be easily obtained in the same manner as a known method using a starting material, for example, as described in J. Med. Chem. 2000, 43, 721-735, etc. It is done according to the method.

The inert solvent used in this step is preferably an ether, and more preferably tetrahydrofuran. If necessary,
The organometallic reagent used in this step is, for example, butyl lithium, sodium hexamethyldisilazide, potassium hexamethyldisilazide, lithium hexamethyldisilazide, lithium diisopropylamide, lithium bis (trimethylsilyl) amide, ethylmagnesium Bromide or isopropylmagnesium bromide, preferably butyllithium.

  The reaction temperature in this step is usually −100 ° C. to 40 ° C., preferably −78 ° C. to 20 ° C.

  The reaction time in this step is usually 0.1 hour to 24 hours, preferably 0.5 hour to 2 hours.

Step H2 This step is a step of producing a compound having the general formula (XXXIV).

  This step is a step of reacting a compound having the general formula (XXXIII) with a silylating agent and a halogenating agent in an inert solvent. For example, according to the method described in Tetrahedron 1995, 51, 11043-11062, etc. Done.

  The inert solvent used in this step is preferably a nitrile, and more preferably acetonitrile.

  The silylating agent used in this step is, for example, trimethylsilyl chloride, triethylsilyl chloride, or t-butyldimethylsilyl chloride, and preferably trimethylsilyl chloride.

  The halogenating agent used in this step is a chlorinating agent, brominating agent or iodinating agent. For example, hydrochloric acid, chlorine, phosphorus trichloride, phosphorus pentachloride, phosphorus oxychloride, oxalyl chloride, thionyl chloride, Toluenesulfonic acid chloride, sulfonyl chloride, N-chlorosuccinimide, trimethylsilyl chloride, odorous acid, bromine, phosphorus tribromide, phosphorus pentabromide, phosphorus oxybromide, oxalyl bromide, thionyl bromide, toluenesulfonic acid chloride, chloride Sulfonyl, N-bromosuccinimide, trimethylsilyl bromide, sodium bromide, or sodium iodide, preferably sodium iodide.

  The reaction temperature in this step is usually 0 ° C. to 160 ° C., preferably 60 ° C. to 90 ° C.

  The reaction time in this step is usually 0.1 to 96 hours, preferably 0.5 to 12 hours.

Step H3 This step is a step of producing a compound having the general formula (XXXV).

  This step is a step of reacting a compound having the general formula (XXXIV) with a nitrating agent in the presence of an acid in an inert solvent or without a solvent. For example, Chem. Heterocycle compound (Engl. Translation) 1981 , 17, 673-675 and the like.

  The inert solvent used in this step is preferably a carboxylic acid, and more preferably acetic acid. If necessary, it can be a mixed solvent with water (mixing ratio is 1: 100 to 100: 1, preferably 10: 1 to 1:10).

  The acid used in this step is, for example, sulfuric acid, methyl sulfate, hydrobromic acid, hydrochloric acid, methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid, trifluoromethanesulfonic acid, acetic acid, formic acid, trifluoroacetic acid or Acetic anhydride, preferably acetic anhydride.

  The nitrating agent used in this step is, for example, nitric acid, copper (II) nitrate or potassium nitrate, and preferably copper (II) nitrate.

  The reaction temperature in this step is usually 0 ° C. to 100 ° C., preferably 20 ° C. to 60 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 24 hours.

Step H4 This step is a step of producing a compound having the general formula (XXXVI).

  This step is performed by reacting a compound having the general formula (XXXV) with zinc in the presence of an acid in an inert solvent or without a solvent.

  The inert solvent used in this step is preferably an alcohol, and more preferably i-propanol. If necessary, it can be a mixed solvent with water (mixing ratio is 1: 100 to 100: 1, preferably 10: 1 to 1:10).

  The acid used in this step is, for example, sulfuric acid, methyl sulfate, hydrobromic acid, hydrochloric acid, methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid, trifluoromethanesulfonic acid, acetic acid, formic acid, trifluoroacetic acid or Acetic anhydride, preferably hydrochloric acid.

  The reaction temperature in this step is usually 0 ° C. to 100 ° C., preferably 20 ° C. to 60 ° C.

  The reaction time in this step is usually 0.1 to 96 hours, preferably 0.5 to 12 hours.

In the compound having the general formula (XV) used in the above-mentioned Method B, Step B1, the method I is a group represented by the general formula (T) where T is a group represented by the formula = C (R ⁵ )-and Q is a nitrogen atom ( (IL).

In the present invention, R ^3a , R ^4a , R ⁵ and X have the same meaning as described above, and R ⁹ represents a C ₁ -C ₆ alkyl group (preferably a methyl group or an ethyl group).

Step I1 This step is a step of producing a compound having the general formula (XXXIX).

  In this step, a known compound or a compound having the general formula (XXXVII) that can be easily obtained in the same manner as a known method using a known compound as a starting material in an inert solvent is known as a known compound or a known compound as a starting material. This is a step of reacting with a compound having the general formula (XXXVIII) which can be easily obtained in the same manner as the method, and is carried out, for example, according to the method described in Eur. J. Med. Chem. 1993, 28, 387, etc.

  The inert solvent used in this step is preferably an aromatic hydrocarbon, and more preferably toluene.

  The reaction temperature in this step is usually 0 ° C. to 200 ° C., preferably 20 ° C. to 120 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 24 hours.

Step I2 This step is a step of producing a compound having the general formula (IL).

  This step is performed by reacting a compound having the general formula (XXXIX) with a base in an inert solvent.

  The inert solvent used in this step is preferably an ether, and more preferably dioxane. If necessary, it can be a mixed solvent with water (mixing ratio is 1: 100 to 100: 1, preferably 1:10 to 10: 1).

  The base used in this step is preferably an alkali metal hydroxide, and more preferably sodium hydroxide.

  The reaction temperature in this step is usually 0 ° C. to 160 ° C., preferably 20 ° C. to 100 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 24 hours.

  Method J is a method for producing a compound having the general formula (XVIII) used in Step D1 of Method D.

In the present invention, R ^4a , T, Q and Z are as defined above.

Step J1 This step is a step of producing a compound having the general formula (ILII).

  In this step, in the presence of an organometallic reagent in an inert solvent, a known compound or a compound having the general formula (ILI) easily obtained in the same manner as a known method using a known compound as a starting material is known or known. The reaction is carried out in the same manner as in Step H1 of Method H above by reacting the compound with a compound having the general formula (XXXII) which can be easily obtained in the same manner as a known method using a starting material.

Step J2 This step is a step of producing a compound having the general formula (ILIII).

  This step is performed by reacting a compound having the general formula (ILII) with an oxidizing agent in an inert solvent.

  The inert solvent used in this step is preferably a halogenated hydrocarbon, and more preferably dichloromethane.

  The oxidizing agent used in this step is, for example, Jones reagent, Collins reagent, PDC, PCC, manganese dioxide, Dess-Martin reagent, TPAP reagent, and preferably Dess-Martin reagent.

  The reaction temperature in this step is usually 0 ° C. to 100 ° C., preferably 20 ° C. to 60 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 6 hours.

Step J3 This step is a step of producing a compound having the general formula (XVIII).

  This step is performed by reacting a compound having the general formula (ILIII) with an acid in an inert solvent.

  The inert solvent used in this step is preferably a halogenated hydrocarbon, and more preferably dichloromethane. If necessary, it can be a mixed solvent with water (mixing ratio is 1: 100 to 100: 1, preferably 1:10 to 10: 1).

  Examples of the acid used in this step include hydrogen halides such as hydrogen chloride gas or hydrogen bromide gas; mineral acids such as sulfuric acid, hydrobromic acid or hydrochloric acid; methanesulfonic acid, p-toluenesulfonic acid. Organic sulfonic acids such as camphorsulfonic acid or trifluoromethanesulfonic acid; carboxylic acids such as acetic acid, formic acid or trifluoroacetic acid; Lewis acids such as zinc chloride, tin tetrachloride, boron trifluoride, boron tribromide; or And acidic ion exchange resins, preferably carboxylic acids, and more preferably trifluoroacetic acid.

  The reaction temperature in this step is usually 0 ° C. to 100 ° C., preferably 20 ° C. to 40 ° C.

  The reaction time in this step is usually 0.1 hour to 96 hours, preferably 0.5 hour to 6 hours.

  Method K is a method for producing a compound having the general formula (XIII) used in Method A, Step A1 and Method C, Step C1.

In the present invention, R ^3a , R ^4a , T and Q have the same meaning as described above.

Step K1 This step is a step of producing a compound having the general formula (ILIV).

  In this step, in the presence of a base, in t-butanol, a known compound or a compound having the general formula (XV) easily obtained in the same manner as a known method using a known compound as a starting material is reacted with an azidating agent. Is done.

  The base used in this step is preferably an organic base, and more preferably triethylamine.

  The azidating agent used in this step is, for example, diphenyl phosphate azide (DPPA) or sodium azide, and preferably DPPA.

  The reaction temperature in this step is usually 10 ° C to 100 ° C, preferably 20 ° C to 80 ° C.

  The reaction time in this step is usually 0.5 hours to 144 hours, preferably 2 hours to 24 hours.

Step K2 This step is a step of producing a compound having the general formula (XIII).

  This step is carried out in the same manner as in Step J3 of Method J above by reacting a compound having the general formula (ILIV) with an acid in an inert solvent.

  Method L is a method for producing a compound having the general formula (XIV) used in Method A, Step A1 and Method D, Step D1.

In the present invention, R ^1a , R ^2a and R ⁹ have the same meaning as described above.

Step L1 This step is a step of producing a compound having the general formula (XIV).

  This step is performed in the same manner as in Step I2 of Method I above by reacting a compound having the general formula (ILV) with a base in an inert solvent.

  Method M is a method for producing a compound having the general formula (XVI) used in Method B, Step B1 and Method C, Step C2.

In the present invention, R ^1a and R ^2a have the same meaning as described above.

Step M1 This step is a step of producing a compound having the general formula (XVI).

  This step is performed by reducing the compound having the general formula (ILVI) in an inert solvent in the presence of a palladium catalyst under a hydrogen atmosphere.

  The inert solvent used in this step is preferably an alcohol, and more preferably ethanol. If necessary, it can be a mixed solvent with water (mixing ratio is 1: 100 to 100: 1, preferably 10: 1 to 1:10).

  The palladium catalyst used in this step is preferably palladium-activated carbon.

  The reaction temperature in this step is usually 0 ° C. to 120 ° C., preferably 20 ° C. to 90 ° C.

  The reaction time in this step is usually 0.5 to 96 hours, preferably 1 to 12 hours.

Method N is a group in which R ^1a is represented by the formula —N (CH ₂ R ¹⁰ ) R ¹³ among the compounds having general formula (XIV) used in Method A, Step A1 and Method D, Step D1. And R ^2a is a method for producing a compound having the general formula (LVIX), which is a group represented by the formula —OR ^8b .

In the present invention, R ⁹ represents the same meaning as described above, R ¹⁰ and R ¹¹ represent a hydrogen atom or a C ₁ -C ₅ alkyl group, and R ¹² represents a C ₁ -C ₆ alkyl group. , R ¹³ represents a hydrogen atom, a group represented by the formula —CH ₂ R ¹⁰ , a group represented by the formula —CH ₂ R ¹¹ or R ¹² , and R ^8b represents a C ₁ -C ₆ alkyl group, C ₂ — C ₆ hydroxyalkyl group, protected C ₂ -C ₆ hydroxyalkyl group, (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkyl) group or di- (C ₁ -C ₆ alkyl) amino- (C ₁ -C ₆ alkyl) group, Y is a halogen atom, C ₁ -C ₆ alkyl sulfonate group or C ₆ -C ₁₀ aryl sulfonate group (preferably a halogen atom, more preferably, Chlorine atom, bromine atom or Is an iodine atom, and more preferably a bromine atom or an iodine atom.

Step N1 This step is a step of producing a compound having the general formula (ILIX).

  In this step, in the presence of a base in an inert solvent, a known compound or a compound having the general formula (ILVII) easily obtained in the same manner as a known method using a known compound as a starting material is converted into a known compound or a known compound. It is carried out by reacting the starting material with a compound having the general formula (ILVIII) which can be easily obtained in the same manner as in a known method.

  The inert solvent used in this step is preferably an amide, and more preferably N, N-dimethylacetamide.

  The base used in this step is preferably an alkali metal carbonate, and more preferably potassium carbonate.

  The reaction temperature in this step is usually 0 ° C. to 200 ° C., preferably 60 ° C. to 80 ° C.

  The reaction time in this step is usually 0.1 hour to 72 hours, preferably 2 hours to 24 hours.

Step N2 This step is a step of producing a compound having the general formula (L).

  This step is performed by reducing a compound having the general formula (ILIX) in an inert solvent in the presence of a palladium catalyst under a hydrogen atmosphere.

  The inert solvent used in this step is preferably an ester, and more preferably ethyl acetate.

  The palladium catalyst used in this step is preferably palladium-activated carbon.

  The reaction temperature in this step is usually 0 ° C. to 100 ° C., preferably 20 ° C. to 60 ° C.

  The reaction time in this step is usually 0.5 to 72 hours, preferably 2 to 24 hours.

Step N3 This step is a step of producing a compound having the general formula (LII) and a compound having the general formula (LIII).

  This step is performed by reacting a compound having the general formula (L) with a known compound having the general formula (LI) in the presence of an acid and a borane reducing agent in an inert solvent.

  The inert solvent used in this step is preferably an ether, and more preferably tetrahydrofuran.

  Examples of the acid used in this step include hydrogen halides such as hydrogen chloride gas or hydrogen bromide gas; mineral acids such as sulfuric acid, methyl sulfate, hydrobromic acid or hydrochloric acid; methanesulfonic acid, p- Organic sulfonic acids such as toluenesulfonic acid, camphorsulfonic acid or trifluoromethanesulfonic acid; carboxylic acids such as acetic acid, formic acid or trifluoroacetic acid; aluminum chloride, zinc chloride, tin tetrachloride, titanium trichloride, boron trifluoride, A Lewis acid such as boron tribromide; or an acidic ion exchange resin, preferably a carboxylic acid, and more preferably acetic acid.

  The borane-based reducing agent used in this step is, for example, sodium borohydride, lithium borohydride, or sodium cyanoborohydride, and preferably sodium cyanoborohydride.

  The reaction temperature in this step is usually 0 ° C. to 60 ° C., preferably 20 ° C. to 40 ° C.

  The reaction time in this step is usually 0.5 hours to 144 hours, preferably 2 hours to 72 hours.

Step N4 This step is a step of producing a compound having the general formula (LV).

  This step is the same as the above-mentioned N3 step by reacting a compound having the general formula (LII) with a known compound having the general formula (LIV) in the presence of an acid and a borane reducing agent in an inert solvent. To be done.

Step N5 This step is a step of producing a compound having the general formula (LVII).

  In this step, in the presence of a base in an inert solvent, a compound having the general formula (LII) is converted to a general formula (LVI) which can be easily obtained in the same manner as in a known method using a known compound or a known compound as a starting material. It is carried out by reacting with a compound having it.

  The inert solvent used in this step is preferably an amide, and more preferably N, N-dimethylformamide.

  The base used in this step is preferably an alkali metal hydride, and more preferably sodium hydride.

  The reaction temperature in this step is usually −20 ° C. to 160 ° C., preferably 0 ° C. to 40 ° C.

  The reaction time in this step is usually 0.5 to 96 hours, preferably 2 to 24 hours.

Step N6 This step is a step of producing a compound having the general formula (LVIX).

  This step is carried out in the same manner as in Step I2 of Method I above by reacting a compound having the general formula (LVIII) with a base in an inert solvent.

The method O is a compound having the general formula (LXI) used in the L method Step L1 and the M method Step M1 (R ¹⁴ is a group represented by the formula —CO ₂ R ⁹ and represented by the formula —OR ^8b . When the group to be represented is R ^2a , it represents a compound having the general formula (ILV), and when R ¹⁴ is a nitro group and the group represented by the formula —OR ^8b is R ^2a , the compound having the general formula (ILVI) Is).

In the present invention, R ^1a , R ^8b and Y are as defined above, R ¹⁴ is a group represented by the formula —CO ₂ R ⁹ and a nitro group (R ⁹ is as defined above). Is shown).

Step O1 This step is a step of producing a compound having the general formula (LXI).

  In this step, in the presence of a base in an inert solvent, a known compound or a compound having the general formula (LX) easily obtained in the same manner as a known method using a known compound as a starting material is converted into a known compound or a known compound. This is a step of reacting a starting material with a compound having the general formula (ILVIII) that can be easily obtained in the same manner as in a known method, and is carried out, for example, according to the method described in US Pat. No. 2,686,198.

  The inert solvent used in this step is preferably a nitrile, and more preferably acetonitrile.

  The base used in this step is preferably an alkali metal carbonate, and more preferably potassium carbonate.

  The reaction temperature in this step is usually 0 ° C. to 160 ° C., preferably 60 ° C. to 90 ° C.

  The reaction time in this step is usually 0.5 to 96 hours, preferably 1 to 24 hours.

Method P is a group ^{compounds (R 14} is represented by the formula _-CO 2 ^{R 9} having the general formula (LXI) to be used in the L Act L1 step and the M Act M1 step, the hydroxy group of ^{R 2a} In the case, it represents a compound having the general formula (ILV), and when R ¹⁴ is a nitro group and the fluorine atom is R ^1a , this is a method for producing a compound having the general formula (ILVI).

In the present ^{invention, R 2a} and ^{R 14} have the same meanings as described ^{above, R 7b} _is, C 1 -C _{6 alkyl,} C 2 -C ₆ hydroxyalkyl group, _C 2 -C protected ₆ Hydroxyalkyl group, (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkyl) group, di- (C ₁ -C ₆ alkyl) amino- (C ₁ -C ₆ alkyl) group, 4-morpholinyl 1 Substituted C ₁ -C ₆ alkyl group, (C ₁ -C ₆ alkylthio)-(C ₁ -C ₆ alkyl) group, (C ₁ -C ₆ alkylsulfinyl)-(C ₁ -C ₆ alkyl) group Or a (C ₁ -C ₆ alkylsulfonyl)-(C ₁ -C ₆ alkyl) group.

Step P1 This step is a step of producing a compound having the general formula (LXI).

  In this step, a known compound or a compound having the general formula (LXII) that can be easily obtained in the same manner as in a known method using a known compound or a known compound as a starting material in the presence of a base in an inert solvent, This is carried out by reacting the starting material with a compound having the general formula (LXIII) which can be easily obtained in the same manner as in the known method.

  The inert solvent used in this step is preferably an alcohol, and more preferably a compound having the general formula (LV).

  The base used in this step is preferably an alkali metal alkoxide, and more preferably sodium ethoxide.

  The reaction temperature in this step is usually 0 ° C. to 160 ° C., preferably 20 ° C. to 100 ° C.

  The reaction time in this step is usually 0.5 to 96 hours, preferably 6 to 24 hours.

Formulas (XIII), (XIV), (XV), (XVI), (XVII), (XX), (XXI), (XXII), (XXV), (XXVI), (XXXI), (XXXII), (XXXIV), (XXXVII), (XXXVIII), (ILI), (ILV), (ILVI), (ILVII),
The starting compound having (ILVIII), (LI), (LIV), (LVI), (LX), (LXII) and (LXIII) is a known compound, or a known method or It is easily manufactured according to a similar method. For example, the compound having the general formula (XXXVIII) is produced according to the method described in Heterocycles, 1991, 32, 693.

In the above, “amino group which may be protected”, “hydroxy group which may be protected” and “carboxyl group which may be protected” in the definition of R ^1a , R ^2a , R ^3a and R ^4a and R ^7b and The protecting group of “protected C ₂ -C ₆ hydroxyalkyl group” in the definition of R ^8b is a protecting group that can be cleaved by a chemical method such as hydrogenolysis, hydrolysis, electrolysis, or photolysis. The protective groups commonly used in organic synthetic chemistry are shown (see, for example, TW Greene et al., Protective Groups in Organic Synthesis, 3rd Edition, John Wiley & Sons, Inc. (1999)).

In the above, the “optionally protected hydroxy group” in the definition of R ^1a , R ^2a , R ^3a and R ^4a and the “protected C ₂ -C ₆ hydroxyalkyl group” in the definition of R ^7b and R ^8b The “protecting group” is not particularly limited as long as it is a protecting group for a hydroxy group used in the field of synthetic organic chemistry. For example, it is a “general protecting group for an ester of a hydroxy group”, and preferably , Formyl group, said “C ₂ -C ₇ alkylcarbonyl group”, halogenated alkylcarbonyl group such as chloroacetyl, dichloroacetyl, trichloroacetyl, trifluoroacetyl, alkoxyalkylcarbonyl group such as methoxyacetyl, acryloyl, propioroyl , Methacryloyl, crotonoyl, isocrotonoyl, (E) -2- “Alkylcarbonyl groups” such as unsaturated alkylcarbonyl groups such as til-2-butenoyl; arylcarbonyl groups such as benzoyl, α-naphthoyl, β-naphthoyl, halogens such as 2-bromobenzoyl, 4-chlorobenzoyl Arylcarbonyl group, 2,4,6-trimethylbenzoyl, C ₁ -C ₆ alkylated arylcarbonyl group such as 4-toluoyl, C ₁ -C ₆ alkoxylated arylcarbonyl group such as 4-anisoyl, 4-nitrobenzoyl, 2-nitrobenzoyl nitrated arylcarbonyl group such as yl, 2- (methoxycarbonyl) C ₂ -C ₇ alkoxycarbonyl arylcarbonyl group such as benzoyl, 4-aryl aryl such as phenyl benzoyl Arylcarbonyl such as carbonyl group Le group ";the" _C 2 -C ₇ alkoxycarbonyl group ", 2,2,2-trichloroethoxycarbonyl, halogen or tri such as 2-trimethylsilyl-ethoxycarbonyl - _(C 1 -C ₆ alkyl) substituted with a silyl group "alkoxycarbonyl groups" such as _C 2 -C ₇ alkoxycarbonyl group is, tetrahydropyran-2-yl, 3-bromo-tetrahydropyran-2-yl, 4-methoxytetrahydropyran-4-yl, tetrahydrothiopyran -2 “Tetrahydropyranyl or tetrahydrothiopyranyl group” such as -yl, 4-methoxytetrahydrothiopyran-4-yl; “tetrahydrofuranyl or tetrahydrothio” such as tetrahydrofuran-2-yl, tetrahydrothiofuran-2-yl Furanyl group "; trimethylsilyl, Tri- (C ₁ -C ₆ alkyl) silyl groups such as triethylsilyl, isopropyldimethylsilyl, t-butyldimethylsilyl, methyldiisopropylsilyl, methyldi-t-butylsilyl, triisopropylsilyl, diphenylmethylsilyl, diphenylbutylsilyl, “Silyl groups” such as (C ₁ -C ₆ alkyl) diarylsilyl or di- (C ₁ -C ₆ alkyl) arylsilyl groups such as diphenylisopropylsilyl, phenyldiisopropylsilyl; methoxymethyl, 1,1-dimethyl- 1-methoxymethyl, ethoxymethyl, propoxymethyl, iso-propoxymethyl, butoxymethyl, t-butoxymethyl, such as _(C 1 -C ₆ alkoxy) methyl group, such as 2-methoxyethoxymethyl _(C 1 -C ₆ Alkoxy) _(C 1 -C ₆ alkoxy) methyl group, 2,2,2-trichloroethoxymethyl, bis (2-chloroethoxy) "alkoxymethyl group" such like _(C 1 -C ₆ halogenated alkoxy) methyl as methyl “Substituted ethyl groups” such as 1-ethoxyethyl, (C ₁ -C ₆ alkoxy) ethyl groups such as 1- (isopropoxy) ethyl, and ethyl halide groups such as 2,2,2-trichloroethyl; C ₁ -C substituted with 1 to 3 aryl groups such as benzyl, α-naphthylmethyl, β-naphthylmethyl, diphenylmethyl, triphenylmethyl, α-naphthyldiphenylmethyl, 9-anthrylmethyl ₆ alkyl group, 4-methylbenzyl, 2,4,6-trimethylbenzyl, 3,4,5-trimethyl benzyl, 4-methoxybenzyl, 4- Butoxy diphenyl methyl, 2-nitrobenzyl, 4-nitrobenzyl, 4-chlorobenzyl, 4-bromobenzyl, _C 1 -C ₆ alkyl, such as _{4-cyanobenzyl,} C 1 -C ₆ alkoxy, nitro, halogen, An “aralkyl group” such as a C ₁ -C ₆ alkyl group substituted by 1 to 3 aryl groups in which the aryl ring is substituted with a cyano group; “alkenyl” such as vinyloxycarbonyl, allyloxycarbonyl, etc. oxycarbonyl group "; benzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, 3,4-dimethoxybenzyl oxycarbonyl, 2-nitrobenzyloxycarbonyl, such as 4-nitrobenzyloxycarbonyl, one or two _{C 1} - The aryl ring may be substituted with a C ₆ alkoxy or nitro group An “aralkyloxycarbonyl group”, more preferably an alkylcarbonyl group, a silyl group, or an aralkyl group.

In the above, the “protecting group” of the “optionally protected carboxyl group” in the definition of R ^4a is not particularly limited as long as it is a protecting group for a carboxyl group used in the field of synthetic organic chemistry. A “common protecting group for esters of carboxyl groups”, preferably “C ₁ -C ₆ alkyl groups”; “C ₂ -C ₆ alkenyl groups such as ethenyl, 1-propenyl, 2-propenyl”; "; ethynyl, 1-propynyl, 2-" _C 2 -C ₆ alkynyl groups such as propynyl ";the" _C 1 -C ₆ halogenated alkyl group ";the" _C 1 -C ₆ hydroxyalkyl group "; acetyl such as methyl _(C 2 -C ₇ alkylcarbonyl) - _(C 1 -C ₆ alkyl group); the "aralkyl group"; a or the "silyl group", more preferably, C -C a _alkyl group or an aralkyl group.

In the above, the “protecting group” of the “amino group that may be protected” in the definition of R ^4a is not particularly limited as long as it is a protecting group of an amino group used in the field of organic synthetic chemistry. “Alkylcarbonyl group”; “arylcarbonyl group”; “alkoxycarbonyl group”; “silyl group”; “aralkyl group”; “alkenyloxycarbonyl group” in “a general protecting group for esters of hydroxy group”; Or a group similar to the “aralkyloxycarbonyl group” or N, N-dimethylaminomethylene, benzylidene, 4-methoxybenzylidene, 4-nitrobenzylidene, salicylidene, 5-chlorosalicylidene, diphenylmethylene, (5- “Forms a Schiff base, such as chloro-2-hydroxyphenyl) phenylmethylene A substituted methylene group ”, preferably an alkylcarbonyl group, an arylcarbonyl group or an alkoxycarbonyl group, and more preferably an alkoxycarbonyl group.

  Processes that require protection and deprotection are known methods (for example, the method described in “Protective Groups in Organic Synthesis” (Theodora W. Greene, Peter GMWuts, 1999, A Wiley-Interscience Publication)) It is done according to.

  When the compound having the general formula (I) of the present invention or a pharmacologically acceptable salt thereof is used as a medicine, it is an excipient or a diluent which is itself or an appropriate pharmacologically acceptable. And can be administered orally, for example, by tablet, capsule, granule, powder or syrup, or parenterally by injection or suppository.

  These formulations include excipients (eg sugar derivatives such as lactose, sucrose, sucrose, mannitol, sorbitol; starch derivatives such as corn starch, potato starch, alpha starch, dextrin; cellulose derivatives such as crystalline cellulose; Gum arabic; dextran; organic excipients such as pullulan; silicate derivatives such as light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate, magnesium metasilicate magnesium phosphate; phosphates such as calcium hydrogen phosphate; calcium carbonate And inorganic excipients such as sulfates such as calcium sulfate), lubricants (for example, stearic acid, calcium stearate, metal stearate such as magnesium stearate) Salt; Talc; Colloidal silica; Veegum, Gay wax Such as wax; boric acid; adipic acid; sulfate such as sodium sulfate; glycol; fumaric acid; sodium benzoate; DL leucine; fatty acid sodium salt; lauryl sulfate such as sodium lauryl sulfate and magnesium lauryl sulfate; And silicic acids such as silicic acid hydrate; and the starch derivatives mentioned above), binders (for example, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, and the above excipients) And the like, and disintegrants (for example, cellulose derivatives such as low-substituted hydroxypropylcellulose, carboxymethylcellulose, carboxymethylcellulose calcium, internally crosslinked sodium carboxymethylcellulose; And chemically modified starch and cellulose such as carboxymethyl starch, sodium carboxymethyl starch, and crosslinked polyvinylpyrrolidone), stabilizers (paraoxybenzoates such as methylparaben and propylparaben; chloro; Alcohols such as butanol, benzyl alcohol and phenylethyl alcohol; benzalkonium chloride; phenols such as phenol and cresol; thimerosal; dehydroacetic acid; and sorbic acid.), Flavoring agents (for example, , Normally used sweeteners, acidulants, flavors, etc.), and can be produced by known methods using additives such as diluents.

  The amount used varies depending on the symptoms, age, etc. of the patient (warm-blooded animal, particularly human), but in the case of oral administration, the lower limit per day is 0.0015 mg / kg body weight (preferably 0.008 mg / kg). kg body weight), an upper limit of 70 mg / kg body weight (preferably 7 mg / kg body weight), and in the case of intravenous administration, a lower limit of 0.00015 mg / kg body weight per day (preferably 0.0008 mg / kg kg body weight) and an upper limit of 8.5 mg / kg body weight (preferably 5 mg / kg body weight) are desirably administered to adults 1 to 6 times per day according to symptoms.

  EXAMPLES Hereinafter, although an Example and a test example are given and this invention is demonstrated further in detail, the scope of the present invention is not limited to these.

Elution in the column chromatography of the examples was performed under observation by TLC (Thin Layer Chromatography, thin layer chromatography). In TLC observation, silica gel 60F ₂₅₄ manufactured by Merck was used as a TLC plate, a solvent used as an elution solvent in column chromatography was used as a developing solvent, and a UV detector was used as a detection method. As silica gel for the column, silica gel SK-85 (230-400 mesh) manufactured by Merck Co., Ltd. or Fuji Silysia Chemical Chromatorex NH (200-350 mesh) was used. In addition to ordinary column chromatography, an automated chromatography apparatus (SP-1) manufactured by Biotage was used as appropriate. The abbreviations used in the examples have the following significance.
mg: milligram, g: gram, mL: milliliter, MHz: megahertz.

In the following examples, nuclear magnetic resonance (hereinafter, ¹ H NMR) spectra are described with chemical shift values as δ values (ppm) using tetramethylsilane as a standard substance. The splitting pattern is indicated by s for single lines, d for double lines, t for triple lines, and q for quadruple lines.

  Mass spectrometry (hereinafter, referred to as MS) was performed by FAB (Fast Atom Bombardment) method, EI (Electron Ionization) method, or ESI (Electron Spray Ionization) method.

Example 1 3- (2-Hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 1-64)
(1a) 3- (3-trifluoromethyl-phenyl) -propionaldehyde 3-iodobenzotrifluoride (10.8 g) in dimethylformamide (150 mL), allyl alcohol (4.1 mL), tetrabutyl Ammonium chloride (16.6 g), sodium bicarbonate (8.34 g), and palladium acetate (485 mg) were added at 0 ° C. The reaction mixture was warmed to room temperature, heated at 50 ° C. for 2 hours, diluted with water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane: ethyl acetate 10: 1-4: 1) to give 7.17 g (89%) of the title compound as a light brown oil.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 9.84 (1H, s), 7.49-7.39 (4H, m), 3.02 (2H, t, J = 7.4 Hz), 2.83 (2H, t, J = 7.6Hz).
(1b) 5- (3-Trifluoromethyl-benzyl) -thiazol-2-ylamine 3- (3-trifluoromethyl-phenyl) -propionaldehyde (7.17 g) dichloromethane obtained in Example (1a) To the (80 mL) solution, L-proline (808 mg) and N-chlorosuccinimide (6.09 g) were added at 0 ° C. The reaction mixture was warmed to room temperature, stirred for 1 h, and hexane (100 mL) was added. The purified suspension was stirred for 1 hour and the white solid was filtered. The filtrate was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and concentrated to give 8.98 g of chloroaldehyde as a pale yellow oil. A solution of 7.62 g of this chloroaldehyde and thiourea (2.45 g) in ethanol (100 mL) was heated to reflux for 7 hours and concentrated. The residue was diluted with ethyl acetate, washed with saturated aqueous sodium carbonate solution and concentrated. The residue was purified by column chromatography (Chromatorex NH 100-200 mesh FUJISILYSIA CHEMICAL LTD., Dichloromethane: ethyl acetate 1: 0 to 10: 1) to give 3.64 g of the title compound as a beige solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.48-7.46 (2H, m), 7.43-7.38 (2H, m), 6.81 (1H, s), 4.87 (2H, brs), 4.01 (2H , s)
MS (ES) m / z: 259 (M + H) ⁺ .
(1c) 3- (2-hydroxyethoxy) -4-methoxybenzoic acid methyl ester 3-hydroxy-4-methoxybenzoic acid methyl ester (27.8 g), 2-bromoethanol (27 mL), and potassium carbonate ( A suspension of 42.3 g) dimethylacetamide (280 mL) was heated at 80-100 ° C. for 8 hours. The reaction mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate 7: 1 to 1: 4). The resulting solid was washed with hexane / diisopropyl ether (5: 1), filtered off and dried to give 23.7 g (69%) of the title compound as a pale yellow solid.
MS (ES) m / z: 227 (M + H) ⁺ .
(1d) 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy) -benzoic acid methyl ester 3- (2-hydroxyethoxy) -4-methoxybenzoic acid obtained in Example (1c) A solution of acid methyl ester (14.8 g), 3,4-dihydro-2H-pyran (18 mL), and PPTS (1.64 g) in dichloromethane (150 mL) was stirred at room temperature for 32 hours. Triethylamine (1.8 mL) was added and the reaction mixture was concentrated. The residue was diluted with ethyl acetate, washed with water, saturated aqueous sodium bicarbonate, and brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate) to obtain 15.1 g (74%) of the title compound as a colorless transparent oil.
MS (FAB ⁺ ) m / z: 333 (M + Na) ⁺ .
(1e) 4-Methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy) -benzoic acid 4-methoxy-3- [2- (tetrahydro-pyran-2) obtained in Example (1d) A mixture of 1N aqueous sodium hydroxide solution (51 mL) of -yloxy) -ethoxy) -benzoic acid methyl ester (14.4 g) and dioxane (140 mL) was heated at 70 ° C. for 2.5 hours. After cooling to room temperature, the organic solvent was removed under reduced pressure. The aqueous solution was acidified with 10% aqueous citric acid solution and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (dichloromethane / methanol 1: 0 to 10: 1). The resulting solid was stirred in hexane / diisopropyl ether (5: 1) at 60 ° C. for 30 minutes, filtered and dried to give 9.24 g (67%) of the title compound as a white solid.
MS (FAB ⁺ ) m / z: 319 (M + Na) ⁺ .
(1f) 4-Methoxy-3- (2-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide 5- (3 obtained in Example (1b) -Trifluoromethyl-benzyl) -thiazol-2-ylamine (4.35 g), 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy)-obtained in Example (1e) A solution of benzoic acid (5.49 g), HATU (7.03 g), and triethylamine (4.7 mL) in dimethylacetamide (90 mL) was stirred at room temperature for 4 days and heated at 70 ° C. for 3 hours. The reaction mixture was diluted with ethyl acetate, washed with saturated sodium bicarbonate and brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (dichloromethane / methanol) to obtain an amide compound (9.26 g). A solution of this amide (9.26 g) in 1N hydrochloric acid (17 mL) and methanol (90 mL) was heated at 50 ° C. for 2 hours. The reaction mixture was neutralized with 2N aqueous sodium hydroxide solution, and the organic solvent was removed under reduced pressure. The aqueous solution was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (chloroform / methanol 1: 0 to 30: 1). The obtained solid was washed with dichloromethane and recrystallized (2-propanol) to obtain 5.04 g (66%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73-7.71 (3H, m), 7.64-7.57 (3H, m), 7.38 (1H, s), 7.10 ( 1H, d, J = 9.0Hz), 4.88 (1H, brs), 4.25 (2H, s), 4.08 (2H, t, J = 5.2Hz), 3.85 (3H, s), 3.76 (2H, t, J = 4.9Hz)
MS (ES) m / z: 453 (M + H) ⁺ .
Melting point: 157-159 ° C.

Example 2 4- (2-Hydroxy-ethoxy) -3-methoxy-N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 1-49)
(2a) 4- (2-hydroxy-ethoxy) -3-methoxy-benzoic acid 4-hydroxy-3-methoxybenzoic acid (10.0 g), 2-bromoethanol (4.6 mL), potassium hydroxide ( A solution of 8.35 g) in ethanol / water (2: 1, 100 mL) was stirred at 90 ° C. for 4 hours and concentrated. The residue was diluted with water, acidified with 2N hydrochloric acid (60 mL), and stirred vigorously at room temperature. The precipitate was collected by filtration, washed with water and isopropanol, and dried under reduced pressure to give 6.77 g (54%) of the title compound as a brown solid.
MS (ES) m / z: 213 (M + H) ⁺ .
(2b) 4- (2-Hydroxy-ethoxy) -3-methoxy-N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide In a manner similar to Example (1f). 5- (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (100 mg) obtained in Example (1b), 4- (2-hydroxy-ethoxy) -3 obtained in Example (2a) The title compound, 34.1 mg (13%), was obtained as a white solid from -methoxy-benzoic acid (89.3 mg).
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.69-7.55 (6H, m), 7.35 (1H, s), 7.08 (1H, d, J = 9.3 Hz) , 4.88 (1H, t, J = 5.1Hz), 4.23 (2H, s), 4.05 (2H, t, J = 5.2Hz), 3.83 (3H, s), 3.72 (2H, q, J = 5.9Hz)
MS (ES) m / z: 453 (M + H) ⁺ .
Melting point: 199-201 ° C.

Example 3 4- (2-Hydroxy-ethoxy) -3-methoxy-N- [4-methyl-5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 9 -1)
(3a) 4- (3-Trifluoromethyl-phenyl) -butan-2-one In the same manner as in Example (1a), 3-iodobenzotrifluoride (5.59 g) and (±) -3- From buten-2-ol (2.7 mL), 3.86 g (87%) of the title compound was obtained as a yellow oil.
MS (FAB ⁺ ) m / z: 217 (M + H) ⁺ .
(3b) 4-Methyl-5- (3-trifluoromethyl-benzyl) -thiazol-2-ylamine In the same manner as in Example (1b), 4- (3-trifluoro obtained in Example (3a) Methyl-phenyl) -butan-2-one (2.86 g) gave 1.05 g (29%) of the title compound as a brown oil.
MS (ES) m / z: 273 (M + H) ⁺ .
(3c) 4- (2-Hydroxy-ethoxy) -3-methoxy-N- [4-methyl-5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide Example (1f) and In a similar manner, 4-methyl-5- (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (100 mg) obtained in Example (3b), 4- (obtained in Example (2a). 2-Hydroxy-ethoxy) -3-methoxy-benzoic acid (77.9 mg) gave 13.9 mg (8%) of the title compound as a yellow solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.3 (1H, brs), 7.68 (1H, s), 7.66 (1H, d, J = 1.9 Hz), 7.60-7.53 (4H, m) , 7.07 (1H, d, J = 8.2Hz), 4.86 (1H, t, J = 5.3Hz), 4.16 (2H, s), 4.04 (2H, t, J = 4.9Hz), 3.82 (3H, s) , 3.72 (2H, q, J = 5.3Hz), 2.27 (3H, s)
MS (ES) m / z: 466 (M + H) ⁺ .
Melting point: 215-217 ° C.

Example 4 N- (5-Benzyl-1,3,4-thiadiazol-2-yl) -4- (2-hydroxy-ethoxy) -3-methoxy-benzamide (Compound No. 5-49)
In the same manner as in Example (1f), 5-benzyl-thiadiazol-2-ylamine (100 mg), 4- (2-hydroxy-ethoxy) -3-methoxy-benzoic acid (100 mg) obtained in Example (2a) ( 122 mg) gave 22.2 mg (11%) of the title compound as a pink solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.8 (1H, brs), 7.72-7.71 (2H, m), 7.36-7.27 (5H, m), 7.10 (1H, d, J = 9.2 Hz), 4.88 (1H, t, J = 5.4Hz), 4.37 (2H, s), 4.06 (2H, t, J = 4.9Hz), 3.84 (3H, s), 3.73 (2H, q, J = 5.3 Hz)
MS (ES) m / z: 386 (M + H) ⁺ .
Melting point: 202-204 ° C.

Example 5 3- (2-Hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzyl) -1,3,4-thiadiazol-2-yl] -benzamide (compound (Number 5-7)
(5a) 5- (3-Trifluoromethyl-benzyl) -thiadiazol-2-ylamine (α, α, α-trifluoro-m-tolyl) acetic acid (1.25 g), thiosemicarbazide (1.15 g) , BOP reagent (3.24 g), and triethylamine (1.7 mL) in anhydrous tetrahydrofuran (20 mL) were stirred at room temperature for 20 hours. The reaction mixture was concentrated, diluted with water and extracted with ethyl acetate (twice). The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and concentrated. A suspension of the obtained white solid (1.72 g) and methanesulfonic acid (0.48 mL) in toluene (20 mL) was heated to reflux for 4 hours. The reaction mixture was diluted with ethyl acetate, washed with saturated aqueous sodium carbonate (twice) and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (dichloromethane / methanol 30: 1 to 10: 1) to obtain 760 mg (48%) of the title compound as a white solid.
MS (ES) m / z: 260 (M + H) ⁺ .
(5b) 3- (2-Hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzyl) -1,3,4-thiadiazol-2-yl] -benzamide Examples (1f ) 5- (3-trifluoromethyl-benzyl) -thiadiazol-2-ylamine (100 mg) obtained in Example (5a) and 4-methoxy-3 obtained in Example (1e). -[2- (Tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (83 mg) gave 29 mg (17%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.8 (1H, brs), 7.76 (3H, d, J = 9.8 Hz), 7.68 (2H, dd, J = 8.1 and 8.1 Hz), 7.61 (1H, dd, J = 7.8 and 7.8Hz), 7.62 (1H, d, J = 7.9Hz), 4.88 (1H, t, J = 5.2Hz), 4.52 (2H, s), 4.07 (2H, t, J = 4.9Hz), 3.85 (3H, s), 3.76 (2H, dt, J = 4.8 and 4.9Hz)
MS (ES) m / z: 454 (M + H) ⁺
Melting point: 198-200 ° C.

Example 6 3-Methoxy-4- (2-morpholin-4-yl-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 1 -56)
(6a) 4- (2-Methanesulfonyloxy-ethoxy) -3-methoxy-benzoic acid methyl ester 4- (2-hydroxy-ethoxy) -3-methoxy-benzoic acid methyl ester (US2686198) (1.01 g ), A suspension of methanesulfonic acid chloride (0.41 mL), triethylamine (1.3 mL) in anhydrous tetrahydrofuran (30 mL) was stirred at room temperature for 30 minutes. The reaction mixture was diluted with ethyl acetate, washed with saturated aqueous sodium bicarbonate and brine, dried over sodium sulfate, and concentrated. The residue was vigorously stirred in hexane, filtered off and dried to give 1.66 g (quantitative yield) of the title compound as a clear colorless oil.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.67 (1H, dd, J = 8.0 and 1.7 Hz), 7.58 (1H, d, J = 2.0 Hz), 6.90 (1H, d, J = 8.3 Hz), 4.65 (2H, t, J = 4.5Hz), 4.34 (2H, t, J = 4.5Hz), 3.91 (3H, s), 3.90 (3H, s), 3.16 (3H, s).
(6b) 3-methoxy-4- (2-morpholin-4-yl-ethoxy) -benzoic acid methyl ester 4- (2-methanesulfonyloxy-ethoxy) -3-methoxy- obtained in Example (6a) A suspension of benzoic acid methyl ester (304 mg), morpholine (0.11 mL), and potassium carbonate (276 mg) in acetonitrile (10 mL) was heated to reflux for 20 hours. The reaction mixture was diluted with ethyl acetate, washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, and concentrated. The residue was purified by column chromatography (dichloromethane / ethyl acetate 5: 1 to 1: 1 and dichloromethane / methanol 25: 1) to give 185 mg (63%) of the title compound as a yellow solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.67 (1H, dd, J = 8.4 and 2.2 Hz), 7.56 (1H, d, J = 2.0 Hz), 6.91 (1H, d, J = 8.6 Hz), 4.22 (2H, t, J = 5.9Hz), 3.91 (3H, s), 3.90 (3H, s), 3.74 (4H, t, J = 4.7Hz), 2.87 (2H, t, J = 6.0 Hz), 2.60 (4H, t, J = 4.7Hz).
(6c) 3-Methoxy-4- (2-morpholin-4-yl-ethoxy) -benzoic acid 3-methoxy-4- (2) obtained in Example (6b) in the same manner as in Example (1e). -Morpholin-4-yl-ethoxy) -benzoic acid methyl ester (185 mg) afforded 161 mg (92%) of the title compound as a white solid.
¹ H NMR (400MHz, DMSO-d6): δ (ppm) = 7.52 (1H, d, J = 7.8Hz), 7.43 (1H, s), 7.05 (1H, d, J = 8.2Hz), 4.12 (2H , t, J = 5.7Hz), 3.78 (3H, s), 3.55 (4H, brs), 3.30 (4H, brs), 2.69 (2H, t, J = 5.5Hz).
(6d) 3-Methoxy-4- (2-morpholin-4-yl-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide Example (1f) and In a similar manner, 3-methoxy-4- (2-morpholin-4-yl-ethoxy) -benzoic acid (161 mg) obtained in Example (6c) and 5- (3 84 mg of amides were obtained from -trifluoromethyl-benzyl) -thiazol-2-ylamine (148 mg).
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72-7.68 (3H, m), 7.64-7.58 (3H, m), 7.37 (1H, s), 7.12 ( 1H, d, J = 9.0Hz), 4.25 (2H, s), 4.16 (2H, t, J = 5.9Hz), 3.84 (3H, s), 3.58 (4H, t, J = 4.7Hz), 2.71 ( 2H, t, J = 5.9Hz), 2.48 (4H, t, J = 4.7Hz)
MS (ES) m / z: 522 (M + H) ^<+> .

Example 7 3,4-Bis- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 1-67)
(7a) 3,4-bis- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid ethyl ester In the same manner as in Example (1c), 3,4-dihydroxybenzoic acid ethyl ester ( 2.50 g) and 2- (2-bromoethoxy) tetrahydro-2H-pyran (4.65 g) gave 3.46 g (58%) of the title compound as a yellow oil.
MS (FAB ⁺ ) m / z: 461 (M + Na) ⁺ .
(7b) 3,4-Bis- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid 3,4 obtained in Example (7a) in the same manner as Example (1e) -Bis- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid ethyl ester (2.04 g) gave 2.04 g (quantitative yield) of the title compound as a yellow oil.
MS (ES) m / z: 409 (M-H) ⁺ .
(7c) 3,4-Bis- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide In the same manner as in Example (1f). 3,4-bis- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (173 mg) obtained in Example (7b) and 5- (3 From trifluoromethyl-benzyl) -thiazol-2-ylamine (100 mg), 267 mg of an amide compound was obtained. 165 mg of this amide was deprotected with 1N hydrochloric acid to obtain 45.2 mg (39%) of the title compound as a white amorphous.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.71 (1H, d, J = 2.4 Hz), 7.68-7.66 (2H, m), 7.62-7.55 (3H, m), 7.35 (1H, s), 7.09 (1H, d, J = 8.8Hz), 4.89 (1H, t, J = 6.9Hz), 4.87 (1H, t, J = 6.6Hz), 4.23 (2H, s), 4.08 (2H, t, J = 5.1Hz), 4.07 (2H, t, J = 5.0Hz), 3.74 (2H, q, J = 6.1Hz), 3.73 (2H, q, J = 6.1Hz)
MS (ES) m / z: 483 (M + H) ^<+> .

Example 8 5- (3-Trifluoromethyl-benzyl) -thiazole-2-carboxylic acid [3- (2-hydroxy-ethoxy) -4-methoxy-phenyl] -amide (Compound No. 2-7)
(8a) 2- (2-Methoxy-5-nitro-phenoxy) -ethanol 2-methoxy-5-nitro-phenol (5.02 g), 2-bromoethanol (4.3 mL), and potassium carbonate (8 A suspension of .22 g) in dimethylacetamide (50 mL) (50 mL) was stirred at 80 ° C. for 28 hours. The mixture was diluted with ethyl acetate, washed with water (x2) and saturated brine, and concentrated to give 4.99 g (79%) of the title compound as a pale yellow solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.96 (1H, d, J = 2.4 Hz), 7.87 (1H, dd, J = 58.5 and 2.5 Hz), 6.94 (1H, d, J = 9.0 Hz), 4.53 (1H, s), 4.21 (2H, t, J = 4.5Hz), 4.03 (2H, t, J = 4.5Hz), 3.97 (3H, s).
(8b) tert-butyl- [2- (2-methoxy-5-nitro-phenoxy) -ethoxy) -dimethylsilane 2- (2-methoxy-5-nitro-phenoxy) -ethanol obtained in Example (8a) (4.9 g), tert-butyldimethylsilyl chloride (5.00 g), and a solution of imidazole (2.42 g) in dimethylformamide (50 mL) were stirred at room temperature for 24 hours. The reaction mixture was diluted with ethyl acetate, washed with water (x2) and brine, dried over sodium sulfate and concentrated to give 8.34 g (quantitative yield) of the title compound as a brown oil.
MS (ES) m / z: 328 (M + H) ⁺ .
(8c) 3- [2- (tert-Butyl-dimethyl-silanyloxy) -ethoxy] -4-methoxyphenylamine tert-butyl- [2- (2-methoxy-5-nitro-) obtained in Example (8b) A suspension of phenoxy) -ethoxy] -dimethylsilane (8.34 g) and palladium on carbon (10%, 1.6 g) in tetrahydrofuran (100 mL) was stirred at room temperature for 48 hours in a hydrogen atmosphere. The reaction mixture was filtered and concentrated. The residue was purified by column chromatography (dichloromethane / ethyl acetate 10: 1) to obtain 6.12 g (88%) of the title compound as a red brown solid.
MS (ES) m / z: 297 (M + H) ⁺ .
(8d) 2-Bromo-5- (3-trifluoromethyl-benzyl) -thiazole 5- (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (2.85 g) obtained in Example (1b). ), Copper sulfate (5.27 g), sodium bromide (4.53 g) in sulfuric acid (9 mol / L, 24 mL) suspension of sodium nitrite (911 mg) in water (10 mL) Slowly added at 0 ° C. The reaction mixture was stirred at 0 ° C. for 1 hour, then warmed to room temperature, stirred for 3.5 hours, diluted with water, and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate) to obtain 812 mg (23%) of the title compound as a pale yellow oil.
MS (FAB ⁺ ) m / z: 322 (M + H) ⁺ .
(8e) 5- (3-Trifluoromethyl-benzyl) -thiazole-2-carboxylic acid [3- (2-hydroxy-ethoxy) -4-methoxy-phenyl) -amide triphosgene (44 mg) in dichloromethane (1 mL ) Solution of 3- [2- (tert-butyl-dimethyl-silanyloxy) -ethoxy] -4-methoxyphenylamine (111 mg) obtained in Example (8c) in dichloromethane (2 mL) and triethylamine (114 μL) was added dropwise at room temperature. The reaction mixture is stirred at room temperature for 20 minutes, diluted with ethyl acetate, washed with saturated sodium bicarbonate solution and brine, dried over sodium sulfate, filtered through celite, and concentrated to remove the isocyanate as a brown solid. Obtained.

To a solution of 2-bromo-5- (3-trifluoromethyl-benzyl) -thiazole (93 mg) obtained in Example (8d) in anhydrous tetrahydrofuran (1 mL) was added n-butyllithium (1.6 M, hexane solution). 218 μL) was added at −78 ° C. After 1 hour, an anhydrous tetrahydrofuran (1 mL) solution of the isocyanate obtained by the above production method was added at -78 ° C. The reaction mixture was slowly warmed to room temperature, diluted with ethyl acetate, washed with aqueous ammonium chloride and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate) to obtain 89 mg of amide compound as a brown syrup. This amide was deprotected with 1N hydrochloric acid to obtain 37.0 mg (22%) of the title compound as a yellow solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 10.5 (1H, brs), 7.93 (1H, s), 7.72 (1H, s), 7.66-7.58 (3H, m), 7.53 (1H, d, J = 2.4Hz), 7.40 (1H, dd, J = 8.8 and 2.4Hz), 6.92 (1H, d, J = 8.8Hz), 4.85 (1H, brs), 4.42 (2H, s), 3.93 ( 2H, t, J = 5.2Hz), 3.74 (3H, s), 3.74-3.72 (2H, m).
MS (ES) m / z: 453 (M + H) ⁺ .
Melting point: 104-106 ° C.

Example 9 3- (2-hydroxy-ethoxy) -N- {5- [hydroxy- (3-trifluoromethyl-phenyl) -methyl] -thiazol-2-yl} -4-methoxy-benzamide (compound (Number 9-17)
(9a) {5- [Hydroxy- (3-trifluoromethylphenyl) -methyl] -thiazol-2-yl) -carbamic acid tert-butyl ester (5-Bromo-thiazol-2-yl) -carbamic acid To a solution of tert-butyl ester (1.07 g) in anhydrous tetrahydrofuran (10 mL), n-butyllithium (2.7 mol / L hexane solution, 3.6 mL) was slowly added dropwise at -78 ° C.
After 1 hour, a solution of 3-trifluoromethylbenzaldehyde (1.00 g) in anhydrous tetrahydrofuran (5 mL) was slowly added dropwise. The reaction mixture was slowly warmed to −5 ° C., diluted with saturated aqueous ammonium chloride and extracted with ethyl acetate. The organic layer was washed with water and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate) to obtain 0.98 g (68%) of the title compound as a yellow solid.
MS (ES) m / z: 375 (M + H) ⁺ .
(9b) [5- (3-Trifluoromethyl-benzoyl) -thiazol-2-yl] -carbamic acid tert-butyl ester {5- [hydroxy- (3-trifluoromethyl) obtained in Example (9a) To a solution of (phenyl) -methyl] -thiazol-2-yl} -carbamic acid tert-butyl ester (473 mg) in dichloromethane (10 mL) was added Dess-Martin reagent (536 mg) at room temperature. After 30 minutes, the reaction mixture was concentrated, diluted with saturated aqueous sodium bicarbonate, and extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate) to obtain 334 mg (71%) of the title compound as a yellow solid.
MS (ES) m / z: 371 (M-H) ⁺ .
(9c) (2-Amino-thiazol-5-yl)-(3-trifluoromethyl-phenyl) -methanone [5- (3-trifluoromethyl-benzoyl) -thiazole-2 obtained in Example (9b) To a suspension of -yl] -carbamic acid tert-butyl ester (234 mg) in dichloromethane (5 mL) was added trifluoroacetic acid (1.7 mL) at room temperature. The resulting yellow solution was stirred for 2 hours, the reaction mixture was concentrated, neutralized with saturated aqueous sodium bicarbonate, and extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (dichloromethane / methanol) to obtain 149 mg (87%) of the title compound as a yellow solid.
MS (ES) m / z: 273 (M + H) ⁺ .
(9d) 3- (2-Hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzoyl) -thiazol-2-yl] -benzamide In the same manner as in Example (1f), 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (175 mg) obtained in Example (1e) and (2-amino-) obtained in Example (9c) An amide was obtained from thiazol-5-yl)-(3-trifluoromethyl-phenyl) -methanone (146 mg). This amide was deprotected with 1N hydrochloric acid to obtain 136 mg (54%) of the title compound as a white solid.
MS (ES) m / z: 467 (M + H) ⁺ .
(9e) 3- (2-Hydroxy-ethoxy) -N- {5- [hydroxy- (3-trifluoromethyl-phenyl) -methyl] -thiazol-2-yl} -4-methoxy-benzamide Example (9d 3- (2-hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzoyl) -thiazol-2-yl] -benzamide (31 mg) in methanol / tetrahydrofuran (1 : 1,6 mL) To the suspension was added sodium borohydride (5 mg) at 0 ° C. The reaction mixture was allowed to rise to room temperature, sodium borohydride was added until the end of the reaction, concentrated, diluted with 1N hydrochloric acid and extracted with ethyl acetate. The organic layer was washed with sodium bicarbonate and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (dichloromethane / methanol) to obtain 15 mg (48%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.72 (1H, s), 7.66-7.61 (2H, m), 7.57 (1H, d, J = 7.8Hz), 7.50 (1H, d, J = 7.8Hz), 7.47 (1H, s), 7.13 (1H, s), 6.95 (1H, d, J = 8.2Hz), 6.09 (1H, s), 4.05-3.97 (4H, m), 3.92 (3H , s)
MS (ES) m / z: 469 (M + H) ⁺ .
Melting point: 119-121 ° C.

Example 10 N- [5- (3-Fluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-16)
(10a) 3- (3-Fluoro-phenyl) -propionaldehyde The title compound 6 was prepared from 3-fluoroiodobenzene (10.0 g) and allyl alcohol (4.64 mL) in the same manner as in Example (1a). Obtained .24 g (91%) as a brown oil.
¹ H NMR (500 MHz, CDCl ₃ ): δ (ppm) = 9.82 (1H, s), 7.27-7.23 (1H, m), 6.98-6.96 (1H, m), 6.92-6.89 (2H, m), 2.96 (2H, t, J = 7.4Hz), 2.79 (2H, t, J = 7.4Hz).
(10b) 5- (3-Fluoro-benzyl) -thiazol-2-ylamine In the same manner as in Example (1b), 3- (3-fluoro-phenyl) -propionaldehyde obtained in Example (10a) ( The title compound 3.70 g (43%) was obtained as an off-white solid from 6.24 g) and thiourea (3.19 g).
MS (ES) m / z: 209 (M + H) ⁺ .
(10c) N- [5- (3-Fluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Performed in the same manner as in Example (1f). 4-Methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (161 mg) obtained in Example (1e), 5- (3- 132 mg (55%) of the amide was obtained from (fluoro-benzyl) -thiazol-2-ylamine (103 mg). This amide was deprotected with 1N hydrochloric acid to obtain 84.9 mg (78%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72-7.70 (2H, m), 7.41-7.33 (2H, m), 7.15-7.05 (4H, m), 4.88 (1H, t, J = 5.4Hz), 4.14 (2H, s), 4.07 (2H, t, J = 5.2Hz), 3.84 (3H, s), 3.75 (2H, dt, J = 5.4, 5.2Hz )
MS (ES) m / z: 403 (M + H) ⁺ .
Melting point: 160-162 ° C.

Example 11 N- [5- (2,5-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-320)
(11a) 3- (2,5-Dichloro-phenyl) -propionaldehyde 2,5-dichloroiodobenzene (10.0 g) and allyl alcohol (3.77 mL) were prepared in the same manner as in Example (1a). Gave 7.64 g (quantitative yield) of the title compound as a light brown oil.
MS (EI) m / z: 202 M ⁺ .
(11b) 5- (2,5-Dichloro-benzyl) -thiazol-2-ylamine 3- (2,5-dichloro-phenyl) obtained in Example (11a) in the same manner as in Example (1b) -Propionaldehyde (7.64 g) and thiourea (2.92 g) gave 3.21 g (34%) of the title compound as a pale yellow solid.
MS (EI) m / z: 258 M ⁺ .
(11c) N- [5- (2,5-dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide In a manner similar to Example (1f). 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (135 mg), obtained in Example (1e), 5- ( 161 mg (72%) of the amide was obtained from 2,5-dichloro-benzyl) -thiazol-2-ylamine (108 mg). This amide was deprotected with 1N hydrochloric acid to obtain 110 mg (81%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.71 (1H, d, J = 8.9 Hz), 7.71 (1H, s), 7.57 (1H, d, J = 2.7Hz), 7.52 (1H, d, J = 8.6Hz), 7.39 (1H, dd, J = 8.6 and 2.7Hz), 7.34 (1H, s), 7.10 (1H, d, J = 8.9Hz), 4.89 (1H, t, J = 5.2Hz), 4.22 (2H, s), 4.07 (2H, t, J = 5.0Hz), 3.84 (3H, s), 3.75 (2H, dt, J = 5.2, 5.0Hz)
MS (ES) m / z: 453 (M + H) ⁺ .
Melting point: 210-211 ° C.

Example 12 N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-40)
(12a) 3- (3-Chloro-phenyl) -propionaldehyde In the same manner as in Example (1a), the title compound 7 was prepared from 3-chloroiodobenzene (10.0 g) and allyl alcohol (4.33 mL). .36 g (quantitative yield) was obtained as a light brown oil.
MS (EI) m / z: 168 M ⁺ .
(12b) 5- (3-Chloro-benzyl) -thiazol-2-ylamine In the same manner as in Example (1b), 3- (3-chloro-phenyl) -propionaldehyde obtained in Example (12a) ( From 7.36 g) and thiourea (3.39 g), 4.70 g (50%) of the title compound was obtained as a pale yellow solid.
MS (ES) m / z: 225 (M + H) ⁺ .
(12c) N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Carried out in a manner similar to Example (1f). 4-Methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (144 mg) obtained in Example (1e), 5- (3- 133 mg (60%) of the amide was obtained from chloro-benzyl) -thiazol-2-ylamine (99.3 mg). This amide was deprotected with 1N hydrochloric acid to obtain 90.0 mg (81%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72 (1H, s), 7.71 (1H, d, J = 7.1 Hz), 7.38-7.35 (2H, m) , 7.31-7.26 (3H, m), 7.07 (1H, d, J = 8.9Hz), 4.88 (1H, t, J = 5.3Hz), 4.12 (2H, s), 4.06 (2H, t, J = 5.3 Hz), 3.84 (3H, s), 3.75 (2H, dt, J = 5.3, 5.3Hz)
MS (ES) m / z: 419 (M + H) ⁺ .
Melting point: 169-171 ° C.

Example 13 4-Ethoxy-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 1-65)
(13a) 4-Fluoro-3-hydroxy-benzoic acid ethyl ester A solution of 4-fluoro-3-hydroxy-benzoic acid (5.0 g) and concentrated sulfuric acid (2.5 mL) in ethanol (50 mL) for 23 hours Heated to reflux. The reaction mixture was concentrated, diluted with ethyl acetate, washed with water, saturated aqueous sodium bicarbonate, and brine, dried over sodium sulfate, and concentrated to give 5.67 g (96%) of the title compound as white. Obtained as a solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.73 (1H, dd, J = 8.4 and 2.1 Hz), 7.63-7.59 (1H, m), 7.12 (1H, dd, J = 9.8 and 8.6 Hz) ), 5.60 (1H, d, J = 3.5Hz), 4.37 (2H, q, J = 7.2Hz), 1.39 (3H, t, J = 7.0Hz).
(13b) 4-Fluoro-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy) -benzoic acid ethyl ester 4-fluoro-3-hydroxy-benzoic acid ethyl ester obtained in Example (13a) ( A suspension of 5.67 g), 2- (2-bromoethoxy) tetrahydro-2H-pyran (7.75 g), and potassium carbonate (8.52 g) in acetonitrile (50 mL) was heated at reflux for 3 days. did. The reaction mixture was diluted with ethyl acetate, washed with water and saturated brine, dried over sodium sulfate, and concentrated to give 10.6 g (quantitative yield) of the title compound as a brown oil.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.72 (1H, dd, J = 7.8 and 2.0 Hz), 7.67-7.63 (1H, m), 7.11 (1H, dd, J = 10.8 and 8.5 Hz) ), 4.73 (1H, t, J = 3.5Hz), 4.37 (2H, q, J = 7.3Hz), 4.32-4.26 (2H, m), 4.12-4.07 (1H, m), 3.94-3.83 (2H, m), 3.56-3.50 (1H, m), 1.89-1.69 (2H, m), 1.67-1.50 (4H, m), 1.39 (3H, t, J = 7.2Hz).
(13c) 4-Ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy) -benzoic acid ethyl ester 4-fluoro-3- [2- (tetrahydro-pyran obtained in Example (13b)] 2-yloxy) -ethoxy] -benzoic acid ethyl ester (10.6 g) and sodium ethoxide (21 wt% ethanol solution, 14.5 mL) in ethanol (100 mL) were heated to reflux for 20 hours. The reaction mixture was concentrated, diluted with water and extracted with ethyl acetate (twice). The organic layer was washed with saturated brine, dried over sodium sulfate and concentrated to give 8.96 g (quantitative yield) of the title compound as a brown oil.
MS (ES) m / z: 339 (M + H) ⁺ .
(13d) 4-Ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy) -benzoic acid 4-ethoxy- obtained in Example (13c) in the same manner as in Example (1e) 3- [2- (Tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid ethyl ester (8.96 g) afforded 4.28 g (45%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.6 (1H, brs), 7.53 (1H, d, J = 7.8 Hz), 7.47 (1H, s), 7.02 (1H, d, J = 9.0Hz), 4.67 (1H, s), 4.14 (1H, s), 4.08 (2H, q, J = 6.9Hz), 3.91-3.87 (1H, m), 3.82-3.77 (1H, m), 3.73- 3.70 (1H, m), 3.42-3.38 (2H, m), 1.75-1.66 (1H, m), 1.64-1.55 (1H, m), 1.52-1.38 (4H, m), 1.32 (3H, t, J = 6.6Hz).
MS (EI) m / z: 310 M ⁺ .
(13e) 4-Ethoxy-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl) -benzamide In a manner similar to Example (1f). 4-ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (203 mg) obtained in Example (13d) and 5- (3 An amide compound was obtained from -trifluoromethyl-benzyl) -thiazol-2-ylamine (176 mg). This amide was deprotected with 1N hydrochloric acid to obtain 10 mg (4%) of the title compound as a pale yellow solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 11.7 (1H, s), 7.73-7.66 (3H, m), 7.64-7.57 (3H, m), 7.37 (1H, s), 7.08 ( 1H, d, J = 10.2Hz), 4.86 (1H, t, J = 6.0Hz), 4.25 (2H, s), 4.12 (2H, q, J = 7.3Hz), 4.08 (1H, t, J = 5.8 Hz), 3.84-3.73 (3H, m), 1.36 (3H, t, J = 6.9Hz)
MS (ES) m / z: 467 (M + H) ⁺ .
Melting point: 130-133 ° C.

Example 14 3- (2-Hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzyl) -thiophen-2-yl] -benzamide (Compound No. 7-7)
(14a) Thiophen-2-yl- (3-trifluoromethyl-phenyl) -methanol In the same manner as in Example (9a), thiophene (1.8 mL) and 3-trifluoromethylbenzaldehyde (2.7 mL) ) Gave 5.05 g (98%) of the title compound as a yellow oil.
MS (EI) m / z: 258 M ⁺ .
(14b) 2- (3-Trifluoromethyl-benzyl) -thiophene To a suspension of sodium iodo (5.37 g) in acetonitrile (9 mL) was added chlorotrimethylsilane (4.5 mL) at room temperature. After 15 minutes, a solution of thiophen-2-yl- (3-trifluoromethyl-phenyl) -methanol (1.99 g) obtained in Example (14a) in acetonitrile (20 mL) was slowly added to the reaction mixture at 0 ° C. And dripped. After further stirring at 0 ° C. for 15 minutes, 2N aqueous sodium hydroxide solution (13.5 mL) was added. The mixture was extracted with ethyl acetate. The organic layer was washed with saturated aqueous sodium bicarbonate, sodium thiosulfate, and saturated brine, dried over sodium sulfate, and concentrated.
The residue was purified by column chromatography (hexane / ethyl acetate) to obtain 1.63 g (87%) of the title compound as a yellow oil.
MS (EI) m / z: 242 M ⁺ .
(14c) 2-Nitro-5- (3-trifluoromethyl-benzyl) -thiophene 2- (3-trifluoromethyl-benzyl) -thiophene (702 mg) obtained in Example (14b) (9 mg) To the solution was added a suspension of copper (II) nitrate trihydrate (700 mg) in acetic anhydride (9 mL) at 0 ° C. After 1.5 hours, the reaction mixture was placed on ice, stirred for 1 hour, and the supernatant was removed. The oily residue was extracted with ethyl acetate and water. The organic layer was washed with saturated aqueous sodium hydrogen carbonate solution and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (hexane / ethyl acetate) to give 689 mg (83%) of the title compound as a brown oil.
MS (ES) m / z: 286 (M-H) ⁺ .
(14d) 3- (2-Hydroxy-ethoxy) -4-methoxy-N- [5- (3-trifluoromethyl-benzyl) -thiophen-2-yl] -benzamide 2-amide obtained in Example (14c) Add zinc powder (692 mg) several times at room temperature to a mixed solution of nitro-5- (3-trifluoromethyl-benzyl) -thiophene (152 mg) in isopropyl alcohol (10 mL) and 1N hydrochloric acid (5 mL). It was added separately. After 30 minutes, saturated aqueous sodium bicarbonate was added to the reaction mixture. The resulting mixture was stirred for 10 minutes and filtered through celite. The filtrate was extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was dissolved in dimethylacetamide (2 mL) and 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (157 mg) obtained in Example (1e). , HATU (201 mg), and triethylamine (0.15 mL). The reaction mixture was stirred overnight at room temperature, diluted with ethyl acetate, washed with saturated sodium bicarbonate, water, and brine, dried over sodium sulfate, and concentrated. The residue was purified by column chromatography (dichloromethane / ethyl acetate) to obtain 46 mg of an amide compound. This amide was deprotected with 1N hydrochloric acid to obtain 19 mg (8%) of the title compound as a yellow solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 11.2 (1H, brs), 7.63-7.53 (6H, m), 7.09 (1H, d, J = 8.7 Hz), 6.72 (1H, d, J = 3.9Hz), 6.70 (1H, d, J = 3.9Hz), 4.89 (1H, t, J = 5.4Hz), 4.18 (2H, s), 4.05 (2H, t, J = 5.1Hz), 3.84 (3H, s), 3.75 (2H, q, J = 5.1Hz)
MS (EI) m / z: 452 (M + H) ⁺ .
Melting point: 174-176 ° C.

Example 15 N- [5- (3-Trifluoromethoxy-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-97)
(15a) 3- (3-trifluoromethoxy-phenyl) -propionaldehyde 3- (trifluoromethoxy) iodobenzene (5.04 g) and allyl alcohol (1.80) were prepared in the same manner as in Example (1a). mL) gave 3.61 g (95%) of the title compound as a yellow oil.
MS (EI) m / z: 218 M ⁺ .
(15b) 5- (3-Trifluoromethoxy-benzyl) -thiazol-2-ylamine 3- (3-trifluoromethoxy-phenyl) obtained in Example (15a) in the same manner as in Example (1b) -Propionaldehyde (3.61 g) and thiourea (1.29 g) gave 1.50 g (33%) of the title compound as a white solid.
MS (ES) m / z: 275 (M + H) ⁺ .
(15c) N- [5- (3-Trifluoromethoxy-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide In a manner similar to Example (1f). 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (133 mg), obtained in Example (1e), 5- ( 112 mg (50%) of the amide compound was obtained from 3-trifluoromethoxy-benzyl) -thiazol-2-ylamine (112 mg). This amide was deprotected with 1N hydrochloric acid to obtain 69.1 mg (73%) of the title compound as a white solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.70 (1H, s), 7.69 (1H, d, J = 8.3 Hz), 7.46 (1H, t, J = 8.0Hz), 7.32 (1H, d, J = 7.8Hz), 7.27-7.22 (3H, m), 7.04 (1H, d, J = 8.3Hz), 4.87 (1H, t, J = 5.6Hz), 4.15 (2H, s), 4.05 (2H, t, J = 5.1Hz), 3.82 (3H, s), 3.75 (2H, dt, J = 5.6, 5.1Hz)
MS (ES) m / z: 469 (M + H) ⁺ .
Melting point: 158-159 ° C.

Example 16 N- [5- (4-Fluoro-3-trifluoromethyl-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1 -177)
(16a) 3- (4-Fluoro-3-trifluoromethyl-phenyl) -propionaldehyde In the same manner as in Example (1a), 2-fluoro-5-iodobenzotrifluoride (4.91 g) and allyl From the alcohol (1.74 mL), 2.94 g (79%) of the title compound was obtained as a brown oil.
MS (EI) m / z: 220 M ⁺ .
(16b) 5- (4-Fluoro-3-trifluoromethyl-benzyl) -thiazol-2-ylamine 3- (4-fluoro-) obtained in Example (16a) in the same manner as in Example (1b) 3-Trifluoromethyl-phenyl) -propionaldehyde (2.94 g) and thiourea (1.04 g) gave 1.63 g (44%) of the title compound as a white solid.
MS (ES) m / z: 277 (M + H) ⁺ .
(16c) N- [5- (4-Fluoro-3-trifluoromethyl-benzyl) -thiazol-2-yl) -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Example (1f) and In a similar manner, 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (136 mg) obtained in Example (1e), obtained in Example (16b) , 5- (4-Fluoro-3-trifluoromethyl-benzyl) -thiazol-2-ylamine (115 mg) gave amide form 134 mg (58%). This amide was deprotected with 1N hydrochloric acid to obtain 91.0 mg (81%) of the title compound as a white solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.74-7.66 (4H, m), 7.48 (1H, t, J = 9.8 Hz), 7.35 (1H, s) , 7.09 (1H, d, J = 8.7Hz), 4.88 (1H, t, J = 5.4Hz), 4.22 (2H, s), 4.07 (2H, t, J = 5.4Hz), 3.84 (3H, s) , 3.75 (2H, dt, J = 5.4, 5.4Hz)
MS (ES) m / z: 471 (M + H) ⁺ .
Melting point: 156-157 ° C.

Example 17 N- [5- (3,5-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-273)
(17a) 3- (3,5-Dichloro-phenyl) -propionaldehyde 3,5-Dichloroiodobenzene (5.23 g) and allyl alcohol (1.97 mL) in the same manner as in Example (1a). Gave 2.16 g (55%) of the title compound as a yellow oil.
MS (EI) m / z: 202 M ⁺ .
(17b) 5- (3,5-Dichloro-benzyl) -thiazol-2-ylamine 3- (3,5-dichloro-phenyl) obtained in Example (17a) in the same manner as in Example (1b) -Propionaldehyde (2.16 g) and thiourea (825 mg) gave 706 mg (26%) of the title compound as a pale yellow solid.
MS (ES) m / z: 259 (M + H) ⁺ .
(17c) N- [5- (3,5-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide In a manner similar to Example (1f). 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (221 mg) obtained in Example (1e), 5- ( 232 mg (43%) of the amide was obtained from 3,5-dichloro-benzyl) -thiazol-2-ylamine (193 mg). This amide was deprotected with 1N hydrochloric acid to obtain 155 mg (79%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.3 (1H, brs), 7.51 (1H, dd, J = 8.4, 1.0 Hz), 7.50 (1H, s), 7.24 (1H, d, J = 1.0Hz), 7.13 (2H, d, J = 6.7Hz), 7.13 (1H, s), 6.92 (1H, d, J = 8.4Hz), 4.17 (2H, t, J = 4.5Hz), 4.05 ( 2H, s), 4.01 (2H, brs), 3.90 (3H, s), 2.66 (1H, brs)
MS (ES) m / z: 453 (M + H) ⁺ .
Melting point: 174-175 ° C.

Example 18 N- [5- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1 −305)
(18a) 3- (3,5-bis-trifluoromethyl-phenyl) -propionaldehyde 3,5-bis (trifluoromethyl) iodobenzene (5.07 g) in the same manner as in Example (1a) And allyl alcohol (1.55 mL) gave 672 mg (17%) of the title compound as a light brown solid.
MS (EI) m / z: 270 M ⁺ .
(18b) 5- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-2-ylamine In the same manner as in Example (1b), 3- (3,5- The title compound (116 mg, 14%) was obtained as a white solid from bis-trifluoromethyl-phenyl) -propionaldehyde (672 mg) and thiourea (193 mg).
MS (ES) m / z: 327 (M + H) ⁺ .
(18c) N- [5- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-2-yl) -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Example (1f) and In a similar manner, 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (105 mg) obtained in Example (1e), obtained in Example (18b). , 5- (3,5-bis-trifluoromethyl-benzyl) -thiazol-2-ylamine (116 mg) gave 88.6 mg (41%) of the amide. This amide was deprotected with 1N hydrochloric acid to obtain 75.6 mg (99%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.3 (1H, brs), 7.79 (1H, s), 7.71 (2H, s), 7.53-7.48 (2H, m), 7.17 (1H, s ), 6.91 (1H, d, J = 8.6Hz), 4.24 (2H, s), 4.17 (2H, t, J = 4.4Hz), 4.02 (2H, brs), 3.89 (3H, s), 2.76 (1H , brs)
MS (ES) m / z: 521 (M + H) ⁺ .
Melting point: 172-173 ° C.

Example 19 N- [5- (3,5-Difluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-233)
(19a) 3- (3,5-Difluoro-phenyl) -propionaldehyde 3,5-difluoroiodobenzene (5.10 g) and allyl alcohol (2.12 mL) in the same manner as in Example (1a) Gave 2.83 g (81%) of the title compound as a pale yellow oil.
MS (EI) m / z: 170 M ⁺ .
(19b) 5- (3,5-Difluoro-benzyl) -thiazol-2-ylamine 3- (3,5-difluoro-phenyl) obtained in Example (19a) in the same manner as Example (1b) Propionaldehyde (2.83 g) and thiourea (1.29 g) gave 1.76 g (47%) of the title compound as a white solid.
MS (ES) m / z: 227 (M + H) ⁺ .
(19c) N- [5- (3,5-Difluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide In a manner similar to Example (1f). 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (138 mg), obtained in Example (1e), 5- ( 75.4 mg (32%) of the amide was obtained from 3,5-difluoro-benzyl) -thiazol-2-ylamine (106 mg). This amide was deprotected with 1N hydrochloric acid to obtain 50.2 mg (80%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73-7.71 (2H, m), 7.35 (1H, s), 7.13-7.04 (4H, m), 4.89 ( 1H, t, J = 5.5Hz), 4.15 (2H, s), 4.07 (2H, t, J = 5.2Hz), 3.84 (3H, s), 3.76 (2H, dt, J = 5.5, 5.2Hz)
MS (ES) m / z: 421 (M + H) ⁺ .
Melting point: 175-176 ° C.

Example 20 N- [5- (3-Chloro-4-fluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-145) )
(20a) 3- (3-Chloro-4-fluoro-phenyl) -propionaldehyde In the same manner as in Example (1a), 3-chloro-4-fluoroiodobenzene (5.04 g) and allyl alcohol (1 .98 mL) gave 2.82 g (79%) of the title compound as a pale yellow oil.
MS (EI) m / z: 186 M ⁺ .
(20b) 5- (3-Chloro-4-fluoro-benzyl) -thiazol-2-ylamine In the same manner as in Example (1b), 3- (3-chloro-4-) obtained in Example (20a) Fluoro-phenyl) -propionaldehyde (2.82 g) and thiourea (1.18 g) gave 2.00 g (55%) of the title compound as an off-white solid.
MS (ES) m / z: 243 (M + H) ⁺ .
(20c) N- [5- (3-Chloro-4-fluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Similar to Example (1f) 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (140 mg) obtained in Example (1e), 5 173 mg (70%) of the amide was obtained from-(3-chloro-4-fluoro-benzyl) -thiazol-2-ylamine (115 mg). This amide was deprotected with 1N hydrochloric acid to obtain 107 mg (74%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.9 (1H, brs), 7.52 (1H, dd, J = 8.6, 2.0 Hz), 7.46 (1H, d, J = 2.0 Hz), 7.47- 7.46 (1H, m), 7.13-7.05 (2H, m), 7.01 (1H, s), 6.88 (1H, d, J = 8.6Hz), 4.14 (2H, t, J = 4.7Hz), 4.04 (2H , s), 4.02 (2H, t, J = 4.7Hz), 3.87 (3H, s), 2.95 (1H, brs)
MS (ES) m / z: 437 (M + H) ⁺ .
Melting point: 152-153 ° C.

Example 21 N- [5- (3,4-Difluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-121)
(21a) 3- (3,4-Difluoro-phenyl) -propionaldehyde 3,4-difluoroiodobenzene (3.71 g) and allyl alcohol (1.59 mL) in the same manner as in Example (1a) Gave 2.19 g (83%) of the title compound as a pale yellow oil.
MS (EI) m / z: 170 M ⁺ .
(21b) 5- (3,4-Difluoro-benzyl) -thiazol-2-ylamine 3- (3,4-difluoro-phenyl) obtained in Example (21a) in the same manner as in Example (1b) -Propionaldehyde (2.19 g) and thiourea (1.00 g) gave 1.61 g (55%) of the title compound as a white solid.
MS (ES) m / z: 227 (M + H) ⁺ .
(21c) N- [5- (3,4-Difluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide In a manner similar to Example (1f). 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (154 mg), obtained in Example (1e), 5- ( The amide 129 mg (49%) was obtained from 3,4-difluoro-benzyl) -thiazol-2-ylamine (118 mg). This amide was deprotected with 1N hydrochloric acid to obtain 88.3 mg (82%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.5 (1H, brs), 7.53-7.49 (2H, m), 7.13-7.02 (3H, m), 6.98-6.96 (1H, m), 6.90 (1H, d, J = 8.6Hz), 4.15 (2H, t, J = 4.5Hz), 4.05 (2H, s), 4.01 (2H, brs), 3.90 (3H, s), 2.72 (1H, brs)
MS (ES) m / z: 421 (M + H) ⁺ .
Melting point: 163-164 ° C.

Example 22 3- (2-Hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (compound (Number 1-68)
(22a) 4-Fluoro-3-hydroxy-benzoic acid methyl ester In the same manner as in Example (13a), 4-fluoro-3-hydroxy-benzoic acid (10.0 g) was used to obtain 10.8 g of the title compound ( 99%) was obtained as a pale pink solid.
MS (ES) m / z: 171 (M + H) ⁺ .
(22b) 4-Fluoro-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester In the same manner as in Example (13b), 4- 20.4 g (quantitative yield) of the title compound was obtained as a pale yellow oil from fluoro-3-hydroxy-benzoic acid methyl ester (10.8 g).
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.73 (1H, dd, J = 8.2, 1.9 Hz), 7.66-7.63 (1H, m), 7.11 (1H, dd, J = 10.6, 8.6 Hz) ), 4.73 (1H, t, J = 3.5Hz), 4.31-4.27 (2H, m), 4.12-4.07 (1H, m), 3.92-3.83 (2H, m), 3.91 (3H, s), 3.56- 3.51 (1H, m), 1.84-1.82 (1H, m), 1.77-1.71 (1H, m), 1.65-1.51 (4H, m).
(22c) 4- (2-Methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid In the same manner as in Example (13c), in Example (22b) 0.68 g of light brown oil was obtained from the obtained 4-fluoro-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (1.98 g). In the same manner as in Example (1e), 284 mg (13%, 2 steps) of the title compound was obtained as a beige solid from this oil (0.68 g).
MS (ES) m / z: 339 (M-H) ⁺ .
(22d) 3- (2-Hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide Example (1f ) 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (154 mg) obtained in Example (22c), The amide compound was obtained from 5- (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (117 mg) obtained in Example (1b). This amide was deprotected with 1N hydrochloric acid to obtain 106 mg (47%) of the title compound as a white solid.
¹ H NMR (400MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.74 (1H, d, J = 2.0Hz), 7.70 (1H, d, J = 2.0Hz), 7.68 (1H , d, J = 2.3Hz), 7.68-7.68 (3H, m), 7.38 (1H, s), 7.11 (1H, d, J = 8.6Hz), 5.14 (1H, brs), 4.25 (2H, s) , 4.20-4.18 (2H, m), 4.09 (2H, t, J = 5.3Hz), 3.75 (2H, t, J = 5.2Hz), 3.70-3.68 (2H, m), 3.32 (3H, s).
MS (ES) m / z: 497 (M + H) ⁺ .
Melting point: 136-138 ° C.

Example 23 N- [5- (3,4-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-201)
(23a) 3- (3,4-Dichloro-phenyl) -propionaldehyde 3,4-Dichloroiodobenzene (5.00 g) and allyl alcohol (1.89 mL) in the same manner as in Example (1a). Gave 2.53 g (68%) of the title compound as a pale yellow oil.
MS (EI) m / z: 202 M ⁺ .
(23b) 5- (3,4-Dichloro-benzyl) -thiazol-2-ylamine 3- (3,4-dichloro-phenyl) obtained in Example (23a) in the same manner as in Example (1b) -Propionaldehyde (2.53 g) and thiourea (968 mg) gave 1.41 g (44%) of the title compound as a pale yellow solid.
MS (ES) m / z: 259 (M + H) ⁺ .
(23c) N- [5- (3,4-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide In a manner similar to Example (1f). 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (121 mg) obtained in Example (1e), 5- (3 , 4-Dichloro-benzyl) -thiazol-2-ylamine (106 mg) gave amide form 134 mg (61%). This amide was deprotected with 1N hydrochloric acid to obtain 90.0 mg (81%) of the title compound as a white solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72 (1H, s), 7.71 (1H, d, J = 7.8 Hz), 7.59 (1H, d, J = 8.8Hz), 7.58 (1H, s), 7.35 (1H, s), 7.30 (1H, dd, J = 7.8, 2.0Hz), 7.09 (1H, d, J = 8.8Hz), 4.88 (1H, t, J = 5.4Hz), 4.14 (2H, s), 4.07 (2H, t, J = 5.1Hz), 3.84 (3H, s), 3.75 (2H, dt, J = 5.4, 5.1Hz)
MS (ES) m / z: 453 (M + H) ⁺ .
Melting point: 165-166 ° C.

Example 24 N- [5- (3-Fluoro-4-methyl-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 1-160 )
(24a) 3- (3-Fluoro-4-methyl-phenyl) -propionaldehyde In the same manner as in Example (1a), 2-fluoro-4-iodotoluene (5.16 g) and allyl alcohol (2. 23 mL) gave 2.87 g (80%) of the title compound as a pale yellow oil.
MS (EI) m / z: 166 M ⁺ .
(24b) 5- (3-Fluoro-4-methyl-benzyl) -thiazol-2-ylamine In the same manner as in Example (1b), 3- (3-fluoro-4-) obtained in Example (24a) was used. Methyl-phenyl) -propionaldehyde (2.89 g) and thiourea (1.34 g) gave 1.24 g (32%) of the title compound as a white solid.
MS (ES) m / z: 223 (M + H) ⁺ .
(24c) N- [5- (3-Fluoro-4-methyl-benzyl) -thiazol-2-yl) -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Similar to Example (1f) 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (137 mg) obtained in Example (1e), obtained in Example (24b) 154 mg (67%) of the amide was obtained from-(3-fluoro-4-methyl-benzyl) -thiazol-2-ylamine (103 mg). This amide was deprotected with 1N hydrochloric acid to obtain 95.1 mg (74%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72 (1H, s), 7.71 (1H, d, J = 7.5 Hz), 7.28 (1H, s), 7.23 (1H, t, J = 8.0Hz), 7.09-7.01 (3H, m), 4.87 (1H, t, J = 5.4Hz), 4.08 (2H, s), 4.06 (2H, t, J = 5.1Hz) , 3.84 (3H, s), 3.75 (2H, dt, J = 5.4, 5.1Hz), 2.20 (3H, s)
MS (ES) m / z: 417 (M + H) ⁺ .
Melting point: 181-182 ° C.

Example 25 2- (3,5-Bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid [3- (2-hydroxy-ethoxy) -4-methoxy-phenyl] -amide (Compound No. 4 -47)
(25a) 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid ethyl ester sodium ethoxide (20% ethanol solution, 18.5 mL) in anhydrous ether (40 mL) solution A solution of ethyl chloroacetate (5.0 mL) and ethyl formate (4.2 mL) in anhydrous ether (40 mL) was slowly added dropwise at 0 ° C. The reaction mixture was warmed to room temperature, stirred overnight and filtered. The filtrate was dissolved in water, acidified carefully with 2N hydrochloric acid and extracted with ether. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated to give 2.25 g of a brown oil. This oil (860 mg) was added to a solution of 2- [3,5-bis (trifluoromethyl) phenyl] ethanethioamide (410 mg) in toluene (4 mL). After refluxing for 5 hours, the reaction mixture was concentrated and purified by column chromatography (hexane / ethyl acetate) to obtain 532 mg (97%) of the title compound as a yellow oil.
MS (ES) m / z: 384 (M + H) ⁺ .
(25b) 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole obtained in Example (25a) A mixed solution of -5-carboxylic acid ethyl ester (260 mg) in 1N aqueous sodium hydroxide solution (1 mL) and 1,4-dioxane (3 mL) was heated at 60 ° C. for 30 minutes. The reaction mixture was acidified with 10% aqueous citric acid solution and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was washed with isopropyl ether / hexane (2: 1) solution, filtered off and dried to give 53 mg (22%) of the title compound as a pale yellow solid.
MS (ES) m / z: 354 (M-H) ⁺ .
(25c) 2- (3,5-Bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid [3- (2-hydroxy-ethoxy) -4-methoxy-phenyl) -amide in Example (25b) The obtained 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid (53 mg) and 3- [2- (tert-butyl-dimethyl-silanyloxy) obtained in Example (8c) ) -Ethoxy] -4-methoxyphenylamine (49 mg), HATU (62 mg), and triethylamine (40 μL) in dimethylacetamide (1 mL) were stirred at room temperature for 16 hours. The reaction mixture was diluted with ethyl acetate, washed with saturated aqueous sodium bicarbonate, water, saturated brine, dried over sodium sulfate and concentrated. The residue was dissolved in 1N hydrochloric acid (0.2 mL) and methanol (2 mL), and heated at 50 ° C. for 30 minutes. The reaction mixture was diluted with ethyl acetate, washed with saturated aqueous sodium bicarbonate and brine, dried over sodium sulfate, and concentrated. The residue was washed with isopropyl ether and dried to give 45 mg (58%) of the title compound as a brown solid.
¹ H NMR (400MHz, DMSO-d6): δ (ppm) = 10.2 (1H, brs), 8.47 (1H, s), 8.16 (2H, s), 8.07 (1H, s), 7.34 (1H, d, J = 2.4Hz), 7.23 (1H, dd, J = 8.6 and 2.4Hz), 6.95 (1H, d, J = 8.6Hz), 4.86 (1H, t, J = 5.5Hz), 4.66 (2H, s) , 3.94 (2H, t, J = 5.3Hz), 3.75 (3H, s), 3.73 (2H, q, J = 5.1Hz)
MS (ES) m / z: 521 (M + H) ⁺ .
Melting point: 148-150 ° C.

Example 26 N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-ethoxy-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 1-41)
In a manner similar to Example (1f), and 4-ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (158 mg) obtained in Example (13d), The amide compound 84.6 mg (32%) was obtained from 5- (3-chloro-benzyl) -thiazol-2-ylamine (114 mg) obtained in Example (12b). This amide was deprotected with 1N hydrochloric acid to obtain 35.0 mg (49%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 1.9 Hz), 7.69 (1H, dd, J = 8.2, 1.9 Hz), 7.39 -7.27 (5H, m), 7.08 (1H, d, J = 8.6Hz), 4.86 (1H, t, J = 5.1Hz), 4.15-4.11 (4H, m), 4.08 (2H, t, J = 5.0 Hz), 3.75 (2H, dt, J = 5.1, 5.0Hz), 1.35 (3H, t, J = 7.0Hz)
MS (ES) m / z: 433 (M + H) ⁺ .
Melting point: 151-153 ° C.

Example 27 4-Ethoxy-N- [5- (4-fluoro-3-trifluoromethyl-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide (Compound No. 1 -178)
In a manner similar to Example (1f), and 4-ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (130 mg) obtained in Example (13d), From 5- (4-fluoro-3-trifluoromethyl-benzyl) -thiazol-2-ylamine (116 mg) obtained in Example (16b), 120 mg (51%) of the amide was obtained. This amide was deprotected with 1N hydrochloric acid to obtain 42.6 mg (42%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.75-7.67 (4H, m), 7.48 (1H, dd, J = 10.6, 8.6 Hz), 7.35 (1H, s), 7.08 (1H, d, J = 8.6Hz), 4.86 (1H, t, J = 5.5Hz), 4.22 (2H, s), 4.12 (2H, q, J = 7.0Hz), 4.08 (2H, t, J = 5.2Hz), 3.75 (2H, dt, J = 5.5, 5.2Hz), 1.35 (3H, t, J = 7.0Hz)
MS (ES) m / z: 485 (M + H) ⁺ .
Melting point: 160-162 ° C.

Example 28 N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (Compound No. 1 -44)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 63 mg), an amide compound was obtained from 5- (3-chloro-benzyl) -thiazol-2-ylamine (42 mg) obtained in Example (12b). This amide was deprotected with 1N hydrochloric acid to obtain 22 mg (26%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72 (1H, d, J = 1.9 Hz), 7.66 (1H, dd, J = 8.4, 2.1 Hz), 7.35 (1H, t, J = 7.8Hz), 7.33 (1H, s), 7.30-7.22 (3H, m), 7.04 (1H, d, J = 8.6Hz), 4.84 (1H, brs), 4.17 (2H, t, J = 4.5Hz), 4.08 (2H, s), 4.07 (2H, t, J = 6.0Hz), 3.74 (2H, q, J = 5.1Hz), 3.68 (2H, t, J = 4.5Hz) , 3.32 (3H, s).
MS (ESI) m / z: 463 (M + H) ⁺ .
Melting point: 143-144 ° C.

Example 29 N- [5- (4-Fluoro-3-trifluoromethyl-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -Benzamide (Compound No. 1-181)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 60 mg), an amide compound was obtained from 5- (4-fluoro-3-trifluoromethyl-benzyl) -thiazol-2-ylamine (49 mg) obtained in Example (16b). This amide was deprotected with 1N hydrochloric acid to obtain 24 mg (26%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.74 (1H, dd, J = 6.3, 2.0 Hz), 7.73 (1H, s), 7.70-7.67 (2H, m), 7.49 (1H, t, J = 5.3Hz), 7.36 (1H, s), 7.12 (1H, s), 4.85 (1H, t, J = 5.3Hz), 4.22 (2H, s), 4.19 ( 2H, t, J = 4.7Hz), 4.09 (2H, t, J = 5.2Hz), 3.75 (2H, q, J = 5.5Hz), 3.68 (2H, t, J = 4.5Hz), 3.32 (3H, s).
MS (ESI) m / z: 515 (M + H) ⁺ .
Melting point: 158-159 ° C.

Example 30 N- [5- (3-Fluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (Compound No. 1 -20)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 166 mg), and the amide form was obtained from 5- (3-fluoro-benzyl) -thiazol-2-ylamine (101 mg) obtained in Example (10b). This amide was deprotected with 1N hydrochloric acid to obtain 68 mg (31%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 2.0 Hz), 7.69 (1H, dd, J = 8.4, 2.2 Hz), 7.41 -7.35 (1H, m), 7.33 (1H, s), 7.16-7.05 (4H, m), 4.85 (1H, t, J = 5.1Hz), 4.19 (2H, t, J = 4.7Hz), 4.14 ( 2H, s), 4.09 (2H, t, J = 5.2Hz), 3.75 (2H, q, J = 5.3Hz), 3.69 (2H, t, J = 4.6Hz), 3.32 (3H, s).
MS (ESI) m / z: 447 (M + H) ⁺ .
Melting point: 137-138 ° C.

Example 31 N- [5- (3,4-Difluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (compound Number 1-125)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 159 mg), an amide compound was obtained from 5- (3,4-difluoro-benzyl) -thiazol-2-ylamine (106 mg) obtained in Example (21b). This amide was deprotected with 1N hydrochloric acid to obtain 124 mg (57%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 2.0 Hz), 7.68 (1H, dd, J = 8.4, 2.1 Hz), 7.40 -7.34 (2H, m), 7.28 (1H, s), 7.16-7.13 (1H, m), 7.08 (1H, d, J = 8.6Hz), 4.85 (1H, t, J = 5.0Hz), 4.18 ( 2H, t, J = 4.7Hz), 4.10 (2H, s), 4.08 (2H, t, J = 5.5Hz), 3.75 (2H, q, J = 5.3Hz), 3.69 (2H, t, J = 4.5 Hz), 3.33 (3H, s).
MS (ESI) m / z: 465 (M + H) ⁺ .
Melting point: 150-152 ° C.

Example 32 N- [5- (3,5-Difluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (compound Number 1-237)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 157 mg), an amide compound was obtained from 5- (3,5-difluoro-benzyl) -thiazol-2-ylamine (104 mg) obtained in Example (19b). This amide was deprotected with 1N hydrochloric acid to obtain 131 mg (61%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 2.0 Hz), 7.69 (1H, dd, J = 8.4, 2.2 Hz), 7.37 (1H, s), 7.13-7.04 (4H, m), 4.19 (2H, t, J = 4.7Hz), 4.16 (2H, s), 4.09 (2H, t, J = 5.2Hz), 3.75 (2H, t, J = 5.1Hz), 3.69 (2H, t, J = 4.5Hz), 3.32 (3H, s).
MS (ESI) m / z: 465 (M + H) ⁺ .
Melting point: 140-143 ° C.

Example 33 N- [5- (3-Chloro-4-fluoro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (Compound Nos. 1-149)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 151 mg), an amide compound was obtained from 5- (3-chloro-4-fluoro-benzyl) -thiazol-2-ylamine (107 mg) obtained in Example (20b). This amide was deprotected with 1N hydrochloric acid to obtain 114 mg (54%) of the title compound as a white solid.
¹ H NMR (400MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 1.9Hz), 7.68 (1H, dd, J = 8.4, 2.2Hz), 7.51 (1H, dd, J = 7.1, 2.0Hz), 7.37 (1H, t, J = 9.0Hz), 7.32-7.28 (1H, m), 7.28 (1H, s), 7.08 (1H, d, J = 8.6 Hz), 4.85 (1H, t, J = 5.0Hz), 4.18 (2H, t, J = 4.7Hz), 4.10 (2H, s), 4.08 (2H, t, J = 5.2Hz), 3.75 (2H, q, J = 5.0Hz), 3.68 (2H, t, J = 4.5Hz), 3.32 (3H, s).
MS (ESI) m / z: 481 (M + H) ⁺ .
Melting point: 159-160 ° C.

Example 34 N- [5- (3,5-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (compound Number 1-277)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 142 mg), an amide compound was obtained from 5- (3,5-dichloro-benzyl) -thiazol-2-ylamine (108 mg) obtained in Example (17b). This amide was deprotected with 1N hydrochloric acid to obtain 65 mg (31%) of the title compound as a white solid.
¹ H NMR (400MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 2.0Hz), 7.69 (1H, d, J = 8.6Hz), 7.49 (1H , s), 7.37 (3H, d, J = 10.2Hz), 7.11 (1H, d, J = 8.6Hz), 4.86 (1H, t, J = 5.5Hz), 4.19 (2H, t, J = 4.5Hz ), 4.15 (2H, s), 4.09 (2H, t, J = 5.2Hz), 3.75 (2H, q, J = 5.1Hz), 3.69 (2H, t, J = 4.5Hz), 3.32 (3H, s ).
MS (ESI) m / z: 497 (M + H) ⁺ .
Melting point: 155-157 ° C.

Example 35 N- [5- (3,4-Dichloro-benzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -benzamide (compound Number 1-205)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 143 mg), an amide compound was obtained from 5- (3,4-dichloro-benzyl) -thiazol-2-ylamine (109 mg) obtained in Example (23b). This amide was deprotected with 1N hydrochloric acid to obtain 85 mg (41%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 1.9 Hz), 7.68 (1H, dd, J = 8.4, 2.2 Hz), 7.59 (1H, d, J = 8.2Hz), 7.57 (1H, s), 7.30 (1H, s), 7.29 (1H, dd, J = 8.2, 2.3Hz), 7.08 (1H, d, J = 8.2Hz) , 4.86 (1H, t, J = 5.3Hz), 4.18 (2H, t, J = 4.5Hz), 4.12 (2H, s), 4.08 (2H, t, J = 5.0Hz), 3.75 (2H, q, J = 5.4Hz), 3.68 (2H, t, J = 4.5Hz), 3.33 (3H, s).
MS (ESI) m / z: 497 (M + H) ⁺ .
Melting point: 140-142 ° C.

Example 36 3- (2-Hydroxy-ethoxy) -4- (2-methoxy-ethoxy) -N- [5- (3-trifluoromethoxy-benzyl) -thiazol-2-yl] -benzamide (compound Number 1-101)
In the same manner as in Example (1f), 4- (2-methoxy-ethoxy) -3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (22c) ( 141 mg), an amide compound was obtained from 5- (3-trifluoromethoxy-benzyl) -thiazol-2-ylamine (114 mg) obtained in Example (15b). This amide was deprotected with 1N hydrochloric acid to obtain 87 mg (41%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72 (1H, d, J = 2.0 Hz), 7.67 (1H, dd, J = 8.4, 2.1 Hz), 7.47 (1H, dd, J = 8.1, 8.0Hz), 7.33 (1H, d, J = 7.8Hz), 7.28 (2H, s), 7.23 (1H, d, J = 7.8Hz), 7.07 (1H, d, J = 8.6Hz), 4.85 (1H, t, J = 5.5Hz), 4.17 (2H, t, J = 5.4Hz), 4.16 (2H, s), 4.08 (2H, t, J = 5.3Hz), 3.75 (2H, q, J = 5.1Hz), 3.68 (2H, t, J = 4.7Hz), 3.33 (3H, s).
MS (ESI) m / z: 513 (M + H) ⁺ .
Melting point: 133-134 ° C.

Example 37 N- [5- (3,5-Difluoro-benzyl) -thiazol-2-yl] -4-ethoxy-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 1-234)
In a manner similar to Example (1f), carrying out 4-ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (148 mg) obtained in Example (13d), The amide compound was obtained from 5- (3,5-difluoro-benzyl) -thiazol-2-ylamine (108 mg) obtained in Example (19b). This amide was deprotected with 1N hydrochloric acid to obtain 65 mg (37%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.73 (1H, d, J = 2.0 Hz), 7.70 (1H, d, J = 8.6 Hz), 7.36 (1H , s), 7.14-7.04 (4H, m), 4.86 (1H, t, J = 5.5Hz), 4.16 (2H, s), 4.14 (2H, q, J = 7.0Hz), 4.08 (2H, t, J = 5.1Hz), 3.76 (2H, q, J = 5.1Hz), 1.35 (3H, t, J = 7.0Hz).
MS (ESI) m / z: 435 (M + H) ⁺ .
Melting point: 182-184 ° C.

Example 38 N- [5- (3-Fluoro-benzyl) -thiazol-2-yl] -4-ethoxy-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 1-17)
In a manner similar to Example (1f), and 4-ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (162 mg) obtained in Example (13d), The amide compound was obtained from 5- (3-fluoro-benzyl) -thiazol-2-ylamine (109 mg) obtained in Example (10b). This amide was deprotected with 1N hydrochloric acid to obtain 46 mg (21%) of the title compound as a white solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.71 (1H, s), 7.69 (1H, d, J = 8.7 Hz), 7.37 (1H, q, J = 7.8Hz), 7.34 (1H, s), 7.15-7.12 (2H, m), 7.08-7.05 (2H, m), 4.85 (1H, t, J = 5.4Hz), 4.14 (2H, s), 4.12 ( 2H, q, J = 6.8Hz), 4.08 (2H, t, J = 5.1Hz), 3.75 (2H, q, J = 5.4Hz), 1.35 (3H, t, J = 6.8Hz).
MS (ESI) m / z: 417 (M + H) ⁺ .
Melting point: 176-178 ° C.

Example 39 N- [5- (3,4-Difluoro-benzyl) -thiazol-2-yl] -4-ethoxy-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 1-122)
In a manner similar to Example (1f), and 4-ethoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (149 mg) obtained in Example (13d), The amide compound was obtained from 5- (3,4-difluoro-benzyl) -thiazol-2-ylamine (109 mg) obtained in Example (21b). This amide was deprotected with 1N hydrochloric acid to obtain 29 mg (14%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.4 (1H, brs), 7.72 (1H, d, J = 2.4 Hz), 7.69 (1H, dd, J = 8.4 and 2.2 Hz), 7.40 -7.36 (2H, m), 7.33 (1H, s), 7.17-7.15 (1H, m), 7.08 (1H, d, J = 8.6Hz), 4.87 (1H, t, J = 5.3Hz), 4.15- 4.11 (4H, m), 4.08 (2H, t, J = 5.0Hz), 3.75 (2H, q, J = 5.5Hz), 1.35 (3H, t, J = 7.1Hz).
MS (ESI) m / z: 435 (M + H) ⁺ .
Melting point: 183-185 ° C.

Example 40 N- [2- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-5-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide (Compound No. 3 -47)
(40a) 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid ethyl ester 2- [3,5-bis (trifluoromethyl) phenyl] ethanethioamide (410 mg) in toluene To the (4 mL) solution was added 2-chloro-3-oxo-propionic acid ethyl ester (Heterocycles, 1991, 32, 699) (430 mg) at room temperature. The reaction mixture was heated to reflux for 4 hours and concentrated. The residue was purified by chromatography (Biotage, hexane / ethyl acetate) to give 532 mg (97%) of the title compound as a yellow oil.
MS (ES) m / z: 384 (M + H) ⁺ .
(40b) 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole-5-carboxylic acid 2- (3,5-bis-trifluoromethyl-benzyl) -thiazole obtained in Example (40a) A mixture of -5-carboxylic acid ethyl ester (238 mg), 1N aqueous sodium hydroxide solution (1 mL) and dioxane (3 mL) was heated at 60 ° C. for 30 minutes. The reaction mixture was diluted with 10% aqueous citric acid and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated to give 206 mg (94%) of the title compound as a yellow solid.
MS (ES) m / z: 354 (M-H) ⁺ .
(40c) [2- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-5-yl] -carbamic acid t-butyl ester 2- (3,5-bis obtained in Example (40b) To a solution of -trifluoromethyl-benzyl) -thiazole-5-carboxylic acid (206 mg) in t-butyl alcohol (5 mL) was added triethylamine (90 μL) and then DPPA (0.13 mL) at room temperature. The reaction mixture was heated at 80 ° C. for 22 hours. Then, triethylamine and DPPA were added and stirred until the reaction was completed. The reaction mixture was cooled to 0 ° C., diluted with ethyl acetate, and saturated sodium bicarbonate solution was added. The resulting aqueous mixture was stirred at room temperature for 1 hour and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by chromatography (Biotage, hexane / ethyl acetate) to give 100 mg (40%) of the title compound as a brown oil.
MS (ES) m / z: 427 (M + H) ⁺ .
(40d) 2- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-5-ylamine [2- (3,5-bis-trifluoromethyl-benzyl) -thiazole obtained in Example (40c) To a solution of -5-yl] -carbamic acid t-butyl ester (79 mg) in dichloromethane (2 mL) was added trifluoroacetic acid (1 mL) at room temperature. The reaction mixture was stirred for 1 hour at room temperature and concentrated. The residue was basified with saturated aqueous bicarbonate and extracted with ethyl acetate. The organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated to give 63 mg (quantitative yield) of the title compound as a brown oil.
MS (ES) m / z: 327 (M + H) ⁺ .
(40e) N- [2- (3,5-Bis-trifluoromethyl-benzyl) -thiazol-5-yl] -3- (2-hydroxy-ethoxy) -4-methoxy-benzamide Example (1f) and In a similar manner, 4-methoxy-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy) -benzoic acid (60 mg) obtained in Example (1e), obtained in Example (40d). An amide compound was obtained from 2- (3,5-bis-trifluoromethyl-benzyl) -thiazol-5-ylamine (63 mg). This amide was deprotected with 1N hydrochloric acid to obtain 6 mg (6%) of the title compound as a brown solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 11.5 (1H, s), 8.09 (2H, s), 8.02 (1H, s), 7.63 (1H, dd, J = 8.3 and 2.0 Hz) , 7.59 (1H, s), 7.56 (1H, d, J = 2.0Hz), 7.12 (1H, d, J = 8.8Hz), 4.89 (1H, t, J = 5.4Hz), 4.51 (2H, s) , 4.05 (2H, t, J = 5.1Hz), 3.85 (3H, s), 3.75 (2H, q, J = 5.4Hz).
MS (ES) m / z: 521 (M + H) ⁺ .
Melting point: 177-179 ° C.

Example 41 4-Dimethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10-85)
(41a) 4-Nitro-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester 3-hydroxy-4-nitro-benzoic acid in the same manner as in Example (1c) From the methyl ester (5.47 g) and 2- (2-bromoethoxy) tetrahydro-2H-pyran (6.3 mL), 8.94 g (99%) of the title compound was obtained as a yellow oil.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 7.84 (1H, s), 7.83 (1H, d, J = 9.8Hz), 7.71 (1H, d, J = 9.7Hz), 4.73 (1H, t, J = 3.3Hz), 4.42-4.34 (2H, m), 4.16-4.08 (1H, m), 3.97 (3H, s), 3.92-3.83 (2H, m), 3.57-3.52 (1H, m) , 1.86-1.71 (2H, m), 1.65-1.51 (4H, m).
(41b) 4-Amino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester In the same manner as in Example (8c), the 4- product obtained in Example (41a) was obtained. Nitro-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (7.33 g) gave 6.88 g (quantitative yield) of the title compound as a colorless oil. .
MS (ES) m / z: 296 (M + H) ⁺ .
(41c) 4-Dimethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester 4-amino-3- [2- (tetrahydro-) obtained in Example (41b) Pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (1.91 g) in dichloromethane (20 mL) and methanol (30 mL) in acetic acid (0.37 mL), formaldehyde (0.5 g), Then sodium triacetoxyborohydride (3.02 g) was added at 0 ° C. The reaction mixture was warmed to room temperature and acetic acid, formaldehyde, sodium triacetoxyborohydride were added until the reaction was complete. The reaction mixture was concentrated and diluted with acetic acid and saturated aqueous sodium bicarbonate. The separated organic layer was washed with saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by chromatography (hexane / ethyl acetate) to obtain 5.54 g (86%) of the title compound as a colorless oil.
MS (ES) m / z: 324 (M + H) ⁺ .
(41d) 4-Dimethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid 4-dimethyl obtained in Example (41c) in the same manner as in Example (1e) Amino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (1.79 g) gave 2.00 g (quantitative yield) of the title compound as a yellow oil. .
MS (ES) m / z: 310 (M + H) ⁺ .
(41e) 4-Dimethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide In a manner similar to Example (1f). 4-dimethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (136 mg) obtained in Example (41d) and 5- () obtained in Example (1b). An amide was obtained from 3-trifluoromethyl-benzyl) -thiazol-2-ylamine (103 mg). This amide was deprotected with 1N hydrochloric acid to obtain 37.5 mg (20%) of the title compound as a white solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.3 (1H, s), 7.67-7.56 (6H, m), 7.35 (1H, s), 6.87 (1H, d, J = 8.8 Hz) , 4.86 (1H, t, J = 5.3Hz), 4.24 (2H, s), 4.09 (2H, t, J = 5.1Hz), 3.78 (2H, q, J = 5.1Hz), 2.85 (6H, s)
MS (ES) m / z: 466 (M + H) ⁺ .
Melting point: 156-158 ° C.

Example 42 N- [5- (3-Chlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-55)
In a manner similar to Example (1f), carried out with 4-dimethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (135 mg) obtained in Example (41d). The amide compound was obtained from 5- (3-chloro-benzyl) -thiazol-2-ylamine (97 mg) obtained in Example (12b). This amide was deprotected with 1N hydrochloric acid to obtain 79 mg (41%) of the title compound as a light brown amorphous.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 11.0 (1H, brs), 7.53 (1H, s), 7.50 (1H, s), 7.25-7.19 (3H, m), 7.16-7.13 (1H , m), 7.06 (1H, s), 6.90 (1H, d, J = 8.6Hz), 4.17 (2H, t, J = 4.5Hz), 4.06 (2H, s), 3.93 (2H, s), 2.95 (1H, brs), 2.87 (6H, s).
MS (ES) m / z: 432 (M + H) ^<+> .

Example 43 4-Dimethylamino-N- [5- (3-fluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-25)
In a manner similar to Example (1f), carried out with 4-dimethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (179 mg) obtained in Example (41d). The amide compound was obtained from 5- (3-fluoro-benzyl) -thiazol-2-ylamine (119 mg) obtained in Example (10b). This amide was deprotected with 1N hydrochloric acid to obtain 110 mg (46%) of the title compound as an off-white amorphous.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.9 (1H, brs), 7.53-7.49 (2H, m), 7.32-7.24 (2H, m), 7.07-7.02 (2H, m), 6.97 -6.87 (2H, m), 4.17 (2H, t, J = 4.5Hz), 4.08 (2H, s), 3.92 (2H, t, J = 4.1Hz), 3.37 (1H, brs), 2.87 (6H, s).
MS (ES) m / z: 416 (M + H) ^<+> .

Example 44 N- [5- (3,5-Dichlorobenzyl) -thiazol-2-yl] -4-dimethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-145)
In a similar manner to Example (1f), carried out with 4-dimethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (154 mg) obtained in Example (41d). The amide compound was obtained from 5- (3,5-dichloro-benzyl) -thiazol-2-ylamine (126 mg) obtained in Example (17b). This amide was deprotected with 1N hydrochloric acid to obtain 69 mg (31%) of the title compound as an off-white amorphous.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.3 (1H, brs), 7.66 (2H, brs), 7.50 (1H, brs), 7.39 (2H, brs), 7.37 (1H, brs) , 6.89 (1H, d, J = 8.6Hz), 4.88 (1H, brs), 4.15 (2H, brs), 4.10 (2H, brs), 4.10 (2H, brs), 2.86 (6H, brs).
MS (ES) m / z: 467 (M + H) ^<+> .

Example 45 4-Diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10-86)
(45a) 4-Diethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester In the same manner as in Example (41c), 4-Example obtained in Example (41b) Amino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (1.09 g) afforded 543 mg (42%) of the title compound as a yellow oil.
MS (ES) m / z: 352 (M + H) ⁺ .
(45b) 4-Diethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid 4-Diethylamino- obtained in Example (45a) in the same manner as in Example (1e) The title compound 503 mg (96%) was obtained as a white solid from 3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (543 mg).
MS (ES) m / z: 338 (M + H) ⁺ .
(45c) 4-Diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide In a manner similar to Example (1f), 4-Diethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (112 mg) obtained in Example (45b) and 5- (3- The amide compound was obtained from (trifluoromethyl-benzyl) -thiazol-2-ylamine (77.9 mg). This amide was deprotected with 1N hydrochloric acid to obtain 69.4 mg (47%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.3 (1H, s), 7.68-7.56 (6H, m), 7.35 (1H, s), 6.87 (1H, d, J = 8.2 Hz) , 4.82 (1H, t, J = 5.3Hz), 4.24 (2H, s), 4.08 (2H, t, J = 5.2Hz), 3.78 (2H, q, J = 5.3Hz), 3.29 (4H, m) , 1.04 (6H, t, J = 7.1Hz).
MS (ES) m / z: 494 (M + H) ⁺ .
Melting point: 126-128 ° C.

Example 46 N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-56)
In a manner similar to Example (1f), 4-diethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (126 mg) obtained in Example (45b) and Example The amide was obtained from 5- (3-chloro-benzyl) -thiazol-2-ylamine (75 mg) obtained in (12b). This amide was deprotected with 1N hydrochloric acid to obtain 30 mg (19%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.4 (1H, brs), 7.57 (1H, d, J = 2.3 Hz), 7.51 (1H, dd, J = 8.4, 2.1 Hz), 7.24- 7.23 (3H, m), 7.14 (1H, d, J = 6.7Hz), 7.07 (1H, s), 6.96 (1H, d, J = 8.2Hz), 4.19 (2H, t, J = 4.5Hz), 4.06 (2H, s), 3.83-3.80 (2H, m), 3.29 (4H, q, J = 7.0Hz), 3.29 (1H, s), 1.11 (6H, t, J = 7.0Hz).
MS (ESI) m / z: 460 (M + H) ⁺ .
Melting point: 130-132 ° C.

Example 47 4-Diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-116)
In a manner similar to Example (1f), 4-diethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (126 mg) obtained in Example (45b) and Example The amide was obtained from 5- (3,5-difluoro-benzyl) -thiazol-2-ylamine (84 mg) obtained in (19b). This amide was deprotected with 1N hydrochloric acid to obtain 33 mg (19%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.2 (1H, brs), 7.57 (1H, d, J = 2.3 Hz), 7.51 (1H, dd, J = 8.2, 1.9 Hz), 7.11 ( 1H, s), 6.97 (1H, d, J = 8.2Hz), 6.78-6.76 (2H, m), 6.71-6.67 (1H, m), 4.20 (2H, t, J = 4.7Hz), 4.07 (2H , s), 3.84-3.81 (2H, m), 3.29 (4H, q, J = 7.0Hz), 3.29 (1H, s), 1.12 (6H, t, J = 7.0Hz).
MS (ESI) m / z: 462 (M + H) ⁺ .
Melting point: 146-148 ° C.

Example 48 3- (2-Hydroxy-ethoxy) -4-morpholin-4-yl-N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide (Compound No. 10- 90)
(48a) 4-morpholin-4-yl-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester 4-amino-3- [2- obtained in Example (41b) From (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (457 mg) and 1-bromo-2- (2-bromo-ethoxy) -ethane (0.23 mL), 37 mg of the title compound ( 10%) as a colorless oil.
MS (ESI) m / z: 366 (M + H) ⁺ .
(48b) 4-Morpholin-4-yl-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid obtained in Example (48a) in a manner similar to Example (1e). From 4-morpholin-4-yl-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (37 mg), 35 mg (97%) of the title compound was obtained as an off-white solid. Obtained.
MS (ESI) m / z: 352 (M + H) ⁺ .
(48c) 3- (2-Hydroxy-ethoxy) -4-morpholin-4-yl-N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide As in Example (1f). 4-morpholin-4-yl-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (35 mg) obtained in Example (48b), Example (1b) 20 mg (29%) of the amide was obtained from 5- (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (29 mg) obtained in 1. This amide was deprotected with 1N hydrochloric acid to obtain 7.9 mg (47%) of the title compound as a white solid.
¹ H NMR (400 MHz, CDCl ₃ ): δ (ppm) = 10.0 (1H, brs), 7.52-7.49 (4H, m), 7.45-7.44 (2H, m), 7.14 (1H, s), 6.95 (1H , d, J = 8.2Hz), 4.21 (2H, t, J = 4.5Hz), 4.16 (2H, s), 3.90-3.88 (2H, m), 3.85 (4H, t, J = 4.7Hz), 3.26 (1H, brs), 3.16 (4H, t, J = 4.7Hz).
MS (ESI) m / z: 508 (M + H) ⁺ .
Melting point: 150-151 ° C.

Example 49 4-Ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 10-83)
(49a) 4-ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester obtained in Example (41b) in a manner similar to Example (41c). -Amino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (4.45 g) and acetaldehyde (6.50 mL) gave 3.19 g (64% ) As a colorless oil.
MS (ESI) m / z: 324 (M + H) ⁺ .
(49b) 4-Ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid 4-Diethylamino obtained in Example (49a) in the same manner as in Example (1e) -3- [2- (Tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (514 mg) afforded 385 mg (78%) of the title compound as an off-white solid.
MS (ESI) m / z: 310 (M + H) ⁺ .
(49c) 4-Ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide Method similar to Example (1f) 4-ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (114 mg) obtained in Example (49b), 5-obtained in Example (1b) 122 mg (60%) of the amide was obtained from (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (95 mg). This amide was deprotected with 1N hydrochloric acid to obtain 62 mg (61%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.1 (1H, s), 7.67-7.56 (6H, m), 7.32 (1H, s), 6.58 (1H, d, J = 8.6 Hz) , 5.78 (1H, t, J = 5.6Hz), 4.98 (1H, t, J = 6.3Hz), 4.23 (2H, s), 4.03 (2H, t, J = 4.7Hz), 3.79-3.75 (2H, m), 3.24-3.17 (2H, m), 1.19 (3H, t, J = 7.2Hz).
MS (ESI) m / z: 466 (M + H) ⁺ .
Melting point: 194-197 ° C.

Example 50 N- [5- (3-Chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-53)
In a manner similar to Example (1f), 4-ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (89 mg) obtained in Example (49b), 60 mg (40%) of the amide was obtained from 5- (3-chloro-benzyl) -thiazol-2-ylamine (65 mg) obtained in Example (12b). This amide was deprotected with 1N hydrochloric acid to obtain 28 mg (56%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.1 (1H, s), 7.67 (1H, d, J = 6.6 Hz), 7.57 (1H, s), 7.40-7.35 (2H, m) , 7.32-7.27 (3H, m), 6.60 (1H, d, J = 8.6Hz), 5.79 (1H, t, J = 5.7Hz), 4.99 (1H, t, J = 6.2Hz), 4.14 (2H, s), 4.05 (2H, t, J = 4.7Hz), 3.78 (2H, t, J = 4.7Hz), 3.26-3.19 (2H, m), 1.21 (3H, t, J = 7.0Hz).
MS (ESI) m / z: 432 (M + H) ⁺ .
Melting point: 177-179 ° C.

Example 51 N- [5- (3,5-Dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-143)
In a manner similar to Example (1f), 4-ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (87 mg) obtained in Example (49b), From 5- (3,5-dichloro-benzyl) -thiazol-2-ylamine (73 mg) obtained in Example (17b), amide 34 mg (30%) was obtained. This amide was deprotected with 1N hydrochloric acid to obtain 26 mg (89%) of the title compound as a white solid.
¹ H NMR (500 MHz, DMSO-d6): δ (ppm) = 12.1 (1H, s), 7.65 (1H, d, J = 8.3 Hz), 7.55 (1H, s), 7.48 (1H, s), 7.38 (2H, s), 7.33 (1H, s), 6.58 (1H, d, J = 8.8Hz), 5.79 (1H, brs), 4.98 (1H, t, J = 5.9Hz), 4.14 (2H, s) , 4.03 (2H, t, J = 4.6Hz), 3.77-3.76 (2H, m), 3.23-3.18 (2H, m), 1.19 (3H, t, J = 7.1Hz).
MS (ESI) m / z: 466 (M + H) ⁺ .
Melting point: 173-175 ° C.

Example 52 N- [5- (3,5-Difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide (Compound No. 10-113)
In a manner similar to Example (1f), 4-ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (88 mg) obtained in Example (49b), From 5- (3,5-difluoro-benzyl) -thiazol-2-ylamine (65 mg) obtained in Example (19b), amide 45 mg (27%) was obtained. This amide was deprotected with 1N hydrochloric acid to obtain 21 mg (56%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.1 (1H, s), 7.65 (1H, d, J = 6.7 Hz), 7.28 (1H, s), 7.56 (1H, d, J = 2.0Hz), 7.12-7.07 (1H, m), 7.03 (2H, d, J = 6.6Hz), 6.58 (1H, d, J = 8.6Hz), 5.71 (1H, brs), 4.98 (1H, t, J = 5.9Hz), 4.12 (2H, s), 4.03 (2H, t, J = 4.7Hz), 3.78-3.75 (2H, m), 3.23-3.17 (2H, m), 1.19 (3H, t, J = 7.2Hz).
MS (ESI) m / z: 434 (M + H) ⁺ .
Melting point: 168-170 ° C.

Example 53 4-Ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiadiazol-2-yl] -benzamide (Compound No. 11-83)
In a manner similar to Example (1f), 4-ethylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (118 mg) obtained in Example (49b), From 5- (3-trifluoromethyl-benzyl) -thiadiazol-2-ylamine (99 mg) obtained in Example (5a), 147 mg (70%) of the amide compound was obtained. This amide was deprotected with 1N hydrochloric acid to obtain 18 mg (14%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.5 (1H, s), 7.77 (1H, s), 7.70-7.66 (3H, m), 7.62 (1H, d, J = 7.5 Hz) , 7.58 (1H, s), 6.60 (1H, d, J = 8.6Hz), 5.89 (1H, brs), 5.01 (1H, t, J = 6.2Hz), 4.50 (2H, s), 4.03 (2H, t, J = 4.5Hz), 3.79-3.75 (2H, m), 3.23-3.19 (2H, m), 1.19 (3H, t, J = 7.1Hz).
MS (ESI) m / z: 467 (M + H) ⁺ .
Melting point: 210-211 ° C.

Example 54 4-acetylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide (Compound No. 10-88)
(54a) 4-Acetylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester 4-amino-3- [2- (tetrahydro-) obtained in Example (41b) To a solution of pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (405 mg) in tetrahydrofuran (10 mL) were added triethylamine (0.57 mL) and acetic anhydride (0.14 mL) at room temperature. The reaction mixture was stirred at room temperature for 1.5 hours and heated to 60 ° C. The mixture was heated at 60 ° C. while adding triethylamine and acetic anhydride until the reaction was completed. After completion of the reaction, the reaction mixture was concentrated, diluted with ethyl acetate, washed with saturated aqueous sodium bicarbonate, water, and saturated brine, dried over sodium sulfate, and concentrated. The residue was purified by chromatography (hexane / ethyl acetate) to give 220 mg (48%) of the title compound as a colorless oil.
MS (ESI) m / z: 336 (M-H) ⁺ .
(54b) 4-acetylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid 4-acetyl obtained in Example (54a) in the same manner as in Example (1e) The title compound was quantitatively obtained as a colorless oil from amino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid methyl ester (220 mg).
MS (ESI) m / z: 322 (M-H) ⁺ .
(54c) 4-acetylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide Method similar to Example (1f) 4-acetylamino-3- [2- (tetrahydro-pyran-2-yloxy) -ethoxy] -benzoic acid (120 mg) obtained in Example (54b), 5-obtained in Example (1b) 200 mg (93%) of the amide was obtained from (3-trifluoromethyl-benzyl) -thiazol-2-ylamine (96 mg). This amide was deprotected with 1N hydrochloric acid to obtain 41 mg (25%) of the title compound as a white solid.
¹ H NMR (400 MHz, DMSO-d6): δ (ppm) = 12.5 (1H, s), 9.22 (1H, s), 8.28 (1H, d, J = 8.2 Hz), 7.77 (1H, d, J = 1.6Hz), 7.69-7.66 (2H, m), 7.64-7.57 (3H, m), 7.38 (1H, s), 5.12 (1H, t, J = 6.1Hz), 4.25 (2H, s), 4.14 ( 2H, t, J = 4.7Hz), 3.82-3.79 (2H, m), 2.17 (3H, s).
MS (ESI) m / z: 480 (M + H) ⁺ .
Melting point: 177-179 ° C.

(Test Example 1)
(1) Human-type stearoyl CoA desaturase expression vector Using a human-type stearoyl CoA desaturase cDNA clone (OriGene, AB-1323 D07) as a template, upstream primer (ttggatccggcccacttgctgcaggacg): SEQ ID NO: 1 and downstream primer (ttaagcttcagccactcttgtagtttcc): SEQ ID NO: 2 The reaction product was treated with restriction enzymes BamHI and HindIII and then inserted into the BamHI and HindIII sites of the mammalian cell expression vector pCMV-Tag2A (Stratagene). It was transformed into E. coli cells and purified as a plasmid. The inserted DNA fragment and the DNA sequence in the vicinity of the insertion site were determined, and it was confirmed that the human stearoyl CoA desaturase had the sequence of the human type stearoyl CoA desaturase and was inserted in the correct translation frame to obtain a human type stearoyl CoA desaturase expression vector.
(2) Preparation of human stearoyl CoA desaturase enzyme fraction
HEK293 cells were maintained in a high glucose DMEM with 10% fetal calf serum, 37 ° C, 5% carbon dioxide incubator. The cells were transfected with a human stearoyl CoA desaturase expression vector using Lipofectamine 2000 (Invitrogen) according to the protocol attached to the product. After 48 hours, the cells were washed with PBS, collected from the culture dish, and disrupted by homogenization. The cell lysate was centrifuged at 700 g for 10 minutes at 4 ° C, and the supernatant was further centrifuged at 45,000C for 165,000 g for 60 minutes. The resulting precipitate was suspended in 0.25 M sucrose, 1 mM EDTA, and 10 mM Tris pH 7.4 to obtain a human type stearoyl CoA desaturase enzyme fraction suspension.
(3) Assay for stearoyl CoA desaturase activity Dissolved in DMSO in 10 μl of stearoyl CoA desaturase enzyme fraction suspension (protein concentration 250 μg / ml) according to the method described in the literature (Bioc. Phar. 1998; 55, 1045-58) After adding 1 μl of the test compound and preincubating at 37 ° C. for 10 minutes, 250 mM sucrose, 150 mM KCl, 40 mM NaF, 100 mM Na3PO4, pH 7.4, 1 mM ATP, 1.5 mM reduced glutathione, 0.06 mM reduced CoA, 0.33 mM A reaction solution in which nicotineamide, 5 mM MgCl2, 1 mM NADH, 0.01 μCi [1-14C] stearic acid was mixed was added, and the reaction was performed at 37 ° C. for 1 hour. 50 ul of methanol containing 10% KOH was added to the reaction mixture to stop the reaction, and further heat-treated at 80 ° C. for 30 minutes. After returning the reaction solution to room temperature, add 15 μl of 5N HCl and 100 μl of ethyl acetate, stir and mix, separate the aqueous layer and organic layer by centrifugation, collect 30 μl from the upper organic layer, and contain 10% silver nitrate It was subjected to thin layer chromatography on silica gel and developed with a developing solvent (CHCl3: MeOH: acetate :: H2O = 90: 8: 1: 0.8). After development, it was air-dried, and the radioactivity of stearic acid and oleic acid was quantified with a BAS2500 imaging analyzer, and the conversion rate from stearic acid to oleic acid was used as an index of stearoyl CoA desaturase activity.

  The stearoyl CoA desaturase activity when no compound was added was defined as 100%, and the inhibition rate was calculated from the stearoyl CoA desaturase activity when 1 μM of the test compound was added.

  Examples 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, Compounds 51, 52, 53 and 54 showed an inhibition rate of 50% or more at a test compound concentration of 1 μM.

  From the above results, the compound of the present invention has an excellent SCD inhibitory action, and is obesity, obesity, hyperlipidemia, hypertriglyceridemia, dyslipidemia, diabetes, arteriosclerosis, fatty liver, non- It is useful as a therapeutic and / or prophylactic agent for alcoholic steatohepatitis or hyperlipidemia, hypertriglyceridemia caused by obesity, dyslipidemia, diabetes, arteriosclerosis, or hypertension.

Formulation Example 1: Capsule 50 mg of the compound of Example 1 or 50
Lactose 128mg
Corn starch 70mg
Magnesium stearate 2mg
―――――――――――――――――
250mg
After mixing the powder of the above formulation and passing through a 60 mesh sieve, this powder is put into a 250 mg gelatin capsule to form a capsule.

Formulation Example 2: Tablet Example 1 or 50 Compound 50 mg
Lactose 126mg
Corn starch 23mg
Magnesium stearate 1mg
―――――――――――――――――
200mg
The powder of the above formulation is mixed, granulated and dried using corn starch paste, and then tableted by a tableting machine to make one tablet of 200 mg. This tablet can be sugar-coated if necessary.

  The compound having the general formula (I) or the pharmacologically acceptable salt thereof of the present invention has an excellent SCD inhibitory action, and is used for warm-blooded animals (particularly humans), obesity, obesity, hyperlipidemia. , Hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome, arteriosclerosis, atherosclerosis, diabetic arteriosclerosis , Fatty liver, nonalcoholic steatohepatitis or obesity-induced hyperlipidemia, hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataracts, Gestational diabetes, polycystic ovary syndrome, arteriosclerosis, atherosclerosis, diabetic arteriosclerosis, hypertension, cerebrovascular disorder, coronary artery disease, fatty liver, respiratory abnormalities, low back pain, knee osteoarthritis, Gout or cholelithiasis, preferably obesity, obesity, hyperlipidemia, hypertriglyceridemia, dyslipidemia, diabetes, arteriosclerosis, fatty liver, nonalcoholic steatohepatitis, or obesity Caused by hyperlipidemia, hypertriglyceridemia, dyslipidemia, diabetes, arteriosclerosis, or hypertension, more preferably obesity, obesity, hyperlipidemia, hypertriglyceridemia, diabetes It is useful as a therapeutic agent and / or preventive agent (particularly a therapeutic agent) for fatty liver or nonalcoholic steatohepatitis.

SEQ ID NO: 1: PCR sense primer SEQ ID NO: 2: PCR antisense primer

Claims (17)

Formula (I)

[Where:
R ¹ is a hydroxy group, a C ₁ -C ₆ alkoxy group, a C ₂ -C ₆ hydroxy alkoxy group, a (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkoxy) group, a di- (C ₁ -C ₆ alkyl) amino- (C ₁ -C ₆ alkoxy) group, C ₁ -C ₆ alkoxy group substituted by 4-morpholinyl, (C ₁ -C ₆ alkylthio)-(C ₁ -C ₆ alkoxy) group , (C ₁ -C ₆ alkylsulfinyl)-(C ₁ -C ₆ alkoxy) group, (C ₁ -C ₆ alkylsulfonyl)-(C ₁ -C ₆ alkoxy) group, amino group, mono-C ₁ -C ₆ alkylamino group, di - _(C 1 -C ₆ alkyl) an amino group, a mono _-C 2 -C ₇ alkylcarbonylamino group or a 4-morpholinyl group,
R ² is a hydroxy group, a C ₁ -C ₆ alkoxy group, a C ₂ -C ₆ hydroxy alkoxy group, a (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkoxy) group or a di- (C ₁ -C). ₆ alkyl) amino- (C ₁ -C ₆ alkoxy) group,
R ¹ and R ² do not simultaneously represent a hydroxy group or a C ₁ -C ₆ alkoxy group,
R ³ represents a hydrogen atom, a halogen atom, a C ₁ -C ₆ alkyl group or a hydroxy group,
R ⁴ is a group selected from C ₆ -C ₁₀ aryl group optionally substituted with 1 to 5 groups independently selected from Substituent Group A or 1 to 3 groups independently selected from Substituent Group A And represents an optionally substituted heterocyclic group,
V represents a group represented by the formula —NH— or a single bond,
W represents a group represented by the formula —NH— or a single bond;
V and W do not simultaneously represent a group represented by the formula —NH— or a single bond,
T represents a group represented by the formula = C (R ⁵ )-or a nitrogen atom,
R ⁵ represents a hydrogen atom, a halogen atom or a C ₁ -C ₆ alkyl group,
Q represents a group represented by the formula = C (R ⁶ )-or a nitrogen atom,
R ⁶ represents a hydrogen atom, a halogen atom or a C ₁ -C ₆ alkyl group,
Substituent group A includes a halogen atom, a C ₁ -C ₆ alkyl group, a C ₁ -C ₆ halogenated alkyl group, a C ₁ -C ₆ hydroxyalkyl group, (C ₁ -C ₆ alkoxy)-(C ₁ -C ₆ alkyl) group, C ₁ -C ₆ alkoxy group, C ₁ -C ₆ halogenated alkoxy group, C ₁ -C ₆ alkylthio group, carboxyl group, C ₂ -C ₇ alkylcarbonyl group, C ₂ -C ₇ alkoxycarbonyl group, a nitro group, an amino group, a mono _-C 2 -C ₇ alkylcarbonylamino group, a mono _-C 1 -C ₆ alkylamino group, di - _(C 1 -C ₆ alkyl) amino group, a cyano group, hydroxy group and A group consisting of a carbamoyl group is shown. Or a pharmacologically acceptable salt thereof as an active ingredient. The compound or a compound thereof according to claim 1, wherein R ¹ is a C ₁ -C ₆ alkoxy group, a mono-C ₁ -C ₆ alkylamino group, a di- (C ₁ -C ₆ alkyl) amino group, or a 4-morpholinyl group. A pharmaceutical comprising a pharmacologically acceptable salt as an active ingredient. The medicament according to claim 1, wherein R ¹ is an ethylamino group, dimethylamino group, diethylamino group or 4-morpholinyl group or a pharmacologically acceptable salt thereof as an active ingredient. The compound or pharmacologically acceptable salt thereof according to any one of claims 1 to 3, wherein R ² is a C ₁ -C ₆ alkoxy group or a C ₂ -C ₆ hydroxyalkoxy group. Contains medicines. 4. The medicine according to claim 1, wherein R ² is a 2-hydroxyethoxy group or a pharmacologically acceptable salt thereof as an active ingredient. 6. The medicine according to any one of claims 1 to 5, wherein R ³ is a hydrogen atom or a pharmacologically acceptable salt thereof as an active ingredient. In any one selected from claims 1 to 6, ^{R 4} is, (a halogen _atom, C 1 -C ₆ alkyl _group, C 1 -C ₆ halogenated alkyl group and _C 1 -C ₆ halogenated alkoxy group And a pharmacologically acceptable salt thereof as an active ingredient, which is a phenyl group independently substituted by 1 to 3 groups selected from In any one selected from claims 1 to 6, ^{R 4} is 3-fluorophenyl group, a 3-chlorophenyl group, 3-trifluoromethylphenyl group, 3,4-difluorophenyl group, 3,5 A compound which is a difluorophenyl group, 3-chloro-4-fluorophenyl group, 4-fluoro-3-trifluoromethylphenyl group, 3,5-dichlorophenyl group or 3,5-di-trifluoromethylphenyl group, or a pharmacology thereof A pharmaceutical comprising a top acceptable salt as an active ingredient.   9. The compound according to any one of claims 1 to 8, wherein V is a group represented by the formula -NH-, and W is a single bond or a pharmacologically acceptable salt thereof as an active ingredient. Medicine to do.   10. The compound according to any one of claims 1 to 9, wherein T is a nitrogen atom, and Q is a group represented by the formula = CH- or a pharmacologically acceptable salt thereof as an active ingredient. Medicine to do. A compound having the general formula (I)
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide,
N- [5- (3-chloro-benzyl) -thiazol-2-yl] -4-diethylamino-3- (2-hydroxy-ethoxy) -benzamide,
4-ethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethyl-benzyl) -thiazol-2-yl] -benzamide,
4-diethylamino-3- (2-hydroxy-ethoxy) -N- [5- (3-trifluoromethylbenzyl) -thiazol-2-yl] -benzamide,
N- [5- (3,5-difluoro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide;
4-diethylamino-N- [5- (3,5-difluorobenzyl) -thiazol-2-yl] -3- (2-hydroxy-ethoxy) -benzamide, or
The compound according to claim 1, which is N- [5- (3,5-dichloro-benzyl) -thiazol-2-yl] -4-ethylamino-3- (2-hydroxy-ethoxy) -benzamide, or a pharmacology thereof. A pharmaceutical comprising a top acceptable salt as an active ingredient.   A pharmaceutical comprising the compound according to any one of claims 1 to 11 or a pharmacologically acceptable salt thereof as an active ingredient.   The medicament according to claim 12, for inhibiting stearoyl CoA desaturase.   The medicament according to claim 12, for the treatment and / or prevention of a disease caused by increased stearoyl CoA desaturase activity.   Obesity, obesity, hyperlipidemia, hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome, arteriosclerosis, atherosclerosis The medicament according to claim 12, for the treatment and / or prevention of atherosclerosis, diabetic arteriosclerosis, fatty liver or nonalcoholic steatohepatitis.   The following diseases caused by obesity: hyperlipidemia, hypertriglyceridemia, dyslipidemia, insulin resistance syndrome, impaired glucose tolerance, diabetes, diabetic complications, cataract, gestational diabetes, polycystic ovary syndrome, arteriosclerosis For the treatment and / or prevention of hypertension, atherosclerosis, diabetic arteriosclerosis, hypertension, cerebrovascular disorder, coronary artery disease, fatty liver, respiratory abnormalities, low back pain, knee osteoarthritis, gout or gallstone disease The medicament according to claim 12. The medicament according to claim 12, for the treatment and / or prevention of diabetes.