JP2010057422A - Gene related to function of making soft natto, bacillus natto bred by using the gene, and soft natto product made by using the bacillus natto - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide Bacillus natto which has capability of making soft natto, to provide a method of manufacturing a soft natto using the Bacillus natto, and to provide a soft natto made by the manufacturing method. <P>SOLUTION: SofA gene and sofB gene of Bacillus natto are acquired for breeding and a protein encoded by these genes is amplified. The Bacillus natto thus developed is used to provide soft natto having hardness of 0.20-0.65 N. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

The present invention relates to a novel natto bacillus and soft natto produced using the natto bacillus, and more specifically, a gene involved in the function of softening natto with the progress of fermentation, and the natto bacillus using the gene The present invention relates to a breeding method, natto bacteria bred by the breeding method, and soft natto produced using the natto bacteria.

Natto is a traditional food produced from fermented natto using raw boiled soybeans.
One factor that determines the quality of natto is hardness (softness), and in recent years, soft natto tends to be preferred.

In order to produce soft natto, for example, selection of soy beans that have a soft boiled characteristic, or attempts to produce soft natto by using boiled beans that have been boiled softly with increased steaming strength. However, it has been difficult to stably procure soybeans that have the characteristics of being softly boiled, and when the steaming strength of soybeans is increased, the bean color turns black and the quality is degraded. .

In this situation, if other fermentative performance is comparable to conventional natto bacteria and natto bacteria having the ability to produce soft natto can be obtained, other characteristics such as stringiness, umami, color tone, fragrance, etc. It can be expected that soft natto without inferiority can be produced stably.
As for Bacillus subtilis having the ability to produce such soft natto, Bacillus subtilis KFP843 strain isolated from Chinese dough is known (for example, see Non-Patent Document 1).

Soft natto can be produced if natto is produced using such natto bacteria, while natto is known to vary significantly in quality depending on the characteristics of natto bacteria used for fermentation. It is known that natto produced using the above Bacillus subtilis KFP843 strain has poor stringiness.
In order to produce natto with quality other than softness that is completely different from natto produced using conventional natto bacteria, natto bacteria that have been used in the past are improved to have the ability to produce soft natto. Is considered desirable.

However, it is completely unclear how to improve the traditionally used natto bacteria to have the ability to produce soft natto, such as the function of producing soft natto and the genes involved in the function. There was also a need to elucidate.
Japan Food Science and Technology Journal, Vol. 52, No. 10, p. 454-461, 2005

  The present invention finds a gene involved in the function of producing soft natto to improve the breeding of conventional natto bacteria into natto bacteria having the ability to produce soft natto, and A method for improving soft natto so as to have the ability to produce soft natto and a natto fungus for producing soft natto bred by the method, and a method for producing soft natto using the natto fungus, The purpose is to provide soft natto.

  As a result of intensive studies to solve the above problems, the present inventor has found a gene encoding a protein involved in the function of producing soft natto in ordinary natto bacteria.

Specifically, the present inventor analyzed a gene group that does not exist in the genome of Bacillus subtilis 168 strain, which is a relative of Bacillus natto, but exists only in Bacillus natto. Two types of genes encoding proteins involved in the function of producing natto can be found, and these genes are respectively referred to as sofA gene (hereinafter also referred to as sofA) and sofB gene (hereinafter referred to as sofB). Also named).

And we found that it is possible to develop natto bacteria having the ability to produce soft natto by amplifying these genes in natto bacteria and enhancing proteins involved in the function of producing soft natto Thus, the present invention has been completed.

That is, the present invention is as follows.
(1) The protein shown in the following (A), (B) or (C).
(A) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. A protein involved in the function and softening of natto as fermentation progresses.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and involved in the function of producing soft natto.
(2) DNA encoding the protein shown in the following (A), (B) or (C).
(A) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and involved in the function of producing soft natto.
(3) DNA shown in the following (A), (B), (C) or (D).
(A) DNA consisting of a base sequence of base numbers 1937 to 2362 among the base sequences shown in SEQ ID NO: 1 in the sequence listing.
(B) Of the base sequence shown in SEQ ID NO: 1 in the sequence listing, hybridizes with DNA consisting of a sequence complementary to the base sequence of base numbers 1937 to 2362 under stringent conditions and produces soft natto DNA encoding a protein involved in the function of
(C) DNA consisting of a base sequence having a function as a primer or probe prepared from a part of the base sequence of base numbers 1937 to 2362 out of the base sequence shown in SEQ ID NO: 1 in the sequence listing, and stringent conditions DNA encoding a protein involved in the function of hybridizing underneath and producing soft natto.
(D) Among the nucleotide sequences shown in SEQ ID NO: 1 in the Sequence Listing, one or several base substitutions, deletions, insertions, additions, or inversions in the nucleotide sequences of nucleotide numbers 1937 to 2362 DNA consisting of a sequence and encoding a protein involved in the function of producing soft natto.
(4) The protein shown in the following (A), (B) or (C).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 4 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing and involved in the function of producing soft natto.
(5) DNA encoding the protein shown in the following (A), (B) or (C).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 4 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing and involved in the function of producing soft natto.
(6) DNA shown in the following (A), (B), (C) or (D).
(A) DNA consisting of the base sequences 2082 to 2459 of the base sequence shown in SEQ ID NO: 3 in the sequence listing.
(B) Of the base sequence shown in SEQ ID NO: 3 in the sequence listing, it hybridizes under stringent conditions with DNA comprising a sequence complementary to the base sequence of base numbers 2082 to 2459, and produces soft natto DNA encoding a protein involved in the function of
(C) DNA consisting of a base sequence having a function as a primer or a probe prepared from a part of the base sequences of base numbers 2082 to 2459, among the base sequences shown in SEQ ID NO: 3 in the sequence listing, and stringent conditions DNA encoding a protein involved in the function of hybridizing underneath and producing soft natto.
(D) Of the base sequences shown in SEQ ID NO: 3 in the sequence listing, one or several base substitutions, deletions, insertions, additions, or inversions in the base sequences 2082 to 2459 DNA consisting of a sequence and encoding a protein involved in the function of producing soft natto.

(7) A method for breeding Bacillus subtilis belonging to Bacillus subtilis characterized by enhancing the function of a protein encoded by a gene involved in the function of producing soft natto.
(8) A natto belonging to Bacillus subtilis as described in (7) above, wherein the gene involved in the function of producing soft natto is the gene as described in (2) or (3) above How to breed fungi.
(9) A natto belonging to Bacillus subtilis as described in (7) above, wherein the gene involved in the function of producing soft natto is the gene as described in (5) or (6) above How to breed fungi.
(10) Bacillus subtilis belonging to Bacillus subtilis having an enhanced function of producing soft natto, which is bred by the method according to any one of (7) to (9) above .
(11) The Bacillus natto strain according to (10) above, which is a Bacillus subtilis SOFAH strain (FERM ABP-10996).
(12) The Bacillus subtilis SOFBH (Bacillus subtilis SOFBH) strain (FERM ABP-10997), wherein the Bacillus natto strain according to (10) above.
(13) A method for producing natto characterized by using the natto bacteria described in any one of (10) to (12) above.
(14) A soft natto produced by the method for producing natto according to (13) above.
(15) The soft natto according to (14), which is produced by the method for producing natto according to (13) and has a hardness of 0.20 to 0.65N.

According to the present invention, a natto bacterium having an ability to produce soft natto is provided. By producing natto using the natto bacterium, soft natto can be produced.

Hereinafter, the present invention will be described in detail.
There is no particular limitation on the natto bacillus used in the present invention, but the natto bacillus having excellent fermentation ability usually used in the natto industry, the natto bacillus isolated and obtained from nature, and the excellent natto It is desirable to use bacteria.

Bacillus natto is classified into Bacillus subtilis, but it can produce the characteristics of natto such as mucilage (stringent material), and is a bacterium that forms the main body in natto fermentation, Moreover, since it has characteristics such as requiring biotin for growth, it is classified as Bacillus natto, and Bacillus subtilis var. Natto or Bacillus subtilis (natto) may be distinguished from Bacillus subtilis.

Examples of Bacillus natto include Bacillus Natto IFO3009, Bacillus subtilis IFO3335, IFO3336, IFO3936, and IFO13169, and various other Bacillus natto can be widely used.

Specific examples include the O-2 strain isolated from commercial natto and the r22 strain (see, for example, Japanese Patent Application Laid-Open No. 2000-224982) which is a mutant for improving the transformation efficiency of the strain. by Takahashi bacteria (T ₃ strains, TUA culture collection chamber) various Bacillus natto such or Miyagino bacteria (Miyagino natto Seisakusho) can be appropriately used.

The protein of the present invention is a protein encoded by a gene involved in the function of producing soft natto. Specifically, from a protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) in the sequence listing, from one or several amino acid substitutions, deletions, insertions, additions, or inversions. And a protein involved in the function of producing soft natto, and further comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) in the sequence listing, and , Relating to proteins involved in the function of producing soft natto.

Further, in the protein consisting of the amino acid sequence shown in SEQ ID NO: 4 (FIG. 6) of the sequence listing, consisting of an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, added, or inverted, and A protein involved in the function of producing soft natto, and further comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 4 (FIG. 6) of the sequence listing, and soft natto The present invention relates to a protein involved in the function of producing.

The method for obtaining and preparing the protein of the present invention is not particularly limited, and may be a naturally derived protein, a chemically synthesized protein, or a recombinant protein produced by a gene recombination technique. When a naturally derived protein is obtained, the protein of the present invention can be obtained by appropriately combining protein isolation and purification methods from cells expressing such protein.

When the protein of the present invention is prepared by chemical synthesis, for example, the protein of the present invention is synthesized according to a chemical synthesis method such as the Fmoc method (fluorenylmethyloxycarbonyl method) or the tBoc method (t-butyloxycarbonyl method). can do. In addition, the protein of the present invention can be synthesized using various commercially available peptide synthesizers.

When the protein of the present invention is prepared by gene recombination technology, the protein of the present invention can be prepared by introducing a DNA consisting of a base sequence encoding the protein into a suitable expression system.

Among these, preparation by a gene recombination technique that can be prepared in a large amount by a relatively easy operation is preferable. In preparing the protein of the present invention by gene recombination technology, in order to recover and purify the protein from the cell culture, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, Known methods including phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography are used, and preferably high performance liquid chromatography is used.

In particular, the column used for affinity chromatography is, for example, a column in which an antibody such as a monoclonal antibody against the protein of the present invention is bound, or when a normal peptide tag is added to the protein of the present invention, By using a column to which an affinity substance is bound, purified products of these proteins can be obtained.

Furthermore, in the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6) in the sequence listing, one or several amino acid substitutions, deletions, insertions, additions, or inversions are made. Or a protein consisting of an amino acid sequence having 85% or more homology with the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6) in the sequence listing SEQ ID NO: 1 (FIGS. 1 and 2) or SEQ ID NO: 3 (FIGS. 4 and 5) in the sequence listing illustrating the nucleotide sequence encoding the amino acid sequence shown in 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6) Those skilled in the art can appropriately prepare or obtain the information based on the base sequence information shown in (1).

For example, polymerase chain reaction (PCR reaction) using an oligonucleotide synthesized based on the nucleotide sequence shown in SEQ ID NO: 1 (FIGS. 1 and 2) or SEQ ID NO: 3 (FIGS. 4 and 5) as a primer ) Or by hybridization using an oligonucleotide synthesized based on the nucleotide sequence as a probe, by screening a homolog of the DNA from Bacillus subtilis belonging to Bacillus subtilis under appropriate conditions. Can be separated. A protein encoded by the homologous DNA can be produced by cloning the full-length DNA of this homologous DNA, then incorporating it into an expression vector and expressing it in a suitable host.

Oligonucleotides can be synthesized according to a conventional method using, for example, various commercially available DNA synthesizers. The PCR reaction is performed using a thermal cycler Gene Amp PCR System 2400 manufactured by Applied Biosystems, TaqDNA polymerase (manufactured by Takara Bio Inc.), KOD-Plus- (manufactured by Toyobo Co., Ltd.), and the like. Can be carried out according to conventional methods.

Furthermore, the protein of the present invention can be combined with a marker protein and / or a peptide tag to form a fusion protein. The marker protein is not particularly limited as long as it is a conventionally known marker protein. Specific examples include an enzyme such as alkaline phosphatase and HRP, an Fc region of an antibody, and a fluorescent substance such as GFP. As peptide tags, known peptide tags such as epitope tags such as HA, FLAG, and Myc, and affinity tags such as GST, maltose-binding protein, biotinylated peptide, oligohistidine, etc. It can be illustrated. Such a fusion protein can be prepared by a conventional method. Purification of the protein of the present invention using the affinity between Ni-NTA and His tag, detection of the protein of the present invention, and quantification of an antibody against the protein of the present invention It is also useful as a research reagent in this field.

The DNA of the present invention includes a DNA encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6), SEQ ID NO: 2 (FIG. 3). Or the amino acid sequence shown in SEQ ID NO: 4 (FIG. 6), comprising an amino acid sequence in which one or several amino acid substitutions, deletions, insertions, additions, or inversions are made, and a function for producing soft natto A DNA encoding a protein having the amino acid sequence, an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6) in the sequence listing, and soft natto DNA encoding a protein involved in the function of producing the nucleotide sequence of SEQ ID NO: 1 (FIGS. 1 and 2) or SEQ ID NO: 3 (FIGS. 4 and 5) DNA encoding a protein involved in the function of producing soft natto, which hybridizes under stringent conditions with DNA consisting of the nucleotide sequence of base numbers 1937 to 2362 or a sequence complementary to base numbers 2082 to 2459, Among the nucleotide sequences shown in SEQ ID NO: 1 (FIGS. 1 and 2) or SEQ ID NO: 3 (FIGS. 4 and 5), the nucleotide sequence of nucleotide numbers 1937 to 2362 or the nucleotide sequence of nucleotide numbers 2082 to 2459 Examples include DNA encoding a protein involved in the function of producing soft natto that hybridizes under stringent conditions with a DNA comprising a base sequence having a function as a primer or probe prepared from a part. .

Thus, in the DNA encoding the protein involved in the function of producing the soft natto of the present invention, one or several amino acids are deleted at one or more positions unless the function of the encoded protein is impaired. May encode a protein substituted, inserted, or added, or inverted.

DNA encoding a protein that is substantially the same as the protein having the function of producing such soft natto is deleted, substituted, inserted or added at a specific site by, for example, site-directed mutagenesis, or It can also be obtained by modifying the base sequence as an inversion. The modified DNA as described above can also be obtained by a conventionally known mutation treatment. Furthermore, since it is generally known that the amino acid sequence of a protein and the base sequence encoding the protein are slightly different between species, strains, mutants, and variants, DNA encoding a substantially identical protein Can be obtained from strains, mutants and varieties of Bacillus natto.

The “amino acid sequence in which one or several amino acids are substituted, deleted, inserted, added or inverted” is, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10, Preferably, it means an amino acid sequence in which any number of 1 to 5 amino acids are substituted, deleted, inserted, added or inverted.

In addition, the above “base sequence in which one or several bases are substituted, deleted, inserted, added or inverted” is, for example, 1 to 20, preferably 1 to 15, more preferably 1 to 10. More preferably, it means a base sequence in which any number of 1 to 5 bases is substituted, deleted, inserted, added or inverted. In the present invention, “substitution, deletion, insertion, addition or inversion” means at least selected from “substitution, deletion, insertion, addition and inversion” in any case of amino acids and bases. Means "one".

For example, DNA (mutant DNA) consisting of a base sequence in which one or several bases are substituted, deleted, inserted, added or inverted is used as described above for chemical synthesis, genetic engineering, mutagenesis. Or any other method known to those skilled in the art. Specifically, a method of bringing a drug that acts as a mutagen into contact with DNA consisting of the base sequence shown in SEQ ID NO: 1 or 3 in the sequence listing, a method of irradiating ultraviolet rays, a genetic engineering method, etc. By using these DNAs to introduce mutations, mutant DNAs can be obtained. Site-directed mutagenesis, which is one of genetic engineering techniques, is useful because it is a technique that can introduce a specific mutation at a specific position. Molecular cloning 2nd edition (Molecular
Cloning: A laboratory Manual, 2nd Ed. , Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY. , 1989) and Current Protocols in Molecular Biology (Current Protocols)
in Molecular Biology, Supplements 1-38, John Wiley & Sons (1987-1997)) and the like. By expressing this mutant DNA using an appropriate expression system, a protein having an amino acid sequence in which one or several amino acids are substituted, deleted, inserted, added or inverted can be obtained.

The above “amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6)” means SEQ ID NO: 2 (FIG. 3). ) Or the amino acid sequence shown in SEQ ID NO: 4 (FIG. 6) is not particularly limited as long as it is 85% or more, for example, 85% or more, preferably 90% or more, more preferably 95%. As mentioned above, it means that it is particularly preferably 98% or more.

The above “stringent conditions” refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. Specifically, DNAs having 50 to 70% homology or more are located between each other. 65 ° C., 1 × SSC, 0.1% SDS, or 0.1 × SSC, 0 which is a condition in which DNAs that hybridize and DNAs having lower homology do not hybridize each other or washing conditions of normal Southern hybridization The conditions for hybridization at a salt concentration corresponding to 1% SDS can be mentioned.

In addition, the above-mentioned “DNA that hybridizes under stringent conditions” uses a nucleic acid such as DNA or RNA as a probe, and uses a colony hybridization method, a plaque hybridization method, a Southern blot hybridization method, or the like. Specifically, using a filter in which colony or plaque-derived DNA or a fragment of the DNA is immobilized, the DNA is high at 65 ° C. in the presence of 0.7 to 1.0 M NaCl. After hybridization, the filter is washed under conditions of 65 ° C. using an SSC solution of about 0.1 to 2 times (the composition of a 1-fold concentration SSC solution is 150 mM sodium chloride, 15 mM sodium citrate). The DNA which can be identified can be mentioned.

Hybridization can be performed according to a method described in Molecular Cloning, Second Edition (Molecular Cloning: A laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989), etc. For example, DNA that can hybridize under stringent conditions can include DNA having a certain degree of homology with the base sequence of the DNA used as a probe, for example, 60% or more, preferably 70%. Preferred examples thereof include DNA having homology of 80% or more, more preferably 90% or more, particularly preferably 95% or more, and most preferably 98% or more.

The method for obtaining and preparing the DNA of the present invention is not particularly limited, and SEQ ID NO: 1 (FIGS. 1 and 2) or SEQ ID NO: 3 (FIGS. 4 and 5) in the sequence listing disclosed herein. An appropriate probe or primer is prepared based on the nucleotide sequence information shown in FIG. 5 or the amino acid sequence information shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6). The target DNA can be isolated by screening a cDNA library that is predicted to exist, or can be prepared by chemical synthesis according to a conventional method.

For example, a gene library of the present invention is prepared by preparing a cDNA library from Bacillus natto according to a conventional method, and then selecting a desired clone from this library using an appropriate probe specific to the gene DNA of the present invention. Can be obtained. In addition, isolation of total RNA from these Bacillus natto, isolation and purification of mRNA, acquisition of cDNA, and cloning thereof can be performed according to conventional methods. Examples of the method for screening the DNA of the present invention from a cDNA library include methods commonly used by those skilled in the art, such as the method described in Molecular Cloning Second Edition.

  Since the base sequence of the DNA of the present invention has been clarified, for example, a polymerase chain reaction (using a genomic DNA of Bacillus natto r22 strain as a template and an oligonucleotide synthesized based on the base sequence as a primer ( PCR reaction) or hybridization using an oligonucleotide synthesized based on the nucleotide sequence as a probe. Chromosomal DNA can be obtained by a conventional method.

  Oligonucleotides can be synthesized according to a conventional method using, for example, various commercially available DNA synthesizers. The PCR reaction is performed using a thermal cycler Gene Amp PCR System 2400 manufactured by Applied Biosystems, TaqDNA polymerase (manufactured by Takara Bio Inc.), KOD-Plus- (manufactured by Toyobo Co., Ltd.), and the like. It can be performed according to conventional methods.

  The DNA of the present invention can be obtained by modifying the nucleotide sequence so that the amino acid at a specific site is deleted, substituted, inserted, added or inverted by, for example, site-directed mutagenesis. The modified DNA as described above can also be obtained by a conventionally known mutation treatment.

  In general, the amino acid sequence of a protein and the base sequence that encodes it are slightly different between species, strains, mutants, and variants, so that DNA encoding substantially the same protein. Can be obtained from strains, mutants and variants of Bacillus natto.

Specifically, from Bacillus natto, or Bacillus natto mutated, natural mutants or variants thereof, for example, base numbers 1937 to 2362 among the base sequences described in SEQ ID NO: 1 (FIGS. 1 and 2) of the Sequence Listing. Alternatively, it hybridizes under stringent conditions with DNA having a base sequence consisting of base numbers 2082 to 2459 in the base sequence described in SEQ ID NO: 3 (FIGS. 4 and 5) to produce soft natto. By isolating a DNA encoding a protein involved in the function, a DNA encoding a protein substantially identical to the protein can be obtained.

In addition, from the amino acid sequence in which one or several amino acids are substituted, deleted, inserted, added or inverted in the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6) in the above sequence listing And at least 85% homology with DNA encoding a protein involved in the function of producing soft natto and the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) or SEQ ID NO: 4 (FIG. 6) The mutant gene or homologous gene of the present invention consisting of a DNA encoding a protein having a function of producing a soft natto and having a function of producing soft natto includes SEQ ID NO: 1 (FIGS. 1 and 2) or Using a DNA fragment having the base sequence shown in SEQ ID NO: 3 (FIGS. 4 and 5) or a part thereof, an appropriate homologue of the DNA is obtained from other Bacillus natto, etc. It can be isolated by screening in the matter under. In addition, it can also be prepared by the aforementioned method for producing mutant DNA.

For example, existing natto bacillus, or mutated natto bacillus, natural mutants or variants thereof, for example, a base sequence shown in SEQ ID NO: 1 in the sequence listing, or a probe prepared from a part thereof, and stringent conditions By isolating a DNA that encodes a protein involved in the function of hybridizing under the above and producing soft natto, DNA encoding a protein substantially identical to the protein can be obtained.

  As one of breeding methods, there is a method in which a gene encoding a protein involved in the function of producing soft natto is amplified by gene recombination to enhance the expression of these proteins.

  In addition, in order to use such a gene recombination method with Bacillus natto, a transformation system for gene introduction into Bacillus natto is required. In the present invention, Bacillus natto with improved transformation ability is used. The gene disruption DNA was efficiently introduced into Bacillus natto using a practical level of transformation system, and the target gene-deficient strain could be bred.

Moreover, as one of the gene recombination systems of Bacillus natto, a transduction method using a phage vector (for example, Applied and Environmental Microbiology), Vol. 63, p. 4087-4089 (see 1997)) has already been developed, and this method is also used in the present invention.

In addition, for example, the gene is ligated to a multi-copy number plasmid vector such as pHY300PLK, and an existing competence transformation method (for example, FEMS Microbiol. Lett.), Vol. 236, p. ~ 20, see 2004) is also effective to introduce the gene into Bacillus natto and amplify the gene.

Furthermore, in the present invention, it is also effective to improve the promoter region in the upstream region of the gene so as to improve the expression by genetic recombination or natural mutation.
In addition, other than the gene recombination techniques as described above, that is, a so-called screening method for selecting from the natural world Bacillus natto in which the expression of the target gene is already enhanced and the expression of the protein encoded by the gene is enhanced, Breeding is also possible by other methods such as those conventionally performed, such as enhancing the expression of these genes by drug mutation methods or the like.

Acquisition of Bacillus natto having the ability to produce the desired soft natto can be carried out as follows. That is, a sample containing isolated Bacillus natto and breeding Bacillus natto is suspended in sterilized water, diluted to an appropriate concentration, plated on a standard agar medium (manufactured by Eiken Chemical Co., Ltd.), and cultured at 37 ° C. overnight. Isolate the resulting colonies.
Furthermore, after the selected colony is applied to an SG medium (see, for example, JP-A-10-215861), it is cultured overnight at 37 ° C. to produce a large amount of mucilage, and Bacillus natto that seems to have a strong stringiness is obtained. select.
From the obtained colonies, a spore solution can be prepared according to a conventional method (see, for example, JP-A No. 10-215861) and used as an inoculum for natto production.

Selection of the target natto bacteria can be carried out as follows. That is, natto is produced using breeding and selected natto bacteria as an inoculum, and natto bacteria that can only produce natto with weak stringiness are first excluded. Next, natto produced using the existing Bacillus subtilis r22 strain (hereinafter also referred to as r22 strain) (for example, see JP 2000-287676 A) is used as a control, and softer than that. Natto bacteria that can produce natto can be selected. Furthermore, it is possible to evaluate the quality of natto produced using the selected natto bacteria, and to select excellent natto bacteria with regard to quality indexes other than hardness.

Natto may be produced as usual. For example, the soaked soybeans are drained, and 1000 to 4000 spores are inoculated per 1 g of steamed soybeans obtained by steaming at 0.18 MPa for 18 minutes, and each 40 g is placed in a PSP tray, the surface is covered with a thin coating, and the lid After putting into a batch-type natto fermentation room, fermentation is performed at room temperature 37-42 ° C. and high humidity. After fermentation, after aging, the quality of the finished natto is evaluated.

In addition, the hardness of natto can be measured and confirmed according to a conventional method (for example, refer to JP-A-2004-24197).
For example, as a hardness meter, a digital hose gauge (model: FGC-0.2, manufactured by Nidec Symposium) equipped with a 1.5 mm diameter plunger is used as an electric vertical simplified test stand (model: FGS-). 50V-L, manufactured by Nidec Simpo Co., Ltd.) with the plunger set downward is used.

And first, natto to be measured is warmed to 15 to 25 ° C., and then loosened well with chopsticks so as not to crush the beans, and an arbitrary grain is placed on the table of the electric vertical simple test stand. The digital hose gauge is lowered at a speed of 60 mm / min, and is crushed so as to pierce the center of the beans with a plunger. When the plunger is lowered from the bottom of the bean to 1 ± 0.2 mm, the descent of the digital hose gauge is stopped, and the display value (unit: Newton (N), peak value) at this time is recorded.

Hereinafter, after measuring the display value for a total of 14 grains in the same manner, the average of the display values for 10 grains excluding the top 2 and the bottom 2 display values, and the hardness of natto (N) Can be requested.
The preferable hardness (N) of natto measured in this manner is about 0.20 to 0.65N, and more preferably about 0.40 to 0.60N.
If the hardness is less than 0.20 N, natto becomes too soft and less preferred, and if it is greater than 0.65 N, it is not preferred because it is too hard.

The present invention has been made to achieve the above object. According to the present invention, for example, as described in the Examples, the sofA gene is amplified in Bacillus natto by gene recombination technology, and the gene is It has succeeded in breeding new natto bacteria having the ability to produce soft natto by enhancing the expression of protein having the function of producing soft natto encoding, one of which is Bacillus subtilis SOFAH (Bacillus subtilis) SOFAH) strain.

The Bacillus subtilis SOFAH (Bacillus subtilis SOFAH) strain was established in 2008 by the National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center (1st, 1st East, 1-chome, Tsukuba City, Ibaraki 305-8565, Japan). 20) received on August 20, and the receipt number is FERM ABP-10996.

In addition, for example, the sofB gene was amplified in natto by gene recombination technology, and the expression of a protein having a function of producing soft natto encoded by the gene was enhanced to succeed in breeding a new natto. And named as Bacillus subtilis SOFBH (Bacillus subtilis SOFBH) strain.

The Bacillus subtilis SOFBH (Bacillus subtilis SOFBH) strain was established in 2008 by the National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center (1st, 1st East, 1-chome, Tsukuba City, Ibaraki 305-8586, Japan). 20) received on August 20, and the receipt number is FERM ABP-10997.

The use of superior natto bacteria capable of producing soft natto selected in this way for natto production is not particularly limited as long as a conventional method is employed.
For example, natto is generally so-called whole soybean natto manufactured using whole soybeans as a raw material, but there is also some ground natto using raw soybeans as a raw material.

The manufacturing method of the whole soybean natto is the steaming obtained by immersing the whole soybean, which is a raw material, in cold water for more than 10 hours and then steaming under pressure (0.15 to 0.20 MPa) using pressurized steam in a steaming pot. The soybean is inoculated and mixed with natto bacteria in a high temperature state (70 to 100 ° C.), then filled into a predetermined container, and then carried into a fermentation room, and at room temperature of 37 to 42 ° C. for a predetermined time (15 to 20 hours) About) After fermentation, it is generally completed by refrigerated aging (about 12 to 72 hours) at around 5 ° C.

Further, in the case of ground natto, it is produced in the same manner as in the case of ordinary round soybean natto, except that the previously ground soybean is soaked in water.

In such a conventional method for producing natto, in the present invention, natto bacteria used in the fermentation process can be used in place of the excellent natto bacteria selected by the above method. In this way, softer natto can be produced compared to conventional natto.

Hereinafter, the present invention will be specifically described by way of examples.

Example 1
(1) The natto bacillus r22 strain used, such as the strain used, is a mutant strain with enhanced transformation ability of the parent strain O-2 isolated from commercial natto, and the parent strain O-2 was chemically treated using nitrosoguanidine (NTG). It is a strain obtained by carrying out a mutation treatment (for example, see JP 2000-224982 A).

The medium is an LB medium (1% polypeptone, 0.5% yeast extract, 1% sodium chloride) described in the Natto test method (for example, “Natto test method”, see Kosuge Publishing, p. 85-97, 1990). , Sporulation medium (0.068% KH ₂ PO ₄ , 0.0535% NH ₄ Cl, 0.0106% Na ₂ SO ₄ , 0.00006% FeCl ₂ .4H ₂ O, 0.00126% MnCl ₂ .4H ₂ O, 0.934% MgSO ₄ .7H ₂ O, 0.238% sodium glutamate monohydrate, 0.025% CaCl ₂ , 0.152% yeast extract, 1 mg / ml biotin), transformation of Spizizen et al. medium (0.5% _{glucose, 5mM MgSO 4 · 7H 2 O} , 0.05% yeast _{extract, 0.6% KH 2 PO 4,} 1.4% K 2 HPO 4, 0 1% sodium citrate dihydrate, 0.2% ammonium sulfate, with 0.1 [mu] g / ml biotin). However, when necessary, spectinomycin (100 μg / ml) and tetracycline (10 μg / ml) were added.

Each of the spectinomycin resistance genes (GenBank ACCNo. X02588) cloned between pUC19's multicloning site BamHI-XbaI was used. The tetracycline resistance gene was amplified by PCR from the Escherichia coli-B. Subtilis shuttle vector pHY300PLK (Takara Shuzo).

(2) Search for candidate genes Based on the assumption that genes encoding proteins involved in the function of producing soft natto are not present in Bacillus subtilis but are in a gene group that is unique to Bacillus natto. The whole genome sequence of Bacillus natto r22 strain and the Bacillus subtilis str. Registered in GenBank. A total of 572 genes unique to Bacillus natto were found as a result of comparison with the genome sequence of 168 strain (registration number NC000964).

Among these gene groups unique to Bacillus natto, genes named as sofA gene (hereinafter sometimes simply referred to as sofA) and sofB gene (hereinafter sometimes simply referred to as sofB) are used as candidate genes. It used for experiment.

In addition, sofA has the base sequence shown in SEQ ID NO: 1 (FIGS. 1 and 2) in the sequence listing, and the protein having the amino acid sequence shown in SEQ ID NO: 2 (FIG. 3) over the base numbers 1937 to 2362 is shown. The presence of an open reading frame encoding was confirmed.

As a result of homology search for base sequence and amino acid sequence databases such as GenBank, EMBL, DDBJ, SwissProt, PIR, PRF, etc., sofA is Geobacillus
sp. It was found that the amino acid sequence had 78% homology with the TrmB gene, which is a transcriptional regulatory factor belonging to the MarR family of WCH70.

Transcriptional regulators belonging to MarR family are said to be involved in drug resistance and oxidative stress response (for example, “Trends Microbiol.”, 7, p. 410-413, 1999). See year), Geobacillus
sp. It is not known at all that the TrmB gene of WCH70 is involved in the function of producing soft natto.

It is estimated that sofA also has a function of controlling the transcription of Bacillus natto genes, and the mechanism for producing soft Bacillus natto bacteria is not known at all. It is completely unclear as to whether it is controlled.

Further, sofB has the base sequence shown in SEQ ID NO: 3 (FIGS. 4 and 5) in the sequence listing, and the protein having the amino acid sequence shown in SEQ ID NO: 4 (FIG. 6) over the base numbers 2082 to 2459 is shown. The presence of an open reading frame encoding was confirmed.

As a result of homology search for base sequences such as GenBank, EMBL, DDBJ, SwissProt, PIR, PRF, and amino acid sequence databases, genes with homology of 15% or more in sofB and 15% or more in amino acid sequence are not searched. , SofB was confirmed to be a gene unique to Bacillus natto. It is unclear what kind of function sofB plays in the mechanism that softens natto.

(3) Preparation of strains lacking sofA and sofB By the following method, DNA fragments for gene deletion for deleting each of sofA and sofB are prepared and introduced into Bacillus natto to cause homologous recombination by the competence method. Thus, each of the strains of sofA and sofB was prepared.

i) Preparation of DNA fragment for gene deletion (A) Preparation of DNA fragment for sofA deletion As described below, DNA for sofA deletion is used to replace sofA on a chromosome with a spectinomycin resistance gene and to delete sofA. Fragments were constructed by the following method combining PCR as shown in FIG.

First, in order to amplify the spectinomycin resistance gene, primer 1 (5′-GCGGCCCGCGTAATAATAAAGAATAATATTATTAATCTGTTAG-3 ′, SEQ ID NO: 5 in the sequence listing and FIG. 7 is used based on the nucleotide sequence registered in GenBank (registration number X02588). And 2 oligo DNAs of primer 2 (5'-CTCGGATAAATATAAGTAATAAAAGCGTCTC-3 ', see SEQ ID NO: 6 in the sequence listing and Fig. 8), and using these primers, between the multiple cloning sites BamHI-XbaI of pUC19 A spectinomycin-resistant gene cloned in was used as a template and amplified by PCR.

In addition, in order to amplify the upstream of sofA, primer 3 (5′-TTGCCTCATCGTCCGCATTATC-3 ′, see SEQ ID NO: 7 in FIG. 9 and FIG. 9) and primer 4 (5′- CTACAGATTATAATATATTTCTTTTATATACGCGCGCATACTCATTGCC sequence number-3 ′ 2 and FIG. 10) were prepared.
Furthermore, in order to amplify the downstream of sofA, primer 5 (5′- GAAATTTAGAGAACGCTTTATTACTTTAATTTACCTGAG GTAGGGGAAGCTAAACAATGGC-3 ′, see SEQ ID NO: 9 and FIG. 11 in the sequence listing) and primer 6 (5′-CAAGCGATTTCGGTTCATGG-3 sequence number, 10 and FIG. 12) were prepared.

Using these as primers and using the total DNA of the r22 strain as a template, PCR was performed as usual, and a 3 'base sequence complementary to the 37' base (underlined) at the 5 'end of the amplified fragment of the spectinomycin resistance gene was used. The upstream portion of sofA on the side and the fragment of the downstream portion of sofA having a base sequence complementary to the 3 'end 38 bases (underlined portion) of the amplified fragment of the spectinomycin resistance gene were amplified.

Next, PCR was carried out using a mixture of the upstream portion of the sofA, the downstream portion and the amplified fragment of the spectinomycin resistance gene as a template, using two types of primers, primer 3 and primer 6. Of the bands generated by agarose electrophoresis of the obtained PCR product, a band of about 5 kb was recovered from agarose.

Based on the internal sequence of the PCR product, primer 7 (5′-CGACCTCCATGTTAGACGGGTTG-3 ′, see SEQ ID NO: 11 in the sequence listing and FIG. 13) and primer 8 (5′-GGCAAGCAGCTCGATATCTC-3 ′, SEQ ID NO: 12 in the sequence listing and The oligo DNAs (see FIG. 14) were prepared and amplified by PCR using these primers and the recovered DNA as a template. The obtained PCR product was used for transformation as a DNA fragment for sofA deletion.

(B) Preparation of DNA fragment for sofB deletion As described below, in order to replace sofA on the chromosome with a spectinomycin resistance gene and to delete sofB, the DNA fragment for sofB deletion is as shown in FIG. It was constructed by the following method combining PCR.

First, in order to amplify the tetracycline resistance gene, primer 9 (5'-TAAGAATAATATATTATAATCTTAGTAGCTGTTAAAAAAAGAGATCAA-3 ', refer to SEQ ID NO: 13 and FIG. 15) based on the nucleotide sequence registered in GenBank (registration number D00946) 2 primers (5′-AGTAATAAAAGCGTTCTCTAATTTCTATTATTGCAATGTGGAATTG-3 ′, see SEQ ID NO: 14 in the sequence listing and FIG. 16), and using these primers, Escherichia coli-B. Subtilis shuttle vector pHY300PLK as a template Amplified by PCR.

In addition, in order to amplify the upstream of sofB, primer 11 (5′-TCCAAAAGAGGCCTGTCATAC-3 ′, see SEQ ID NO: 15 in the sequence listing and FIG. 17) and primer 12 (5′- TACAGATTATAATAATTATTTCTTTA TTATACGCGCCGCCCACCCTTCTGTATG-3 ′) 16 and FIG. 18) were prepared.
Furthermore, in order to amplify the downstream of sofB, primer 13 (5′- GAAATTTAGAGACGCTTTATTACT TTAATTTACTCGAGTCCTTTGCCATTTCCTCCGTC-3 ′, see SEQ ID NO: 17 in FIG. 19 and FIG. 19) and primer 14 (5′-TGGGATGATCTATACCGAAGGC-3) 18 and 20) were prepared.

Using these as primers and the total DNA of the r22 strain as a template, PCR was performed as usual, and the base sequence complementary to the 23 'base (underlined) of the 5' end of the amplified fragment of the tetracycline resistance gene was 3 'side. The fragment of the upstream part of sofB and the downstream part of sofB having a base sequence complementary to the 3 'end 24 bases (underlined part) of the amplified fragment of the tetracycline resistance gene on the 5' side were amplified.

Next, PCR was carried out using a mixture of the upstream portion of the sofB, the downstream portion, and the amplified fragment of the tetracycline resistance gene as a template, using two types of primers, the primer 11 and the primer 14. Of the bands generated by agarose electrophoresis of the obtained PCR product, a band of about 5.5 kb was recovered from agarose.

Based on the internal sequence of the PCR product, primer 15 (5′-TCCCCATTAAAATACCACTGC-3 ′, see SEQ ID NO: 19 in the sequence listing and FIG. 21) and primer 16 (5′-AGACGCCTGCGGGACACTATATC-3 ′, SEQ ID NO: 20 in the sequence listing and The two oligo DNAs (see FIG. 22) were prepared, and these primers were used to amplify by PCR using the recovered DNA as a template. The obtained PCR product was used for transformation as a DNA fragment for sofA deletion.

ii) Transformation Using the DNA fragment obtained by PCR, the r22 strain was transformed by the competence method using the transformation medium of Spizizen et al. Selection of transformants was performed using spectinomycin resistance as an index when obtaining a strain deficient in sofA, and using tetracycline resistance as an index when obtaining a strain deficient in sofB.

Eight out of each of the obtained spectinomycin-resistant transformants and tetracycline-resistant transformants were selected. Genomic DNA was collected after overnight culture at 37 ° C. and 120 rpm in LB medium, amplified by PCR using primer 7 and primer 8, or primer 15 and primer 16, and treated with an appropriate restriction enzyme. The sofA gene and the sofB gene were confirmed to be deficient.
One of each strain was selected and designated as ΔSOFA strain and ΔSOFB strain.

(3) Trial production of natto and evaluation of softness For the ΔSOFA strain and ΔSOFB strain obtained as described above, spore solution was prepared using a spore-forming medium by a conventional method, and natto was produced according to a conventional method. The quality of natto and the hardness of natto were evaluated. In the evaluation of natto, natto produced using the r22 strain under the same cooking conditions and fermentation conditions was used as a control.
The quality of natto produced using the ΔSOFA and ΔSOFB strains was the same as the control produced using the r22 strain in terms of appearance and stringiness as a result of a sensory test by a specialized panelist.

Next, the hardness of natto was measured with a hardness meter.
In other words, the hardness tester is a digital hose gauge (model: FGC-0.2, manufactured by Nidec Shinpo Co., Ltd.) equipped with a 1.5 mm diameter plunger, and an electric vertical simple test stand (model: FGS-50V). -L, manufactured by Nidec Sympo Corporation) was used with the plunger set downward.
Then, after first heating the natto to be measured to 15 to 25 ° C., the beans were well loosened with chopsticks so as not to crush the beans, and an arbitrary one was placed on the table of the electric vertical simple test stand.
Thereafter, the digital hose gauge was lowered at a speed of 60 mm / min, and crushed so as to pierce the center of the beans with a plunger. When the plunger was lowered from the bottom of the bean to 1 ± 0.2 mm, the descent of the digital hose gauge was stopped, and the displayed value (unit: Newton (N), peak value) was recorded.

Hereinafter, after measuring the display value for a total of 14 grains in the same manner, the average of the display values for 10 grains excluding the top 2 and the bottom 2 display values, and the hardness of natto (N) Asked. Table 1 shows the hardness (N).

When natto was produced with ΔSOFA and ΔSOFB strains, hard natto could be produced as compared to the case with r22 strain.
The ΔSOFA strain and ΔSOFB strain are natto bacteria deficient in sofA and sofB, respectively. Therefore, it was estimated that sofA and sofB are genes encoding proteins having a function of producing soft natto, respectively.

(Example 2)
(1) Escherichia coli DH5α, E. coli vector pT7Blue, Bacillus subtilis vector pHY300PLK used by Takara Shuzo Co., Ltd.

(2) Preparation of SofA-enhanced strain A sofA-enhanced strain was prepared by constructing a vector having about 430 bases of the full length of sofA and about 120 bases upstream thereof, and introducing the vector into Bacillus natto by the following method.

i) Vector construction primer 17 (5'-GC TCTAGA GATGGAAAGCATCCAATGGG- 3', see SEQ ID NO: 21 and 23 in the sequence listing) and primer 18 (5'-CGC GGATCC TTATTAAAACTGCCATTGTTTAGC- 3', SEQ ID NO: 22 and the sequence listing 24)), and using them as primers, using the total DNA of the r22 strain as a template, PCR was performed in the usual manner, and the full length of the open reading frame of sofA (426 bases) and its The upstream region (124 bases) was amplified, and restriction enzyme XbaI and BamHI recognition sites were introduced at the positions indicated by the underline.
This amplified DNA was cloned into the cloning vector pT7Blue to obtain pSOFA1. Among two bands generated by agarose electrophoresis after pSOFA1 was cleaved with restriction enzymes XbaI and BamHI, the shorter band (about 500 bases) was recovered from agarose, and a number of Bacillus subtilis cleaved with XbaI and BamHI The copy number vector was inserted into pHY300PLK. The obtained plasmid was named pSOFA2 and was used for the following experiment.

ii) Transformation Using plasmid pSOFA2 prepared using Escherichia coli DH5α as a host, Bacillus natto r22 strain was transformed by a protoplast method as usual.
The transformant was selected using tetracycline resistance as an index. Plasmids were recovered from the obtained transformants to confirm that pSOFA2 was retained, and one of these was designated as SOFAH.

After culturing the SOFAH strain in LB medium containing tetracycline at 30 ° C. and 150 rpm until OD660 becomes 0.4, the plasmid was recovered as usual, cleaved with the restriction enzyme BamHI, and the absorbance at 260 and 280 nm was determined from the absorbance at each wavelength. Nucleic acid concentration and purity were measured, and it was confirmed that multiple copies of pSOFA2 were present.

After culturing SOFAH strain and r22 strain in LB medium with or without tetracycline at 37 ° C. and 150 rpm until OD660 becomes 0.4, RNA is extracted as usual, and then the internal sequence of sofA is targeted By performing RT-PCR and comparing the band intensity at the time of electrophoresis, it was confirmed that the SOFAH strain highly expressed sofA compared to the r22 strain.

The SOFAH strain obtained here was named Bacillus subtilis SOFAH (Bacillus subtilis SOFAH) strain, and as FERM ABP-10996, the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Tsukuba City East, Ibaraki Prefecture 305-8586) Deposited at 1-chome 1-address 1 center 6).
Similarly, the plasmid pHY300PLK was used to transform the r22 strain, and one obtained strain was designated as pHY300PLK / r22 strain.

(3) Natto Trial Production / Softness Evaluation For each of the SOFAH strain and pHY300PLK / r22 strain, spore solutions were prepared using a spore formation medium, and natto was produced according to a conventional method. The quality of natto produced using the SOFAH strain was the same as the control produced using the pHY300PLK / r22 strain in terms of both appearance and stringiness as a result of a sensory test by a specialized panelist.

It was confirmed by the following method that the SOFAH strain retained the plasmid pSOFA2 during natto fermentation. That is, after adding 0.85% sterilized saline to the fermented natto and suspending the suspension, the solution was applied to an LB agar plate and an LB agar plate containing tetracycline and cultured at 37 ° C overnight. It was confirmed that the number of colonies was almost the same on both plates.

Next, the hardness of natto was measured in the same manner as in Example 1. In the evaluation of natto, boiled beans before fermentation cooked under the same conditions and natto produced using pHY300PLK / r22 strain under the same cooking conditions and fermentation conditions were used as controls. Table 2 shows the hardness.

  When fermenting boiled beans with the SOFAH strain, softer natto could be produced as compared with the case of the r22 strain. From this, it was confirmed that natto bacteria having the ability to produce soft natto can be bred by increasing the copy number of the sofA gene and enhancing the expression of the protein encoded by sofA.

(Example 3)
(1) Preparation of a sofB-enhanced strain A sofB-enhanced strain was constructed by constructing a vector having about 380 bases of the full length of sofB, about 570 bases upstream thereof, and about 140 bases downstream thereof, and the vector was natto by the following method. It was prepared by introducing into a fungus.

i) Vector construction primer 19 (see 5′-GC TCTAGA TTTAGGGATATTGGTTCAAAAC-3 ′, see SEQ ID NO: 23 in FIG. 25 and FIG. 25) and primer 20 (5′-TCCCCCGGGACACTCCCAAAAACAATAAATATATA-3 ′, see SEQ ID NO: 24 in FIG. 26) ), And using these as primers, using the total DNA of the r22 strain as a template, PCR was performed as usual, and the full length of the open reading frame of sofB (384 bases), its upstream region (569 bases) and its downstream region (144 bases) were amplified, and recognition sites for restriction enzymes XbaI and SmaI were introduced at the positions indicated by the underline.

This amplified DNA was cloned into the cloning vector pT7Blue to obtain pSOFB1. Among the two bands generated by agarose electrophoresis after cutting pSOFB1 with restriction enzymes XbaI and SmaI, the shorter band (about 1100 bases) was recovered from the agarose, and a number of Bacillus subtilis digested with XbaI and SmaI were collected. The copy number vector was inserted into pHY300PLK. The resulting plasmid was named pSOFB2 and was used for the following experiment.

ii) Transformation Plasmid pSOFB2 prepared using Escherichia coli DH5α as a host was transformed into Bacillus natto r22 strain by a protoplast method as usual. The transformant was selected using tetracycline resistance as an index. Plasmids were recovered from the obtained transformants to confirm that pSOFB2 was retained, and one of these was designated as SOFBH strain.

After culturing the SOFBH strain in LB medium containing tetracycline at 30 ° C. and 150 spm until OD660 reached 0.4, the plasmid was recovered as usual, cleaved with the restriction enzyme SmaI, and the absorbance at 260 and 280 nm was determined from the absorbance at each wavelength. Nucleic acid concentration and purity were measured, and it was confirmed that multiple copies of pSOFB2 were present.

After culturing SOFBH strain and r22 strain in LB medium with or without tetracycline at 37 ° C and 150 spm until OD660 becomes 0.4, RNA is extracted as usual, and then the internal sequence of sofB is targeted By performing RT-PCR and comparing the band intensity at the time of electrophoresis, it was confirmed that the SOFBH strain expressed higher sofB than the r22 strain.

The SOFBH strain obtained here was named Bacillus subtilis SOFBH (Bacillus subtilis SOFBH) strain, and it was named FERM ABP-10997 as an independent administrative agency, National Institute of Advanced Industrial Science and Technology, Patent Biological Depositary Center (Tsukuba City East, Ibaraki Prefecture 305-8565) Deposited at 1-chome 1-address 1 center 6).

(3) Trial production of natto and evaluation of softness For each of the SOFBH strain and the pHY300PLK / r22 strain, a spore solution was prepared using a spore formation medium, and natto was produced according to a conventional method. The quality of natto produced using the SOFBH strain was the same as the control produced using the pHY300PLK / r22 strain in terms of appearance and stringiness as a result of a sensory test by a specialized panelist.

It was confirmed by the following method that the SOFBH strain retained the plasmid pSOFB2 during natto fermentation. That is, after adding 0.85% sterilized saline to the fermented natto and suspending the suspension, the solution was applied to an LB agar plate and an LB agar plate containing tetracycline and cultured at 37 ° C overnight. It was confirmed that the number of colonies was almost the same on both plates.

Next, the hardness of natto was measured in the same manner as in Example 1. In the evaluation of natto, boiled beans before fermentation cooked under the same conditions and natto produced using pHY300PLK / r22 strain under the same cooking conditions and fermentation conditions were used as controls. Table 3 shows the hardness.

  When fermenting boiled beans with the SOFBH strain, soft natto could be produced as compared with the case of the r22 strain. From this, it was confirmed that natto bacteria having the ability to produce soft natto can be bred by increasing the copy number of the sofB gene and enhancing the expression of the protein encoded by sofB.

It is a figure which shows the base sequence of the area | region containing a sofA gene. It is a figure which shows the base sequence following FIG. It is a figure which shows the amino acid sequence of the protein which a sofA gene codes. It is a figure which shows the base sequence of the area | region containing a sofB gene. It is a figure which shows the base sequence following FIG. It is a figure which shows the amino acid sequence of the protein which a sofB gene codes. FIG. 3 is a diagram showing the base sequence of primer 1. FIG. 3 is a view showing a base sequence of primer 2. FIG. 3 is a view showing the base sequence of primer 3. FIG. 4 is a view showing the base sequence of primer 4. FIG. 3 is a view showing a base sequence of primer 5. FIG. 3 is a view showing a base sequence of primer 6. FIG. 3 is a diagram showing the base sequence of primer 7. FIG. 3 is a view showing a base sequence of primer 8. FIG. 4 is a view showing a base sequence of primer 9. FIG. 3 is a view showing a base sequence of primer 10. FIG. 3 is a view showing a base sequence of primer 11. FIG. 3 is a view showing the base sequence of primer 12. It is a figure which shows the base sequence of the primer 13. FIG. 3 is a diagram showing the base sequence of primer 14. FIG. 4 is a view showing a base sequence of primer 15. FIG. 3 is a diagram showing the base sequence of primer 16. FIG. 4 is a diagram showing the base sequence of primer 17. FIG. 3 is a diagram showing the base sequence of primer 18. FIG. 3 is a diagram showing the base sequence of primer 19. FIG. 3 is a view showing a base sequence of primer 20. It is a figure which shows the outline of DNA fragment preparation for sofA gene deletion | deletion. It is a figure which shows the outline of DNA fragment preparation for sofB gene deletion | deletion.

Claims (15)

The protein shown in the following (A), (B) or (C).
(A) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and involved in the function of producing soft natto. DNA encoding the protein shown in the following (A), (B) or (C).
(A) A protein consisting of the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing and involved in the function of producing soft natto. DNA shown in the following (A), (B), (C) or (D).
(A) DNA consisting of a base sequence of base numbers 1937 to 2362 among the base sequences shown in SEQ ID NO: 1 in the sequence listing.
(B) Of the base sequence shown in SEQ ID NO: 1 in the sequence listing, hybridizes with DNA consisting of a sequence complementary to the base sequence of base numbers 1937 to 2362 under stringent conditions and produces soft natto DNA encoding a protein involved in the function of
(C) DNA consisting of a base sequence having a function as a primer or probe prepared from a part of the base sequence of base numbers 1937 to 2362 out of the base sequence shown in SEQ ID NO: 1 in the sequence listing, and stringent conditions DNA encoding a protein involved in the function of hybridizing underneath and producing soft natto.
(D) Among the nucleotide sequences shown in SEQ ID NO: 1 in the Sequence Listing, one or several base substitutions, deletions, insertions, additions, or inversions in the nucleotide sequences of nucleotide numbers 1937 to 2362 DNA consisting of a sequence and encoding a protein involved in the function of producing soft natto. The protein shown in the following (A), (B) or (C).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 4 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing and involved in the function of producing soft natto. DNA encoding the protein shown in the following (A), (B) or (C).
(A) A protein comprising the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing.
(B) A soft natto comprising the amino acid sequence represented by SEQ ID NO: 4 in the sequence listing, wherein the amino acid sequence is one or several amino acid substitutions, deletions, insertions, additions, or inversions. Protein involved in function.
(C) A protein comprising an amino acid sequence having at least 85% homology with the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing and involved in the function of producing soft natto. DNA shown in the following (A), (B), (C) or (D).
(A) DNA consisting of the base sequences 2082 to 2459 of the base sequence shown in SEQ ID NO: 3 in the sequence listing.
(B) Of the base sequence shown in SEQ ID NO: 3 in the sequence listing, it hybridizes under stringent conditions with DNA comprising a sequence complementary to the base sequence of base numbers 2082 to 2459, and produces soft natto DNA encoding a protein involved in the function of
(C) DNA consisting of a base sequence having a function as a primer or a probe prepared from a part of the base sequences of base numbers 2082 to 2459, among the base sequences shown in SEQ ID NO: 3 in the sequence listing, and stringent conditions DNA encoding a protein involved in the function of hybridizing underneath and producing soft natto.
(D) Of the base sequences shown in SEQ ID NO: 3 in the sequence listing, one or several base substitutions, deletions, insertions, additions, or inversions in the base sequences 2082 to 2459 DNA consisting of a sequence and encoding a protein involved in the function of producing soft natto. A method for breeding Bacillus subtilis belonging to Bacillus subtilis characterized by enhancing the function of a protein encoded by a gene involved in the function of producing soft natto. The method for breeding Bacillus subtilis belonging to Bacillus subtilis according to claim 7, wherein the gene involved in the function of producing soft natto is the gene according to claim 2 or claim 3. The method of breeding Bacillus subtilis belonging to Bacillus subtilis according to claim 7, wherein the gene involved in the function of producing soft natto is the gene according to claim 5 or 6. A Bacillus subtilis belonging to Bacillus subtilis having an enhanced function of producing soft natto, which has been bred by the method according to any one of claims 7 to 9. Bacillus subtilis SOFAH (Bacillus subtilis SOFAH) strain (FERM ABP-10996). The Bacillus subtilis SOFBH (FERM ABP-10997) strain (FERM ABP-10997).   A method for producing natto, wherein the natto bacterium according to any one of claims 10 to 12 is used.   A soft natto produced by the method for producing natto according to claim 13.   The soft natto according to claim 14, which is produced by the method for producing natto according to claim 13, and has a hardness of 0.20 to 0.65N.

Images