JP2010037255A - Agent for preventing or ameliorating visual dysfunction - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an agent for the prevention and/or amelioration of visual dysfunction, having high safety and useful as a drug, quasi-drug, food, etc. <P>SOLUTION: The agent for the prevention and/or amelioration of visual dysfunction contains one or more kinds of plants selected from Caesalpinia sappan, Zingiber officinale and Perilla frutescens or its extract as an active component. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to an RDH12 gene expression promoting agent, a PEDF gene expression promoting agent, and a visual function lowering preventing or improving agent.

  With the spread of personal computers, the Internet, mobile mail, etc., the time required to work on the image display terminal (Visual display terminal (VDT)) increases, and fatigue of the eyes and associated fatigue (eye strain) become a problem. Yes. In fact, the “Ministry of Health, Labor and Welfare” conducted by the Ministry of Health, Labor and Welfare conducted in about 12,000 private establishments, and the workers who were aware of physical fatigue in VDT work at work. It is reported that 91.6% replied that they had “eye fatigue / pain” (Non-patent Document 1).

  In addition, deterioration of visual function associated with aging, such as presbyopia, cataract, glaucoma, and age-related macular degeneration, and deterioration of visual function associated with diseases such as diabetic retinopathy are causes of lowering QOL (Quality of Life). Therefore, it is necessary to prevent and improve them. In particular, in an aging society, deterioration of visual function associated with aging is considered to be a serious problem.

  So far, attempts have been made to improve visual function deterioration associated with fatigue, aging / disease, and anthocyanins (patent document 1), astaxanthin (patent document 2), chrysanthemum flower (patent document 3) and the like improve visual function. Has been shown to have. However, the action mechanism of these components has not been clarified in detail, and it is difficult to say that the effect of preventing or improving visual function deterioration is sufficiently satisfactory.

  Moreover, retinal function deterioration is mentioned as one of the main causes of tired eyes and visual function deterioration accompanying aging / disease. Retinal function is the function of “photocells”, which are light-receiving cells in the retina, that convert light signals into electrical signals and transmit them to the center. One of the causes of retinal dysfunction, known to be the prevention and amelioration of visual function loss for anthocyanins contained in blueberries and cassis, is said to be associated with the promotion of rhodopsin resynthesis (non- Patent Document 2).

  Rhodopsin consists of a seven-transmembrane protein called opsin and a cofactor, retinal (11-cis-retinal), and is present in the disc-shaped membrane of the retina outer segment. . When isomerization from 11-cis-retinal to all-trans-retinal occurs by light, opsin undergoes a structural change and causes activation of transducin (G protein). As a result of the activation of the information transmission system, the light signal is converted into an electrical signal and transmitted to the center via the optic nerve. In order for one photoreceptor cell to receive light again, it has been found that all-trans-retinal is converted to 11-cis-retinal by multiple enzyme reactions and rhodopsin needs to be re-synthesized.

  The RDH12 (retinol dehydrogenase 12) gene encodes an enzyme that catalyzes the conversion of 11-cis-retinol to 11-cis-retinal (the retinal that constitutes rhodopsin described above), and is an important gene in rhodopsin resynthesis. is there. Since the genetic deficiency of RDH12 causes severe visual impairment, it is considered to play an important role in maintaining visual function (Non-patent Document 3). In addition, in studies using mice, it has been shown that RDH12 exerts an inhibitory action on retinal degeneration (Non-patent Document 4). From these facts, it is considered that RDH12 expression enhancement and function enhancement are good means for preventing and improving visual function deterioration.

On the other hand, PEDF (pigment epithelium-derived factor) is known as a secreted protein having an angiogenesis inhibitory action and a neuroprotective action. It has been reported that PEDF expression decreases in human vitreous in eye diseases such as diabetic retinopathy, age-related macular degeneration, etc., due to aging and oxidative stress causing decreased expression of PEDF (Non-patent Document 5). ), And is thought to be associated with decreased visual function, especially with age and disease. In addition, it has been reported that cell death of photoreceptor cells in the retina is suppressed by intraocular injection of a viral vector expressing PEDF in a retinitis pigmentosa model animal (Non-patent Document 6). Increased expression and promotion of secretion are considered to be good means for preventing and improving deterioration of visual function.

  Thus, although it is thought that the expression enhancement of RDH12 and PEDF, enhancement of function, or promotion of secretion are important for prevention / improvement of visual function deterioration, for the prevention / improvement of visual function deterioration having such a function. No food ingredients are ever known.

On the other hand, Suesu (Caesalpinia sappan) is an evergreen shrub native to India and distributed in the Himalayas, Thailand, and Southeast Asia. It contains essential oils and tannins, and is called soboku in Chinese medicine and is used for anti-inflammation, analgesia, abdominal pain, menstrual disorders, bruises and the like. In addition, heart contraction force enhancement, central nerve suppression, and antibacterial action are known (Non-patent Document 7).
Ginger (Zingiber officinale) is a perennial herb native to India, but its rhizome includes gingerol, gingerol and gingeron, which are pungent components, and gingivalen, linalool, citral, and cionaire, which are aromatic components. Widely used as a spice and folk medicine around the world. In particular, it is used for raw foods and pickles in Asia, as a raw material for curry powder, and in Western and Arab countries, dried products are used for cooking, bread and confectionery. It is called ginger in Chinese medicine and is said to have an effect of improving metabolic function, and is used for vomiting, abdominal pain, back pain, appetite enhancement, etc. (Non-patent Document 8).
Perilla leaves are called soba in Chinese medicine and are said to have antipyretic and antiseptic effects, and are used for bronchitis, colds, etc. as published, antipyretic, antitussive and analgesic drugs (Non-patent Document 8) . In recent studies, the flavonoid luteolin, which is a component of perilla leaves, has shown a strong antiallergic effect (Non-patent Document 9). Perilla frutescens (Perilla frutescens) is an annual herb native to the central and southern parts of China, but its leaves contain ingredients such as rosmarinic acid, anthocyanin-based shisonin, and malonylshisonin. It is also useful as a health food.

  However, until now, nothing has been known about the effect of preventing or improving the visual function of suou, ginger or perilla.

WO01 / 001798 pamphlet WO2002 / 094253 pamphlet JP 11-246455 A Ministry of Health, Labor and Welfare Minister's Secretariat Statistics Information Department: 2003 Survey of actual conditions related to technological innovation and labor. , Ministry of Health, Labor and Welfare, 2004 Matsumoto, H., et al. J. Agric. Food Chem. 54, 578-582, 2006 Janecke, A. R., et al., Nat. Genet., 36, 850-854, 2004 Maeda, A., et al., J. Biol. Chem., 281, 37697-37704, 2006 Tombran-Tink, J., et al., J. Neurosci., 15, 4992-5003, 1995 Miyazaki, M., et al., Gene Therapy, 10, 1503-1511, 2003 Primary color herbal medicine and drinks picture book, Facial mask, Nanten Shobo, 1982 Primary Color Makino Wakuhan Herb Encyclopedia, Hiroshi Mitsuhashi, Hokuryukan, 2002 Makino, T., et al., Biol. Pharm. Bull., 24, 1206-1209, 2001

  The present invention relates to providing a safe and useful agent for preventing or improving visual function deterioration.

  As a result of searching for natural product materials, the present inventors have found that Suo extract, Ginger extract and Perilla extract have excellent RDH12 gene expression promoting action, and Ginger extract also has PEDF gene expression promoting action. As a result, the present invention has been completed.

That is, the present invention relates to the following 1) to 3).
1) An RDH12 gene expression promoter comprising as an active ingredient at least one plant selected from Suou, Ginger and Perilla or an extract thereof.
2) A PEDF gene expression promoter comprising a ginger plant or an extract thereof as an active ingredient.
3) An agent for preventing or improving visual function deterioration, comprising as an active ingredient at least one plant selected from Suou, Ginger and Perilla.

  The RDH12 gene expression promoting agent, PEDF gene expression promoting agent, and visual function lowering preventing or improving agent of the present invention have an excellent RDH12 gene and / or PEDF gene expression promoting action and are highly safe because they are derived from crude drugs. Therefore, it is effective as a medicine, food, etc. for preventing or improving the deterioration of visual function.

The suo used in the present invention is a leguminosae Caesalpinia sappan, a ginger is Zingiberaceae zingiber officinale, and a perilla is Lamiaceae ( Lamiaceae) Perilla frutescens, all known as the origin of herbal medicine.
Examples of the use site of the plant of Suou, Ginger or Perilla include whole plant, above-ground part, heartwood, sapwood, leaf, bark, branch, rhizome, root, flower, fruit, fruit or seed of the plant.
Among the above-mentioned use sites, it is preferable to use the sites used in Chinese medicine, specifically, it is more preferable to use heartwood if Suou, more preferable to use rhizome if Ginger, If it is perilla, it is more preferable to use a leaf.
The above-mentioned use site can be used alone or after being mixed and pulverized.

  As an extract of Suou, Ginger or Perilla, in addition to an extract obtained by extracting the above-mentioned used part as it is or after being dried and cut to an appropriate size or pulverized, it is further separated and purified The fraction (component) having high activity obtained in this manner is included.

  As the plant extraction means, the plant is impregnated with a solvent in a state of low temperature (0 to 4 ° C.), room temperature (5 to 40 ° C.) or warm (40 to 105 ° C.), or extraction using a Soxhlet extractor or the like. In addition to the solvent extraction method performed using instruments, a method of extraction using a distillation method such as steam distillation, a supercritical extraction method in which carbon dioxide gas is brought into a supercritical state, or a pressing method to obtain an extract by pressing Etc.

  As the extraction solvent used for solvent extraction, either a polar solvent or a nonpolar solvent can be used, and these can also be mixed and used. For example, water; alcohols such as methanol, ethanol, propanol and butanol; polyhydric alcohols such as ethylene glycol, propylene glycol and butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; tetrahydrofuran Linear and cyclic ethers such as diethyl ether; polyethers such as polyethylene glycol; halogenated hydrocarbons such as dichloromethane, chloroform and carbon tetrachloride; hydrocarbons such as hexane, cyclohexane and petroleum ether; benzene and toluene Aromatic hydrocarbons such as; pyridines; supercritical carbon dioxide; oils, waxes, other oils, and the like. These can be used alone or in combination of two or more, and can be repeated by changing the solvent. In . Among these, it is preferable to use water, a lower (C1-C6) alcohol, or a water / lower (C1-C6) alcohol mixed liquid, and methanol and ethanol are especially preferable as the lower alcohol.

  For extraction, for example, 1 to 50 parts by weight of a solvent is used per 1 part by weight of the plant, and the mixture is immersed or heated to reflux for 1 to 3 hours to 2 to 3 days in the range of room temperature (5 to 40 ° C.) to the boiling point of the solvent. Is preferred.

  As these extracts, as an example, Suo heartwood, ginger rhizome or perilla leaves are added to a 20-100 volume% ethanol aqueous solution (ethanol: water = 20-100: 80-0 (V / V)) at room temperature ( 5 to 40 ° C.) and an extract obtained by immersing for 1 to 10 days and extracting the ethanol aqueous solution-soluble component. The extraction temperature is preferably 20 to 40 ° C., the extraction period is preferably 5 to 9 days, the extraction solvent is more preferably 20 to 80% by volume ethanol aqueous solution, and further preferably 40 to 60% by volume ethanol aqueous solution.

  Examples of the means for separating and purifying the extract include activated carbon treatment, liquid-liquid distribution, column chromatography, liquid chromatography, gel filtration, and precision distillation.

The extract of the present invention may be used as it is, or may be used as a diluted solution diluted with an appropriate solvent, or as a concentrated extract or dry powder, or in a paste form. It may be prepared.
In addition, the above extract can be freeze-dried and diluted with a solvent usually used for extraction, for example, water, ethanol, water / ethanol mixed solution or the like. It can also be used by encapsulating in vesicles such as liposomes or microcapsules.

The plant of the present invention or an extract thereof has an action of enhancing the expression of the RDH12 gene and / or PEDF gene, as shown in Examples below, and the expression of each of these genes is enhanced to enhance the RDH12 protein and / or PEDF. Increased protein expression and increased function or promotion of secretion, fatigue eyes; decreased retinal function; decreased visual function associated with aging, including presbyopia, cataract, glaucoma, age-related macular degeneration, etc .; cataract, glaucoma In addition, it is possible to prevent and / or improve general visual function decline such as diminished visual function associated with diseases such as diabetic retinopathy and age-related macular degeneration (see, for example, Non-Patent Documents 3 to 6).
Here, prevention and / or improvement of deterioration of visual function includes maintenance of visual function.
Therefore, the plant or the extract thereof is an RDH12 gene expression promoter, PEDF gene expression promoter, and visual function lowering prevention and / or improvement agent (hereinafter referred to as “visual function lowering prevention and / or improvement agent, etc. It can also be used for producing a visual function lowering prevention and / or improvement agent and the like. The visual function deterioration preventing and / or improving agent can be used as a food, functional food, quasi-drug, pharmaceutical, or the like for preventing and / or improving visual function deterioration. And the said plant or its extract can be utilized as food for special use, such as food with a label indicating that it is used for visual function deterioration and / or improvement, for example, food for the sick, food for specified health use, etc. .

  Examples of the dosage form when the agent for preventing and / or improving visual function of the present invention is used as a pharmaceutical include oral administration by tablets, capsules, granules, powders, syrups, etc., or injections, suppositories, and inhalants. And parenteral administration using transdermal absorption agents, eye drops, external preparations and the like. In order to prepare pharmaceutical preparations of such various dosage forms, the above-mentioned plant of the present invention or an extract thereof can be used alone, or other pharmaceutically acceptable excipients, binders, bulking agents, Disintegrants, surfactants, lubricants, dispersants, buffers, preservatives, flavoring agents, fragrances, coating agents, carriers, diluents, and the like can be used in appropriate combinations. Among these dosage forms, the preferred form is oral administration, and when used as a preparation for oral administration, the content of the plant of the present invention or the extract thereof in the preparation is generally 0.01 to 80 mass. %, And more preferably 0.5 to 80% by mass.

Examples of the case where the visual function deterioration preventing and / or improving agent of the present invention is used as food include breads, cakes, noodles, confectionery, jelly, frozen foods, ice creams, dairy products, and beverages. In addition to various foods, the same forms (tablets, capsules, syrups, etc.) as the above-mentioned oral preparations can be mentioned.
In order to prepare various forms of food, the above-mentioned plant of the present invention or an extract thereof is used alone, or other food materials, solvents, softeners, oils, emulsifiers, preservatives, fragrances, stabilizers, colorings. An agent, an antioxidant, a humectant, a thickener and the like can be used in appropriate combination. The content of the plant of the present invention or the extract thereof in the food is preferably 0.001 to 1.0% by mass, more preferably 0.003 to 0.5% by mass. 005 to 0.05% is more preferable.

  When the agent for preventing and / or improving visual function of the present invention is used as a medicine or food, the daily administration or intake per adult varies depending on various factors such as age, weight, sex, and administration method. However, in the case of oral administration, the plant or extract thereof (in terms of solid content) is 0.1 to 5000 mg, particularly 10 to 2000 mg, more preferably 50 to 1000 mg as the plant or extract thereof of the present invention. Is preferably administered once to several times a day.

Production Example 1: Each extract For Suo extract, 200 g of dry pulverized heartwood (Caesalpinia sappan) heartwood (name of crude drug: Sugi, place of origin: Guangxi) in 10 times amount (2 liters) of 50% ethanol aqueous solution It was immersed for 7 days at room temperature (20-30 ° C.), insoluble matter was filtered off, concentrated under reduced pressure, and lyophilized to obtain an extract (solid content 13.9 g). The extract was diluted with 50% ethanol water to 1.0 mass to volume (W / V)% and used.
As for the ginger extract, 500 g of dried ginger (Zingiber officinale) rhizome dried product (trade name: ginger powder) was immersed in 10 times (5 liters) of 50% ethanol aqueous solution at room temperature (20-30 ° C.) for 7 days. The insoluble material was filtered off, concentrated under reduced pressure, and lyophilized to obtain an extract (solid content: 21.3 g). The extract was diluted with 50% ethanol water to 1.0 mass to volume (W / V)% and used.
As for the perilla extract, a food color preparation (trade name: Diamond Red; Maruzen Pharmaceutical) extracted from perilla (Perilla frutescens var. Acuta) leaves was used as the extract. The dye preparation was diluted with 50% ethanol water to 1.0 mass to volume (W / V)% and used.

Example 1: RDH12 and PEDF gene expression enhancing action in Y79 cells Suspension of human retinoblastoma cell line Y79 cells at 2.0 × 10 ⁵ cells / well in a 24-well Poly-D-Lysine plate (Becton Dickinson) On the first day from the start of culture, the medium was replaced with RPMI 1640 medium containing each test sample, inactivated fetal bovine serum (ThermoTrace), 100 units / ml penicillin, and 100 μg / mL streptomycin.
Furthermore, Suo extract is 0.001 mass to volume (W / V)%, Ginger extract is 0.01 mass to volume (W / V)%, Perilla extract is 0.001 mass to volume (W / V). %), 48 hours after the addition, the cells were collected, and RNA was extracted using a nucleic acid extraction reagent ISOGEN (Nippon Gene). Reverse transcription reaction was performed using 125 ng of total RNA. Using the synthesized cDNA (total RNA: 6.25 ng), mRNA expression levels of RDH12 and PEDF were quantified by Real-time PCR.

RDH12 amplification primer 5 'side: AACTGCCCAGACAGACCCCAG (SEQ ID NO: 1)
3 'side: GCACCAGGGTTCCAGGACTT (SEQ ID NO: 2)
PEDF amplification primer 5 'side: ATTCCAACCATTTCGCACTGG (SEQ ID NO: 3)
3 ′ side: TGCACAAAGTTGATGCCCTC (SEQ ID NO: 4)
Primer for amplification of 36B4 5 'side: CTGATCATCCAGCAGGGTTT (SEQ ID NO: 5)
3 'side: CCAGGAAGGCCTTGACCCTTT (SEQ ID NO: 6)

The analysis was performed using SYBR Green Master Mix and ABI PRISM7000 Seaquence Detectoin System (Applied Bio Japan), and the mRNA expression level of each gene was corrected by the mRNA expression level of 36B4 (ribosomal protein, large, P0) gene. . Moreover, the gene expression level was expressed as a relative value with the gene expression level in the solvent control being 1.
As shown in FIG. 1, the expression level of RDH12 gene was increased in Y79 cells cultured in the presence of any of Susu extract, Ginger extract and Perilla extract. Moreover, as shown in FIG. 2, the expression level of PEDF gene increased in Y79 cells cultured in the presence of ginger extract. From this, it can be seen that Suou, Ginger and Perilla increase visual function regulatory gene expression and are effective as a preventive and / or ameliorating agent for visual function deterioration.

Example 2
One tablet of 200 mg was produced according to a conventional method using the following components.
(Composition) (%)
Suou, Ginger or Perilla extract 3.3
Hydroxypropyl cellulose 30
Light anhydrous silicic acid 6.6
Lactose 16.7
Crystalline cellulose 16.7
Talc 16.7
Diacylglycerol 10

Example 3
One tablet of 200 mg was produced according to a conventional method using the following components.
(Composition) (%)
Suou, Ginger or Perilla extract 10
Starch 65
Magnesium stearate 5
Lactose 20

Example 4
The following ingredients were mixed and then filled into a gelatin capsule to obtain a soft capsule of 250 mg per tablet.
(Composition) (%)
Suo extract 20
Ginger Extract 20
Perilla extract 10
Lactose 25
Crystalline cellulose 25

Example 5
After 200 g of granulated sugar was dissolved in 200 mL of water by heating, 200 g of ginger slice was added and heated for 15 minutes. A ginger drink was prepared by adding 800 mL of carbonated water to 200 mL of the extract obtained by filtration.

Example 6
500 g of perilla leaf was added to 1800 mL of hot water and heated for 10 minutes. 30 g of citric acid and 800 g of granulated sugar were dissolved in the extract obtained by filtration to prepare a perilla concentrated beverage.

Example 7
Using the ginger beverage prepared in Example 5, 1 cup 50 g of jelly was prepared as shown below.
First, the following components were mixed and dissolved by overheating.
Ginger drink 750mL
100g of granulated sugar
Gelatin 25g
After dissolution, the following components were further added and mixed, then poured into a vessel and cooled at 4 ° C. to prepare a jelly.
Lemon juice 75mL
500ml ginger drink

Example 8
Using the perilla concentrated beverage prepared in Example 6, 1 cup of 50 g of jelly was prepared as shown below.
First, the following components were mixed and dissolved by overheating.
Perilla concentrated beverage 200mL
800mL water
50g of granulated sugar
60g gelatin
After dissolution, the following components were further added and mixed, then poured into a vessel and cooled at 4 ° C. to prepare a jelly.
Ginger juice 75mL
The ginger juice is squeezed after ginger is rinsed.

It is a figure which shows the gene expression level of RDH12 in the Y79 cell cultured in the presence of a susu extract, a ginger extract, or a perilla extract. It is a figure which shows the gene expression level of PEDF in the Y79 cell cultured in presence of the ginger extract.

Claims (3)

  An RDH12 gene expression promoter comprising as an active ingredient at least one plant selected from Suou, Ginger and Perilla or an extract thereof.   A PEDF gene expression promoter comprising a ginger plant or an extract thereof as an active ingredient.   An agent for preventing or improving visual function deterioration comprising, as an active ingredient, at least one plant selected from Suou, Ginger and Perilla or an extract thereof.

Images