JP2010022365A - Method for bluing petal cell for creating blue flower - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new technique for bluing a specific site in a plant. <P>SOLUTION: It is found that bluing of a petal of a tulip can be achieved by identifying and isolating a bluing gene specifically expressing in the blue flower bottom part, and expressing the gene. Thus, a method for bluing a petal cell including expressing the bluing gene possessed by the tulip in a purple cell is provided. Furthermore, a method for bluing a petal cell including expressing the bluing gene and an artificially constructed ferritin repressor gene in the purple cell is provided. A petal-specific promoter useful for use in the method for bluing the petal cell is also provided. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for modifying the flower color of a plant. More specifically, the present invention relates to a method for modifying tulip blue genes by expressing them in purple cells. In addition, the present invention relates to a method of changing to a deeper blue color by suppressing the expression of endogenous ferritin gene and expressing a bluening gene.

  Flower color is one of the most important traits in flower gardening crops, and various improvements have been made since ancient times. Flower color components are mainly anthocyanins, carotenoids and betalains, and the red, orange and purple colors of many plants are derived from anthocyanins. Anthocyanins are those in which sugar is bound to anthocyanidin, which is the mother nucleus in terms of chemical structure, and the type of sugar varies depending on the plant species, and further undergoes modifications such as acylation. There are mainly three types of anthocyanidins, pelargonidin (orange), cyanidin (red), and delphinidin (purple), and the color tone changes as the number of hydroxyl groups on the B ring changes from 1 to 3, respectively.

Many of the blue flowers are known to have a delphinidin pigment, but the vacuoles in plant cells where anthocyanins are localized are generally weakly acidic, and it is experimentally found that delphinidin is purple under mildly acidic conditions. It has been confirmed (Non-patent document 1; Non-patent document 2; Non-patent document 3). Therefore, there is a mechanism peculiar to plant species in order to exhibit blue. For example, alkalinization of vacuolar pH (morning glory), complex formation with metal ions (hydrangea, cypress)
, And pigment effect by flavonol and flavonol.

  Until now, other plants have been developed using a method of making cut flowers soaked with a colorant or genetically modified technology for the purpose of creating new blue flowers in plants that do not have blue color, especially in plants without delphinidin pigment. Attempts have been made to make genetic recombinants into which the derived delphinidin synthase gene (flavonoid 3 ′, 5 ′ hydroxylase gene) has been introduced (Non-patent Document 4; Non-patent Document 5). For example, roses and carnations whose flower color has been modified by genetic engineering techniques developed so far (so-called blue roses and blue carnations) are delphinidin pigments by introducing flavonoid 3 ', 5' hydroxylase genes derived from other plants. Has succeeded in making new. However, the flower color has an intermediate color between blue and purple and has not yet been clearly called blue.

  As a pigment for tulip petals, there are anthocyanins having pelargonidin, cyanidin, and delphinidin as mother nuclei (Non-patent document 6; Non-patent document 7). Furthermore, it has been found by analysis of the present inventors that eleven types of flavonols exist (Non-patent Document 8). Tulip flower colors are mainly orange by anthocyanins, red, purple and yellow by carotenoids, and they combine to present various colors. However, there are no blue flowers in the whole petal.

  However, there are several varieties of tulips that have a blue bottom (flower bottom) inside the petals. This blue color expression specific to the flower bottom has been known for a long time, and is a phenomenon also seen in wild tulip species. Tulip breeding began in the 16th century (Non-Patent Document 9), but since that time, attempts have been made to spread the blue color of the flower bottom throughout the petals. However, despite the many years of efforts of those skilled in the art, the blue color of the tulip petals has not yet been realized. It implies that there are different and distinct physiological mechanisms in the flower bottom and petal top. Therefore, we analyzed what is physiologically different, and found that iron ions were contained in the vacuole of cells at the bottom of the flower about 25 times more than the upper petals, and delphinidin, iron ions, and flavonol formed a complex. It has been found and reported that blue color is exhibited (Non-patent Document 10). However, it has been shown that iron ions and magnesium ions turn blue in cypress (Non-patent Document 11), and cornflower shows that iron ions and calcium ions are necessary from X-ray analysis of blue pigment crystals. (Non-Patent Document 12), it was considered that not only iron ions but also a plurality of other factors are involved in the blue coloration of tulip petals.

  In plants, iron is an essential element essential for growth. At the same time, iron is a substance called a hydroxy radical in the organism, which causes the generation of oxidants, so excessive absorption of iron can be toxic to plants. It is known (Non Patent Literature 13). Therefore, it is known that the absorption into the plant body and the intracellular concentration are strictly regulated. However, the mechanism has not yet been fully elucidated and there are many unclear points. Currently, studies on Arabidopsis and rice, which are model plants, are proceeding with the elucidation of genes and proteins involved in iron ion absorption in soil and transport in plants. An example of such a gene is the VIT1 gene in Arabidopsis thaliana (Non-patent Document 14). Non-patent document 2 shows that the VIT gene is most highly expressed in seed and seedling cotyledonary vascular bundles. However, the yeast CCC1 gene (ortholog of the VIT gene) knockout mutant resulted in a three-fold increase in the accumulation of iron ions in the vacuole, but in the Arabidopsis VIT gene knockout mutant, seeds and cotyledons were compared with the wild type. Since there is no difference in the iron content of iron, the adjustment of iron ion concentration is still unclear. Furthermore, many factors are involved in homeostasis of iron ions such as transporters (AtNRAMP2, 3) that transport iron ions, manganese ions, and cadmium ions from the vacuole to the cytoplasm side in Arabidopsis thaliana (Non-patent Document 15). Was obvious. From these facts, it was considered that artificial adjustment of the iron ion level in the vacuole was impossible (Non-Patent Document 16).

Goto, T .; , Prog. Chem. Org. . Nat. Products 52: 113-158, 1987 Broillard, R.A. In The Flavoids: Advance in Research since 1980, pp. 525-538, 1988 Yoshida, K .; , Et al. , Plant Cell Physiol. 44: 262-268, 2003 Fukui, Y .; , Et al. , Phytochemistry 63: 15-23, 2003. Katsumoto, Y. et al. , Et al. , Plant Cell Physiol. , 48: 1589-1600, 2007. Torskangerpol, K.M. , Et al. , Phytochemistry 52: 1687-1692, 1999. Torskangoll, K.M. , Et al. Biochem. Syst. Ecol. 33: 499-510, 2005 Shoji, et al., Horticultural studies 6, another (2): 310, 2007 Tulip / Uchinaka Kasuke Kimura Kazuaki Soji et al., “Perianth Bottom-Specific Blue Color Development in Tulip cv. Murazakizu Requirez Ferric Irons”, Plant Cell Physiol. 48 (2): 243-251 (2007) Kondo, T .; , Et al. , Nature 358: 515-518, 1992. Shiono, M .; , Et al. , Nature 436: 791, 2005 Curie, C.I. , And Briat, J-F. , Annu. Rev. Plant Biol. 54: 183-206, 2003 Sun A. Kim et al., “Localization of Iron in Arabidopsis See Requests the Vacuum Membrane Transporter VIT1,” Science, Vol 314, November 24, 2006. Thomasine, S.M. , Et al. Plant J .; 34: 685-695, 2003 Briat, J-F. , Et al. , Current Opinion in Plant Biology 2007, 10: 276-285.

  For this reason, the development of a new technique for blueizing a specific site in a plant has been an issue.

  As a result of extensive research, the present inventors have identified and isolated a bluening gene that is specifically expressed at the bottom of a blue flower, and that this gene can be expressed to achieve blueening of the tulip petals. Was unexpectedly discovered, and the present invention was completed. The present inventors further control the expression of the bluening gene and the ferritin gene by identifying and isolating the ferritin gene, which is another gene related to tulip bluening, and analyzing its expression pattern. It has also been found that a deeper blue can be achieved. As mentioned above, the fact that several factors including iron ions were thought to be involved in the blue expression of tulips, and the artificial regulation of iron ion levels in the vacuole is far from possible In view of the fact that it was considered that, the effect of tulip petalization achieved by the present invention is a remarkable effect that could not be easily achieved by those skilled in the art. The present invention realizes the blue coloration of tulip petals that those skilled in the art have been trying since the 16th century, and this effect has been unexpected.

In order to solve the above problems, the present invention provides the following items, for example.
(Item 1)
A method for producing a plant cell for producing a blue plant, wherein the plant cell is:
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
Introducing a nucleic acid selected from the group consisting of, wherein the nucleic acid is operably linked to a petal-specific promoter.
(Item 2)
A method for producing a blue plant, which is as follows:
(I) In plant cells:
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
Introducing a nucleic acid selected from the group consisting of: a step wherein the nucleic acid is operably linked to a petal-specific promoter, and (ii) from the plant cell produced in step (i) A process of regenerating the plant body,
Including the method.
(Item 3)
A method for producing a plant cell for producing a blue plant, comprising the following nucleic acid (1) and nucleic acid (2):
(1) A nucleic acid selected from the group consisting of (a) to (d) below,
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
(2) a nucleic acid that decreases the expression level of a nucleic acid selected from the group consisting of (e) to (h) below:
(E) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 3, and that encodes a polypeptide having iron ion storage activity;
(F) a nucleic acid comprising a sequence having at least 80% homology with the nucleic acid sequence set forth in SEQ ID NO: 3, and encoding a polypeptide having iron ion storage activity;
(G) a nucleic acid encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4; and (h) an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 4 A nucleic acid encoding a polypeptide having iron ion storage activity,
Wherein the nucleic acid is operably linked to a petal specific promoter.
(Item 4)
A method for producing a blue plant, which is as follows:
(I) The following (1) nucleic acid and (2) nucleic acid:
(1) A nucleic acid selected from the group consisting of (a) to (d) below,
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
(2) a nucleic acid that decreases the expression level of a nucleic acid selected from the group consisting of (e) to (h) below:
(E) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 3, and that encodes a polypeptide having iron ion storage activity;
(F) a nucleic acid comprising a sequence having at least 80% homology with the nucleic acid sequence set forth in SEQ ID NO: 3, and encoding a polypeptide having iron ion storage activity;
(G) a nucleic acid encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4; and (h) an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 4 A nucleic acid encoding a polypeptide having iron ion storage activity,
Wherein the nucleic acid is operably linked to a petal-specific promoter, and (ii) regenerating the plant from the plant cell produced in step (i),
Including the method.
(Item 5)
Item 5. The method according to any one of Items 1 to 4, wherein the petal-specific promoter is a Myb transcription factor gene promoter having the base sequence of SEQ ID NO: 15.
(Item 6)
Item 5. The method according to any one of Items 1 to 4, wherein the petal-specific promoter is an anthocyanidin synthase gene promoter having the base sequence of SEQ ID NO: 16.
(Item 7)
Item 5. The method according to any one of Items 2 and 4, wherein the plant has a blue petal.
(Item 8)
Item 8. The method according to any one of Items 1 to 7, wherein the plant is a tulip.
(Item 9)
The above tulips are purple crystal, purple of dreams, Prince Charles, Negrita, Cote d'Azur, Neptune, Blue Jim, Purple Palace, Purple World, Purple Flag, Louvre, Blue Purple, Amethyst, Carabela, Purple Marvel, Pandion, French Hals 9. The method of item 8, wherein the method is selected from the group consisting of: Atella, Prince Charles, Purple Hat, and Reliance.
(Item 10)
A plant having a blue petal, which is produced by the method according to any one of items 2 and 4-6.
(Item 11)
Item 11. The plant according to Item 10, wherein the plant is a tulip.
(Item 12)
The above tulips are purple crystal, purple of dreams, Prince Charles, Negrita, Cote d'Azur, Neptune, Blue Jim, Purple Palace, Purple World, Purple Flag, Louvre, Blue Purple, Amethyst, Carabela, Purple Marvel, Pandion, French Hals Item 12. The plant according to Item 11, selected from the group consisting of: Atella, Prince Charles, Purple Hat, and Reliance.
(Item 13)
A plant cell for producing a blue-colored plant body, which is produced by the method according to any one of items 1, 3, 5, or 6.
(Item 14)
A nucleic acid having the base sequence of SEQ ID NO: 15.
(Item 15)
A nucleic acid having the base sequence of SEQ ID NO: 16.

  According to the present invention, a new technique for blueening a specific site in a plant is provided.

FIG. 1 shows the flower color and anthocyanin pigment of the tulip variety “Purple Crystal”. As shown in (a), the whole petal is purple, but as shown in (b), only the flower bottom is blue. FIG. 1 (c) shows the structure of the delphinidin 3-O-rutinoside dye which is the purple and blue group. FIG. 2 shows the nucleic acid sequence of the bluening gene isolated from the tulip flower bottom (upper; SEQ ID NO: 1) and the amino acid sequence encoded by the nucleic acid sequence (lower: SEQ ID NO: 2). FIG. 3 shows the nucleic acid sequence (upper row: SEQ ID NO: 3) and amino acid sequence (lower row: SEQ ID NO: 4) of the tulip ferritin gene that affects cell bluening. When the gene is introduced, a repressed gene improved from this gene is used. FIG. 4 shows the results of expression analysis during the petal development process of the bluening gene and ferritin gene. FIG. 4 (a) shows 6 stages from the bud stage to the senescence stage in the development process of purple quartz. FIG. 4 (b) shows the expression of the bluening gene in each stage, and FIG. 4 (c) shows the expression of the ferritin gene in each stage. Expression in (b) and (c) was quantified by real-time RT-PCR. FIG. 5 shows the expression analysis results of (a) the bluening gene and (b) the ferritin gene in each tissue of purple crystal. FIG. 6 shows the results of expression analysis in other varieties other than purple crystal. The upper part of FIG. 6 (a) is a variety whose flower bottom is blue, and the lower part is a variety whose flower bottom is not blue (all of which are of growth stage 4). FIG. 6 (b) shows the expression analysis of the bluening gene in each variety, and FIG. 6 (c) shows the expression analysis of the ferritin gene in each variety. FIG. 7 shows a gene transfer vector used in the present invention. Km ^R : kanamycin resistance gene, GFP: green fluorescent protein gene, TgVIT-A1: tulip bluening gene, TgFER1: tulip ferritin gene, TgFER1-RNAi: tulip ferritin suppressor gene, PNOS: nopaline synthase gene promoter, TNOS: Nopaline synthase gene terminator, P35S: cauliflower mosaic virus 35S promoter. FIG. 8 shows the result of gene introduction into purple petal cells by introduction of each gene introduction vector shown in FIG. Transduced cells are indicated by arrows (left photo). The introduced cell emits fluorescence by GFP (right photo). pBI-BCF is a vector for introducing a bluening gene, pBI-anti-BCF is a vector for introducing an antisense gene of a bluening gene), pBI-FER is a vector for introducing a ferritin gene, and pBI-FER-RNAi is ferritin. The suppressor gene introduction vector, and pBI-BCF-FER-RNAi represent a bluening gene and a ferritin suppressor gene introduction vector, respectively. FIG. 9 shows the sequence of a ferritin-suppressing gene. This sequence contains the 292-547 bp portion (upper case) of ferritin cDNA, and an intron derived from Arabidopsis thaliana WRKY33 gene and the sequence of the vector (lower case portion) are sandwiched (SEQ ID NO: 14). FIG. 10 shows callus cell growth and GFP fluorescence at day 2, 2 and 3 after introduction of the blue gene transfer vector pBI-BCF. FIG. 11 shows the expression of MYB gene and ANS gene in various tissues. As a control, the GAPDH gene constitutively expressed in cells was used. FIG. 12 shows the base sequence (SEQ ID NO: 15) of the MYB gene promoter which is a petal-specific promoter. FIG. 13 shows the base sequence (SEQ ID NO: 16) of the ANS gene promoter which is a petal-specific promoter. FIG. 14 shows a bluening gene introduction vector prepared by linking a MYB gene promoter or ANS gene promoter and a bluening gene (VIT gene). In the purple cells into which the bluening gene was introduced, a change in cell color from purple to blue was observed. FIG. 15 shows confirmation of the promoter activity of the petal specific promoter. FIG. 16 shows the state of callus redifferentiation after introduction of a vector (pBT-1 or pBT-11) linking a petal-specific promoter and a bluening gene (VIT gene). GFP fluorescence can be confirmed in the shoot or a part thereof (round frame) into which the gene has been introduced.

  There are no blue flowers in tulips, but there are varieties with blue flowers. The variety “purple crystal” has a purple petal as a whole and a blue color at the bottom of the flower. As a result of dye analysis, both anthocyanin dyes are the same dye (delphinidin 3-O-rutinoside) having delphinidin as a mother nucleus (FIG. 1).

  In the present invention, as a result of comprehensive comparison of the analysis of the genes expressed in the upper petal and flower bottom of the tulip “purple crystal”, the presence of the gene specifically expressed in the flower bottom was confirmed. Was named the bluening gene (SEQ ID NO: 1) (FIG. 2). Although this gene is highly homologous to a known vacuolar iron ion transporter gene, it can be said to be a new gene having a function of being expressed in petal cells and capable of modifying flower color.

  Furthermore, the present inventors focused on the ferritin protein known as an iron ion storage protein in animals and plants, and isolated the ferritin gene (SEQ ID NO: 3) from the upper part of the same tulip petal (FIG. 3). When the expression in the petal upper part and the flower bottom part of these genes was compared at each stage of flower development, the bluening gene was strongly expressed in the epidermis cells in the flower bottom part in stages 1 to 3, but not expressed in the upper petal, and the ferritin gene was It was found that it was strongly expressed in the upper petal epidermis cells of stage 4 but not in the flower bottom (FIG. 4).

  That is, it was clarified that the bluening gene and the ferritin gene showed completely opposite expression patterns in the petal purple cells and the flower bottom blue cells. Such a fact has never been reported in other plants so far and is a new discovery. Although not intended to be bound by theory, these facts indicate that blue cells express blue genes and suppress ferritin genes in blue cells, so that intracellular iron ions are transported into the vacuole, where delphinidin In order to bind to the dye and form a complex, it turns blue.On the other hand, in purple cells, the ferritin gene is expressed and the expression of the bluening gene is suppressed, so that intracellular iron ions are transported to the plastid where ferritin is present. It could be logically assumed that the delphinidin pigment was purple because it was not transported into the vacuole vacuole. In addition, when the expression of each gene was examined in other tissues, the bluening gene was most strongly expressed in the flower bottom epidermis cells. The ferritin gene was also most strongly expressed in the petal upper epidermis tissues expressed in petal soft tissues and stems (FIG. 5). These facts strongly suggest that these genes are closely related to flower color expression.

  Furthermore, in order to strengthen the above reasoning, when comparing the varieties other than purple crystal with varieties with blue flower bottom and non-blue varieties, all varieties with blue flower bottom showed similar results to purple crystal. It was strongly suggested here that blue expression in the flower bottom part is associated with expression of bluening gene and suppression of ferritin gene expression (FIG. 6).

  Therefore, a vector for gene introduction was constructed to actually introduce the bluening gene into the purple cells above the petals (FIG. 7). Here, a bluening gene expression vector (pBI-BCF), a bluening gene antisense vector (pBI-antiBCF), a ferritin expression vector (pBI-FER), a ferritin gene suppression vector (pBI-FER-RNAi) Then, a vector for bluening gene expression and ferritin gene suppression (pBI-BCF-FER-RNAi) was prepared. When these vectors were introduced into the purple cells above the petals, it was confirmed that the purple cells changed to blue by introduction of the bluening gene (FIG. 8). Furthermore, in order to suppress the expression of the ferritin gene expressed in purple cells, when an artificially constructed ferritin-suppressing gene using RNA interference technology is simultaneously introduced (pBI-BCF-FER-RNAi), an actual flower It was demonstrated that it can be modified to a deep blue color close to the blue color at the bottom (FIG. 8).

  The invention will now be described by way of example, with reference to the accompanying drawings, where appropriate. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

  The embodiments provided below are provided for a better understanding of the present invention, and the scope of the present invention should not be limited to the following description. It will be apparent to those skilled in the art that modifications can be made as appropriate within the scope of the present invention in consideration of the description in the present specification.

  As used herein, “plant” is a generic term for organisms belonging to the plant kingdom, characterized by chloroplasts, hard cell walls, the presence of abundant permanent embryonic tissue, and organisms that are not capable of motility. It is done. Plant types are broadly classified in, for example, “Primary Color Makino Botanical Encyclopedia” (Kitatakakan (1982)), and all types of plants described therein can be used in the present invention. Typically, a plant refers to a flowering plant having cell wall formation and anabolism by chloroplasts. “Plant” includes both monocotyledonous and dicotyledonous plants. Monocotyledonous plants include lily family plants. Preferred monocotyledonous plants include tulips, lilies, corn, wheat, rice, oats, barley, sorghum, rye and millet, and more preferably, but not limited to tulips. Examples of dicotyledonous plants include cruciferous plants, legumes, eggplants, cucurbits and convolvulaceae, but are not limited thereto. Brassicaceae plants include but are not limited to Chinese cabbage, rapeseed, cabbage and cauliflower. Unless otherwise indicated, a plant means any plant, plant organ, plant tissue, plant cell, and seed. Examples of plant organs include roots, leaves, stems and flowers. In certain embodiments, a plant can mean a plant. A particularly preferred plant in the present invention is a tulip, and among them, a variety that produces a delphinidin pigment and expresses a large amount of ferritin (for example, purple crystal, purple of dreams, Prince Charles, Negrita, Cote d'Azur, Neptune, Blue Jim, Purple Palace World, Purple World, Purple Flag, Louvre, Blue Purple, Amethyst, Calavera, Purple Marvel, Pandion, French Hals, Atella, Prince Charles, Purple Hat, and Reliance are preferred).

  In another embodiment, examples of plant species that can be used in the present invention include: liliaceae, solanaceae, gramineae, brassicaceae, rosaceae, legumes, cucurbitaceae, perilla, rhesobiaceae, sericaceae, convolvulaceae Plants such as family and asteraceae are listed. Furthermore, examples of plant species that can be used in the present invention include any tree species, any fruit tree species, mulberry plants (eg, rubber), and mallow (eg, cotton).

  Examples of the liliaceae plants include plants belonging to lily, omoto, baimo, and katsura, and include, for example, tulips and enamel. Particularly preferred plants in the present invention are tulips, among which purple crystal, purple of dreams, Prince Charles, Negrita, Cote d'Azur, Neptune, Blue Gym, Purple Palace, Purple World, Purple Flag, Louvre, Blue Purple, Amethyst, Carabela, Purple Marvel, Pandion, French Hals, Atella, Prince Charles, Purple Hat, and Reliance are preferred (but not limited to).

  As used herein, “plant cell” refers to any cell derived from the above plant and having regenerative ability. Examples of plant cells include callus and suspension culture cells.

  As used herein, “regenerative ability” refers to the ability to regenerate an original individual or organ from a part (eg, a cell) of the individual or organ. In the present invention, “cells having regenerative ability” include, but are not limited to, callus or somatic embryo.

  As used herein, the term “cell” refers to any undifferentiated and young cell derived from any plant or animal and capable of self-renewal and differentiation, including callus. .

  The methods of the present invention include plant cells (including callus and suspension culture cells) or plant tissues (including dormant tissues (including ripe seeds, immature seeds, winter buds, and tubers), germplasm, growth points, and flower buds). On the other hand, it is carried out by performing transformation by a gene transfer method such as particle gun, Agrobacterium, electroporation or the like. The method of the present invention is preferably performed on plants.

As used herein, the term “iron ion transport activity” refers to the activity of transporting iron ions to the vacuole in plants (particularly tulips). The iron ion transport activity is measured, for example, by using a cut flower to absorb an aqueous solution containing the radioactive isotope ⁵⁹ Fe of iron, and measuring ⁵⁹ Fe uptake in the vacuole as an index. Alternatively, the iron ion transport activity can be measured using resistance acquired by the transgene as an index. When an iron-sensitive mutant strain is cultured in a medium containing iron in yeast culture, the mutant strain cannot be transported into the vacuole, and is therefore lethal due to iron toxicity. However, recombinant yeast introduced with a gene encoding a protein having iron ion transport activity has iron transport activity into the vacuole, and thus iron is accumulated in the vacuole and detoxified, thus exhibiting iron resistance. In the present invention, a typical protein having iron ion transport activity is a bluening gene, which has the amino acid sequence set forth in SEQ ID NO: 2 and is encoded by the nucleic acid set forth in SEQ ID NO: 1.

As used herein, the term “iron ion storage activity” refers to the activity of storing iron ions in proteins in plants (particularly tulips). The iron ion storage activity can be measured, for example, as follows. A recombinant protein is produced by expressing a gene of a protein expected to store iron in E. coli. At this time, it keeps adding known concentrations of synthetic stable isotope ^{57 Fe} iron in the medium. After purification of the produced recombinant protein, the ratio of ⁵⁶ Fe and isotope ⁵⁷ Fe that are most abundant in nature is determined by isotope dilution-mass spectrometry. Since the amount of added ⁵⁷ Fe is known, the amount of ⁵⁶ Fe is determined therefrom. If there is iron ion storage activity, iron ions can be detected in the purified protein. Alternatively, the iron concentration can also be measured by primitive absorption method or ICP method. In the present invention, a typical protein having iron ion storage activity is ferritin, which has the amino acid sequence set forth in SEQ ID NO: 4 and is encoded by the nucleic acid set forth in SEQ ID NO: 3. As used herein, “storage” of iron ions in a protein refers to the incorporation of iron ions into the internal cavities.

  “Ferritin” is one of complex proteins containing iron. Ferritin is a water-soluble protein and exists widely in living organisms from animals, plants to bacteria. Ferritin is a spherical shell protein with a diameter of about 13 nm and has a 7 nm cavity inside. Metal ions can be incorporated into the internal cavity to form an oxide core. In the living body, iron can be taken into the cavity in the form of oxides, and it plays a role in detoxifying iron in the body and controlling the iron concentration. The size of the core is limited to the size of the inner wall and is 7 nm at the maximum. This corresponds to 4500 iron atoms. It has been reported that manganese, cobalt, nickel, chromium, indium and the like as metals other than iron are incorporated into ferritin to form a core.

  As used herein, “blue plant” refers to at least a portion of the plant (including but not limited to petals, stems, leaves, etc. of the plant). It refers to any plant that has turned blue, and is not necessarily limited to a plant that is entirely blue. The blue site in the “blue plant body” is preferably a petal. The plant body in the “blue plant body” is preferably a tulip.

  As used herein, “plant cell for producing a blue plant body” means that when a plant body is regenerated from the plant cell, at least a part of the regenerated plant body is blue. It refers to plant cells that are present. In some embodiments, the entire plant cell is blue. In some embodiments, only some of the plant cells are blue. In some embodiments, the plant cell itself is not blue.

In the present invention, the color in the plant body is generally determined using the color value according to the CIEL * a * b * color system, which expresses the color as a numerical value, as an index. The color value according to the CIEL * a * b * color system is represented by the CIEL * a * b * value of an image obtained with a stereomicroscope under white light illumination. In the CIE L * a * b * color system, colors are represented in three dimensions, L axis, a axis, and b axis. Lightness is represented from 0 (black) to 100 (white) on the L-axis, red on the a-axis, negative on green, yellow on the b-axis, and blue on negative. In CIE L * a * b *, red, green, yellow, and blue are converted into numerical values, a color is expressed by a combination thereof, and an element of brightness is added. It can be said that the expression of color by CIE L * a * b * exists almost infinitely. In addition, the colors are continuously connected. For example, even a change from red to purple, blue, and green cannot be clearly distinguished, and an intermediate color always exists. In the present invention, for the sake of convenience, a range of purple, blue, and dark blue is specified as follows, but it is apparent that there are colors that do not fall within this range.
Purple 20 ≦ L * ≦ 80, 40 ≦ a * ≦ 90, −50 <b * ≦ −10
Blue 20 ≦ L * ≦ 80, −8 ≦ a * ≦ 90, −107 ≦ b * ≦ −50
Dark blue 5 ≦ L * <20, −8 ≦ a * ≦ 90, −107 ≦ b * ≦ −50.

  As used herein, the terms “transformation”, “transduction” and “transfection” are used interchangeably unless otherwise stated and refer to the introduction of a nucleic acid into a host cell. In the present invention, transformation by a gene transfer method such as particle gun, Agrobacterium, electroporation or the like is used.

  “Transformant” refers to all or part of a living organism such as a cell produced by transformation. Examples of the transformant include prokaryotic cells, yeast, plant cells, plant bodies, animal cells, insect cells and the like. A transformant is also referred to as a transformed cell, transformed tissue, transformed host, etc., depending on the subject, and encompasses all of these forms herein, but may refer to a particular form in a particular context. . In the present specification, typically, transformants are plant cells or plants.

  In this specification, “regenerate” means a phenomenon in which an entire individual is restored from a part of the individual. For example, by regeneration, a plant body is formed from cells such as callus and protoplasts and tissue pieces such as leaves or roots.

A method for regenerating a transformant (for example, a transformed plant cell) into a plant is well known in the art. Such methods include Rogers et al. , Methods in Enzymology 118: 627-640 (1986); Tabata et al. , Plant Cell Physiol. , 28: 73-82 (1987); Shaw, Plant Molecular Biology: A practical approach. IRL press (1988); Shimamoto et al. , Nature 338: 274 (1989); Malliga et
al. , Methods in Plant Molecular Biology: A laboratory course. Cold Spring Harbor Laboratory Press (1995); Hiei et al. , Plant
Mol Biol 35: 205 (1997); Toki et al. , Plant
J 47: 969 (2006). Therefore, a person skilled in the art can regenerate a transformant (for example, a transformed plant cell) by appropriately using a method well-known in the art according to the transgenic plant aimed at. For example, the tulip is sliced from bulb flakes to a thickness of 2 to 3 mm, and this is obtained with Murashige-Skoog medium (sucrose 20 g / L, 2,4-D 2 mg / L, BA 0.2 mg / L). Callus was induced at 20 ° C., the gene of interest was introduced into this, and shoots were made in Murashige-Skoog medium (sucrose 20 g / L, 2,4-D 0.2 mg / L) at 20 ° C. under light irradiation. Can be regenerated by inducing.

  Cells and tissues that have been transfected / transformed by the methods of the present invention can be differentiated, grown and / or expanded by any method known in the art. In the case of plant species, the process of differentiating, growing and / or proliferating cells or tissues can be achieved, for example, by cultivating the plant cells or plant tissues or plants containing them. In the present specification, plant cultivation can be performed by any method known in the art. See, for example, supervised by Isao Shimamoto and Kiyoshi Okada, “Experimental Protocol for Model Plants—Edited by Rice and Arabidopsis thaliana”: Cell Engineering, Separate Volume, Plant Cell Engineering Series 4; 28-32, and Niwa Yasuo, Arabidopsis cultivation method, pp. 33-40 and can be easily implemented by those skilled in the art and need not be described in detail herein. For example, Arabidopsis can be cultivated by soil cultivation, rock wool cultivation, or hydroponics. When cultivated under a white fluorescent lamp (about 6000 lux) under constant light conditions, the first flower will bloom about 4 weeks after sowing, and the seed will ripen about 16 days after flowering. About 40 to 50 seeds can be obtained with one pod, and about 10,000 seeds can be obtained in 2 to 3 months after sowing. In addition, for example, in the cultivation of wheat, it is well known that it does not head and bloom unless it is exposed to low-temperature short-day conditions for a certain period after sowing. Therefore, for example, when cultivating wheat in an artificial environment (for example, a greenhouse or a gross chamber), the wheat seedlings are treated at a low temperature and short day (for example, 20 ° C., light period 8 hours (about 2000 lux) in the early stage of growth. ) And 8 ° C. treatment in the dark period of 16 hours). This process is called vernalization. The cultivation conditions required for each plant species are generally well known in the art, and therefore need not be described in detail herein. For example, tulips are grown at 20 ° C. in a cycle of 12 hours light and 12 hours dark.

  As used herein, the terms “protein”, “polypeptide”, “oligopeptide” and “peptide” are used interchangeably herein and refer to a polymer of amino acids of any length.

  As used herein, the terms “polynucleotide”, “oligonucleotide”, and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as those explicitly indicated. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-). 98 (1994)).

  In the present specification, “gene” refers to a sequence of a certain length of nucleic acid present in a cell, which is a factor that defines a genetic trait. In the present invention, the gene may or may not define a genetic trait. In the present specification, a gene refers to a gene that is usually present in the genome, but is not limited thereto, and it is understood to include an extrachromosomal sequence, a mitochondrial sequence, and the like. Many genes are usually arranged in a certain order on the chromosome. Those that define the primary structure of a protein are called structural genes, and those that influence the expression are called regulatory genes (for example, promoters). As used herein, “gene” may refer to “polynucleotide”, “oligonucleotide” and “nucleic acid” and / or “protein” “polypeptide”, “oligopeptide” and “peptide”. In the present specification, the “open reading frame” or “ORF” of a gene is one of three frameworks when the base sequence of the gene is divided into 3 bases, having a start codon, and halfway A reading frame that has a certain length without a stop codon and may actually encode a protein. In the present specification, genes include structural genes and regulatory genes unless otherwise specified. Thus, for example, a DNA polymerase gene usually includes both a structural gene for DNA polymerase and a transcriptional and / or translational regulatory sequence such as a promoter for DNA polymerase. In the present invention, it is understood that regulatory sequences such as transcription and / or translation as well as structural genes are also useful as the gene to which the present invention is directed. As used herein, “gene” refers to “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” and / or “protein”, “polypeptide”, “oligopeptide” and “peptide”. Sometimes. Also herein, “gene product” refers to “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” and / or “protein” “polypeptide”, “oligopeptide” expressed by a gene. And “peptide”. A person skilled in the art can understand what a gene product is, depending on the situation.

  As used herein, “homology” of genes (eg, nucleic acid sequences, amino acid sequences, etc.) refers to the degree of identity of two or more gene sequences with each other. In this specification, the identity of sequences (nucleic acid sequences, amino acid sequences, etc.) refers to the degree of two or more comparable sequences that are identical to each other (individual nucleic acids, amino acids, etc.). Therefore, the higher the homology between two genes, the higher the sequence identity or similarity. Whether two genes have homology can be determined by direct comparison of the sequences or, in the case of nucleic acids, hybridization methods under stringent conditions. When directly comparing two gene sequences, the DNA sequence between the gene sequences is typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% , 95%, 96%, 97%, 98% or 99% are identical, the genes are homologous. In the present specification, “similarity” of genes (eg, nucleic acid sequence, amino acid sequence, etc.) refers to two or more gene sequences when the conservative substitution is regarded as positive (identical) in the above homology. The degree of identity with each other. Thus, when there is a conservative substitution, homology and similarity differ depending on the presence of the conservative substitution. When there is no conservative substitution, homology and similarity indicate the same numerical value.

  In this specification, the comparison of similarity, identity and homology between amino acid sequences and base sequences is calculated using FASTA, which is a sequence analysis tool, and using default parameters.

  As used herein, “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, Examples include 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg, 11 etc.) are also suitable as lower limits. obtain. In the case of polynucleotides, examples include 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 and more nucleotides. Non-integer lengths (eg, 11 etc.) may also be appropriate as a lower limit. In the present specification, the lengths of polypeptides and polynucleotides can be represented by the number of amino acids or nucleic acids, respectively, as described above, but the above numbers are not absolute, and the upper limit is not limited as long as they have the same function. Alternatively, the above-mentioned number as the lower limit is intended to include the upper and lower numbers (or, for example, up and down 10%) of the number. In order to express such intention, in this specification, “about” may be added before the number. However, it should be understood herein that the presence or absence of “about” does not affect the interpretation of the value. The length of a fragment useful herein can be determined by whether or not at least one of the functions of a full-length protein that serves as a reference for the fragment is retained.

  As used herein, “homology” of genes refers to the degree of identity of two or more gene sequences with respect to each other. Therefore, the higher the homology between two genes, the higher the sequence identity or similarity. Whether two genes have homology can be determined by direct comparison of the sequences or, in the case of nucleic acids, hybridization methods under stringent conditions. When directly comparing two gene sequences, the DNA sequence between the gene sequences is typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% , 95%, 96%, 97%, 98% or 99% are identical, the genes are homologous.

As used herein, “stringent hybridization conditions” refers to well-known conditions commonly used in the art. Such a polynucleotide can be obtained by using colony hybridization method, plaque hybridization method, Southern blot hybridization method or the like using a polynucleotide selected from among the polynucleotides of the present invention as a probe. Specifically, polynucleotides that hybridize under stringent conditions are hybridized at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which colony or plaque-derived DNA is immobilized. After the test, a 0.1- to 2-fold concentrated SSC (saline-sodium citrate) solution (the composition of the 1-fold concentrated SSC solution was 150 mM sodium chloride, 15 mM
A polynucleotide that can be identified by washing the filter under 65 ° C conditions. Hybridization was performed in Molecular Cloning 2nd ed. , Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford Universe. Here, the sequence containing only the A sequence or only the T sequence is preferably excluded from the sequences that hybridize under stringent conditions. The “hybridizable polynucleotide” refers to a polynucleotide that can hybridize to another polynucleotide under the above hybridization conditions. Specifically, the hybridizable polynucleotide is a polynucleotide having at least 60% homology with the base sequence of DNA encoding a polypeptide having the amino acid sequence specifically shown in the present invention, preferably 80% The polynucleotide which has the above homology, More preferably, the polynucleotide which has 95% or more of homology can be mentioned.

  In this specification, comparison of base sequence identity and calculation of homology are calculated using BLAST, which is a sequence analysis tool, using default parameters. The identity search can be performed using, for example, NCBI BLAST 2.2.9 (issued 2004.5.12). In the present specification, the identity value usually refers to a value when the BLAST is used and aligned under default conditions. However, if a higher value is obtained by changing the parameter, the highest value is the identity value. When identity is evaluated in a plurality of areas, the highest value among them is set as the identity value.

  In the present specification, “search” refers to finding another nucleobase sequence having a specific function and / or property using a nucleobase sequence electronically or biologically or by other methods. Say. As an electronic search, BLAST (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85: 2444-). 2448 (1988)), the Smith and Waterman method (Smith and Waterman, J. Mol. Biol. 147: 195-197 (1981)), and the Needleman and Wunsch method (Needleman and Wunsch, J. Mol. Biol. 48:44:44). -453 (1970)) and the like. Biological searches include stringent hybridization, macroarrays with genomic DNA affixed to nylon membranes, microarrays affixed to glass plates (microarray assays), PCR and in situ hybridization, etc. It is not limited to. In the present specification, it is intended that the promoter used in the present invention should include a corresponding sequence identified by such an electronic search or biological search.

  In the present specification, “expression” of a gene, polynucleotide, polypeptide or the like means that the gene or the like undergoes a certain action in vivo to take another form. Preferably, a gene, polynucleotide or the like is transcribed and translated into a polypeptide form. However, transcription and production of mRNA can also be an aspect of expression. More preferably, such polypeptide forms may be post-translationally processed.

  Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by the generally accepted single letter code.

The character codes are as follows.
3 letter code of amino acid 1 letter code Meaning Ala A alanine Cys C cysteine Asp D aspartic acid Glu E glutamic acid Phe F phenylalanine Gly G glycine His H histidine Ile I isoleucine Lys K lysine Leu L leucine Met M methionine Asl G Glutamine Arg R Arginine Ser S Serine Thr T Threonine Val V Valine Trp W Tryptophan Tyr Y Tyrosine Asx Asparagine or Aspartate Glx Glutamine or Glutamate Xaa Unknown or other amino acids.

Base symbol Meaning
a adenine g guanine c cytosine t thymine u uracil r guanine or adenine purine y thymine / uracil or cytosine pyrimidine m adenine or cytosine amino group k guanine or thymine / uracil keto group s guanine or cytosine w adenine or thymine / uracil b guanine or cytosine Thymine / uracil d adenine or guanine or thymine / uracil h adenine or cytosine or thymine / uracil v adenine or guanine or cytosine n adenine or guanine or cytosine or thymine / uracil, unknown or other base.

  As used herein, “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg, 11 etc.) are also suitable as lower limits obtain. In the case of polynucleotides, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 200, 300, 400, 500, 600, 600, 700, 800 , 900, 1000 and more nucleotides, and lengths expressed in integers not specifically listed here (eg, 11 etc.) may also be appropriate as lower limits.

  As long as the polypeptide used in the present invention has substantially the same action as the naturally occurring polypeptide, one or more (for example, one or several) amino acids in the amino acid sequence are substituted, added and / or missing. It may be lost, and the sugar chain may be substituted, added and / or deleted.

  It is well known in the art that one amino acid can be replaced by another amino acid having a similar hydrophobicity index and still result in a protein having a similar biological function (eg, an equivalent protein in enzymatic activity). It is. In such amino acid substitution, the hydrophobicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5. It is understood in the art that such amino acid substitutions based on hydrophobicity are efficient. The hydrophilicity index is also considered in the production of variants. As described in US Pat. No. 4,554,101, the following hydrophilicity indices have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3. 0 ± 1); glutamic acid (+ 3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline ( Alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−0.5 ± 1); -1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). It is understood that an amino acid can be substituted with another that has a similar hydrophilicity index and can still provide a biological equivalent. In such amino acid substitution, the hydrophilicity index is preferably within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

  In the present invention, “conservative substitution” refers to a substitution in which the hydrophilicity index and / or the hydrophobicity index of the amino acid to be replaced with the original amino acid is similar as described above. Examples of conservative substitutions are well known to those skilled in the art and include, for example, substitutions within the following groups: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine; However, it is not limited to these.

  In the present specification, the “variant” refers to a substance in which a part of the original substance such as a polypeptide or polynucleotide is changed. Such variants include substitutional variants, addition variants, deletion variants, truncated variants, allelic variants, and the like. An allele refers to genetic variants that belong to the same locus and are distinguished from each other. Therefore, an “allelic variant” refers to a variant having an allelic relationship with a certain gene. “Species homologue or homolog” means homology (preferably at least 60% homology, more preferably at least 80%, at a certain amino acid level or nucleotide level within a certain species. 85% or higher, 90% or higher, 95% or higher homology). The method for obtaining such species homologues will be apparent from the description herein. “Ortholog” is also called an orthologous gene, which is a gene derived from speciation from a common ancestor with two genes. For example, taking the hemoglobin gene family with multiple gene structures as an example, the human and mouse alpha hemoglobin genes are orthologs, but the human alpha and beta hemoglobin genes are paralogs (genes generated by gene duplication). . Since orthologs are useful for the estimation of molecular phylogenetic trees, the orthologs of the present invention may also be useful in the present invention.

  As used herein, “functional variant” refers to a variant that retains the biological activity of a reference sequence.

  As used herein, “conservative (modified) variants” applies to both amino acid and nucleic acid sequences. Conservatively modified variants with respect to a particular nucleic acid sequence refer to nucleic acids that encode the same or essentially the same amino acid sequence, and are essentially identical if the nucleic acid does not encode an amino acid sequence. An array. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are “silent modifications (mutations)” which are one species of conservatively modified mutations. In nucleic acids, conservative substitutions can be confirmed, for example, while measuring promoter activity.

  As used herein, in addition to amino acid substitutions, amino acid additions, deletions, or modifications can also be made to produce genes encoding functionally equivalent polypeptides. Amino acid substitution means that the original peptide is substituted with one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids. The addition of amino acids means that one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids are added to the original peptide chain. Deletion of amino acids means deletion of one or more, for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3 amino acids from the original peptide. Amino acid modifications include, but are not limited to, amidation, carboxylation, sulfation, halogenation, alkylation, glycosylation, phosphorylation, hydroxylation, acylation (eg, acetylation), and the like. The amino acid to be substituted or added may be a natural amino acid, a non-natural amino acid, or an amino acid analog. Natural amino acids are preferred.

  As used herein, a nucleic acid form of a polypeptide to be expressed refers to a nucleic acid molecule that can express the protein form of the polypeptide. As long as the expressed polypeptide has substantially the same activity as the naturally occurring polypeptide, a part of the nucleic acid sequence is deleted or replaced by another base as described above. Alternatively, other nucleic acid sequences may be partially inserted. Alternatively, another nucleic acid may be bound to the 5 'end and / or the 3' end. Alternatively, it may be a nucleic acid molecule that hybridizes under stringent conditions with a gene encoding a polypeptide and encodes a polypeptide having substantially the same function as the polypeptide. Such genes are known in the art and can be used in the present invention.

  Such a nucleic acid can be obtained by a well-known PCR method, and can also be chemically synthesized. These methods may be combined with, for example, a site-directed mutagenesis method or a hybridization method.

  As used herein, “substitution, addition or deletion” of a polypeptide or polynucleotide is a substitution of an amino acid or a substitute thereof, or a nucleotide or a substitute thereof, respectively, with respect to the original polypeptide or polynucleotide. , Adding or removing. Such substitution, addition, or deletion techniques are well known in the art, and examples of such techniques include site-directed mutagenesis techniques. The number of substitutions, additions or deletions may be any number as long as it is one or more, and the number is increased as long as the intended function is retained in the variant having the substitution, addition or deletion. be able to. For example, such a number can be one or several, and preferably can be within 20%, within 10%, or less than 100, less than 50, less than 25, etc. of the total length.

  In the present specification, when referring to a gene, a “vector” refers to one that can transfer a target polynucleotide sequence into a target cell. Such vectors can be autonomously replicated in host cells such as prokaryotic cells, yeast, plant cells, animal cells, insect cells, plant individuals and animal individuals, or can be integrated into the chromosome, Examples include those containing a promoter at a position suitable for transcription of the polynucleotide of the present invention. In the present specification, for example, a BAC vector can be used. A BAC vector is a plasmid prepared based on the F plasmid of Escherichia coli, and is a vector that can stably hold and proliferate DNA fragments of a large size of about 300 kb or more in bacteria such as Escherichia coli. is there. The BAC vector contains at least a region essential for replication of the BAC vector. Examples of the region essential for the replication include oriS, which is the replication origin of F plasmid, or a variant thereof.

  As used herein, the term “promoter” (or promoter sequence) refers to a region on DNA that determines the transcription start site of a gene and directly regulates its frequency. Usually, RNA polymerase binds to transcription. This is the base sequence to start. Therefore, in this specification, a part having a promoter function of a gene is referred to as a “promoter part”. The promoter region can be estimated by predicting the protein coding region in the genomic base sequence using DNA analysis software. The putative promoter region varies for each structural gene, but is usually upstream of the structural gene, but is not limited thereto, and may be downstream of the structural gene.

In the present invention, the promoter may be a petal specific promoter. Examples of petal-specific promoters include anthocyanidin synthase gene promoter and Myb transcription factor gene promoter. The Myb transcription factor gene (MYB gene) promoter has the base sequence of SEQ ID NO: 15, and the anthocyanidin synthase gene (ANS gene) promoter has the base sequence of SEQ ID NO: 16. As other petal-specific gene promoters, flower color-related genes are considered, and the following gene promoters are considered as promoters other than MYB and ANS. These are all related to biosynthesis of anthocyanins and flavonols.
AS (aureusidin synthase) gene ANR (anthocyanidin reductase) gene CHI (chalcone isomerase) gene CHS (chalcone synthase) gene DFR (dihydroflavonol 4-reductase) gene F3H (flavanone 3-hydroxylase) gene F3 'H (flavonoid 3'-hydroxylase) gene F3'5'H (flavonoid 3', 5'-hydroxylase) gene FLS (flavonol synthase) gene FNS (flavone synthase) gene GST (glutathione S-transfer) Enzyme) gene UF3GT (UDP-glucose 3-O-glycosyltransferase) gene.

  In the present specification, an “enhancer” can be used to increase the expression efficiency of a target gene. A plurality of enhancers may be used, but one may be used or may not be used. A region in the promoter that enhances promoter activity may also be called an enhancer.

  As used herein, “operably linked” means the control of a transcriptional translational regulatory sequence (eg, promoter, enhancer, etc.) or translational regulatory sequence that has the expression (operation) of the desired sequence. It is arranged below. In order for a promoter to be operably linked to a gene, the promoter is usually placed immediately upstream of the gene, but need not necessarily be adjacent.

As used herein, an “expression vector” refers to a nucleic acid sequence in which various regulatory elements are operably linked in a host cell in addition to a structural gene and a promoter that regulates its expression. The regulatory element can preferably include a terminator, a selectable marker such as a drug resistance gene (eg, kanamycin resistance gene, hygromycin resistance gene, etc.) and an enhancer. It is well known to those skilled in the art that the type of organism (eg, plant) expression vector and the type of regulatory element used can vary depending on the host cell. “Refers to a vector capable of transferring a polynucleotide sequence of interest to a target cell. Such vectors can be autonomously replicated in host cells such as prokaryotic cells, yeast, plant cells, animal cells, insect cells, plant individuals and animal individuals, or can be integrated into chromosomes. Examples include those containing a promoter at a position suitable for nucleotide transcription.

  As used herein, the term “upstream” refers to a position from a particular reference point toward the 5 ′ end of a polynucleotide.

  As used herein, the term “downstream” refers to a position from a particular reference point toward the 3 ′ end of a polynucleotide.

  In the present specification, the “expression level” refers to an amount at which a polypeptide or mRNA is expressed in a target cell or the like. Such expression level is evaluated by any appropriate method including immunoassay methods such as ELISA method, RIA method, fluorescent antibody method, Western blot method, and immunohistochemical staining method using the antibody of the present invention. The amount of expression of the polypeptide of the present invention at the protein level, or mRNA of the polypeptide of the present invention evaluated by any suitable method including molecular biological measurement methods such as Northern blotting, dot blotting, and PCR The expression level at the level is mentioned. “Change in expression level” means an increase in the expression level at the protein level or mRNA level of the polypeptide of the present invention evaluated by any appropriate method including the above immunological measurement method or molecular biological measurement method. Or it means to decrease.

  As used herein, “selection marker” refers to a gene that functions as an index for selecting a host cell containing a target nucleic acid construct or vector. Selection markers include, but are not limited to, fluorescent markers, luminescent markers, and drug resistance selection markers. “Fluorescent markers” include genes encoding fluorescent proteins such as green fluorescent protein (GFP), blue fluorescent protein (CFP), yellow fluorescent protein (YFP) and red fluorescent protein (dsRed). It is not limited. “Luminescent markers” include, but are not limited to, genes encoding photoproteins such as luciferase. The “drug resistance selection marker” includes hygromycin resistance gene, kanamycin resistance gene, neomycin resistance gene, hypoxanthine guanine phosphoribosyltransferase (hprt), dihydrofolate reductase gene, glutamine synthetase gene, aspartate transaminase, metallothionein (MT ), Adenosine deaminase (ADA), adenosine deaminase (AMPD1, 2), xanthine-guanine-phosphoribosyltransferase, UMP synthase, P-glycoprotein, asparagine synthetase, ornithine decarboxylase and the like. Examples of herbicide resistance genes include ALS (AHAS) gene and PPO gene. Examples of the “negative selection marker” include diphtheria toxin protein A chain gene (DT-A), Exotoxin A gene, Ricin toxin A gene, codA gene, cytochrome P-450 gene, RNase T1 gene and barnase gene. It is not limited to.

(General biochemistry / molecular biology)
(General technology)
Molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M.M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associate ES and Wiley-Interscience; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M.M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F .; M.M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F .; M.M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, “Experimental Methods for Gene Transfer & Expression Analysis”, Yodosha, 1997, etc., which are related in this specification (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPpress; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R .; L. etal. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T.A. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the present invention is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims.

(General example)
1. Measurement of transport activity of iron ion to vacuole in plant Iron ion transport activity is measured by absorbing an aqueous solution containing the radioactive isotope ⁵⁹ Fe of iron in cut flowers and taking up ⁵⁹ Fe in the vacuole as an index. Alternatively, the iron ion transport activity can be measured using resistance acquired by the transgene as an index. When an iron-sensitive mutant strain is cultured in a medium containing iron in yeast culture, the mutant strain cannot be transported into the vacuole, and thus exhibits lethality due to iron toxicity. However, recombinant yeast introduced with a gene encoding a protein having iron ion transport activity has iron transport activity into the vacuole, and thus iron is accumulated in the vacuole and detoxified.

2. Measurement of Iron Ion Storage Activity in Plants Recombinant protein is produced by expressing a protein gene that is predicted to store iron in E. coli. At this time, it keeps adding known concentrations of synthetic stable isotope ^{57 Fe} iron in the medium. After purification of the produced recombinant protein, the ratio of ⁵⁶ Fe and isotope ⁵⁷ Fe that are most abundant in nature is determined by isotope dilution-mass spectrometry. Since the amount of added ⁵⁷ Fe is known, the amount of ⁵⁶ Fe is determined therefrom. If there is iron ion storage activity, iron ions can be detected in the purified protein. Alternatively, the iron concentration can also be measured by primitive absorption method or ICP method.

(Example 1: Analysis of genes expressed in petals of tulip cultivar "Shizoku")
The buds at the time when the purple crystal petals began to color were cut into petal tops and flower bottoms, and 100 mg of the epidermis inside each petal was peeled off with tweezers and placed in a 1.5 ml microtube and frozen in liquid nitrogen. The frozen tissue was pulverized using a homogenizer pestle, 0.5 ml of Plant RNA Purification Reagent (Invitrogen) was added, and RNA extraction was performed at room temperature for 10 minutes. After extraction, cell debris was precipitated by centrifugation (15,000 rpm, 5 minutes), and the supernatant was purified using RNeasy Plant Mini Kit (Qiagen) according to the manual. Next, 1st cDNA was synthesized from the purified RNA using Fluorescence Differential Display kit rhodamine version (Takara Bio) using nine types of fluorescent downstream primers. Furthermore, PCR reaction (94 ° C., 2 minutes; 40 ° C., 1 minute; 72 ° C., 1 minute) using 24 types of 10-mer primers and 12 types of 10-mer Primer Set (manufactured by Operon) included in the kit; 35 cycles). In this reaction, 324 PCR reactions were performed on the epidermis of the upper and lower petals using 9 types of fluorescent anchor primers and 36 types of upstream primers.

  The obtained PCR product was subjected to electrophoresis (1500 V, 2 hr) on an 8% denaturing polyacryl gel and then read with a fluoro image analyzer FLA-5100 (Fuji Film), and the amplified bands at the top of the petal and the bottom of the flower were compared. As a result, the presence of 6 types of genes expressed only at the flower bottom was confirmed. Therefore, each DNA band was cut out from the gel, put into a 1.5 ml microtube, 50 μl of sterilized water was added, and extraction was performed at 100 ° C. for 10 minutes. Furthermore, PCR reaction was performed again with 1 μl of the extract and the primer combination used for amplification, and the amplified product was subcloned into the E. coli cloning vector pT7-Blue T vector (Takara Bio).

  The DNA sequence of the obtained DNA was determined according to a conventional method. Furthermore, 5'-RACE primers were designed based on the obtained base sequence information, and 5'-side cloning was performed using a 5'-RACE system (Invitrogen). Similarly, the DNA base sequence was determined after subcloning into an E. coli vector.

  As a result of comparison with existing genes in the DNA database based on the obtained DNA base sequence information, protein phosphorylase (kinase) gene, protein gene having DNA binding activity, vacuolar iron ion transporter gene, etc. It was found to have homology with. There were also genes with unknown functions. In particular, the vacuolar iron ion transporter gene was found to have three types of sequences. From these results, it is considered that genes that are directly related to bluish coloration of flower bottoms are genes having homology to vacuolar iron ion transporters, and these genes are positioned as bluening genes, and TgVIT- They were named A1, TgVIT-A2 and TgVIT-B1.

(Example 2: Gene isolation of iron ion storage protein ferritin)
Ferritin is known as a protein having a function of storing iron ions in cells. In plant cells, they are localized in chloroplasts (plastids) and are thought to be involved in the regulation of intracellular iron ion concentration. Since iron ions are essential for the blue coloration at the bottom of tulip, we tried to isolate the ferritin gene of tulip for the purpose of investigating whether ferritin gene is expressed in petal cells.

First, 1st cDNA was synthesized using 5′-RACE system (Invitrogen) based on RNA isolated and purified from tulip petals, and then oligo dC was added to 3 ′ end using TdT and dCTP. Next, Abrided that hybridizes to oligo dC
A primer (5'-CCVASYCKTCKSARYTGRGNCACATAYTC-3 ': SEQ ID NO: 5) for a highly homologous region was synthesized from the DNA sequences of soybean, rapeseed, Arabidopsis thaliana, and wheat, whose gene sequences were already known with Anchor primer, and PCR reaction ( 94 ° C, 1 minute; 60 ° C, 1 minute; 72 ° C, 1 minute; 35 cycles). Here, “R” in the primer sequence means guanine or adenine, “Y” means thymine / uracil or cytosine, “M” means adenine or cytosine, and “K” means guanine. Or thymine / uracil, “S” means guanine or cytosine, “W” means adenine or thymine / uracil, “B” means guanine or cytosine or thymine / uracil, “D” means adenine or guanine or thymine / uracil, “H” means adenine or cytosine or thymine / uracil, and “V” means adenine or guanine or cytosine. As a result, amplification with the expected size (800 bp) was obtained. Furthermore, in order to confirm that this amplification product is a part of the ferritin gene, primers for regions having high homology in the DNA base sequences of soybean, rapeseed, Arabidopsis thaliana and wheat present in the obtained DNA fragment ( 5′-RTBARYGARCARATCAATTGTGGARTWCAA-3 ′: SEQ ID NO: 6) was synthesized, and PCR was performed again. As a result, an amplified fragment could be obtained in the expected size (430 bp), indicating that the first amplified 800 bp DNA was part of the ferritin gene. Furthermore, as a result of the base sequence, it was confirmed to be ferritin. Further, a primer was synthesized based on the base sequence of the obtained DNA fragment (5′-TCCCATCCCTTCCTCTCCACACCCCCG-3 ′: SEQ ID NO: 7), and PCR was performed with the oligoT primer (94 ° C., 30 seconds; 60 ° C., 30 Second; 72 ° C., 1 minute; 35 cycles), and the downstream region of the ferritin gene was cloned and its base sequence was determined. As a result, it was revealed that the tulip ferritin gene encodes a protein having a molecular weight of 27,288 consisting of 1,060 bp and consisting of 248 amino acids (FIG. 3). Like other ferritins, tulip ferritin has a chloroplast (plastid) translocation signal sequence on the N-terminal side, and the mature protein showed homology of 77% with Arabidopsis and 74% with rice. The isolated gene was named TgFER1.

(Example 3: Expression analysis in the petal development process of a bluening gene and an iron ion storage protein ferritin gene)
The expression patterns of the bluening gene and ferritin gene during flower development are related to flower color expression and are considered important. Therefore, using the petals (FIG. 4a) divided into six stages from the bud stage to the senescence stage of the quartz crystal, the upper petal and the bottom of the petal are cut out for each growth stage in the same manner as in Example 1, and from each epidermis and soft tissue. Total RNA was isolated and purified. Next, 1st cDNA was synthesized by SuperScript II (Invitrogen) based on 2 μg of the obtained RNA. Specific primers for TgVIT (F1: 5′-GAGCCTCACGTGTATAATCC-3 ′, R1 (SEQ ID NO: 8): 5′-TGCACTCTCTAGTGCTCTCC-3 ′ (SEQ ID NO: 9)) and TgFER specific primers (F1: 5′-TGCATACTTTGATCGGGACA-3 ', R1 (SEQ ID NO: 10): 5'-TCGGAGGGCATCATGAGATAGAC-3' (SEQ ID NO: 11)) was used for quantitative PCR. GAPDH (glyceraldehydes-3-phosphate dehydrogenase) gene (F1: 5′-CAAGTCCTGACATCCACATTG-3 ′, R1 (SEQ ID NO: 12): 5′-TGCACATAGTAGCATCAAACC-3 ′ (constantly expressed in cells as an internal standard gene SEQ ID NO: 13)) was used to determine the relative quantitative value of gene expression with a relative value where the expression level of TgVIT or TgFER expressed in the upper petal epidermis tissue of flowering stage (stage 4) was 1.

  As a result, it was revealed that the expression of the TgVIT gene is specific to the epidermis tissue at the flower bottom, is high in the wrinkles (stages 1 to 3) before flowering, and is suppressed after stage 4 where coloring begins (Fig. 4a). This phenomenon suggests that iron ions at the flower bottom have accumulated in the vacuole before flowering, confirming the phenomenon that blue expression begins without going purple. In addition, the expression of the TgFER gene is high in the epidermis and soft tissue above the petals and low in the flower bottom. In particular, it gradually increases at stage 4 where coloring begins in the epidermal tissue, and expression is induced in the soft tissue from the budding period (stage 1) to the coloring period (stage 4) (FIG. 4b). From the above results, it is not intended to be bound by theory, but the TgVIT gene is expressed in the flower bottom and the expression of the TgFER gene is suppressed, whereby iron ions accumulate in the vacuole and express blue. The expression of TgVIT gene was suppressed in the upper petal, and the TgFER gene was expressed, so that iron ions were transferred to the plastid and were not accumulated in the vacuole, so that it was assumed that the color was purple. Such a phenomenon has not been known so far and has been revealed for the first time in this experiment.

(Example 4: Tissue-specific expression analysis of bluening gene and ferritin gene)
Elucidating how the bluening gene and ferritin gene are expressed in tissues other than petals is important for investigating the characteristics of these genes and also for inferring the dynamics of iron ions in tissues. is there. Therefore, gene expression levels in leaves, stems, bulbs (ring pieces) and roots were compared. As a result, it was found that the expression of the bluening gene at the flowering stage was highest in the flower bottom epidermis tissue where some expression was observed in other tissues such as leaves and stems, and the specificity was high in the flower bottom (FIG. 5a). ). That is, it can be said that the involvement of such genes was revealed for the first time by examining the characteristics of tulips. Furthermore, the ferritin gene at the same period is strongly expressed in the epidermal tissue, soft tissue and stem of the upper petal (FIG. 5b). This is also a characteristic of tulips, and there has been no example of examining the difference in gene expression between the upper and lower flower petals including other plants, and this is the phenomenon that has been revealed for the first time by the present invention. From the above results, it was suggested that the expression of the bluening gene and ferritin gene was the highest in petal tissue during the flowering period and was greatly related to flower color expression.

(Example 5: Expression in other varieties of bluening gene and ferritin gene)
Examining whether the expression pattern in the petals of the bluening and ferritin genes revealed in purple quartz is characteristic of purple quartz, or a phenomenon common to other varieties, is the invariance of the bluening mechanism. It is important to discuss. So, the blue petals of blue crystal, Snow White, Mirella, purple clouds, Queen of Knight and the non-blue white clouds, Messiapozellan, Huang Komachi, Golden Melody, Golden Empire State, Purple Palace, Neptune's bud (stage 4) The gene expression levels in the flower bottom epidermis tissues were compared by quantitative PCR.

  As a result, the expression of the bluening gene was not expressed in the upper part of the petal in all varieties having a blue flower bottom, but was expressed only in the flower bottom, particularly in the mirala and queen of knights, which was more strongly expressed than purple crystal (FIG. 6b). In the cultivars where the flower bottom was not blue, expression was observed in the flower bottom of Huang Komachi and Golden Empire State, but in other varieties, expression was not observed in the flower bottom. In Yellow Komachi and Golden Empire State, there is accumulation of iron ions in the vacuole due to the expression of the bluening gene, but it is thought that it does not turn blue because no delphinidin pigment is made.

  The expression of ferritin gene is strongly expressed in the epidermis tissue above the petals in all blue cultivars at the bottom of the flower, and is low at the bottom of the flower. In addition, although the golden melody and the golden empire state are strongly expressed in the upper part of the petal in the cultivar whose flower bottom is not blue, the other varieties are expressed in the flower bottom as much as the upper part of the petal (FIG. 6c). In addition, purple palace and Neptune do not have a blue flower bottom even though the petals are purple. This is considered to be because iron ions are not transported to the vacuole because the bluening gene is not expressed at the flower bottom and the ferritin gene is expressed.

  Based on the above results, the blue flower bottom varieties show both blue flowering gene expression and ferritin gene expression suppression. It was shown to be involved. Moreover, it can be said from these results that the bluening gene functions not only for the function of iron ion transport to the vacuole but also for clearly expressing blue.

(Example 6: Construction of vector for gene transfer)
In order to prove that the bluening gene and ferritin gene are involved in petal blueening, we attempted to introduce the gene into purple cells above the petals.

  First, in order to prepare a vector by the Gate way system, for TgVIT-A1 gene, TgFER1 gene or TgVIT-A1 antisense (reverse direction) or RNA interference (RNAi) according to the manual of entry vector pENTR / SD / D (Invitrogen) An entry vector in which a part of the TgFER1 gene was linked to was prepared. The part used for the RNAi construct is the 292-547 bp part of the ferritin cDNA (capital part in FIG. 9), with an Arabidopsis thaliana WRKY33 gene-derived intron and vector sequence (lower case part in FIG. 9) sandwiched in between. (SEQ ID NO: 14) (see FIG. 9).

  Next, the target gene is transferred to the destination vector pBI-OX-GW (GFP) (Inplanta Innovations) using the LR clonase enzyme (Invitrogen), and gene transfer vectors pBI-BCF, pBI-antiBCF, and pBI-FER are prepared. pBI-FER-RNAi was prepared using pBI-sense, antisense-GW (Implanter Innovations), and the AvrII-EcoRI site of pBI-BCF was ligated after terminal blunting to the restriction enzyme PmeI site of pBI-FER-RNAi. PBI-BCF-FER-RNAi was prepared (FIG. 7). Each vector incorporates a GFP (green fluorescent protein) gene that becomes a label during gene introduction.

(Example 7: Gene introduction into purple petal cells)
The gene introduction vector prepared in Example 6 was introduced into the purple cell of the upper petal of the tulip purple crystal by the particle gun method, and the color change was observed.

  Into a 1.5 ml microtube, 0.3 mg (60 mg / ml concentration) of gold particles for particle gun (60 mg / ml concentration) was added, and 5 μg of vector DNA (1 μg / μl concentration) was added and mixed well. Further, 50 μl of 2.5 M calcium chloride solution and 20 μl of 0.1 M spermidine solution were sequentially added and mixed for 3 minutes with a vortex mixer. After leaving it at room temperature for 30 minutes, it was centrifuged at 500 rpm for 3 minutes to precipitate gold particles. After discarding the supernatant, 1 ml of 70% ethanol was added to wash the gold particles. After centrifugation, the ethanol was removed, and further washed with 1 ml of 100% ethanol. After further centrifugation, ethanol was removed, and finally 100 μl of 100% ethanol was added and dispersed in ethanol while thoroughly loosening the gold particles. Furthermore, the gold particles were finely dispersed by ultrasonic treatment. 10 μl of this was placed in the center of the microcarrier disk and air-dried. Next, gene introduction was performed at a pressure of 1350 psi under a 28-inch Hg vacuum using a particle gun device (Bio-Rad PDS-1000 / He system).

  The gene-introduced petal was placed at 20 ° C., and the color of the cell was observed since the cell that emitted green fluorescence by the GFP protein under the blue light excitation of a fluorescent stereomicroscope after 2 days was the cell into which the gene was introduced.

  As a result, it was confirmed that the pBI-BCF-introduced cells expressing the bluening gene were changed from purple to blue, and that the pBI-anti-BCF into which the bluening gene was inserted in the reverse direction did not turn blue. From this, it was shown that the expression of the bluening gene is essential for bluening in the flower bottom (FIG. 8). In addition, since the flower color of pBI-FER-RNAi-introduced cells that suppress ferritin gene expression by RNA interference with pBI-FER expressing ferritin gene remains purple, the ferritin gene has no direct effect on bluening it was thought. However, the pBI-BCF-FER-RNAi-introduced cells that express the bluening gene and suppress the expression of the ferritin gene show a darker blue color than the pBI-BCF-introduced cell. (Fig. 8).

  This reproduces the blue color expression at the flower bottom and can be said to be a result indicating that the inference so far is correct. In other words, blue expression is carried out by the expression of the bluening gene and the suppression of ferritin gene expression at the bottom of the “purple crystal” flower. By reproducing the expression of these genes in the purple cells above the petals, This is the first example showing that the blueness of can be reproduced even with purple cells.

Here, in order to objectively express the modified blue color, a color value according to the CIE L * a * b * color system generally representing a color as a numerical value was obtained. In the method, the color of the cell was expressed as a CIEL * a * b * value by a microspectrophotometer (JASCO Corp. MSV-300 type) by microspectrophotometry. As a result, Table 1
As shown in the figure, a blue numerical value was obtained.

As described above, in the present invention, purple, blue, and dark blue are designated as follows.
Purple 20 ≦ L * ≦ 80, 40 ≦ a * ≦ 90, −50 <b * ≦ −10
Blue 20 ≦ L * ≦ 80, −8 ≦ a * ≦ 90, −107 ≦ b * ≦ −50
Dark blue 5 ≦ L * <20, −8 ≦ a * ≦ 90, −107 ≦ b * ≦ −50
In Table 1, purple cells (L = 37.9, a = 68.8, b = −44.8) are included in the above purple range, and blue cells (L = 22) are introduced by introduction of a bluening gene. .8, a = 60.8, b = −82.8). Furthermore, blue cells (L = 7.1, a = 26.5, b = −59.5) are obtained when the bluening gene and ferritin-suppressing gene are introduced, which is brighter than the cells simply introduced with the bluening gene. It can be seen that the pod red has fallen remarkably and has changed to dark blue.

(Example 8 Introduction of gene introduction vector pBI-BCF into callus)
The bluening gene transfer vector pBI-BCF prepared in Example 6 was introduced into the callus.

(Callus induction)
The outer skin of the tulip bulb was peeled and cut into sizes of about 2 to 4 parts. It was put in a sterilized closed container, and a 10% sodium hypochlorite solution was added to such an extent that the bulb was sufficiently immersed, and ultrasonic waves were applied for 5 to 10 minutes. Thereafter, the bulb was sterilized by allowing to stand for 5 to 10 minutes. After sterilization, the bulbs were rinsed 2-3 times with sterilized water in a clean bench, and bulb flakes were sliced to a thickness of about 2 mm on filter paper and placed on a callus induction medium.

For callus induction, the basic medium was MS (Murashige & Skog) medium. However, the inorganic salts were used at a 1 / 2-fold concentration, and NH ₄ NO ₃ was used at a 1 / 4-fold concentration. The composition and concentration are shown below.
(Inorganic salts) per liter,
NH ₄ NO ₃ 0.41 g
KNO ₃ 0.95g
KH ₂ PO ₄ 85 mg
MnSO ₄ · 4H ₂ O 11.15 mg
ZnSO ₄ · _4H 2 O 4.3mg
CuSO ₄ · _5H 2 O 0.0125mg
NaMoO ₄ · _2H 2 O 0.125mg
CoCl ₂ · 6H ₂ O 0.0125 mg
KI 0.415mg
H ₃ BO ₃ 3.1 mg
CaCl ₂ · 2H ₂ O 220mg
185 mg of MgSO ₄ · 7H ₂ O
FeSO ₄ · _7H 2 O 13.9mg
Na ₂ -EDTA 18.65mg
(Vitamins)
Nicotinic acid 0.5mg
Thiamine hydrochloride 0.1mg
Pyridoxy hydrochloride 0.5mg
Myo-Inositol 100mg
Glycine 2mg
(sugar)
Sucrose 40g
(Plant hormone)
2,4-D (2,4-Dichlorophenoacid Acid) 1mg
BA (6-Benzylazine) 1mg
(Solidifying agent)
Gellan gum 2g
(PH adjustment)
pH 5.8 KOH

  After mixing these components, the mixture was sterilized by autoclaving at 121 ° C. for 20 minutes, and after cooling to about 60 ° C., it was dispensed into a 9 cm sterile petri dish. After placing a slice of flakes on the medium, it was sealed with parafilm and cultured in the dark at 20 ° C.

(Gene transfer)
After callus formation was observed after 1 to 2 months from the above-mentioned powder placement bed, gene introduction into callus cells was attempted by the particle gun method. The gene transfer conditions are shown below.

  Preparation of gold particles: Gold particles (60 mg / ml) were placed in a 1.5 ml microtube, and 1 ml of 99.5% ethanol was added and vigorously suspended. Thereafter, the mixture was centrifuged at 7,000 rpm to precipitate gold particles, and ethanol was discarded. 1 ml of sterilized water was added thereto for washing, and after centrifugation, the sterilized water was discarded. Then 50% glycerol was added and well suspended.

DNA coating on gold particles: 50 μl (0.3 mg) of gold particles was placed in a 1.5 ml microtube, 5 μl of gene transfer vector (pBI-BCF) DNA (1 μg / μl) was added, and vigorously mixed with a vortex mixer. Thereto, 50 μl of CaCl ₂ (2.5 M) and 20 μl of spermidine (0.1 M) were sequentially added and mixed with a vortex mixer. After mixing, the mixture was allowed to stand at room temperature for 30 minutes, and then centrifuged at 7,000 rpm, the supernatant was removed, and 1 ml of 70% ethanol was newly added and stirred gently. After centrifugation, ethanol was removed, and 1 ml of 99.5% ethanol was newly added and lightly stirred. After centrifugation, ethanol was removed, and 50 μl of 99.5% ethanol was newly added to suspend the gold particles well. 10 μl of the suspension was placed on the center of the microcarrier and air-dried. The gene was introduced into callus cells under the following conditions.

Gene transfer device: PDS-1000 / He particle delivery system (manufactured by Bio-Rad)
Gene transfer pressure: 1,550-1,800 psi
Degree of vacuum: 28inHg
Gold particle diameter: 0.6 to 1.0 μm.

  The state of cell proliferation and expression of GFP in the gene-transferred cells on the second day, the second week and the third week after the gene transfer are shown. As shown in FIG. 10, the cells into which the bluening transgene vector pBI-BCF has been introduced are whitened with callus cells becoming chlorosis (iron deficiency) after 3 weeks (see arrow in FIG. 10). It became clear that it did not grow any more. Although not intending to be bound by theory, this phenomenon is thought to be due to the iron concentration in the cytoplasm being extremely reduced due to the transport of iron into the vacuole due to the expression of the bluening gene. This event is an example that shows that it is very difficult to artificially regulate the iron ion level in the vacuole without harming the plant body.

(Example 9 Isolation of a petal-specific promoter)
A new promoter that induces gene expression specifically in petals was isolated. Specifically, the Myb transcription factor gene (MYB gene) and the anthocyanidin synthase gene (ANS gene), which are genes related to flower color expression, were isolated. When the expression analysis of the MYB gene and the ANS gene was performed, it was found that the expression in the petals was the strongest, expressed in both the upper and lower petals, and almost not expressed in other tissues (Fig. 11).

Subsequently, the promoters of the MYB gene and the ANS gene were isolated by the following method (Right Walk method), and their DNA base sequences were determined.
In order to clone an unknown promoter region from known sequences of genomic DNA (ANS gene and MYB gene), a RightWalk kit from Bex Corporation was used.

1. Genomic DNA is treated with a restriction enzyme that does not have a cleavage site within the known sequence.
2. One base extension is performed using Klenow enzyme (3 ′ → 5′exo−).
3. Connect the adapter.
4). The first PCR is performed using a primer specific for the adapter (WP1) and a known sequence-specific primer (SP1).
5. Dilute the first PCR product 100-fold and use it as a template for the second PCR.
6. Perform the second PCR using a primer (WP2) specific to the adapter located inside the primer used for the first PCR and a known sequence specific primer (SP2).
7). Analyze the base sequence of the amplified product and confirm that it is an unknown sequence including a part of the known sequence.

  In more detail, Tokyo Tsuchiya, Nanako Kameya and Iku Nakamura (2009) Strike Walk: A modified method of migration wal- ing federation walting. See Analytical Biochemistry 388: 158-160.

(Isolation of MYB gene promoter)
1. Treatment of 500 ng genomic DNA with restriction enzyme Nhe I for 1 hour at 37 ° C. <Reaction solution composition>
DNA (500 ng) 7.0 uL
10 x restriction enzyme buffer 2.0 uL
NheI (10U) 1.0 uL
Sterile water 10.0 uL
Total 20.0 uL

2. One base extension reaction was performed at 25 ° C. for 15 minutes using Klenow enzyme with dCTP as a substrate. Thereafter, the Klenow enzyme was inactivated by treatment at 72 ° C. for 20 minutes.
<Reaction solution composition>
Step 1 Reaction solution 10.0 uL
dCTP (1 mM) 1.0 uL
Klenow (3 '→ 5'exo-) 1.0 uL
Total 12.0 uL

3. The RWA-2 adapter was bound with T4 DNA ligase at 16 ° C. for 16 hours.
<Reaction solution composition>
Step 2 Reaction solution 12.0 uL
RWA-2 2.0 uL
T4 DNA ligase 2.0 uL
10 × ligase buffer 2.4 uL
Sterile water 5.6 uL
Total 24.0 uL

4). 26 μl of water was added to 24 μl of the reaction solution in step 3, and the first PCR was performed using 1 μl of that as a template.
Primer sequence WP1: CGCAGGCTGGCAGTCTCTTTTTAG (SEQ ID NO: 17)
SP1: TTCGAGAACTGAAGATGAAGATATACCTG (SEQ ID NO: 18)
<Reaction solution composition>
Template DNA 1.0 uL
KOD polymerase (5U / uL) 1.0 uL
10 x PCR buffer 5.0 uL
dNTPs (2 mM) 5.0 uL
MgSO ₄ (25 mM) 2.0 uL
WP1 (10 pmol) 1.0 uL
SP1 (10 pmol) 1.0 uL
Sterile water 34.0 uL
Total 50.0 uL
<Reaction conditions>
94 ° C 2 minutes (1 cycle)

94 ° C 30 seconds 65 ° C 30 seconds 68 ° C 7 minutes (35 cycles)

5. PCR was performed a second time using 1 μl of the first PCR product as a template. The reaction solution composition is the same as in Step 4 except for the primer. The reaction conditions are the same.
Primer sequence WP2: ATGCGGCCGCTCTCTTTTGGGTTACACGAGTGCTT (SEQ ID NO: 19)
SP2: TCCATAGTCCATGGTCCTTTCCTAAC (SEQ ID NO: 20)

  Amplification of a PCR product of 6.1 kbp or more was confirmed.

7). The obtained PCR product was TA cloned into a TOPO vector, and the nucleotide sequence was analyzed.
As a result, an unknown sequence 1,208 bp expected to contain a promoter upstream of the MYB gene was obtained.

(Isolation of ANS gene promoter)
1. Treatment of 500 ng of genomic DNA with the restriction enzyme BamHI for 1 hour at 37 ° C. <Reaction solution composition>
DNA (500 ng) 7.0 uL
10 x restriction enzyme buffer 2.0 uL
BamHI (10U) 1.0 uL
Sterile water 10.0 uL
Total 20.0 uL

2. One base extension reaction was performed using dGTP as a substrate and Klenow enzyme.
<Reaction solution composition>
Step 1 Reaction solution 10.0 uL
dGTP (1 mM) 1.0 uL
Klenow (3 '→ 5'exo-) 1.0 uL
Total 12.0 uL

3. The RWA-1 adapter was bound with T4 DNA ligase.
<Reaction solution composition>
Step 2 Reaction solution 12.0 uL
RWA-1 2.0 uL
T4 DNA ligase 2.0 uL
10 × ligase buffer 2.4 uL
Sterile water 5.6 uL
Total 24.0 uL

4). 26 μl of water was added to 24 μl of the reaction solution bound with the adapter, and the first PCR was performed using 1 μl of the reaction as a template.
Primer sequence WP1: CGCAGGCTGGCAGTCTCTTTTTAG (SEQ ID NO: 21)
SP1: CTCACCCTTCCAATCACCCTTTTTGC (SEQ ID NO: 22)
<Reaction solution composition>
Template DNA 1.0 uL
KOD polymerase (5U / uL) 1.0 uL
10 x PCR buffer 5.0 uL
dNTPs (2 mM) 5.0 uL
MgSO ₄ (25 mM) 2.0 uL
WP1 (10 pmol) 1.0 uL
SP1 (10 pmol) 1.0 uL
Sterile water 34.0 uL
Total 50.0 uL
<Reaction conditions>
94 ° C 2 minutes (1 cycle)

94 ° C 30 seconds 65 ° C 30 seconds 68 ° C 7 minutes (35 cycles)

5. PCR was performed a second time using 1 μl of the first PCR product as a template. The reaction solution composition is the same as in Step 4 except for the primer. The reaction conditions are the same.
Primer sequence WP2: ATGCGGCCGCTCTCTTTTGGGTTACACGAGTGCTT (SEQ ID NO: 23)
SP2: TCAACACACTTCCGCCCTCTCTCT (SEQ ID NO: 24)

  Amplification of a PCR product of 6.1 kbp or more was confirmed.

  7). The obtained PCR product was TA cloned into a TOPO vector, and the nucleotide sequence was analyzed.

  As a result, an unknown sequence 879 bp expected to contain a promoter upstream of the ANS gene was obtained.

  FIG. 12 shows the nucleotide sequence (SEQ ID NO: 15) of the MYB gene promoter isolated by the above-described method, and FIG. 13 shows the nucleotide sequence (SEQ ID NO: 16) of the ANS gene promoter.

  In order to test whether or not the isolated MYB gene promoter and ANS gene promoter actually have promoter activity, a vector (pBT-1 and pBT-1) in which a bluening gene (VIT gene) is linked to each promoter region. pBT-11) was constructed (see FIG. 14), and the gene was introduced into the purple cells of the petals by the particle gun method. As a result, a change in cell color from purple to blue was observed in the purple cells into which the bluening gene was introduced (see FIG. 15). It was revealed that it has a promoter activity that induces expression.

(Example 10 Introduction of bluening gene into callus using petal-specific promoter)
The bluening gene introduction vectors pBT-1 and pBT-11 prepared in Example 9 were introduced into callus by the same method as in Example 8. After the gene introduction, the culture was continued in a callus induction medium, and after 2 to 4 weeks, it was transplanted to a culture medium in which bialaphos (50 mg / l) was added to the callus induction medium. After culturing for 2 to 3 months, the cells were transplanted to the following regeneration medium to induce regeneration. The regeneration conditions were the plant hormone 2,4-D 0.01 mg, BA 0.2 mg, and the others were the same as the callus induction conditions. However, the cells were cultured with light irradiation (about 2,000 lux). Surprisingly, callus growth inhibition as observed in Example 8 and FIG. 10 was not observed, revealing redifferentiation after cell selection (see FIG. 16). GFP fluorescence can be confirmed in the shoot or a part thereof (round frame) into which the gene has been introduced.

(Example 11: Production of a plant having a blue petal)
The callus is introduced with a gene transfer vector containing a petal-specific promoter, a bluening gene, and a selection marker, and then cultured in a medium containing a selection drug, for example, to grow only cells into which the target gene has been introduced, By regenerating this, a plant having a blue petal can be obtained.

  For example, the tulip is sliced from bulb flakes to a thickness of 2 to 3 mm, and this is obtained with Murashige-Skoog medium (sucrose 20 g / L, 2,4-D 2 mg / L, BA 0.2 mg / L). Callus was induced at 20 ° C., the gene of interest was introduced into this, and shoots were made in Murashige-Skoog medium (sucrose 20 g / L, 2,4-D 0.2 mg / L) at 20 ° C. under light irradiation. Can be regenerated by inducing.

  Regeneration into plants is also described by Rogers et al. , Methods in Enzymology 118: 627-640 (1986); Tabata et al. , Plant Cell Physiol. , 28: 73-82 (1987); Shaw, Plant Molecular Biology: A practical approach. IRL press (1988); Shimamoto et al. , Nature 338: 274 (1989); Maliga et al. , Methods in Plant Molecular Biology: A laboratory course. Cold Spring Harbor Laboratory Press (1995); Hiei et al. , Plant Mol Biol 35: 205 (1997); Toki et al. , Plant J 47: 969 (2006) and the like. Furthermore, a recombinant production method not required for tissue culture has been developed in recent years, and is not necessarily limited to this example.

  As mentioned above, although this invention has been illustrated using preferable embodiment of this invention, this invention should not be limited and limited to this embodiment. It is understood that the scope of the present invention should be construed only by the claims. It is understood that those skilled in the art can implement an equivalent range based on the description of the present invention and the common general technical knowledge from the description of specific preferred embodiments of the present invention.

SEQ ID NO: 1 = Nucleic acid sequence of bluening gene SEQ ID NO: 2 = Amino acid sequence of bluening gene SEQ ID NO: 3 = Nucleic acid sequence of ferritin gene SEQ ID NO: 4 = Amino acid sequence of ferritin gene SEQ ID NO: 5 = Primer sequence number for ferritin homologous region = Ferritin homology region primer SEQ ID NO: 7 = Ferritin primer SEQ ID NO: 8 = TgVIT specific primer SEQ ID NO: 9 = TgVIT specific primer SEQ ID NO: 10 = TgFER specific primer SEQ ID NO: 11 = TgFER specific primer SEQ ID NO: 12 = GAPDH Gene primer SEQ ID NO: 13 = GAPDH gene primer SEQ ID NO: 14 = ferritin gene RNAi
SEQ ID NO: 15 = nucleotide sequence of MYB gene promoter SEQ ID NO: 16 = nucleotide sequence of ANS gene promoter

Claims (15)

A method for producing a plant cell for producing a blue plant body, the plant cell comprising:
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
A method comprising introducing a nucleic acid selected from the group consisting of: wherein the nucleic acid is operably linked to a petal specific promoter. A method for producing a blue plant, which is as follows:
(I) In plant cells:
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
A step of introducing a nucleic acid selected from the group consisting of: a step wherein the nucleic acid is operably linked to a petal specific promoter; and (ii) from the plant cell produced in step (i) A process of regenerating the plant body,
Including the method. A method for producing a plant cell for producing a blue plant, comprising the following nucleic acid (1) and nucleic acid (2):
(1) A nucleic acid selected from the group consisting of (a) to (d) below,
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
(2) a nucleic acid that decreases the expression level of a nucleic acid selected from the group consisting of (e) to (h) below:
(E) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 3, and that encodes a polypeptide having iron ion storage activity;
(F) a nucleic acid comprising a sequence having at least 80% homology with the nucleic acid sequence set forth in SEQ ID NO: 3, and encoding a polypeptide having iron ion storage activity;
(G) a nucleic acid encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4; and (h) an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 4 A nucleic acid encoding a polypeptide having iron ion storage activity,
Wherein the nucleic acid is operably linked to a petal specific promoter. A method for producing a blue plant, which is as follows:
(I) The following (1) nucleic acid and (2) nucleic acid:
(1) A nucleic acid selected from the group consisting of (a) to (d) below,
(A) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 1, and that encodes a polypeptide having iron ion transport activity;
(B) a nucleic acid comprising a sequence at least 80% homologous to the nucleic acid sequence set forth in SEQ ID NO: 1 and encoding a polypeptide having iron ion transport activity;
(C) a nucleic acid encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2; and (d) from an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid encoding a polypeptide having iron ion transport activity,
(2) a nucleic acid that decreases the expression level of a nucleic acid selected from the group consisting of (e) to (h) below:
(E) a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid comprising the nucleic acid sequence set forth in SEQ ID NO: 3, and that encodes a polypeptide having iron ion storage activity;
(F) a nucleic acid comprising a sequence having at least 80% homology with the nucleic acid sequence set forth in SEQ ID NO: 3, and encoding a polypeptide having iron ion storage activity;
(G) a nucleic acid encoding a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4; and (h) an amino acid sequence comprising one or several deletions, additions or substitutions in the amino acid sequence set forth in SEQ ID NO: 4 A nucleic acid encoding a polypeptide having iron ion storage activity,
Wherein the nucleic acid is operably linked to a petal-specific promoter, and (ii) a step of regenerating a plant from the plant cell produced in step (i),
Including the method. The method according to any one of claims 1 to 4, wherein the petal-specific promoter is a Myb transcription factor gene promoter having the base sequence of SEQ ID NO: 15. The method according to any one of claims 1 to 4, wherein the petal-specific promoter is an anthocyanidin synthase gene promoter having the base sequence of SEQ ID NO: 16. The method according to claim 2, wherein the plant body has a blue petal. The method according to claim 1, wherein the plant is a tulip. The tulip is purple crystal, purple of dreams, Prince Charles, Negrita, Cote d'Azur, Neptune, Blue Gym, Purple Palace, Purple World, Purple Flag, Louvre, Blue Purple, Amethyst, Carabela, Purple Marvel, Pandion, French Hals 9. The method of claim 8, wherein the method is selected from the group consisting of: Atella, Prince Charles, Purple Hat, and Reliance. A plant having a blue petal, produced by the method according to any one of claims 2 and 4-6. The plant according to claim 10, wherein the plant is a tulip. The tulip is purple crystal, purple of dreams, Prince Charles, Negrita, Cote d'Azur, Neptune, Blue Gym, Purple Palace, Purple World, Purple Flag, Louvre, Blue Purple, Amethyst, Carabela, Purple Marvel, Pandion, French Hals 12. The plant of claim 11, selected from the group consisting of: Atella, Prince Charles, Purple Hat, and Reliance. A plant cell for producing a blue plant body, which is produced by the method according to any one of claims 1, 3, 5, and 6. A nucleic acid having the base sequence of SEQ ID NO: 15. A nucleic acid having the base sequence of SEQ ID NO: 16.