JP2009297021A - Juvenile hormone response element - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a juvenile hormone response element (JHRE) inducing transcription in response to juvenile hormone (JH), methods of assaying and screening JH agonists and antagonists using the JHRE, and a control system for gene expression using the JH agonists and antagonists, and also to provide genes and proteins having high responsiveness to JH as well as uses thereof. <P>SOLUTION: A sequence (JHRE) having remarkable responsiveness to JH and inducing the transcription of downstream gene in response to JH has been identified. This JHRE shows dose-dependent transcription inducing activity to JH and analogs thereof and allows for using in combination with heterologous promoters. JH inducing expression systems using mammalian animal cells are successfully constituted by using this JHRE. In this way, assaying and screening JH agonists and antagonists using cultured cells are efficiently conducted. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a juvenile hormone response element derived from a gene responsive to juvenile hormone. The present invention also relates to utilization of the gene, protein, and element.

  Juvenile hormone (JH) is a multifunctional hormone involved in various physiological phenomena such as embryogenesis, molting / metamorphosis, sexual maturation, and dormancy in insects and crustaceans (Hartfelder, K. (2000 ) Brazilian Journal of Medical and Biological Research 33: 157-177). In particular, since JH has no ortholog in mammals, disrupting the endocrine system of JH is a safe insecticide for humans and mammals. Because of these advantages, search for chemically stable JH analogs has been made so far. For example, compounds such as methoprene, pyroproxyfen, and phenoxycarb have been developed. It is used as an insecticide for sanitary pests (Minakuchi C. and Riddiford LM. (2006) J. Pestic. Sci. 32: 77-84).

  However, random screening methods using insects are the mainstream for searching for compounds in these pesticides. For example, screening for JH agonists and antagonists is performed by observing in detail abnormalities such as molting and metamorphosis using insect individuals. However, screening using individuals requires a lot of time and effort, and the observation data of such individuals alone cannot reveal whether the hit compound is truly a JH agonist or antagonist, and its mechanism of action. . There is a need for a system that can more easily and directly evaluate JH action.

Hartfelder, K. (2000) Insect juvenile hormone: from "status quo" to high society. Brazilian Journal of Medical and Biological Research 33: 157-177 Minakuchi C. and Riddiford LM. (2006) Insect juvenile hormone action as a potential target of pest management. J. Pestic. Sci. 32: 77-84

  The present invention provides a JH response element (JHRE) that increases transcription in response to JH, a JH agonist and antagonist assay and screening method using JHRE, and a gene expression control system using JH agonist and antagonist . The present invention also provides a gene, protein having high responsiveness to JH, and use thereof.

  Several methods for screening JH agonists and antagonists and JH gene expression control systems that can be carried out in an in vitro system have been reported so far (for example, WO01 / 002436 (Japanese translations of 2003-505019); WO97 / 13864 (Special Table 2000-500323); WO98 / 46724 (Special Table 2002-510195); JP 2004-283080). However, development of a practical method for screening JH agonists and antagonists with high throughput is still not sufficient.

By the way, Kruppel homolog l (Kr-h1, CG9167) (Kruppel u is u umlaut) is known as a transcription factor having a C2-H2 type Zinc finger. Recently, in Drosophila melanogaster and Tribolium castaneum individuals, its expression has been reported to be induced by JH, suggesting that Kr-h1 is involved in JH signaling (Minakuchi, C. et al., 2008, Mech Dev. 125: 91-105; Parthasarathy, R. et al., 2008, Mech Dev. 125: 299-313; Mizuguchi Tomoe, Shinoda Tetsuro, 2008, Juvenile Hormone (JH ) Role of Jr-inducible transcription factor Kr-h1 in signaling, Abstracts of the 52nd Annual Meeting of the Japanese Society of Applied Entomology. However, the induction of Kr-h1 expression by JH has only been confirmed in individuals, and it is completely unknown how JH induces the expression of Kr-h1. Since the regulation of gene expression by JH is thought to involve multiple organs and tissues in a coordinated manner, the induction of Kr-h1 expression by JH is indirectly induced by JH via multiple organs and tissues. The possibility of being controlled was considered.
For example, the prothymotropic hormone PTTH secreted from the brain acts on the prothymus to promote the synthesis and secretion of the molting hormone (ecdysone), and ecdysone induces the expression of many genes such as skin. That is, the regulation of gene expression in skin and the like by PTTH seen in vivo (individual) is indirect via ecdysone and not seen in vitro. It is likely that the expression of Kr-h1 by JH is also indirectly induced in this way, and it is difficult to predict whether it can be used for in vitro expression control or screening systems.

In order to elucidate the expression control mechanism by JH through the analysis of the transcriptional regulatory mechanism, the present inventors have sought to isolate the Drosophila Kr-h1 gene homolog and its transcriptional regulatory region in silkworms. However, lepidopterous insects to which silkworms belong and Drosophila (Diptera) are systematically separated, so even if there is a homolog, it is expected that the homology is low, and the Drosophila Kr-h1 gene is used as a probe. Therefore, it was not expected that the silkworm Kr-h1 gene could be isolated by simply screening silkworm cDNA.
Therefore, the present inventors first dissected about 2000 silkworms, collected Arata bodies including lateral heart bodies, extracted total RNA from them, and performed full-length Arata by V-capping method (Hitachi High-Tech Science Systems). A body cDNA library was prepared. Furthermore, 20,000 clones were randomly selected from this library, DNA was extracted for each clone, and the sequence of the cDNA inserted into these clones was determined from the 5'- and 3'- sides. . As a result, a database consisting of about 30,000 EST sequences was constructed.
A search for this full length EST database of the silkworm larvae using the Drosophila Kr-h1 amino acid sequence (Accession numbers NP_477467.1 and NP_477466.1 (SEQ ID NOs: 6 and 8)) finally revealed a clone considered to be an ortholog Was successfully identified. The nucleotide sequence of the identified silkworm Kr-h1 (BmKr-h1) cDNA is shown in SEQ ID NOs: 1 and 3, and the amino acid sequences of the proteins encoded by each are shown in SEQ ID NOs: 2 and 4, respectively.

  Next, the present inventors isolated BmKr-h1 transcriptional regulatory region DNA (SEQ ID NO: 9) from the vicinity of the transcription start site of BmKr-h1 to about 5 kb upstream, and based on this, a plurality of reporter constructs were prepared. This was prepared and examined for in vitro JH responsiveness. As a result, the expression of the reporter gene from the silkworm Kr-h1 promoter was significantly increased by JH, so activation of the Kr-h1 promoter was not performed in multiple cells or organs. It was revealed that it was directly induced by JH. Surprisingly, it was found that the induction of expression of silkworm Kr-h1 gene by JH was significantly higher than that of Drosophila Kr-h1 gene (FIGS. 6 and 7). In addition, in the Kr-h1 gene of Lepidoptera insect cells (Sf9) other than silkworms, expression induction similar to that of silkworm BmN4 cells was observed by JH (FIGS. 14 and 15). Thus, the lepidopteran insect Kr-h1 gene and its promoter have significantly higher JH responsiveness than Drosophila. And proved to be extremely useful.

  In order to identify a cis factor (JH response element) that causes JH responsiveness in the BmKr-h1 transcriptional regulatory region, various sequences in the BmKr-h1 transcriptional regulatory region were deleted to examine JH responsiveness. As a result, there is certainly a sequence that brings about JH responsiveness around the 5 'side of the transcription start site of BmKr-h1, especially from -2165 to the transcription start site (+1) of BmKr-h1α. It was found that JHRE having high activity was present in the 2068 sequence (SEQ ID NO: 12).

  As a result of further analysis of this region, JH responsiveness is not lost even if a mutation is introduced into the base upstream of -2079 (FIGS. 21 and 22). : 39) was found to exist. In addition, when the DNA upstream of the transcription start site of the Kr-h1 gene was isolated and analyzed, this region certainly showed transcriptional activity in response to JH, and also matched the JHRE sequence of BmKr-h1α. The sequence was found to be included (Figures 23 and 24). Furthermore, this sequence was found to exist upstream of the transcription start site of the BmKr-h1β isoform. From the above results, it was considered that the essential sequence for JH response is CTCCACGTG (SEQ ID NO: 42).

  Next, in order to identify a transcription factor interacting with this sequence, various transcription factor candidates were transfected together with a reporter plasmid in which a luciferase gene was linked downstream of this sequence, and JH responsiveness was verified. As a result, a dramatic increase in JH responsiveness was observed in cells into which Met (Methoprene-tolerant) protein (BmMet2) was introduced. Therefore, the transcription factor that interacts with JHRE and induces transcription is Met. It turned out to be. Surprisingly, the Met protein can strongly induce downstream transcription in human cells (Fig. 28), and can further induce JHRE reporter plasmid expression in insects and human cells in a JH-dependent manner. It was possible (Figures 27 and 29-31).

  The above results indicate that the JHRE of the present invention can induce transcription in response to JH not only in insect cells but also in a wide range of cells. By utilizing this property, it becomes possible to control the expression of the target gene in response to JH in various cells, and to perform high-throughput screening of JH agonists and antagonists using this system. Is also possible. For example, mammalian systems using steroid hormones or tetracycline have been put into practical use as gene expression control systems so far (for example, GeneSwitch system and T-REX system of Invitrogen), but JH was used. There were almost no gene expression control systems. The gene expression control system using the transcriptional regulatory element of the present invention is not only a useful tool for controlling expression in insect cultured cells, but also new expression using JH in other cells such as mammalian cells. An induction system is possible.

That is, the present invention provides an element (JHRE) that increases transcription in response to JH, an assay and screening method for JH agonists and antagonists using JHRE, a gene expression control system using JH agonists and antagonists, and the like. . The present invention also provides genes, proteins having high responsiveness to JH, use thereof, and the like. The present invention specifically includes:
[1] DNA comprising SEQ ID NO: 42 or a sequence in which one base thereof is substituted, and having an activity of increasing transcription in response to juvenile hormone or an activity of binding to a Met (Methoprene-tolerant) protein,
[2] The DNA according to [1], wherein the DNA according to any one of the following (a) to (d):
(A) In a transcriptional regulatory region of a juvenile hormone responsive gene, this is a sequence excised so as to include a sequence in which SEQ ID NO: 42 or one base thereof is substituted, and increases transcription in response to juvenile hormone. DNA comprising a sequence having activity or activity to bind to a Met (Methoprene-tolerant) protein,
(B) a DNA comprising a sequence obtained by substituting, deleting, and / or adding one or more bases in the DNA of (a), wherein the activity or Met ( Methoprene-tolerant) DNA having an activity to bind to a protein,
(C) DNA having 90% or more identity with the DNA sequence of (a) above and having an activity of increasing transcription in response to juvenile hormone or binding to a Met (Methoprene-tolerant) protein ,
(D) DNA that hybridizes with the probe prepared from the DNA of (a) above under stringent conditions, and binds to an activity that increases transcription in response to juvenile hormone or a Met (Methoprene-tolerant) protein DNA having an activity of
[3] The DNA according to [1] or [2], wherein the gene is Kr-h1 (Kruppel homolog 1) or a homologous gene thereof,
[4] SEQ ID NO: 9 (-4741 / + 968), 10 (-2763 / + 116), 11 (-2165 / -2025), 12 (-2165 / -2068), 31 (TcKr-h1 -6299 / -2401), 34 (TcKr-h1 -351 / + 48), 35 (-477 / + 106), 36 (-2128 / -2045), 37 (-2128 / -2049), 38 (-2105 / -2068 ), 39 (-2079 / -2068), or a fragment thereof having juvenile hormone responsiveness, DNA according to any one of [1] to [3],
[5] the DNA according to any one of [1] to [4], wherein the heterologous promoter and / or the heterologous gene is operably linked;
[6] A vector comprising the DNA according to any one of [1] to [5],
[7] A composition for expression of juvenile hormone response, comprising the vector according to [6],
[8] A transformant comprising the DNA according to any one of [1] to [5] or a vector containing the DNA,
[9] The transformant according to [8], wherein a Met (Methoprene-tolerant) gene is introduced,
[10] The transformant according to [8] or [9], which is an insect cell or a mammalian cell,
[11] A juvenile hormone-responsive transcription enhancer comprising the DNA of any one of [1] to [5],
[12] Use of the DNA according to any one of [1] to [5] as a juvenile hormone response element,
[13] Use of the DNA according to any one of [1] to [5] for binding to a Met (Methoprene-tolerant) protein,
[14] Use of the DNA according to any one of [1] to [5] in expression control by juvenile hormone, an agonist or antagonist thereof,
[15] An expression control method comprising a step of bringing a juvenile hormone, an agonist or an antagonist thereof into contact with a cell into which the DNA according to any one of [1] to [5] is introduced,
[16] (a) DNA according to any one of [1] to [5], and (b) (i) juvenile hormone, an agonist or antagonist thereof, and / or (ii) Met (Methoprene-tolerant) A kit comprising a nucleic acid encoding or a cell into which the nucleic acid has been introduced,
[17] A method for assaying juvenile hormone action, comprising the step of detecting the transcriptional activity of the DNA according to any one of [1] to [5],
[18] The method according to [17], wherein the step is carried out in the presence of a test compound, thereby detecting the effect of promoting or suppressing the test compound on the action of juvenile hormone,
[19] The method according to [18], wherein the method is further carried out in screening for a compound that increases the action of juvenile hormone, and further comprises a step of selecting a compound that increases the transcriptional activity of the DNA;
[20] The method according to [18], wherein the step is performed in the further presence of juvenile hormone or an agonist thereof, thereby detecting the activity of a test compound that reduces the action of juvenile hormone,
[21] The method according to [20], wherein the method is further carried out in screening for a compound that reduces the action of juvenile hormone, and further comprises a step of selecting a compound that decreases the transcriptional activity of the DNA;
[22] The method according to any one of [17] to [21], which is performed in an assay or screening for insecticidal compounds,
[23] DNA according to the following (a) to (c),
(A) DNA comprising a silkworm gene encoding the amino acid sequence of SEQ ID NO: 2 or 4, or a homologous gene sequence in a lepidopteran insect, having juvenile hormone responsiveness,
(B) a DNA having juvenile hormone responsiveness, comprising a sequence obtained by substituting, deleting, and / or adding one or several bases in the sequence described in (a) above,
(C) a natural sequence that hybridizes under stringent conditions with a probe prepared from the sequence described in (a) above, and has juvenile hormone responsiveness,
[24] a protein comprising the amino acid sequence encoded by the DNA of [23],
[25] An immunogenic polypeptide comprising a continuous fragment of 8 or more amino acids of the protein according to [24],
[26] A nucleic acid comprising 15 or more consecutive nucleotides of SEQ ID NO: 1 or 3 or a complementary sequence thereof, or hybridizing under stringent conditions to SEQ ID NO: 1 or 3 or a complementary sequence thereof , Nucleic acids used as probes or primers,
[27] A polypeptide comprising an antibody or an antigen-binding fragment thereof that specifically binds to the protein of [24],
[28] A detection agent for juvenile hormone comprising the nucleic acid according to [26], or a polypeptide comprising the antibody or antigen-binding fragment thereof according to [27],
[29] (a) a kit comprising the nucleic acid according to [26], or a polypeptide comprising the antibody or antigen-binding fragment thereof according to [27], and (b) juvenile hormone, an agonist or antagonist thereof,
[30] A method of activating transcription of the DNA in non-insect eukaryotic cells, comprising the step of binding a Met (Methoprene-tolerant) protein or a fusion protein of the protein and a DNA binding protein to DNA,
[31] a transcription activator in non-insect eukaryotic cells, comprising a Met (Methoprene-tolerant) protein, a fusion protein of the protein and a DNA-binding protein, or a nucleic acid encoding either of them,
About.

The present invention also provides
[1] DNA according to the following (a) to (c),
(A) DNA comprising the sequence of a silkworm gene encoding the amino acid sequence of SEQ ID NO: 2 or 4, or the sequence of a homologous gene in a lepidopteran insect, or a sequence in the transcriptional regulatory region of those genes, DNA with hormone responsiveness,
(B) a DNA having juvenile hormone responsiveness, comprising a sequence obtained by substituting, deleting, and / or adding one or more bases in any of the sequences described in (a) above,
(C) DNA that hybridizes under stringent conditions with a probe prepared from any of the sequences described in (a) above, and having juvenile hormone responsiveness,
[2] The DNA according to [1], wherein the DNA of (a) includes a sequence in a transcriptional regulatory region,
[3] DNA according to [2], comprising SEQ ID NO: 9 or a fragment thereof having juvenile hormone responsiveness,
[4] DNA according to [2], comprising SEQ ID NO: 10 or a fragment thereof having juvenile hormone responsiveness,
[5] DNA according to [2], comprising SEQ ID NO: 11 or a fragment thereof having juvenile hormone responsiveness,
[6] DNA according to [2], comprising SEQ ID NO: 12 or a fragment thereof having juvenile hormone responsiveness,
[7] DNA according to any one of [2] to [6], wherein heterologous genes are operably linked,
[8] A vector comprising the DNA according to any one of [1] to [7],
[9] The vector according to [8], which is a juvenile hormone responsive expression vector,
[10] A transformant comprising the DNA according to any one of [1] to [7] or a vector containing the DNA,
[11] a protein comprising an amino acid sequence encoded by a silkworm gene encoding the amino acid sequence of SEQ ID NO: 2 or 4 or a homologous gene in a lepidopteran insect,
[12] A polypeptide comprising a continuous 8 amino acid fragment of the protein according to [11],
[13] A nucleic acid comprising 15 or more consecutive nucleotides of SEQ ID NO: 1 or 3 or a complementary sequence thereof, or hybridizing under stringent conditions to SEQ ID NO: 1 or 3 or a complementary sequence thereof. , Nucleic acids used as probes or primers,
[14] A polypeptide comprising an antibody or an antigen-binding fragment thereof that specifically binds to the protein of [11],
[15] A detection agent for juvenile hormone comprising the nucleic acid according to [13], or a polypeptide comprising the antibody or antigen-binding fragment thereof according to [14],
[16] (a) a kit comprising the nucleic acid according to [13], or a polypeptide comprising the antibody or antigen-binding fragment thereof according to [14], and (b) juvenile hormone, an agonist or antagonist thereof,
[17] Use of the DNA according to any one of [2] to [7] in expression control by juvenile hormone, an agonist or antagonist thereof,
[18] An expression control method comprising a step of bringing a juvenile hormone, an agonist or an antagonist thereof into contact with a cell containing the DNA according to any one of [2] to [7],
[19] A kit comprising (a) the DNA according to any one of [2] to [7], and (b) juvenile hormone, an agonist or antagonist thereof,
[20] A method for assaying juvenile hormone action, comprising a step of detecting the transcriptional activity of the DNA according to any one of [2] to [7],
[21] The method according to [20], wherein the step is performed in the presence of a test compound, thereby detecting the effect of the test compound on the action of juvenile hormone,
[22] The method according to [21], wherein the method is further carried out in screening for a compound that increases the action of juvenile hormone, and further comprises a step of selecting a compound that increases the transcriptional activity of the DNA;
[23] The method according to [21], wherein the step is performed in the further presence of juvenile hormone or an agonist thereof, thereby detecting the activity of a test compound that reduces the action of juvenile hormone,
[24] The method according to [23], wherein the method is further carried out in screening for a compound that decreases the action of juvenile hormone, and further comprises a step of selecting a compound that decreases the transcriptional activity of the DNA;
[25] The method according to any one of [20] to [24], which is performed in an assay or screening for insecticidal compounds,
Also related.

  In the claims of the present application, an invention that is an arbitrary combination of two or more of the inventions described in each claim that cites the same claim is already in the invention described in the higher-order claim cited therein. Is intended. Also, any inventive element described herein and any combination thereof are contemplated herein. Further, in the present invention, an invention excluding any element described in this specification or any combination thereof is also intended in this specification. Further, with respect to the present invention, a specific aspect described in the specification not only discloses the invention but also includes an invention that excludes the aspect from the invention disclosed in a higher order including the aspect. It is disclosed.

  In the present invention, a gene refers to a nucleic acid corresponding to a sequence to be transcribed, and includes initial transcription products including exons and introns, spliced RNA, nucleic acids encoding them (for example, genomic DNA, cDNA) and the like. A gene encoding an amino acid sequence is a nucleic acid (such as mRNA and cDNA) that continuously encodes the amino acid sequence, and a nucleic acid that is separated and encoded discontinuously (such as genomic DNA that is encoded by being divided into introns). Is included. That is, a gene encoding a certain amino acid sequence may contain an intron, 5 ′ and / or 3 ′ untranslated region (UTR), etc., as long as the amino acid sequence is encoded continuously or discontinuously. In the present invention, the sequence of a gene encoding an amino acid sequence refers to the nucleotide sequence of a nucleic acid that encodes the entire amino acid sequence continuously or discontinuously. Preferably, the base sequence continuously encodes the entire amino acid sequence. The base sequence may encode the amino acid as part of a longer amino acid sequence, or may encode an amino acid sequence of exactly that length. The base sequence may contain a non-coding sequence (intron, 5 ′ and / or 3 ′ untranslated region (UTR), etc.) as long as it encodes the amino acid sequence.

  In the present invention, the nucleic acid may be DNA or RNA, and the form thereof is not particularly limited. The nucleic acid may be genomic DNA, cDNA, synthetic DNA, mRNA and the like. In addition, the term “protein” in the present invention is not limited in its chain length, but includes those consisting of short peptide chains called oligopeptides. Proteins include what are called polypeptides. The proteins and nucleic acids of the present invention include isolated ones and recombinants. Isolated proteins and nucleic acids refer to proteins and nucleic acids that have been separated from their natural state, and include purified products and artificially produced products. Recombinant refers to a nucleic acid that has been produced or replicated by genetic recombination or synthesis, and if it is a nucleic acid, it means a nucleic acid whose both ends or one end is not connected in the same way as in the natural state, and is contained in a plasmid or other vector. Includes cloned and synthetic nucleic acids. Recombinant nucleic acid can be produced by cleaving natural nucleic acid with nuclease or ultrasonic wave and rebinding with ligase or the like. It can also be produced using a recombinant enzyme or the like. In addition, a synthesized nucleic acid and a nucleic acid amplified by a plasmid, phage, PCR or the like are also referred to as a recombinant nucleic acid in the present invention. In the case of a protein, a protein expressed from a recombinant nucleic acid or a synthesized protein is called a recombinant protein.

  In the present invention, DNA includes single strands and double strands. For example, the antisense strand of a gene is useful as a probe for detecting mRNA, and the sense strand is useful as a template for preparing a probe. Each chain is useful as a template when amplifying this gene by PCR or preparing a labeled probe or the like. Double-stranded DNA is useful for transcription of this gene and production of the protein encoded by this gene.

  The transcriptional regulatory region of a gene is a region that regulates the transcription of the gene. Usually, it is upstream of the gene (5 'side of the sense strand), but introns, exons, 5'- and 3'-UTR May be present inside. The main sequence that regulates transcription is usually present in a region several thousand bases upstream from the transcription start site of the gene. In the present invention, the sequence or DNA in the transcriptional regulatory region is a sequence or DNA that includes part or all of the transcriptional regulatory region of a gene. The sequence or DNA in the transcriptional regulatory region having JH responsiveness includes a part or all of the transcriptional regulatory region, and thereby downstream of the functionally linked downstream in response to JH. A sequence or DNA having an activity to control (promote) transcription of a gene, and more specifically, an appropriate transcription unit (having a transcription initiation site, transcription sequence, and transcription termination site, optionally a promoter and / or enhancer) A sequence or DNA that activates (or increases) transcription in response to JH. The sequence or DNA may or may not have a transcribed sequence (eg, 5'-UTR and / or intron). In general, the transcriptional regulatory region of a gene is a region ranging from the 5 ′ periphery to the upstream of the sequence to be transcribed up to several kbp, for example, 5 kb from the transcription start point, more preferably within the range of 4 kb, 3 kb, or 2 kb. A region, but a sequence that is essential for conferring JH responsiveness, is a fraction of that sequence. Transcriptional regulatory region DNA is generally used as double-stranded DNA.

  Natural JHs include JH-I, JH-II, JH-III, JH-0, and Methyl Farnesoate (Blum, MS (Ed.) 1985, Fundamentals of Insect Physiology, John Wiley and Sons, New York). Examples of JH agonists and JH analogs include methoprene, phenoxycarb, pyriproxyfen, kinoprene, diofenolan, and derivatives thereof.

  In the present invention, unless otherwise specified, the term JH includes natural and synthetic JH, JH agonists, and JH agonist JH analogs. JH responsiveness means having responsiveness to natural and synthetic JH, JH agonist, or JH agonist JH analog, preferably JH-I, JH-II, JH-III, JH-0 And responsiveness to at least one of the mesoprene, preferably responsiveness to at least one of the natural JHs (eg, JH-I). Further, detecting the action of JH includes detecting the activity of JH, its analog or agonist.

  The present invention provides a JH response element (JHRE), a JH agonist and antagonist assay and screening method using JHRE, a gene expression control system using JH agonist and antagonist, and the like. In addition, the present invention provides genes, proteins having high responsiveness to JH, and uses thereof. By using the expression of the gene or protein of the present invention or the transcriptional activation by the JH response element as an index, JH can be detected easily and with high sensitivity. In particular, the gene is induced by JH with very high efficiency even in an in vitro culture system of clonal cells, without being mediated by a plurality of cell types, tissues or organs. This makes it possible to construct a high-throughput screening system using cultured cells without using the phenotype of the individual as an index. Moreover, if the JH response element of the present invention is used, the expression of the target gene can be controlled by JH. For example, when the expression control system of the present invention is combined with an existing expression control system, the expression of a plurality of genes can be independently controlled using each system.

Structure of BmKr-h1 gene (α isoform). Sequence around the transcriptional regulatory region and transcription start site of BmKr-h1 gene. The number on the left indicates the position of the α isoform relative to the transcription start site. The transcription start sites of α and β isoforms are indicated by +1, and the first exon of α isoform and the exon of β isoform are boxed. An asterisk was placed above the translation initiation codon (ATG). Response of BmKr-h1 gene to JH and 20E in 6 silkworm cultured cells. Each silkworm cultured cell was cultured at 25 ° C. for 4 hours in a medium supplemented with JH I (1 μg / ml), 20E (0.5 μg / ml), or both, and then RNA was extracted and real-time quantitative PCR was performed. Was used to quantify the expression levels of BmKr-h1 and rp49. NH represents a medium without hormones. Induction of BmKr-h1 gene by JH analog. Silkworm BmN4 cells and aff3 cells are cultured in a medium supplemented with mesoprene (10 μM) at 25 ° C for a specified time, then RNA is extracted, and the expression levels of BmKr-h1 and rp49 are quantified by real-time quantitative PCR. did. (MEAN ± SD, n = 3) Induction of BmKr-h1 gene in silkworm cultured cells (aff3) by mesoprene (A) and JHI treatment (B). After culturing at 25 ° C. for 2 hours in a medium supplemented with each concentration of mesoprene or JHI, RNA was extracted, and the expression levels of BmKr-h1 and rp49 were quantified by real-time quantitative PCR. (MEAN ± SD, n = 3) Comparison of Kr-h1 gene induction rate by JH (mesoprene 10 μM) in Drosophila cultured cells (S2) and silkworm cultured cells (BmN4, aff3). Induction rate of DmKr-h1 gene (S2 cell) and BmKr-h1 gene (BmN4 cell, aff3 cell) when cultured for 2 hours in medium supplemented with mesoprene (10 μM, + JH). The value when cultured in an additive-free medium (-JH) for 2 hours was set to 1. (MEAN ± SD, n = 3) Kr-h1 gene induction by JH in various cultured cells derived from silkworm. The cells were cultured for 4 or 6 hours in a medium supplemented with JH-I or mesoprene (each 1 μM), and the expression levels of BmKr-h1 and rp49 were quantified. The induction ratio of the Kr-h1 gene when the value (control) when cultured in the non-added medium (-JH) is 1 is shown on each bar. BmKr-h1 promoter construct and primers used for its construction. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) are seeded on a 24-well plate at 1 × 10 ⁶ / well, cultured in 1 ml of IPL41 (+ 10% FBS) for 48 h at 25 ° C., then 1 μg of pGL4.14 construct shown in the figure, pIZT-Rluc 0.01 μg was transfected with 3 μl of TransFast ^™ (Promega) at 25 ° C. for 48 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) were seeded on a 96-well plate at 1.5 × 10 ⁵ / well and cultured in 200 μl of IPL41 (+ 10% FBS) at 25 ° C. for 12 hours, followed by 0.2 μg of pGL4.14 construct shown in the figure, pIZT- Transfast ^™ (Promega) 0.6 μl was used to transfect Rluc 0.002 μg at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) were seeded on a 96-well plate at 1.5 × 10 ⁵ / well and cultured in 200 μl of IPL41 (+ 10% FBS) at 25 ° C. for 12 hours, followed by 0.2 μg of pGL4.14 construct shown in the figure, pIZT- Transfect Rluc 0.002μg with TransFast ^TM (Promega) 0.6μl at 25 ° C for 24h, then add mesoprene to 10μM and 20E to 0.5μg / ml and incubate at 25 ° C for 24h for reporter activity. It was measured. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) are seeded on a 24-well plate at 1 × 10 ⁶ / well, cultured in 1 ml IPL41 (+ 10% FBS) for 48 h at 25 ° C., then pGL4.14_-2763 / + 116 1 μg, pIZT -Rluc 0.01 μg was transfected with 3 μl of TransFast ^TM (Promega) at 25 ° C. for 48 h, and then mesoprene was added to 10 μM and incubated at 25 ° C. for 2, 4, 6, 12, 24, and 48 h. The reporter activity was measured. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) were seeded in a glass tube at 1.5 × 10 ⁵ / well, cultured in 200 μl IPL41 (+ 10% FBS) at 25 ° C. for 48 hours, and then pGL4.14_-2763 / + 116 0.2 μg, Transfects pIZT-Rluc 0.002μg with TransFast ^TM (Promega) 0.6μl at 25 ℃ for 48h, then added JHI, JHII, JHIII, or mesoprene and incubated at 25 ℃ for 24h to measure the reporter activity . BmKr-h1 reporter assay. Silkworm cultured cells (BmN4) are seeded on a 24 well plate at 2 × 10 ⁵ / well, cultured in 1 ml of Ex-cell (+ 10% FBS) at 25 ° C. for 24 hours, and 1 μg of pGL4.14 construct shown in the figure, pIZT -Rluc 0.01 μg was transfected with 3 μl of TransFast ^™ (Promega) at 25 ° C. for 48 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Cultivated sweet potato-derived cultured cells (Sf9) were seeded on a 96-well plate at 1.5 × 10 ⁵ / well, cultured in 200 μl of Sf-900 SFM at 25 ° C. for 48 hours, and then 0.2 μg of pGL4.14 construct, pIZT-Rluc 0.002 shown μg of TransFast ^™ (Promega) (0.6 μl) was used for transfection at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Drosophila cultured cells (S2) were seeded on a 96-well plate at 5 × 10 ⁵ / well, cultured in 200 μl of Schneider (+ 10% FBS) at 25 ° C. for 48 hours, 0.2 μg of pGL4.14 construct as shown, pIZT- Transfast ^™ (Promega) 0.6 μl was used to transfect Rluc 0.002 μg at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) are seeded on a 96-well plate at 1.5 × 10 ⁵ / well, cultured in 200 μl of IPL41 (+ 10% FBS) at 25 ° C. for 24 hours, 0.2 μg of pGL4.14 construct shown in the figure, pIZT- Transfast ^™ (Promega) 0.6 μl was used to transfect Rluc 0.002 μg at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) are seeded on a 96-well plate at 1.5 × 10 ⁵ / well, cultured in 200 μl of IPL41 (+ 10% FBS) at 25 ° C. for 24 hours, 0.2 μg of pGL4.14 construct shown in the figure, pIZT- Transfast ^™ (Promega) 0.6 μl was used to transfect Rluc 0.002 μg at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) were seeded on a 96-well plate at 1.5 × 10 ⁵ / well and cultured at 25 ° C. in 200 μl of IPL41 (+ 10% FBS) for 48 μg. Then, 0.2 μg of pGL4.14 construct shown in the figure, pIZT Transfast ^™ (Promega) 0.6 μl was used to transfect Rluc 0.002 μg at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. BmKr-h1 reporter assay. Silkworm cultured cells (aff3) are seeded on a 96-well plate at 1.5 × 10 ⁵ / well, cultured in 200 μl of IPL41 (+ 10% FBS) at 25 ° C. for 24 hours, 0.2 μg of pGL4.14 construct shown in the figure, pIZT- Transfast ^™ (Promega) 0.6 μl was used to transfect Rluc 0.002 μg at 25 ° C. for 24 hours, and then mesoprene was added to 10 μM and cultured at 25 ° C. for 24 hours to measure the reporter activity. The JHRE analysis of BmKr-h1 is shown. BmKr-h1 region containing JHRE-containing region -2165 / -2025 was mutated at various positions, and aff3 was used to examine changes in JH response by dual luciferase assay. The JHRE analysis of BmKr-h1 is shown. Similarly to FIG. 21, the base of the JHRE region of BmKr-h1 was mutated, and changes in JH response were examined by dual luciferase assay using aff3. This shows the DNA sequence of the transcription initiation region of Kr. The number indicates the position from the transfer start point (+1). FIG. 23 is a continuation of FIG. The transcription start point is indicated by “+1”. The box represents an exon, and the asterisk represents the start codon. The JHRE analysis of Kokunu Stomodoki Kr-h1 (TcKr-h1) is shown. The sequence of the promoter region of TcKr-h1 includes the essential sequence (CTCCACGTG) of JHRE of BmKr-h1. Using this region, changes in the JH response were examined by a dual luciferase assay using aff3. The influence of substitution of the promoter region of BmKr-h1 is shown. The promoter region of BmKr-h1 was replaced with the promoter region of actin A3 gene (BmA3) or HSP70 gene (BmHSP70), and JH responsiveness was examined using aff3. In the figure, the ratio of increase in expression by JH is shown. A clear JH response was observed with either promoter. Identification of factors that interact with JHRE. BmKr-h1 JHRE dual luciferase assay was performed using the Drosophila S2 cell line. In BmMet2, JH responsiveness was significantly induced. Functional analysis of Met2. A plasmid (gal4-DBD_BmMet2) expressing a fusion protein of GAL4 DNA-binding domain and BmMet2 was prepared, and co-transfection with a UAS-luciferase plasmid (pGL_Luc (UAS_Luc)) into a cultured cell line derived from human kidney (HEK293) A reporter assay was performed. Induction of JH-responsive expression in mammalian cells. HEK293 (0.5 × 10 ⁵ / well; 96 well plate) was cultured in MEM + 0.1 mM NEAA + 10% FBS at 37 ° C. for 48 h, and then the JHRE luciferase reporter plasmid pGL4.14_-2165 / -2025 & -49 / 116, pGL4.14_-2763 / 116, pGL4.14_JHRE × 4 & TK, or pGL4.14_JHRE × 5 & -49 / 116, a wild-type BmMet2 expressing plasmid (pBIND_BmMet2_-gal4), and an internal standard reporter vector pRL Co-transfection (37 ° C, 48h) with Lipofectamine 2000 with -TK (Promega) was performed, and JHI 0.1µM was added (37 ° C, 24h), followed by dual luciferase assay. An empty vector that does not encode Met2 was used as a control. Induction of JH-responsive expression using JHRE of Kc. Drosophila S2 cells and silkworm aff3 cells were seeded in 96-well plates at 1.5 × 10 ⁵ / well and cultured at 25 ° C. for 24 hours in schneider medium containing 10% FBS or IPL41 medium containing 10% FBS. Transfect 0.2 g of reporter plasmid (pGL4.14_Tckrh1_pro) containing -477 / + 106 of TcKr-h1 and pIZT-Rluc 0.002 μg as an internal standard using TransFast ^™ (Promega) 0.6 μl at 25 ° C. for 24 hours, Mesoprene 10 μM was added and cultured at 25 ° C. for 24 hours, followed by luciferase assay. Induction of JH-responsive expression in human cells using JHRE of TcKr-h1. HEK293 cells were seeded in a 96-well plate at 0.2 × 10 ⁵ / well and cultured at 37 ° C. for 48 hours in a MEM medium containing 10% FBS and 0.1 mM non-essential amino acid (NEAA). 0.2 μg of reporter plasmid containing -477 / + 106 of TcKr-h1, 0.2 μg of plasmid expressing gal4-DBD_BmMet2 expression plasmid (pcDNA_BmMet2) or wild type BmMet2 (pBIND_BmMet2_-gal4), and internal standard reporter vector Co-transfection (37 ° C, 48h) was performed using 0.2µg of pRL-TK (Promega) using Lipofectamine 2000 (0.5µg), and 0.1µM of JHI was added (37 ° C, 24h), followed by dual luciferase assay. As a control, an empty vector (pcDNA_none) not encoding Met2 was used. Dose-dependent characteristics of JH-induced expression in mammalian cells. PGL4.14_-2165 / -2025 & -49 / 116 and BmMet2 expression vector (pBIND_BmMet2_-gal4) were added to HEK293 (0.2 × 10 ⁵ / well, 96 well plate) cultured in 200 μl of MEM + 0.1 mM NEAA + 10% FBS. Co-transfection (48h) using Lipofectamine 2000 with standard reporter vector pRL-TK, JH treatment (JHI, II, III, MT (methoprene), MF (methyl farnesoate), FA (Farnesoic acid), 24h) And performed a dual luciferase assay. Dose-dependent characteristics of JH-induced expression in silkworm cells. Cultivate aff3 cells in 200 μl of IPL41 containing 10% FBS (1.5 × 10 ⁵ / well, 96 well plate), and after JH treatment (JHI, II, III, MT (methoprene), MF (methyl farnesoate), FA (Farnesoic acid ), 2h), the transcription level of endogenous BmKr-h1 was measured. The transcription level of endogenous ribosomal protein 49 (BmRp49) was measured as an internal standard.

  The present invention provides a JH response element (JH response element (JHRE)) that activates transcription of downstream genes in response to juvenile hormone (JH). The DNA of the present invention includes DNA having a sequence in the transcriptional regulatory region of a gene having JH responsiveness, and DNA having JH responsiveness due to the presence of the sequence (in the present invention, Also called DNA containing JHRE). More specifically, the DNA of the present invention contains an essential sequence of JHRE (CTCCACGTG (SEQ ID NO: 42) or a sequence highly similar thereto). The JHRE of the present invention more preferably includes, for example, one containing CCTCCACGTG (SEQ ID NO: 41), GCCTCCACGTG (SEQ ID NO: 40), GGCCTCCACGTG (SEQ ID NO: 39), or a sequence highly similar to any of these. . The DNA is DNA that imparts JH responsiveness by being inserted in the vicinity of an appropriate promoter, or DNA that increases JH responsiveness as compared with the case where it is not inserted. Since transcription of such DNA is promoted in response to JH or a JH agonist, the action of JH can be evaluated by detecting its expression. Therefore, these DNAs are useful as markers for detection or screening of JH or its agonists and antagonists, or for control of expression by JH or its agonists and antagonists.

  The DNA can be used as a JH-responsive transcription enhancer. That is, in the transcriptional regulatory region (for example, within 5 kb, within 4 kb, within 3 kb, within 2 kb, within 1 kb, within 500 b from the transcription start point), inducing transcription of downstream genes in response to JH. Can do. The DNA of the present invention is useful as a sequence (ie, JH response element) for regulating transcription of a downstream gene in response to JH in a transcriptional regulatory region.

  Having JH responsiveness means that expression is increased or increased in response to JH or an agonist thereof. In a DNA containing a transcriptional regulatory region sequence, a certain cell is under the control of the DNA. The level of transcription of the DNA linked to (or the level of expression or activity of the protein encoded therein) induced in response to JH or an agonist thereof, or increased relative to the absence of JH or an agonist thereof. To tell. The DNA of the transcriptional regulatory region can be appropriately evaluated for JH responsiveness (ie, reporter assay) in combination with other promoters (those not necessarily having JH responsiveness), transcription initiation sites, reporter genes, and the like. JH may be natural JH or synthetic JH (eg, mesoprene). Synthetic JH includes JH agonists (including JH agonistic JH analogs).

  The present invention also relates to a DNA containing CTCCACGTG (SEQ ID NO: 42) or a sequence highly similar thereto, which is a Met (Methoprene-tolerant) protein (resistance to juvenile hormone (Rst (1) JH) or juvenile hormone resistence). Provided is DNA having an activity of binding to protein (also called protein). By binding the Met protein to DNA, expression of downstream genes can be induced not only in insect cells but also in other cells such as mammalian cells. Therefore, DNA that binds to the Met protein (Met binding element) is useful as a regulatory sequence for regulating expression by the Met protein, and also used for assays and screening for compounds that inhibit the binding of this DNA to the Met protein. be able to. The present invention provides the use of the DNA of the present invention for binding to a Met protein. Such use includes use for obtaining a result (effect) by binding to the Met protein. For example, the present invention relates to a method for interacting a Met protein with the DNA, comprising the step of allowing the DNA of the present invention and the Met protein to coexist in the presence of JH or an agonist thereof. The method can be used to induce transcriptional activity of the DNA in response to JH.

  As the DNA of the present invention, a DNA containing a sequence highly similar to that can be used as long as it has JH response activity and / or Met protein binding activity, even if it is not the same sequence as the CTCCACGTG sequence. Such a sequence may be a sequence in which one or several bases are substituted, deleted, and / or added to CTCCACGTG (SEQ ID NO: 42) (or SEQ ID NO: 39 to 41), more preferably. A sequence in which one or several bases are substituted. The modified nucleotide sequence has an identity of 65% or more, preferably 70% or more, 75% or more, 80% or more, 85% or more, or 90% or more before modification. For example, the number of bases to be modified is preferably 3 or less, more preferably 2 or less, and even more preferably 1. For example, CTNCACGTG (for example, CTMCACGTG), CWCCACGTG (for example, CACCACGTG) and the like can be mentioned.

  The DNA of the present invention may further comprise a sequence in the transcriptional regulatory region of the JH responsive gene. For example, in the transcriptional regulatory region of a JH-responsive gene (for example, within 5 kb, preferably within 4 kb, 3 kb, or 2 kb from the transcription start site), a portion containing CTCCACGTG or a sequence highly similar thereto can be cut out and used. As long as it has JH response activity, the range to be cut out is not particularly limited, for example, 10 bases or more, preferably 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50 , 70, or 100 bases or more may be cut out and used. In a preferred embodiment, the 5 ′ side (upstream side) of CTCCACGTG or a sequence highly similar thereto is, for example, 1 base or more, preferably 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 , 30, 40, 50, or 60 bases or more.

  As the JH-responsive gene, any gene can be used as long as it contains CTCCACGTG or a sequence highly similar thereto in the transcriptional regulatory region, and the sequence has an activity to activate transcription in response to JH. As a JH responsive gene, the expression of the gene is preferably significantly higher than that in the absence of JH, preferably in the presence of an optimal JH concentration, preferably 1.5 times or more, more preferably 2 times or more, 3 times or more, 4 It is a gene that rises more than twice, more than 5 times, more than 6 times, more than 8 times, more than 10 times. In particular, it is possible to obtain a transcriptional regulatory sequence that exhibits extremely high JH responsiveness by excising the sequence from the transcriptional regulatory region of the Kr-H1 gene, which is one of the JH-responsive genes. Examples of the Kr-h1 gene include Kr-h1 genes such as lepidopterous insects and Coleoptera (Coleoptera) insects, and the transcriptional regulatory sequences of these genes can be preferably used. For example, the silkworm Kr-h1 gene representing lepidopterous insects is shown in SEQ ID NOs: 1 and 3, and the sequence of the transcription region is shown in SEQ ID NO: 9. In addition, the Kr-h1 gene of Tribolium castaneum representing the Coleoptera is shown in SEQ ID NO: 32, and the sequence of the transcription region is shown in SEQ ID NO: 31. In the present invention, Kr-h1 gene and Kr-h1 protein include homologous genes and homologous proteins of these genes and proteins. Specific examples of the Kr-h1 gene include, for example, Nasonia vitripennis Kr-h1 (XM_001600244.1, XP_001600294.1), Apis mellifera Kr-h1 (NM_001011566.1, NP_001011566. 1), pea aphid Kr-h1 (Acyrthosiphon pisum) (XM_001946159.1, XP_001946194.1), Aedes aegypti Kr-h1 (XM_001655112.1, XP_001655162.1), Culex quinquefasciatus (Culex quinquefasciatus) XM_001863494.1, XP_001863529.1), Anopheles gambiae Kr-h1 (AGAP009662-PA; XM_318706.4, XP_318706.4) and the like.

  For example, when a suitable DNA containing a sequence in the transcriptional regulatory region of BmKr-h1 is specifically exemplified, -4741 to +968 (SEQ ID NO: 9), -4741 to +116, -4041 with respect to BmKr-h1α ~ + 116, -2763 ~ + 116 (SEQ ID NO: 10), -4041 ~ + 968, -2763 ~ -1695, -2565 ~ + 116, -2347 ~ + 116, -2165 ~ + 116, -2165 ~- 1999 and -285 to +116 combination, -2165 to -2049 and -285 to +116 combination, -2165 to -1999 and -192 to +116 combination, -2165 to -2049 and -192 to +116 Combinations, -2165 to -1999 and -111 to +116 combinations, -2165 to -2049 and -111 to +116 combinations, -2165 to -1999 and -49 to +116 combinations, -2165 to -2049 and -49 to +116 combinations, -2165 to -2001 and -49 to +116 combinations, -2165 to -2025 and -49 to +116 combinations, -2165 to -2045 and -49 to +116 combinations, Combinations of -2165 to --2068 and -49 to +116, and fragments of these In addition, examples include, but are not limited to, those having Met protein binding activity. In particular, -2165 to -2025 (SEQ ID NO: 11), -2128 to -2045 (SEQ ID NO: 36), -2165 to -2049, -2165 to --2068, -2128 to -2049 (SEQ ID NO: 37), -2105 to- 2068 (SEQ ID NO: 38), -2079 to -2063, -2079 to -2068 (SEQ ID NO: 39), or fragments thereof having JH responsiveness, particularly -2094 to -2089, -2079 to -2063 , -2079 ~ -2068, -2078 ~ -2068, -2077 ~ -2068, or -2076 ~ -2068, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 Examples thereof include JH-responsive fragments or Met protein-binding fragments of 100 bases or more. Further, SEQ ID NO: 34, 35 (-351 / + 48, -477 / + 106 of TcKr-h1) or a fragment thereof having JH responsiveness or Met binding activity, particularly SEQ ID NO: 34 including CTCCACGTG 1 to 351 of the fragments, and fragments having JH responsiveness or Met binding activity can be exemplified.

  For example, the sequence in the transcriptional regulatory region of Nasonia vitripennis Kr-h1 includes a sequence containing 9 bases from -2892 / -2884 upstream from the translation start point (for example, -2941 / -2842 (SEQ ID NO: 43) is a candidate. The accession number AAZX01010451.1 can be referred to for the base sequence of this region. The sequence in the transcriptional regulatory region of Apis mellifera Kr-h1 includes a sequence containing 9 bases upstream from the translation start point -1997 / -1989 (for example, -2068 / -1926 (SEQ ID NO: 44)) ) Is a candidate. For the base sequence of this region, reference can be made to accession number NW — 001260508.1. The sequence in the transcriptional regulatory region of the pea aphid (Acyrthosiphon pisum) Kr-h1 includes a sequence containing 9 bases from -1221 / -1213 upstream from the translation start point (for example, -1260 / -1193 (SEQ ID NO: 45)) Sequence) is a candidate. The accession number ABLF01017962.1 can be referred to for the base sequence of this region. In addition, a sequence including SEQ ID NO: 46 in the complementary sequence of AC092216.1 (GI: 14578097) can be used as a candidate.

It should be noted that the JH responsiveness in DNA containing the transcriptional regulatory region sequence is higher in the presence of JH than in the absence of JH, rather than whether the DNA increases absolute transcription levels in the presence of JH. Measured by rate of increase in transcription level (induction magnification). Therefore, when a DNA is inserted into a promoter, even if the transcription level is reduced even in the presence of JH compared to when the DNA is not inserted, in the promoter in which the DNA is inserted, in the absence of JH. If the transcription level is further reduced, the DNA is JH responsive. That is, a sequence that acts as a negative regulatory element of transcription specifically in the absence of JH (ie, stronger than in the presence of JH) is also a sequence having JH responsiveness. In a preferred embodiment, the DNA of the present invention has a transcriptional activity of 1.5 times or more, more preferably 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times in the presence of JH compared to the absence of JH. As described above, it has an activity of increasing 8 times or more, 10 times or more. The optimum concentration of JH can be determined as appropriate.
The binding activity with the Met protein is determined by pull-down assay using labeled DNA, measurement using surface plasmon resonance (Biacore), system using reporter construct similar to one-hybrid assay described in Examples, etc. Can be detected. The Met protein may bind to JHRE and / or activate transcription via JHRE as a heterodimer, but preferably binds to JHRE and / or activates transcription via JHRE alone.

  The DNA of the present invention is a DNA having a sequence modified by substitution, deletion, and / or addition of one or more bases in the above-mentioned DNA, and the sequence has JH responsiveness or Met binding activity. DNA having For example, DNA having JH responsiveness imparts JH responsiveness by being inserted into an appropriate promoter, or increases JH responsiveness as compared with the case where no insertion is made. A sequence excised from the transcriptional regulatory region of a JH-responsive gene can be easily modified to easily create variations that maintain JH-responsiveness or Met binding activity.

  Methods well known to those skilled in the art for preparing sequence-modified nucleic acids include site-directed mutagenesis (Gotoh, T. et al. (1995) Gene 152, 271-275, Zoller, MJ, and Smith, M. (1983) Methods Enzymol. 100, 468-500, Kramer, W. et al. (1984) Nucleic Acids Res. 12, 9441-9456, Kramer W, and Fritz HJ (1987) Methods. Enzymol. 154, 350-367, Kunkel, TA (1985) Proc. Natl. Acad. Sci. USA. 82, 488-492, Kunkel (1988) Methods Enzymol. 85, 2763-2766). Mutations and variations also exist in nature. The DNA of the present invention includes such artificially generated DNA and DNA that is natural or naturally occurring variations and has JH applicability. These variations include polymorphisms as well as mutations that do not affect JH responsiveness or Met binding activity.

  The number of bases modified in DNA is not particularly limited, but for example, within 30%, preferably within 25%, within 20%, within 15%, 10% of the total number of bases of DNA having JH responsiveness or Met binding activity. It can be within%, within 5%, within 3%, or within 1%. Also, for example, within 100 bases, preferably within 80 bases, within 70 bases, within 60 bases, within 50 bases, within 40 bases, within 30 bases, within 20 bases, within 10 bases, within 5 bases, or 1 base modified May have been. These DNAs are transcriptional regulatory region DNAs of the Kr-h1 gene (for example, silkworm Kr-h1 and Krnus moth Kr-h1, or its homologous genes (orthologs) in Lepidoptera and Coleoptera) DNA sequence having sex or Met binding activity (for example, BmKr-h1 -4741 to +968, -4741 to +116, -4041 to +116, -2763 to +116, -4041 to +968, -2763 to -1695, -2565 to +116, -2347 to +116, -2165 to +116, -2165 to --2025, -2128 to -2045, -2165 to -2049, -2165 to --2068, -2128 ~ -2049, -2079 ~ -2063, -2079 ~ -2068, -2094 ~ -2089, -2079 ~ -2063, -2079 ~ -2068, -2078 ~ -2068, -2077 ~ -2068, -2076 ~- 2068 or a JH-responsive fragment within them) and at least 9 consecutive bases, preferably 10, 11, 12, 13, 15, 17, 20, 25, 30, 35, 40, 45, 50, 55, Over 60, 65, 70, 80, 90, or 100 bases, preferably 70% or more, more preferably 75% or more, more preferred 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more, and most preferably 100% identity. Contains an array with

  Here, the identity of the base sequence and the amino acid sequence is determined by aligning the sequences to be compared with appropriate gaps so that the bases and amino acids match, respectively, and matching all the amino acids in the aligned range or the matching amino acids or bases. Calculated as a percentage. For example, BLAST (Proc. Natl. Acad. Sei. USA, 1990, 87, 2264-2268, Karlin, S. & Altschul, SF., Proc. Natl. Acad. Sei) is an algorithm by Karlin and Altschul. USA, 1993, 90, 5873). Programs called BLASTN and BLASTP based on the BLAST algorithm have been developed (Altschul, SF. Et al., J Mol Biol, 1990, 215, 403). Specifically, the blastn program is used to determine the identity of the base sequence, and the blastp program is used to determine the identity of the amino acid sequence. For example, “Low” on the BLAST web page of NCBI (National Center for Biothchnology Information) All the filter settings such as “complexity” are turned off, and calculation is performed using default parameters (Altschul, SF et al. (1993) Nature Genet. 3: 266-272; Madden, TL et al. (1996) Meth. Enzymol. 266: 131-141; Altschul, SF et al. (1997) Nucleic Acids Res. 25: 3389-3402; Zhang, J. & Madden, TL (1997) Genome Res. 7: 649-656). For example, the open gap cost is 5 for nucleotides and 11 for proteins, the cost for extend gaps is 2 for nucleotides and 1 for proteins, the penalty for nucleotide mismatch is -3, the reward for nucleotide match is 1, and the expect value is 10, wordsize is 11 nucleotides, protein is 2, Dropoff (X) for blast extensions in bits is 20 for blastn, 7 for other programs, X dropoff value for gapped alignment (in bits) is 15, other than blastn, final X The dropoff value for gapped alignment (in bits) is 50 for blastn and 25 for other programs. In comparing amino acid sequences, BLOSUM62 can be used as a matrix for scoring (Henikoff, S. and Henikoff, J. G. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919). With the help of the blast2sequences program (Tatiana A et al. (1999) FEMS Microbiol Lett. 174: 247-250) that compares two sequences, an alignment of the two sequences can be created. In the calculation of sequence identity, for example, the ratio of bases or amino acids that match during alignment of the entire range of sequences to be compared (added gaps are added to the denominator) is calculated. Gaps and mismatches located outside the original sequence are excluded from the calculation, and the gaps in the alignment are regarded as equivalent to the mismatches.

  The DNA of the present invention includes DNA that hybridizes with the probe prepared from the above DNA under stringent conditions and has JH responsiveness or Met binding activity. The present invention also encodes DNA having JH response activity or Met binding activity, specifically silkworm Kr-h1 (SEQ ID NO: 2 or 4), which is excised from the sequence in the transcriptional regulatory region of the Kr-h1 gene. A sequence in the transcriptional regulatory region of Kr-h1 gene, Kr-h1 gene, and its homologous gene (ortholog) in other insects, and having JH response activity or Met binding activity, or a complementary strand thereof It also relates to DNA that hybridizes under stringent conditions and has JH responsiveness or Met binding activity. For example, silkworm BmKr-h1 (SEQ ID NO: 1 or 3) or its transcriptional regulatory region DNA (for example, SEQ ID NO: 9), or Kuknutomodoki Kr-h1 (SEQ ID NO: 32) or its transcriptional regulatory region DNA (for example, SEQ ID NO: :)), and a DNA that hybridizes under stringent conditions can be obtained by screening a genomic DNA library or the like by hybridization. Such DNA can be expected to have high responsiveness to JH, as shown in the Examples. That is, the expression of the transcribed sequence and the protein encoded therein are induced in response to JH, and the DNA in the transcriptional regulatory region can activate transcription of the functionally linked gene in response to JH. Can be expected.

For example, silkworm BmKr-h1 (for example, SEQ ID NO: 1, 3, or a CDS thereof, or a complementary sequence thereof), Knotnumodoki Kr-h1 (SEQ ID NO: 32 or a CDS thereof, or a complementary sequence thereof), Or a transcription sequence (or CDS or a complementary sequence thereof) of those homologous genes, or a DNA (sense strand) of a transcription regulatory region thereof (for example, any of SEQ ID NOs: 9 to 12, 31 or a complementary sequence thereof) , Antisense strand, or both) can be used as a probe or a template thereof, for example, labeled probe by nick translation method, random primer method, PCR, in vitro translation, etc. (Feinberg, AP and Vogelstein, B., 1983, Anal. Biochem. 132, 6-13; Feinberg, AP and Vogelstein, B., 1984, Anal. Biochem. 137, 266-267; Saiki RK, et al: Science 230: 1350, 1985, Saiki RK, et al: Science 239: 487, 1988). As the random primer method, random hexamer (pd (N) ₆ ), random nonamer (pd (N) ₉ ) or the like may be used (for example, Random Primer DNA Labeling Kit, Takara Bio Inc., Otsu, Japan). The template DNA used for preparing the probe is, for example, 20 or more consecutive bases, preferably 30, 40, 50, 70, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800. Or 1000 bases or more. The average chain length of the probe is, for example, 20 bases or more, preferably 30, 40, 50, 70, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, or 1000. More than base, for example, less than 5000 bases, preferably less than 4000, 3000, or 2000 bases. Even if the probe contains a nucleic acid having a short chain length, in hybridization under stringent conditions, these probes cannot be hybridized to the nucleic acid, so there is little influence.

  Hybridization under stringent conditions is routinely performed by those skilled in the art (Southern, EM, J. Mol. Biol., 98: 503, 1975; Sambrook and Russell, Molecular Cloning, 3rd ed., Cold Spring). Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 2001). Specifically, for example, 5 × SSC (1 × SSC includes 150 mM NaCl and 15 mM sodium citrate), 7% (W / V) SDS, 100 μg / ml denatured salmon sperm DNA, 5 × Denhardt's solution (1 × Denhardt's solution is a condition for performing hybridization at 50 ° C., preferably 60 ° C., more preferably 65 ° C. in a solution containing 0.2% polyvinyl pyrrolidone, 0.2% bovine serum albumin, and 0.2% ficoll. The hybridization time may be appropriately adjusted. For example, it is 3 hours or longer, preferably 5 hours or longer, preferably 8 hours or longer, preferably 12 hours or longer, for example, 5 to 15 hours. . Washing after hybridization is performed at the same temperature as hybridization, for example, in 2 × SSC, 0.1% SDS for 20 minutes, preferably 30 minutes, more preferably 40 minutes. More preferably, the post-hybridization wash is in 1 × SSC, 0.1% SDS, more preferably in 0.5 × SSC, 0.1% SDS, more preferably in 0.2 × SSC, 0.1% SDS at the same temperature as the hybridization. More preferably, it is washed in 0.1 × SSC, 0.1% SDS for 20 minutes, preferably 30 minutes, more preferably 40 minutes.

  The biological species from which the DNA is derived may be, for example, a desired insect or crustacean, preferably a lepidopterous insect or a Coleoptera, more preferably Bombycoidea, Noctuoidea, Examples include insects of Zygaenoidea, Sphingoidea, Yponomeutoidea, and Tenebrionoidea. Specifically, Bombycidae, Saturniidae, and Saga (Noctuidae), Pyralidae, Sphingidae, Yponomeutidae, Tenebrionidae insects, more preferably Bombycidae, Saturniidae, and Tenebrionidae ), More preferably, insects of the genus Bombyx (Bombyx mori, Bombyx mandalina) and the genus Bombyx (Tribolium) .

  Of the transcriptional regulatory region, the region required for JH response or Met binding (JHRE) is considered to occupy only a small part (see Examples). Therefore, the DNA of the transcription regulatory region may be deleted as long as it does not lose JH responsiveness or Met binding activity. The sequence essential for having the activity can be identified by appropriately deleting the region and specifying the region where the activity is maintained (Examples 4 to 6). For example, the present invention relates to a DNA having SEQ ID NO: 9 and having JH response or Met binding property. Such DNAs include -4741 to +116, -4041 to +116, -2763 to +116, -4041 to +968, -2763 to --1695, -2565 to +116,-to BmKr-h1α. 2347 ~ + 116, -2165 ~ + 116, -2165 ~ -2025, -2128 ~ -2045, -2165 ~ -2049, -2165 ~ -2068, -2128 ~ -2049, -2079 ~ -2063, -2079 ~ -2068, -2094 to -2089, -2079 to -2063, -2079 to -2068, -2078 to -2068, -2077 to -2068, or -2076 to -2068, or a JH-responsive fragment thereof or DNA containing Met binding fragments is included. In order to obtain a fragment with JH responsiveness, for example, as described in the Examples, an appropriate fragment is prepared by PCR, restriction enzyme treatment, exonuclease treatment, mutagenesis, etc., and a marker gene is linked downstream thereof. Then, JH responsiveness is examined, and one that retains JH responsiveness may be selected. The sequences of SEQ ID NOs: 12, 34 to 42 are considered to contain at least one of the major JHREs of Kr-h1. DNAs that are fragments of these sequences and have JH responsiveness are included in the present invention. Further, it is suggested that the intron sequence (SEQ ID NO: 15) of BmKr-h1α contains a sequence (JHRE) that causes JH responsiveness. DNA containing SEQ ID NO: 15 or a fragment thereof and having JH responsiveness is included in the present invention. The JH responsiveness of these fragments can be confirmed by the method described in the Examples.

In addition, in the BmKr-h1α, the 3 ′ side of the −2068 position, for example, the −2068 to −2025 region, gradually decreases in JH responsiveness when deleted from the 3 ′ side (FIG. 20). This also suggests that sequences involved in JH responsiveness are included. Therefore, DNA containing sequences contained in these regions is also excellent as the DNA of the present invention. That is, the present invention relates to a DNA comprising the base sequence of -2165 to -2045 or a fragment thereof with respect to BmKr-h1α and having Met binding activity or JH responsiveness (which results in JH responsiveness). . Further, the present invention is a DNA comprising the base sequence of -2165 to -2025 (SEQ ID NO: 11) or a fragment thereof with respect to BmKr-h1α and having Met binding activity or JH responsiveness. Concerning DNA).
In particular, SEQ ID NO: 12 (region of −2165 to −2068 relative to BmKr-h1α), including all or at least the 3 ′ end of a sequence selected from 38 to 42, and more downstream (3 ′, ie −2167 DNA including at least a partial region of ~) is preferred. For example, it includes a partial sequence including any of SEQ ID NO: 12, 38 to 42, or a base at the 3 ′ end thereof, and further includes −2067 to −2045 or a fragment thereof with respect to BmKr-h1α. A DNA having JH responsiveness is included in the present invention. Moreover, JH responsiveness is further increased in a DNA that is further downstream (3 ′), for example, up to −2025 (FIG. 20). SEQ ID NO: 12 or a partial sequence containing a base sequence at the 3 ′ end thereof, and a DNA further comprising -2067 to −2025 or a fragment thereof relative to BmKr-h1α, and comprising JH responsiveness or Met DNA having binding activity is included in the present invention. The present invention also relates to a DNA that comprises the base sequence of the region −2105 to −2068, or −2165 to −2045, or a fragment thereof for BmKr-h1α, and that results in JH responsiveness. The present invention also relates to a DNA comprising the region of -2105 to -2068 or -2165 to -2025 for BmKr-h1α, or a fragment thereof, which brings about JH responsiveness or Met binding by the sequence.

  The DNA may appropriately include a transcription initiation site. There is no particular limitation on the transcription start site, and for example, a transcription start site derived from a lepidopteran insect gene can be linked to the 3 'side. However, the transcription initiation site and the promoter itself do not have to be derived from Kr-h1, and sequences derived from other genes can be used as appropriate (FIGS. 26 and 28). The distance between the fragment containing JHRE and the transcription start site may be adjusted as appropriate. When using the transcription start site of BmKr-h1α, for example, -285 to +116, -192 to +116, -111 to +116, -49 to +116 (SEQ ID NO: 13), or BmKr-h1α The base sequences of those fragments including the transcription start (+1) site can be used, but are not limited thereto. Alternatively, a fragment containing the transcription start site of BmKr-h1β may be used. As a suitable example, DNA containing the sequences of −2165 to −2025 and −49 / + 116 with respect to BmKr-h1α can be exemplified. A DNA comprising a base sequence (SEQ ID NO: 14) in which −2165 to −2025 and −49 / + 116 are linked to BmKr-h1α is particularly suitable as a JH-responsive promoter.

  In addition, the region corresponding to the intron of BmKr-h1α (+131 to +942; SEQ ID NO: 15) maintains JH responsiveness even without it, but as described above, this region also becomes JH responsive. It seems that they are involved. The present invention relates to a DNA comprising a base sequence of an intron of BmKr-h1α or a fragment thereof, which has a Met binding activity or a DNA whose JH responsiveness is increased by the sequence. The increase in JH responsiveness may be due to the presence of the sequence to increase transcription in the presence of JH or JH agonist, or by suppressing transcription in the absence of JH or JH agonist. Alternatively, the transcription induction (induction ratio) in the presence of a JH agonist may be increased. The base sequence of the intron or a fragment thereof may be used in appropriate combination with the transcription start site of BmKr-h1. For example, it can be used in combination with -49 to +116 (SEQ ID NO: 13) of BmKr-h1α. Alternatively, a fragment containing a sequence around the transcription start site of BmKr-h1β (A at position 815 of SEQ ID NO: 9) is also suitable. Further, it is used in combination with -2165 to --2068 (SEQ ID NO: 12) or a JH-responsive fragment sequence thereof, or -2165 to --2045, -2165 to --2025, or a JH-responsive fragment sequence thereof. Is preferred. A DNA containing a BmKr-h1α intron or a partial sequence thereof and increasing JH responsiveness is preferably used particularly in cells such as Sf9 and BmN4.

  The DNA of the present invention does not include DNA of the entire chromosome including the Kr-h1 gene. Further, the present invention does not include DNA that constitutes a fragment chromosome containing the Kr-h1 gene, which is generated, for example, by irradiation or mutagen exposure. Moreover, DNA which consists of a continuous sequence | arrangement (contig etc.) of a silkworm chromosome fragment | piece as shown by accession number AADK01001667 (GI number 54108045; Update Date: Oct 12 2004 7:59 PM) is not contained. The DNA of the present invention preferably has at least a part of the sequence of accession number AADK01001667, for example, a contiguous sequence of 15, 20, 50, 100, 200, 500, and 1000 bases, preferably at least 2, more preferably Does not contain at least 3, 4, 5, 6, or 7 sequences. Specifically, for example, AADK01001667, 1st to 10000th (SEQ ID NO: 29) and / or 24958 to 25957th (SEQ ID NO: 30), preferably at least 2, more preferably at least 3, 4, It does not contain 5, 6, or 7 consecutive 15, 20, 50, 100, 200, 500, 1000 base sequences. For example, the DNA of the present invention does not include SEQ ID NO: 29 or its complementary sequence. More preferably, it does not include a partial sequence of 800 bases or more of SEQ ID NO: 29 or its complementary sequence, more preferably a partial sequence of 600, 500, 400, 300, 200, or 100 bases or a complementary sequence thereof. The DNA of the present invention does not include, for example, SEQ ID NO: 30 or its complementary sequence. More preferably, it does not include a partial sequence of 800 bases or more of SEQ ID NO: 30 or a complementary sequence thereof, more preferably a partial sequence of 600, 500, 400, 300, 200, or 100 bases or a complementary sequence thereof. The DNA of the present invention usually does not contain a natural DNA sequence containing the Kr-h1 gene continuously over 25 kb. Preferably, the DNA of the present invention comprises a natural DNA sequence containing a part of the Kr-h1 gene or a part of the transcriptional regulatory region of the Kr-h1 gene, at least 20 kb or less, preferably 18 kb, 15 kb, It contains only 13 kb, 10 kb, 9 kb, 8 kb, 7 kb, or 6 kb or less.

  The present invention also relates to a desired promoter comprising a DNA having Met binding activity or JH responsive JH responsiveness of the present invention (that is, a DNA containing JHRE). A JHRE may contain one, two, three, four, five, or more copies (eg in tandem). Moreover, as long as it can induce transcription in response to JH, it may be used in either forward or reverse direction. Furthermore, the present invention relates to DNA in which a desired DNA is operably linked to DNA containing JHRE. Functionally linked means that, for example, transcription of linked DNA is linked so as to exhibit JH responsiveness. There is no particular limitation on the DNA to be ligated, and a desired heterologous gene may be ligated. Examples include DNA encoding a protein, DNA encoding a functional RNA (antisense, ribozyme, siRNA, etc.), tag sequence, etc. It is done. Here, the heterologous gene is a gene other than a gene that is naturally linked to JHRE. Of course, the gene (Kr-h1 gene) that is operably linked downstream of the DNA of the transcription regulatory region in nature may be ligated so as not to be exactly the same as the natural sequence. For example, by linking a desired reporter gene, reporter activity can be induced in response to JH. DNA linked to a reporter gene is useful for various assays and screening. Many reporter genes are known, and examples include chloramphenicol acetyltransferase (CAT) gene, lacZ gene, luciferase gene, β-glucuronidase (GUS) gene, and GFP gene.

  Further, the DNA containing JHRE of the present invention may contain an appropriate transcription initiation site as described above. The transcription start site may be that of a gene from which JHRE is derived, or may be that of another gene. For use in lepidopteran insect cells, the transcription start site of lepidopteran insect genes is preferably used. Further, the DNA containing JHRE may contain a transcriptional regulatory sequence (such as a promoter and / or enhancer) of a gene different from the natural gene. For example, JH responsiveness can be imparted to transcriptional activity by combining a desired promoter with the DNA of the transcriptional regulatory region of the present invention having JH responsiveness. For example, a promoter (heterologous promoter) other than the promoter that is naturally bound to JHRE can be suitably used as the promoter. Examples of promoters used in combination include Autographa californica nuclear polyhedrosis virus promoter (for example, immediate-early 1 (IE-1) gene promoter, delayed-early 39K promoter), baculovirus p10 promoter, baculovirus polyhedrin promoter, Examples include a metallothionein promoter, an actin promoter, a ribosomal protein gene, a heat shock protein gene (eg, heat shock protein 70 (hsp70)), and an actin gene (eg, actin A3) promoter (FIG. 26). It can also be combined with a desired promoter used in mammalian cells such as adenoviruses, retroviruses, promoters of viral genes including CMV (cytomegalovirus) and HSV (Herpes simplex virus), actin promoter, EF1α promoter, etc. Good (Figures 28, 29, 31).

The present invention also relates to a DNA encoding a silkworm BmKr-h1 protein (SEQ ID NOs: 2 and 4), a DNA encoding a homologous protein of the silkworm BmKr-h1 protein in lepidopterous insects, and these DNAs. Related to RNA and protein. These nucleic acids and proteins are highly efficiently induced by JH. Therefore, these nucleic acids and proteins are very useful as natural markers for JH.
These proteins and nucleic acids encoding the proteins include polymorphisms and / or mutants. If JH responsiveness is maintained even in a mutated DNA or protein, they can be used as a natural marker for JH. Such mutations include naturally occurring or naturally occurring mutations and artificially introduced mutations. Even if a small amount of the natural sequence is modified, the effect is low, so the original function is not lost, and it is unlikely to affect the survival of the individual (Mark, DF et al., Proc. Natl. Acad. Sci. USA (1984) 81, 5662-5666, Zoller, MJ & Smith, M. Nucleic Acids Research (1982) 10, 6487-6500, Wang, A. et al., Science 224, 1431-1433, Dalbadie-McFarland, G et al., Proc. Natl. Acad. Sci. USA (1982) 79, 6409-6413, Bowie et al., Science (1990) 247, 1306-1310). Thus, mutations from the native sequence are permissible as long as the mutation does not lose viability and JH responsiveness in lepidopteran insect cells. In addition, if a slight mutation is introduced into the base sequence of the original gene or the gene encoding the variant is replaced with the original gene, the variant is expressed under the control of the promoter of the original gene with JH responsiveness. Can be made. Thereby, a tag sequence can be inserted into the original gene, or a specific restriction enzyme site can be introduced or deleted. Since the expression of these DNAs is induced according to JH in an individual, it is useful as a marker for JH assay or screening using the individual.

  Here, the homologous genes and proteins in lepidopterous insects include silkworm genes and protein polymorphisms and mutants other than the genes and proteins isolated in the Examples. In addition, having JH responsiveness means that expression is increased or increased in response to JH or an agonist thereof, and in genes and proteins, in a cell that naturally expresses them, The expression of genes and proteins is induced by JH or an agonist thereof or refers to an increase compared to the absence of JH or an agonist thereof. JH responsiveness is preferably that observed in vitro, eg, in a clonal cell population. Examples of the cells for examining JH responsiveness include insect cells, such as lepidopterous insect fat body cells, embryo-derived cells, ovary-derived cells, and the like. Specifically, BmN4 (Funakoshi Co., Tokyo, Japan), Sf9 (Gidwin, G., et al. 1993, Focus 15, 44; Invitrogen), Sf21 (Harris, R., et al. 1997, Focus 19, 6; Invitrogen), SES-BoMo-C129 (NIAS Genebank (National Institute of Agrobiological Sciences Genebank; Tsukuba, Ibaraki, Japan) MAFF No. 275026; Shigeo Imanishi (1998) Conservation List of Insect Culture Cell Line Research Institute for Silkworm and Insect Agricultural Technology 24: 45-56), SES-BoMo-J125K6 (MAFF No. 275032; Shigeo Imanishi (1998) same as above), NIAS-Bm-aff3 cells (Takahashi, T. et al. (2006) J. Insect Biotech. Sericol. 75: 79-84), Oyanagi2 (Annual Report 2007) , National Institute of Agrobiological Sciences, pp. 37-41). JH may be natural JH or synthetic JH (eg, mesoprene). Synthetic JH includes JH agonists (including JH agonistic JH analogs).

  That is, the present invention includes an amino acid obtained by substituting, deleting, and / or adding one or more amino acids in the amino acid sequence of a silkworm BmKr-h1 protein (for example, SEQ ID NO: 2 or 4) or a homologous protein thereof in Lepidoptera insects. A protein containing a sequence, which includes a protein having JH responsiveness and a DNA encoding the protein. For example, in cells having such DNA in a non-recombinant state, as long as the expression of the DNA (or encoded protein) has JH responsiveness, they are useful as JH markers. The modified amino acid is, for example, within 150 amino acids, preferably within 100, within 80, within 70, within 60, within 50, within 40, within 30, within 20, within 10, or within 1 amino acid. In the present invention, high identity with the amino acid sequence of SEQ ID NO: 2 or 4 (70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% More preferably 95% or more, more preferably 97% or more, more preferably 99% or more, and most preferably 100%), which includes a protein having JH responsiveness. Here, the protein having JH responsiveness means that expression is induced or increased according to JH in a state of being bound under the control of a natural promoter. JH responsiveness can be confirmed, for example, by culturing cells that naturally contain the gene in vitro and adding JH to detect whether the expression of the gene is induced or increased.

  The present invention also includes substitution, deletion, and deletion of one or more bases in the coding sequence of the silkworm BmKr-h1 gene (for example, the CDS of SEQ ID NO: 1 or 3) or a homologous gene coding sequence thereof. DNA containing JH responsiveness and a protein encoded by the DNA are included. The base to be modified is, for example, within 500 bases, preferably within 450, 400, 350, 300, 250, 200, 150, 100, 80, 60, 50, 40, 30 Within 20, 20 within 15, 10 within, or 5 within. In the present invention, high identity (70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably) with the coding sequence (CDS) of SEQ ID NO: 1 or 3 Includes sequences having 90% or more, more preferably 95% or more, more preferably 97% or more, more preferably 99% or more, and most preferably 100%), and DNA encoded by JH responsiveness and encoded therein Contains protein. Here, having JH responsiveness means that transcription of this DNA or expression of the protein encoded therein is induced or increased in response to JH in a state of being bound under the control of a natural promoter.

  The DNA of the present invention includes a probe prepared from a DNA (eg, SEQ ID NO: 1 or 3) encoding the amino acid sequence of the silkworm BmKr-h1 protein (eg, SEQ ID NO: 2 or 4) or a homologous gene thereof in a lepidopterous insect DNA that hybridizes under stringent conditions with a probe prepared from (ortholog) DNA, and includes DNA having JH responsiveness and the protein encoded therein. The present invention also relates to DNA (for example, SEQ ID NO: 1 or 3) encoding the amino acid sequence of the silkworm BmKr-h1 protein (for example, SEQ ID NO: 2 or 4), DNA of its homologous gene (ortholog) in lepidopterous insects, or The present invention also relates to DNAs that hybridize with their complementary strands under stringent conditions and have JH responsiveness and proteins encoded thereby. For example, by preparing a probe from silkworm BmKr-h1 (SEQ ID NO: 1 or 3) and screening a genomic DNA library by hybridization, DNA that hybridizes under stringent conditions can be obtained. Hybridization conditions may be those described in this specification. The probe may be composed of, for example, SEQ ID NO: 1 or 3, a part or all of the coding sequence thereof, or a complementary sequence thereof. DNA isolated by hybridization can be expected to have high responsiveness to JH, similar to silkworm BmKr-h1. That is, the transcribed sequence and the protein encoded therein are induced to be expressed in response to JH, and the transcriptional regulatory region DNA can activate transcription of the functionally linked gene in response to JH. There is expected.

  The above-mentioned protein of the present invention can be appropriately combined with another protein or peptide to form a fusion protein. In order to prepare a fusion protein, DNAs encoding the target protein may be ligated together so that the frames coincide with each other, introduced into an expression vector, and expressed in a host. Other proteins attached to the fusion are not particularly limited, and examples thereof include marker proteins and tag peptides. The present invention relates to a protein comprising a sequence in which a desired amino acid sequence such as a tag or other protein is added to one or both ends of the amino acid sequence shown in SEQ ID NO: 2 or 4, or a fragment thereof, and a nucleic acid encoding the protein. Is included.

  More specifically, for example, FLAG (Hopp, TP et al., BioTechnology (1988) 6, 1204-1210), several (1, 2, 3, 4, 5) , 6, 7, 8, 9, or 10) His (histidine) residue, influenza agglutinin (HA), human c-myc fragment, VSV-GP fragment, p18HIV fragment, T7 tag, HSV tag, Known tag peptides such as SV40T antigen fragments can be mentioned. The length of the polypeptide to be added is, for example, within 50 amino acids, preferably within 30 amino acids, within 25 amino acids, within 20 amino acids, within 15 amino acids, or within 10 amino acids, but is not limited thereto. Examples of other proteins to be fused include GST (glutathione S-transferase), HA (influenza agglutinin), immunoglobulin constant region, β-galactosidase, MBP (maltose binding protein) and the like. Fusion proteins with GST and MBP are often used to recover proteins expressed in vitro (Guan, C. et al. (1987) Gene, 67, 21-30; Maina, CV et al. (1988) Gene, 74, 365-373; Riggs, PD (1990) In Expression and Purification of Maltose-Binding Protein Fusions. FM Ausebel, R. Brent, RE Kingston, DD Moore, JG Seidman, JA Smith and K. Struhl (Eds.), Current Protocols in Molecular Biology, pp. 16.6.1-16.6.10; Bar-Peled and Raikhel (1996) Anal. Biochem. 241: 140-142; Brew K, et al. (1975) JBC 250 (4): 1434-44; H. Youssoufian, (1998) BioTechniques 24 (2): 198-202). By designing a peptidase cleavage sequence at the boundary of the fusion protein, after purifying the protein, the GST or MBP moiety can be cleaved to recover only the target protein.

  The present invention also relates to a vector into which the nucleic acid described herein is inserted. The vector includes a vector containing the DNA of the present invention having JH responsiveness or Met binding property, and a vector containing a DNA encoding the BmKr-h1 protein or the lepidopteran insect homologous protein. The vector is not particularly limited. For example, plasmid, virus vector, phage, cosmid, YAC (yeast artificial chromosome), BAC (bacterial artificial chromosome), PAC (P1-derived artificial chromosome), TAC (transformation-competent artificial chromosome) ) Etc. can be used. Examples of viral vectors include, but are not limited to, baculovirus vectors, retrovirus vectors, adenovirus vectors, adeno-associated virus vectors, and the like. A DNA containing a transcription regulatory region sequence having JH responsiveness or Met binding property (ie, DNA containing JHRE) may or may not have a desired gene bound thereto downstream. For example, multiple cloning sites may be linked so that a desired gene can be inserted later. The present invention includes a vector comprising the JHRE of the present invention, a vector comprising a DNA having a structure in which a foreign gene is operably linked under the control of the JHRE, and downstream of the JHRE (for example, 10, 8, 7, 6, The present invention relates to a vector comprising a DNA having a structure having a site for functionally inserting an arbitrary gene into 5, 4, 3, 2, or 1 kb (or less). Examples of such sites include restriction enzyme recognition sequences, recombinant enzyme target sequences such as clonase, and TA cloning sites. The vector containing JHRE of the present invention is useful as a JH-responsive expression vector. In addition, a DNA encoding a sequence to be transcribed such as a protein coding sequence may be appropriately linked with a desired promoter sequence upstream. The vector may further contain a terminator as appropriate.

  For expression systems using baculovirus vectors, see Bailey MJ, Possee RD (1991): Manipulation of baculovirus vectors. In. Murray EJ (ed): "Methods in Molecular Biology." Clifton, NJ: The Humana Press, vol. 7, pp. 147-168, Patel et al., "The baculovirus expression system", in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al. (Eds.), Pp. 205-244 (Oxford University Press 1995 ), Ausubel (1995) pp. 16-37, 16-57, Richardson (ed.), Baculovirus Expression Protocols (The Humana Press, Inc. 1995), Lucknow, "Insect Cell Expression Technology", in Protein Engineering: Principles and Practice, Cleland et al. (Eds.), Pp. 183-218 (John Wiley & Sons, Inc. 1996) can also be constructed for reference.

The present invention also relates to a host carrying the above vector. The host may be any desired cell and non-human organism, such as E. coli, yeast, plant cells, animal cells, insect cells, nematode cells, plants, non-human animals (eg insects, nematodes (eg Caenorhabditis elegans)) Mammals (for example, rats, mice)) and the like. Insects are especially lepidopterous insects, more preferably Bombycoidea, Noctuoidea, Zygaenoidea, Sphingoidea, Yponomeutoidea, and Dromedary Examples include insects of Tenebrionoidea, and specifically, Bombycidae, Saturniidae, Noctuidae, Pyralidae, Sphingidae, Yponomeutidae, and Ganoderma (Tenebrionidae) insects, more preferably Bombycidae, Saturniidae, and Tenebrionidae insects, such as Bombyx genus (eg Bombyx mori, Bombyx mandalina), Spodoptera frugiper (eg Spodoptera frugiper) And insects such as Tribolium confusum.
Examples of mammalian cells include human cells, mouse cells, rat cells, monkey cells, and examples include, but are not limited to, 293 cells (ATCC CRL-1573) and HeLa cells (ATCC CCL-2).
Examples of insect cells include lepidopteran fat body cells, embryo-derived cells, ovary-derived cells, and the like. Specifically, BmN4 (Funakoshi Co., Tokyo, Japan), Sf9 (Gidwin, G., et al 1993, Focus 15, 44; Invitrogen), Sf21 (Harris, R., et al. 1997, Focus 19, 6; Invitrogen), SES-BoMo-C129 (NIAS Genebank (National Institute of Agrobiological Sciences Genebank; Tsukuba, Ibaraki , Japan) MAFF No. 275026; Shigeo Imanishi (1998) Conservation List of Insect Cultured Cell Lines Research Institute for Silkworm and Insect Agriculture Technology 24: 45-56), SES-BoMo-J125K6 (MAFF No. 275032; Shigeo Imanishi ( 1998) Same as above). NIAS-Bm-aff3 cells (Takahashi, T. et al. (2006) J. Insect Biotech. Sericol. 75: 79-84), Oyanagi2 (Annual Report 2007, National Institute of Agrobiological Sciences, pp. 37-41) Etc. are also preferable. When DNA containing a transcription regulatory region sequence having JH responsiveness is used for JH expression control, JH assay or screening, it is preferably introduced into lepidopterous insect cells. Vectors can be introduced into host cells according to the host and vector, for example, calcium method, calcium phosphate precipitation method (Virology, Vol.52, p.456, 1973), electric pulse perforation method (Current protocols in Molecular Biology edit. Ausubel et al. (1987) Publish. John Wiley & Sons Section 9.1-9.9; Mandel, M. & Higa, A., Journal of Molecular Biology, 1970, 53, 158-162, Hanahan, D., Journal of Molecular Biology, 1983, 166, 557-580), lithium acetate method (BD Yeastmaker Yeast Transformation System 2, BD Bioscience / Clontech), methods using Lipofectamine and various transfection reagents (TransIT ^TM Transfection Reagents, Mirus Bio Corporation), DEAE It can be performed by a known method such as a dextran method or a microinjection method. When introduced into a living body, it can be introduced ex vivo or in vivo.

  Moreover, the transformant is a Met (Methoprene-tolerant) (also called resistance to juvenile hormone (Rst (1) JH) or juvenile hormone resistence protein) gene (Ashok M. et al., Proc. Natl. Acad. Sci. USA 95: 2761-2766, 1998) may be further introduced. Met induces JH-dependent transcription from the JHRE of the present invention. Therefore, by introducing a DNA containing the JHRE of the present invention (sequence that binds to Met) into a host cell that expresses Met, transcription from the DNA can be induced in a JH-dependent manner. In cells that do not endogenously express the Met gene, transcription from JHRE can be induced by introducing and expressing the Met gene (FIGS. 29 to 32). The Met protein is not limited as long as it binds to the DNA of the present invention or induces JH-dependent transcription, and examples thereof include Accession No. NM_001114985.1 (NP_001108457.1) (Bombyx mori juvenile hormone resistence protein II). Other candidates include, for example, NM_001099342.1 (NP_001092812.1) (Tribolium castaneum methoprene-tolerant), AY955097.1 (AAX55681.1) (Aedes aegypti), XM_001864544.1 (XP_001864579.1) (Culex quinquefasciatus ), XM_395005.3 (XP_395005.3) (Apis mellifera), XM_001606725.1 (XP_001606775.1) (Nasonia vitripennis), XM_316059.4 (XP_316059.4) (Anopheles gambiae), NM_078571.2 (NP_511126.2), NM_078605.1 (NP_511160.1) etc.

  The present invention also relates to a non-insect eukaryotic cell into which a Met (Methoprene-tolerant) gene has been introduced. Surprisingly, transcriptional activation by Met was not limited to insect cells (FIGS. 29 and 32). Therefore, Met can be expected to induce transcription from bound DNA in response to JH in general eukaryotic cells. Examples of the Met gene include, but are not limited to, Accession No. NM_001114985.1 (NP_001108457.1) (Bombyx mori juvenile hormone resistence protein II). In order to bind Met to DNA, the JHRE of the present invention can be used. For example, a sequence-specific DNA binding protein can be fused with Met, thereby allowing Met to bind specifically to the target sequence. (FIG. 28). For example, various DNA-binding proteins that bind in a sequence-specific manner can be used as the DNA-binding protein. Examples include binding domains. If JH is added to a non-insect eukaryotic cell having a gene having a target DNA as a transcriptional regulatory region, expression of the gene can be induced in a JH-dependent manner. As the cells, desired eukaryotic cells including mammalian cells, plant cells, yeasts, and nematode cells can be used. The present invention also provides use of the above cells for JH-dependent expression. The present invention also relates to non-human individuals including non-insect eukaryotic cells into which the Met gene has been introduced. Transgenic eukaryotes (such as transgenic animals and transgenic plants) other than insects into which the Met gene has been introduced induce transcription of DNA to which Met binds in response to JH.

  The invention also relates to transgenic animals and plants of the DNA of the invention, as well as organs, tissues and cells into which the DNA has been introduced. The present invention also relates to a knock-in animal in which other DNA is inserted or replaced in an insect (for example, Lepidoptera or Coleoptera) that naturally have the DNA of the present invention. Transgenic animals and plants are useful for in vivo production of the protein of the present invention. In addition, in an insect naturally having the DNA of the present invention, if another gene is knocked in downstream thereof, the gene can be expressed in response to JH. In addition, if a DNA containing JHRE is introduced into a lepidopteran insect such as a silkworm, a desired gene can be expressed in response to JH. When animals are used as hosts, systems using, for example, mammals and insects are well known. As mammals, goats, pigs, sheep, mice, and cattle can be used (Vicki Glaser, SPECTRUM Biotechnology Applications, 1993; Bio / Technology, Vol. 12, p.699-702, 1994). For example, silkworms can be used as insects (Nature, Vol. 315, p. 592-594, 1985; Nature Biotech. 21: 52-56, 2002). When using a plant, for example, tobacco can be used. When tobacco is used, a DNA encoding a desired protein is inserted into a plant expression vector, and this vector is introduced into a bacterium such as Agrobacterium tumefaciens. This bacterium can be infected with tobacco (Nicotiana tabacum etc.) to obtain a desired protein from leaves (Eur. J. Immunol., Vol. 24, p. 131-138, 1994).

  When a protein is expressed from a vector, a recombinant protein can be produced by recovering the expressed protein. The host cell is not particularly limited as long as it is a cell suitable for expression of a recombinant protein, and bacteria such as E. coli, yeast, various animal and plant cells (including insect cells), and the like can be used. Various methods known to those skilled in the art can be used to introduce a vector into a host cell. The recombinant protein expressed in the host cell can be purified and recovered from the host cell or its culture supernatant by methods known to those skilled in the art. As described above, the recombinant protein may be expressed as a fusion protein with another protein. For example, a fusion protein with maltose binding protein (pMAL vector, New England BioLabs), a fusion protein with glutathione S-transferase (GST) (pGEX vector, Amersham Pharmacia Biotech), a protein with a histidine tag (pET vector, Novagen) As a result, it is possible to produce a protein. When a recombinant protein is expressed as a fusion protein with a maltose binding protein or the like, affinity purification can be easily performed using an amylose column or the like. When expressed as a fusion protein with GST, a glutathione column can be purified, and a protein with a His tag added can be purified and recovered using a nickel column.

  Since the protein of the present invention is expressed in response to JH, the protein and the nucleic acid encoding it can be used as a marker for JH. That is, the present invention relates to a JH marker comprising the protein of the present invention or a fragment thereof, or a nucleic acid encoded by them (for example, a transcribed sequence or a part thereof). The present invention also relates to the use of these proteins and nucleic acids as JH markers. Here, JH includes a JH agonist and an agonistic analog of JH. For example, when screening for JH agonists and antagonists, a test compound is added to cells and these markers are detected. A compound that induces expression is a candidate for a JH agonist. It is also possible to screen for JH antagonists by examining expression in the presence of JH.

  Protein expression can be detected by, for example, an antibody that binds to the protein. An antibody can be produced by a well-known method using a polypeptide containing the protein of the present invention or a fragment thereof as an immunogen. That is, the polypeptide containing the protein of the present invention or an antigenic fragment thereof serves as a reagent for preparing a composition for detecting a JH marker containing an antibody that binds thereto. For example, a protein encoding the amino acid sequence of SEQ ID NO: 2 or 4 (BmKr-h1), or a protein encoded by a JH-responsive DNA consisting of a homologous gene in a lepidopteran insect and a fragment thereof, express the expression of the protein. Useful for making antibodies for detection. The length of the fragment may be any immunogenic, for example, 8 amino acids or more, preferably 9 amino acids or more, more preferably 10, 11, 12, 13, 14, 15, 16, 18, 20, 25, 28, 30, 35, 40, 50, or 60 amino acids or more. In addition, an amino acid or a polypeptide may be further added to the fragment. They may be bound to the above fragments as a fusion protein, or may be bound in another binding form, for example, covalently or non-covalently. The number of added amino acids is, for example, 30 amino acids or less, preferably 25, 20, 18, 15, 13, 10, 8, 5, 3, 2 amino acids or less, for example 1 amino acid. For example, when used as an antigen, it can be used by binding to a desired carrier protein such as serum albumin or keyhole limpet hemocyanin (KLH).

  Particularly preferred sites for the fragments include, for example, a fragment consisting of the 1st to 44th positions of SEQ ID NO: 2 (preferably a fragment consisting of the 1st to 34th positions), a fragment consisting of the 228th to 268th positions, a fragment consisting of the 275th to 348th positions, SEQ ID NO: : A fragment consisting of 1 to 57 of 4 (preferably a fragment consisting of 1 to 47, more preferably a fragment consisting of 1 to 15), or a partial sequence of these fragments, at least 8 amino acids, preferably It is a fragment of at least 9, 10, 11, 12, 13, 14, 15, 16, 18, 20, 50, 100 amino acids or more. Polypeptides containing these fragments or fragments consisting of partial sequences thereof are useful for the production of antibodies that bind to them.

  The present invention also relates to an antibody that binds to the protein of the present invention or a fragment thereof. The antibody is preferably a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4 (BmKr-h1) or a homologous protein in a lepidopteran insect and specific to a protein naturally expressed from a gene having JH responsiveness It is an antibody that binds to. Specific binding refers to binding to the protein significantly more strongly than to other proteins, preferably substantially to other proteins (ie compared to controls using non-specific antibodies). An antibody that does not bind (significantly stronger). For example, it is preferable that the protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4 (BmKr-h1) or the binding to homologous proteins in lepidopterous insects is stronger than the binding to homologous proteins of other insects, such as Drosophila homologous proteins . Antibody binding can be determined by a known method, for example, by calculating a dissociation constant (Kd). The antibody of the present invention has an affinity for the homologous protein of Drosophila (accession number NP_477467.1 (GI No. 17137730, Version 1, Undate date: Jan 4 2008 7:45) PM) and accession number NP_477466.1 (GI No. 17137728, Version 1, Undate date: Jan 4 2008 7:45 PM)) (SEQ ID NOs: 6 and 8), preferably Significantly, more preferably 2 times or more, more preferably 5, 8, 10, 20, 50, 100, 200 times or more. Alternatively, when the antibody is targeted to the same number of moles of protein, it is preferably significantly higher in signal intensity for the lepidopteran homologous protein than Drosophila homologous protein, more preferably more than twice, more preferably 5, 8, 10, 20, 50, 100, 200 times higher. Protein detection using an antibody can be performed by a well-known method such as Western blotting or immunoprecipitation. In particular, a fragment that does not match a fragment of a Drosophila homologous protein (preferably an identity of 80% or less, such as 75, 70, 65, or 60% or less), for example, a fragment consisting of positions 1 to 44 of SEQ ID NO: 2. (Preferably a fragment consisting of 1 to 34), a fragment consisting of 228 to 268, a fragment consisting of 275 to 348, a fragment consisting of 1 to 57 of SEQ ID NO: 4 (preferably a fragment consisting of 1 to 47) , More preferably a fragment consisting of the 1st to 15th positions), or a partial sequence thereof, which is at least 8 amino acids, preferably at least 9, 10, 11, 12, 13, 14, 15, 16, 18, 20 Antibodies that bind fragments of 50, 100 amino acids or more are preferred in the present invention.

  As described above, the antibody of the present invention can be prepared by using the protein of the present invention or a partial peptide thereof as an antigen. For example, a polyclonal antibody can be prepared from serum obtained by immunizing an immunized animal such as a rabbit with the purified protein of the present invention or a part of the peptide, collecting blood after a certain period, and removing the blood clot. is there. In addition, the monoclonal antibody is obtained by fusing an antibody-producing cell of an animal immunized with the protein or peptide and a bone tumor cell, and isolating a single clone cell (hybridoma) that produces the target antibody. (Antibodies: A Laboratory Manual, E. Harlow and D. Lane, ed., Cold Spring Harbor Laboratory (Cold Spring Harbor, NY, 1988)). The antibody thus obtained can be used for detection of the protein of the present invention. The antibodies of the present invention include polyclonal antibodies, monoclonal antibodies, and polypeptides (including Fab, Fab ′, F (ab ′) 2, Fv, and single chain Fv (scFv)) containing the antigen-binding portion of these antibodies. included. The present invention also relates to compositions comprising the above antibodies, such as antisera.

  The JH-responsive gene of the present invention and its expression can also be detected by Northern hybridization or RT-PCR using a probe or primer prepared based on the DNA of the present invention. The present invention relates to a gene (eg, SEQ ID NO: 1 or 3) encoding an amino acid sequence of a silkworm BmKr-h1 protein (eg, SEQ ID NO: 2 or 4) or a base sequence of a homologous gene in a lepidopteran insect or a complementary sequence thereof. The present invention relates to a nucleic acid containing at least a part of Such a nucleic acid is preferably a sequence to be transcribed (especially CDS) of the above gene (SEQ ID NO: 1 or 3 or a homologous gene thereof in Lepidoptera) or a complementary sequence thereof of at least 15 nucleotides, more preferably Contains 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 30, 33, 35, 40, 45, 50, 55, 60, 100, 200, 300 nucleotides or more. Further, such a nucleic acid preferably does not partially contain a base sequence of another gene adjacent on the genome (for example, a sequence to which the adjacent gene is transcribed) or a complementary sequence thereof. Such a nucleic acid includes, for example, 20,000 or more consecutive nucleotides of the nucleotide sequence of the above-mentioned gene (SEQ ID NO: 1 or 3 or a homologous gene in the lepidopterous insect) or a complementary sequence thereof. No nucleic acids, e.g. 15000, 10000, 8000, 5000, 3000, 2000, 1000, 500, 300, 250, 200, 150, 100, 80, 60, 50, 45, 40, 35, 30, 25, or 20 It may be a nucleic acid containing no more than nucleotides. The total length of the nucleic acid is 20000 nucleotides or less, for example, 15000, 10000, 8000, 5000, 3000, 2000, 1000, 500, 300, 250, 200, 150, 100, 80, 60, 50, 45, 40, 35, 30 , 25, or 20 nucleotides or less. These nucleic acids are useful as probes or primers for detecting gene expression or as probes or primers for isolating homologous genes in lepidopteran insects.

  The present invention also relates to a nucleic acid that hybridizes under stringent conditions to a silkworm BmKr-h1 gene (SEQ ID NO: 1 or 3), a DNA comprising a homologous gene in a lepidopteran insect, or a DNA comprising a complementary sequence thereof. . The stringent conditions are specifically the conditions described in the present specification. Such a nucleic acid is preferably 70%, preferably 80%, 90%, 95% or more identical to the base sequence of the homologous gene in SEQ ID NO: 1 or 3 or a homologous gene thereof in Lepidoptera or a complementary sequence thereof. Have sex. The total length of the nucleic acid is 20000 nucleotides or less, such as 15000, 10000, 8000, 5000, 3000, 2000, 1000, 500, 300, 250, 200, 150, 100, 80, 60, 50, 45, 40, 35, 30, It may be 25 or 20 nucleotides or less.

  The nucleic acid is preferably a nucleic acid that specifically hybridizes to the silkworm BmKr-h1 gene (SEQ ID NO: 1 or 3) or its homologous gene in Lepidoptera insects or DNA consisting of its complementary sequence. Specifically hybridizing means to hybridize significantly more strongly with respect to the DNA or the DNA comprising its complementary sequence than to other nucleic acids, and preferably substantially (i.e., back to the other nucleic acids). Significantly stronger than ground) means not hybridizing. For example, hybridization to DNA consisting of SEQ ID NO: 1 or 3, or a homologous gene in a lepidopteran insect or a complementary sequence thereof is performed by homologous genes of insects other than lepidopteran, for example, a Drosophila homologous gene (accession number NM_058119 (GI No 24582139, Version 3, Undate date: Jan 4 2008 7:45 PM) and accession number NM_058118 (GI No. 24582138, Version 3, Undate date: Jan 4 2008 7:45 PM)) (SEQ ID NOs: 5 and 7) Alternatively, those stronger than hybridization to DNA consisting of complementary sequences thereof are preferred. The intensity of hybridization of nucleic acids can be determined by a well-known method, for example, by performing hybridization on a membrane blotted with the same number of moles and comparing the intensity of signals. The hybridization conditions may be, for example, the conditions described in this specification, and can be appropriately adjusted by increasing the temperature or the like in order to maximize the difference between the two signals. The nucleic acids of the present invention preferably have a hybridization signal to the silkworm BmKr-h1 or lepidopteran homologous gene that is at least two times higher than that to the Drosophila homologous gene, under some optimized hybridization conditions. As described above, more preferably 5, 8, 10, 20, 50, 100, 200 times higher. The difference in melting temperature (Tm) is, for example, 5 ° C. or more, preferably 7, 8, 9, 10, 11, 12, 13, 14, 15, 18, 20, 25, 30 ° C. or more.

  In addition, the Tm of the above-described nucleic acid with respect to a completely complementary DNA is, for example, 50 ° C. or higher, preferably 55, 56, 57, 58, 59, 60, 61, 62 under a monocation concentration of 150 mM and no formamide. 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, or 75 ° C or higher. Tm = 2x (A + T) + 4x (G + C) if the nucleotide is about 20mer, DNA / DNA hybrid is Tm = 81.5 + 16.6 (log (M)) + 0.41 (% GC)-500 / n, the DNA / RNA hybrid is approximated by Tm = 79.8 + 18.5 (log (M)) + 0.58 (% GC)-11.8 (% GC) ^ 2-820 / n (Where M is the molar concentration of the monocation and n is the length of the chain of nucleotides). A 1% mismatch increases Tm by about 1.4 ° C (Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994); Wetmur JG, Davidson N (1968) J Mol Biol 31: 349-370; Casey J , Davidson N (1977) Nucleic Acids Res 4: 1539-1552).

  The above-mentioned nucleic acid, antibody, and polypeptide containing an antigen binding site of an antibody can be used as a reagent for detecting the gene and protein of the present invention. In addition, since the expression of the gene and protein of the present invention is induced or promoted in response to JH, JH assay can be performed by detecting the expression using the nucleic acid or antibody. The present invention relates to the use of the nucleic acid, antibody, or polypeptide comprising an antigen binding site of an antibody in an assay of JH, use in JH detection, and use in JH measurement. The present invention also relates to a JH detection agent containing the nucleic acid, antibody, or polypeptide containing an antigen binding site of the antibody, and a JH measurement agent. These reagents can be used alone or, for example, in the case of a nucleic acid, a sense strand primer and an antisense strand primer may be combined. A primer pair of a sense strand and an antisense strand is useful for detecting the expression of the gene of the present invention by RT-PCR. The present invention also relates to a composition for JH assay, a composition for JH detection, and a composition for JH measurement, comprising the nucleic acid, antibody, or polypeptide containing the antigen binding site of the antibody. The composition may be combined with a suitable carrier and / or vehicle, such as water, saline, pH buffer, other desired pharmaceutically acceptable carriers. The present invention also relates to a package and kit comprising (a) the nucleic acid, antibody, and polypeptide comprising the antigen-binding site of the antibody, and (b) JH, an agonist or antagonist thereof. This package and kit can be used for detection, assay or measurement of JH.

  The present invention also relates to the use of the DNA of the present invention having JH responsiveness or Met binding activity in the expression control by JH (including JH agonist) or JH antagonist. Here, the expression control is to increase and / or decrease the expression by JH and / or JH antagonist. JH-responsive DNA containing sequences in the transcriptional regulatory region (DNA containing JHRE) can control the expression of DNA under its control in response to JH or JH antagonists. Thus, for example, expression can be increased by adding a JH or JH agonist, and expression can be decreased by removing the JH or JH agonist. Expression can be suppressed by a JH antagonist, and expression can be increased by removing the JH antagonist. For expression control, the target DNA is placed under the control of the DNA of the present invention (DNA containing JHRE) having JH responsiveness or Met binding activity. That is, the present invention expresses the expression of the DNA by JH (including JH agonist) or JH antagonist, comprising placing the target DNA under the control of the DNA of the present invention having JH responsiveness or Met binding activity It relates to a method for producing a controllable DNA construct. Also, a method of controlling expression of the target DNA with JH (including JH agonist) or JH antagonist, comprising adding or removing JH (including JH agonist) or JH antagonist to cells containing this DNA construct. Related. The present invention also provides an enhancer comprising the DNA of the present invention having JH responsiveness or Met binding activity. An enhancer is a sequence for enhancing transcription. The enhancer of the present invention is used to activate transcription in response to JH. An enhancer can be used by being incorporated into a transcriptional regulatory region of a nucleic acid containing an expression unit such as an expression vector. A sequence for activating transcription in response to JH is also referred to as a JH response element. The present invention provides the use of a DNA of the present invention having JH responsiveness or Met binding activity as a JH response element. A JH response element can be incorporated into a transcriptional regulatory region of a nucleic acid containing an expression unit such as an expression vector and used to express a downstream gene in response to JH. When expression is controlled by JH, ecdysone can be further combined. As ecdysone, 20-hydroxyecdysone (20E) can be used. By combining JH (including a JH agonist) and ecdysone, the expression inducing effect can be enhanced compared to JH alone. Examples of the DNA used include, for example, the DNA of the transcriptional regulatory region of the silkworm gene encoding the amino acid sequence of SEQ ID NO: 2 or 4, and the DNA containing the sequence of the transcriptional regulatory region of the homologous gene in lepidopterous insects. DNA having hormone responsiveness is included. Furthermore, in DNA comprising the sequence of these transcriptional regulatory regions, DNA having one or more bases substituted, deleted, and / or added, having juvenile hormone responsiveness, and their transcriptional regulatory regions DNA that hybridizes under stringent conditions with a probe prepared from a DNA comprising the sequence, and that has juvenile hormone responsiveness.

  For example, expression of the target DNA can be controlled under the control of the DNA of the present invention by functionally linking the target DNA downstream (3 ′ side in the sense strand) of the DNA of the present invention. “Functionally linked” refers to the binding of target DNA such that transcription of the target DNA is induced or promoted in response to JH. As the promoter, a desired promoter can be used as appropriate. Functionally linking DNA having promoter activity and a target gene can be easily performed by those skilled in the art using general genetic engineering techniques. Even if the JHRE of the present invention is not directly linked to the target DNA, it can be indirectly arranged so that transcription of the target DNA is induced or promoted according to JH. For example, a DNA construct is created in which a target DNA is linked downstream of a constitutive promoter (constantly activated promoter) and a spacer DNA sandwiched between a pair of target sequences of sequence-specific recombinase is inserted between them. To do. The spacer DNA preferably contains a transcription termination sequence (terminator), or a stop codon may be present so as to prevent protein translation. Then, DNA encoding the sequence-specific recombinant enzyme is ligated downstream of the promoter containing JHRE. In response to JH, a sequence-specific recombinant enzyme is expressed from a promoter containing JHRE, thereby removing the spacer DNA between the constitutive promoter and the target DNA and inducing target DNA expression. Thus, a promoter containing JHRE and a target DNA can be indirectly linked functionally, and the target DNA can be placed under the control of a promoter containing JHRE. As the sequence-specific recombinase, Cre recombinase and Flp recombinase are often used. The present invention also relates to a nucleic acid in which a DNA encoding a sequence-specific recombinant enzyme such as Cre recombinase or Flp recombinase is bound downstream of the JH-responsive DNA of the present invention (DNA containing JHRE). Regulation of expression by JHRE can be performed in vitro and in vivo. Transgenics in which DNA containing JHRE is introduced into lepidopterous insects can be used to control the expression of the gene of interest in response to JH. It is also useful in the JH assay and screening described below.

  The present invention also relates to an expression control agent (expression inducer, inhibitor) by JH or an antagonist thereof, including the DNA having JH-responsive transcription activity of the present invention (DNA containing JHRE). This regulator can control the expression of a downstream gene in response to JH or the like by incorporating it into a transcriptional regulatory region (that is, use as a JH-responsive transcription enhancer). The control agent can also be used as a decoy to inhibit the JH response. The present invention also relates to the use of the DNA containing the JHRE of the present invention in controlling expression by JH or its antagonist. In addition, the present invention controls the expression of a target DNA, including a step of acting and / or removing JH or its antagonist in a cell containing the target DNA placed under the control of the DNA containing JHRE. Relates to methods (promoting and / or suppressing respectively).

The present invention also includes (a) DNA having JH-responsive transcription activity of the present invention (DNA containing JHRE), and (b) a nucleic acid encoding Met (Methoprene-tolerant) or a cell into which the nucleic acid has been introduced. Package and kit. Examples of the Met gene include, but are not limited to, Accession No. NM_001114985.1 (NP_001108457.1) (Bombyx mori juvenile hormone resistence protein II). The package and kit may further comprise JH, an agonist or antagonist thereof. The present invention also relates to (a) DNA having JH-responsive transcription activity of the present invention (DNA containing JHRE), and (b) a package and kit containing JH, an agonist or antagonist thereof. These packages and kits are useful for controlling target DNA expression by JH or its agonists and antagonists. The package and kit can further include cells. As the cell, a cell expressing Met is preferable. The present invention also relates to a package and kit comprising (a) DNA having JH-responsive transcription activity of the present invention (DNA containing JHRE), and (b) Lepidoptera or Coleoptera insect cells. Lepidoptera or Coleoptera insect cells are not particularly limited, but cells having high JH responsiveness are preferred. Preferred cells include, for example, Bombycoidea, Noctuoidea, Zygaenoidea, Sphingoidea, Yponomeutoidea, Tenebriodonida insect cells Specifically, Bombycidae, Saturniidae, Noctuidae, Pyralidae, Sphingidae, Yponomeutidae, Tenebrionidae, More preferably, Bombycidae, Saturniidae, and Tenebrionidae, such as Bombyx insects (such as Bombyx mori, Bombyx mandalina), Spodoptera insects (such as Spodoptera frugiperda), ) Cells. In particular, cells derived from fat body cells, embryo-derived cells, ovary-derived cells and the like can be used.
More specifically, BmN4 (Funakoshi Co., Tokyo, Japan), Sf9 (Gidwin, G., et al. 1993, Focus 15, 44; Invitrogen), Sf21 (Harris, R., et al. 1997, Focus 19 , 6; Invitrogen), SES-BoMo-C129 (NIAS Genebank MAFF No. 275026), SES-BoMo-J125K6 (MAFF No. 275032), NIAS-Bm-aff3 cells (Takahashi, T. et al. (2006) J Insect Biotech. Sericol. 75: 79-84), Oyanagi2 (Annual Report 2007, National Institute of Agrobiological Sciences, pp. 37-41), and the like.

  The present invention also relates to a method for detecting transcriptional activity, comprising a step of detecting the transcriptional activity of DNA having JH-responsive transcriptional activity (DNA containing JHRE) according to the present invention. The present invention also provides a method for assaying JH action, which comprises the step of detecting the transcriptional activity of DNA having JH-responsive transcriptional activity (DNA containing JHRE). Specifically, the assay method for JH action includes (a) a step of detecting the transcription activity of the DNA (DNA containing JHRE), (b) an increase in transcription activity is an increase in JH action, and a decrease in transcription activity is JH A step of relating to a reduction in action. Here, JH activity assay refers to qualitative and / or quantitative measurement of JH, JH agonist, or JH antagonist, or their activity, detection of the presence or absence of these activities, determination of activity level, etc. It may be. Transcriptional activity of DNA containing JHRE increases according to JH. Therefore, it can be seen that if the transcription activity is increased, the action of JH is increased, and if the transcription activity is decreased, it is understood that the action of JH is reduced. For example, transcriptional activity can be measured for two samples, and the level of JH action can be compared by the difference in transcriptional activity between the two samples. The two samples may be samples different from each other, or may be the same sample measured at different times. Moreover, the JH level contained in the other sample can also be quantified by using one sample whose JH concentration is known in advance. Such a method is also included in the above-described method of the present invention.

This assay is a natural lepidopteran insect or a cell thereof containing DNA containing JHRE (eg, non-genetically recombinant or genetically modified but recombined for DNA that does not contain DNA containing JHRE of the present invention) Or a cell or individual (for example, Lepidoptera or Coleoptera insect cells) or a lepidopterous or Coleoptera insect introduced with a suitable heterologous gene linked to JHRE-containing DNA. It can also be implemented. Further, as long as transcription from JHRE is activated in response to JH, it can be performed using desired cells other than insect cells. For example, cells that forcibly express Met can also be used (FIGS. 29 and 32). ). When using insect cells into which DNA containing JHRE has not been introduced, the expression of endogenous Kr-h1 mRNA or Kr-h1 protein can be detected. When using cells into which DNA containing JHRE has been introduced, the expression of the gene under its control may be detected.If a reporter gene is ligated downstream of DNA containing JHRE, the expression of that gene is When recombinase or the like is linked and other genes are expressed indirectly by the Cre / loxP system, the expression of the gene serving as an indicator may be detected as appropriate. In addition, this assay may be performed using cells, tissues, or individuals, and includes, for example, in vitro assays using cultured cell systems, tissue culture systems, or organ culture systems, and in vivo assays using individuals. . Cells, tissues, organs, and individuals to be used are appropriately selected, but preferably lepidopterous or Coleopterous insects such as Bombycoidea, Noctuoidea, Zygaenoidea, and Spermidae (Sphingoidea), Suga superfamily (Yponomeutoidea), Tenebrionoidea superfamily (Tenebrionoidea) Insects, specifically, Bombycidae, Saturniidae, Saturniidae, Noctuidae, Maigaidae ( Pyralidae), Sphingidae, Yponomeutidae, Tenebrionidae insects, more preferably Bombycidae, Saturniidae, and Tenebrionidaby insects, such as Bomberidae For example Bombyx mori, Bombyx mandalina), Spodoptera insects (eg Spodoptera frugiperda), and the genus Tricholium (genus Tribolium) Those derived from is used. In particular, cells derived from fat body cells, embryo-derived cells, ovary-derived cells and the like can be preferably used.
More specifically, BmN4 (Funakoshi Co., Tokyo, Japan), Sf9 (Gidwin, G., et al. 1993, Focus 15, 44; Invitrogen), Sf21 (Harris, R., et al. 1997, Focus 19 , 6; Invitrogen), SES-BoMo-C129 (NIAS Genebank MAFF No. 275026), SES-BoMo-J125K6 (MAFF No. 275032), NIAS-Bm-aff3 cells (Takahashi, T. et al. (2006) J Insect Biotech. Sericol. 75: 79-84), Oyanagi2 (Annual Report 2007, National Institute of Agrobiological Sciences, pp. 37-41), and the like.

  The above assay is particularly useful for testing the effect of various compounds on JH action. That is, the present invention is a method for assaying JH action, comprising the step of detecting the transcription activity of DNA having JH-responsive transcription activity of the present invention (DNA containing JHRE), wherein the step comprises the presence of a test compound. The method relates to a method for detecting the effect of a test compound on the action of JH. That is, the present invention provides a method for detecting the effect of a test compound on the action of JH, comprising the step of detecting the transcriptional activity of the DNA in the presence of the test compound. The present invention also relates to a method for detecting the effect of a test compound on the transcription activity, which comprises the step of detecting the transcription activity of the DNA in the presence of the test compound. When the test compound has JH activity, transcriptional activity increases. By detecting it, qualitative or quantitative detection of JH action becomes possible. To quantify JH activity, for example, one or more samples containing a predetermined concentration of JH may be used as a reference and compared with those values.

  Specifically, the present invention includes (a) a step of detecting the transcription activity of the DNA of the present invention having JH-responsive transcription activity (DNA containing JHRE) in the presence of the test compound, and (b) depending on the test compound. Increasing the transcriptional activity includes an assay method comprising a step relating to an increase in JH action, and a decrease in transcriptional activity is related to a reduction in JH action. When detection is performed using natural cells, tissues, or individuals, the expression of the JH marker (Kr-h1 mRNA or protein) of the present invention is detected. When a reporter assay is performed, a reporter gene is expressed under the control of DNA containing JHRE, and the expression level of the reporter gene is measured. A compound that induces or increases expression in the absence of a test compound or in the presence of a low concentration is a candidate for a JH agonist. The present invention also relates to a method for screening a compound that increases the action of JH, further comprising the step of selecting such a compound.

  The test compound is not particularly limited. For example, a natural compound, an organic compound, an inorganic compound, a protein, a single compound such as a peptide, a compound library, an expression product of a gene library, a cell extract, a cell culture supernatant And fermented microorganism products, marine organism extracts, plant extracts, prokaryotic cell extracts, eukaryotic single cell extracts, animal cell extracts, and the like. The test compound may be applied alone or in combination with other compounds. For example, a test sample that may contain an unknown compound may be used. The test compound is administered, for example, by adding the cells to a culture medium, orally administering to an individual, or injection. When the test compound is a nucleic acid or protein, for example, a vector may be introduced for expression. If the test compound changes the expression level as compared to the case where it is measured in the absence of the test compound (control), it can be seen that the test compound is a compound that regulates the transcriptional activity of JHRE.

  When the test compound has activity as a JH antagonist, transcriptional activity decreases. By detecting it, qualitative or quantitative detection of the activity that antagonizes JH action becomes possible. When assaying for JH antagonists, for example, the assay may be performed in the presence of JH or a JH agonist. That is, the present invention relates to a method for assaying JH action, comprising the step of detecting the transcription activity of DNA having JH-responsive transcription activity (DNA containing JHRE), which comprises (i) a test compound, and ( ii) It relates to a method for detecting the activity of a test compound which is carried out in the presence of JH or a JH agonist and thereby reduces JH action. More simply, the present invention relates to a method for detecting the effect of a test compound on the action of JH (particularly the effect of reducing the action of JH), comprising (i) a test compound, and (ii) a JH or JH agonist. A method comprising detecting the transcriptional activity of the DNA in the presence of. The present invention also relates to a method for detecting the effect of a test compound on the transcription activity, comprising the step of (i) test compound, and (ii) detecting the transcription activity of the DNA in the presence of JH or JH agonist. Also related.

  Specifically, the present invention relates to (a) (i) a test compound, and (ii) transcription of the DNA of the present invention having JH-responsive transcription activity (DNA containing JHRE) in the presence of JH or a JH agonist. An assay method comprising a step of detecting an activity, and (b) an increase in transcription activity by a test compound is associated with an increase in JH action, and a decrease in transcription activity is associated with a decrease in JH action. A compound that decreases expression compared to the absence of a test compound or the presence of a low concentration is a candidate for a JH antagonist. The present invention also relates to a method for screening a compound that reduces the action of JH, further comprising the step of selecting such a compound. In conducting the assay and screening, please refer to the following literature: "Survey Report on Insect Technology Research" March 2007 Agricultural, Forestry and Fisheries Advanced Technology Industry Promotion Center pp. 30-31, pp. 85- 87, pp. 193-197; Insect technology research and its industrial use (2005) Kawasaki Kenjiro, Noda Hiroaki, Kiuchi Shin Supervised by CMC Publishing pp. 190-197; WO01 / 002436; WO97 / 13864; WO98 / 46724; 2004-283080.

  The present invention also relates to a method for allowing the Met protein to interact with the DNA, comprising the step of causing the DNA of the present invention having JH responsiveness or Met binding activity and the Met protein to coexist in the presence of JH or a JH agonist. In the present invention, it was found that the Met protein is a transcriptional activator that binds to JHRE. By binding both, transcription of a gene downstream of the DNA can be activated. In addition, if a compound that regulates the binding between the two is screened, a compound that regulates the JH action can be obtained. For example, by detecting the interaction between Met such as pests and natural enemy insects and JHRE, it becomes possible to assay and screen JH agonists and antagonists for those organisms.

  The present invention also relates to a method for detecting the binding between the DNA and the Met protein, comprising the steps of contacting a DNA having a JH responsiveness or a Met binding activity with a Met protein, and detecting the binding between the two. The contact between the two is appropriately performed in the presence of JH, JH analog or the like. The present invention also detects the effect of a test compound on the binding, comprising the steps of bringing the DNA into contact with the Met protein in the presence of the test compound, and detecting the binding between the DNA and the Met protein. On how to do. If the binding is enhanced compared to the absence of the test compound, the compound is determined to be a compound that promotes the binding. If the binding decreases compared to the absence of the test compound, the compound is determined to be a compound that inhibits the binding. By selecting a compound that enhances or decreases the binding, screening of a compound that promotes or suppresses the binding between the DNA and the Met protein can be performed.

  The compound obtained by screening can be used as a JH agonist or JH antagonist, and can be used, for example, to control molting or metamorphosis by controlling the action of JH. The compound can be appropriately combined with a desired carrier and / or medium to form a composition. Examples of the carrier and / or medium include sterilized water, physiological saline, vegetable oil, surfactant, lipid, solubilizer, buffer, preservative and the like. These compounds and compositions are insect-specific insecticides, insect development inhibitors (IDI), and insect growth regulators (IGR) that use JH disruption. Can be used as etc.

  EXAMPLES The present invention will be described in more detail with reference to examples below, but the present invention is not limited to these examples. All documents cited in this specification are incorporated as a part of this specification.

[Example 1] Cloning of silkworm Kruppel-homolog 1 (BmKr-h1) cDNA
Construction of EST database derived from full-length Arata body cDNA Approximately 2000 silkworm 4th instar larvae (breed; flapping) were dissected to collect Arata bodies (including lateral heart bodies), and total RNA was extracted. Using the obtained 20 μg of RNA, a full-length Arata cDNA library was prepared by the V-capping method (Hitachi High-Tech Science Systems). 20,000 clones were randomly extracted from this library and sequenced from the 5'- and 3'- sides to construct a database consisting of about 30,000 EST sequences.

BmKr-h1 cDNA and gene sequence and structure Six clones that were thought to be derived from the same gene were identified from the silkworm larva body full-length EST database constructed above. When the amino acid sequence that can be encoded by these 6 clones was examined, it was homologous to the amino acid sequence of Drosophila Kruppel-homolog 1 (Kr-h1; CG18783) (SEQ ID NOs: 6 and 8) and considered to be an ortholog. It was. Among them, 5 clones (fcaL-P41K11, fcaL-P35K20, fcaL-P53H11, fcaL-P02L21, fcaL-P07E22) had the same 5 ′ terminal sequence and were considered to be full-length cDNAs. The other clone (fcaL-P37A01) had a different 5 ′ end sequence and was considered to be an isoform transcribed from a different promoter.
Two clones (fcaL-P02L21, fcaL-P07E22) were selected from the former and the full-length sequence was sequenced. This sequence was registered in DDBJ as BmKr-h1 (α-isoform) (accession number; AB360766).
The base sequence of BmKr-h1 cDNA is shown in SEQ ID NO: 1, and the predicted amino acid sequence is shown in SEQ ID NO: 2. The cDNA was 1918 bp and contained 123 bp of 5′-UTR, 1047 bp of ORF (124-1170 (including stop codon)), and 748 bp of 3′-UTR. The ORF encoded a peptide consisting of 348 amino acid residues (SEQ ID NO: 2). The homology between the orthologues of silkworm (BmKr-h1), Drosophila (DmKr-h1), Butterfly (TcKr-h1) and honeybee (AmKr-h1) is 32.4%, 37.7%, 42.0, respectively. % Met.

[Example 2] Structure of BmKr-h1 gene
The silkworm genome sequence registered in NCBI was searched using the BmKr-h1 cDNA sequence, the DNA sequence containing the BmKr-h1 gene was identified, and the gene structure and the promoter sequence were identified by comparing the two.
Specifically, as a result of searching (blastn) the silkworm genome sequence registered in NCBI using the BmKr-h1 cDNA sequence described above, genome fragment sequence information (25957 bp) containing the same gene was obtained (DDBJ accession number) AADK01001667). As a result of comparing the BmKr-h1 cDNA sequence and the genomic sequence (AADK01001667), the BmKr-h1α gene is composed of a first exon (130 bp), a second exon (1788 bp) and an 812 bp intron, and the translation is 124 bp of the first exon. And was expected to stop at 1170 bp (position in cDNA) of the second exon (FIG. 1).
On the other hand, the gene structure of β-isoform has a transcription initiation site and translation initiation codon in the middle of α-isoform intron, and is a single exon linked in-frame with the second exon of α-isoform. (Fig. 2). The base sequence and encoded amino acid sequence of β-isoform cDNA are shown in SEQ ID NOs: 3 and 4, respectively. The β-isoform consists of 361 amino acid residues, and the N-terminal two residues of the α-isoform and the N-terminal 15 residues of the β-isoform were sequences unique to each isoform.

[Example 3] Induction of BmKr-h1 gene by JH (quantitative PCR)
Various silkworm cultured cells were treated with JH (including JH mimic), RNA was extracted, and it was examined by quantitative RT-PCR whether the BmKr-h1 gene was induced by JH. In addition, as a control experiment, we examined the response to molting hormone (20-hydroxyecdysone) and JH analogues. For comparison, the response of DmKr-h1 gene to JH in Drosophila S2 cells was also examined. Detailed experimental procedures are shown below.

[Method]
Cell culture and hormone-treated silkworm fat body-derived cell line NIAS-Bm-aff3 (abbreviated as aff3; Takahashi, T. et al., J. Insect Biotech. Sericol. (2006) 75: 79-84), silkworm embryo-derived cells Strain SES-BoMo-J125K6 (abbreviated as K6; NIAS Genebank MAFF No. 275032; Shigeo Imanishi (1998) Conservation List of Insect Cultured Cell Line Research Institute for Silkworm and Insect Agricultural Technology 24: 45-56), Oyanagi2 (also oy2) Abbreviated; Annual Report 2007, National Institute of Agrobiological Sciences, pp. 37-41), NIAS-Bm-M1 (abbreviated as M1; Suzuki MG, et al., Mol. Cell. Biol. 28: 333-343, 2008) ), SES-BoMo-C129 (abbreviated as C129; MAFF No. 275026; Shigeo Imanishi (1998) ibid), Drosophila-derived cell line S2 (Invitrogen) and yaga Spodoptera frugiperda-derived cell line Sf9 (Invitrogen) were used in the experiment. Each cell line was cultured in the following medium. aff3, IPL41 + 10% or 15% FBS; K6, MGM448 + 10% FBS; oy2, IPL-41 + 15% FBS; M1, IPL-41 + 15% FBS; C129, MGM448 + 10% FBS; S2, Schneider's Drosophila Medium (Invitrogen) + 10% FBS; Sf9, Sf900 II SFM (Invitrogen).
JH I (SciTech) or mesoprene (SDS Biotech) was used as juvenile hormone (JH). 20-hydroxyecdysone (20E) was from Sigma. The solution was transferred to a liquid vial that was coated with JH dissolved in toluene or methanol with PEG 20000, and then the solvent was removed with a nitrogen stream, a predetermined amount of an appropriate medium was added to a predetermined concentration, and dissolution was performed by sonication. The same medium was treated with only the solvent as a control. JH treatment was performed by removing the old medium and adding medium containing JH or containing no JH as a control. In the normal test, a commercially available 24-well or 96-well plastic plate for cell culture was used, but in the concentration response test, a siliconized glass test tube (diameter 12 mm x 75 mm) was tested to prevent adsorption of JH to the container. Used for.

Quantitative PCR
Total RNA was extracted from the cultured cells using RNeasy ^™ Plus Mini Kit (QIAGEN) or TRIzol ^™ (Invitrogen), and 1st strand cDNA was prepared by reverse transcription reaction. Preparation of the cDNA, Advantage-RT-for-PCR kit (Clontech), carried out using any of the Ready-To-Go T-Primed First-Strand Kit (GE Healthcare), or PrimeScript ^TM RT reagent Kit (Takara) It was. Using the obtained cDNA as a template, the expression levels of Kr-h1 gene and ribosomal protein rp49 (internal standard) were measured by real-time quantitative PCR, and the ratio of the expression level of Kr-h1 to rp49 was calculated. Using a dilution series of plasmids containing the cDNA of each gene as well as the sample cDNA as a standard, PCR reaction was performed using the following primers for quantification. Silkworm Kr-h1: BmKrh1-QF1 ACCCATACTGGCGAGCGACCAT (SEQ ID NO: 16), BmKrh1-QR1, CCTCTCCTTTGTGTGAATACGACGG (SEQ ID NO: 17); Silkworm rp49: Bmrp49-F CAGGCGGTTCAAGGGTCAATAC (SEQ ID NO: 18), BmTGGAGGCT-R 19); Drosophila Kr-h1: DmKrh1A-QF1 CTTGGATTACGATTTGCGGTCG (SEQ ID NO: 20), DmKrh1-QR1 TTAGTGGAGGCGGAACCTGGA (SEQ ID NO: 21); Drosophila rp49: DmRp49-QF1 AACCCACTGG Number: 23).
LightCycler ^™ DX400 (Roche) or LightCycler ^™ 480 (Roche) was used as the quantification device, and SYBR ^™ Premix Ex Taq (Takara) was used as the quantification reagent. PCR conditions were carried out according to Shinoda and Itoyama (Proc. Natl. Acad. Sci. USA 100, 11986-11991, 2003).

[result]
Induction of BmKr-h1 gene by JH
The quantitative expression of Kr-h1 expression in several silkworm cultured cells (aff3, oyanagi2, C129, M1, K6) treated with JH I revealed that Kr-h1 was treated with JH I alone in all cells. It was significantly induced 4 hours after the treatment (FIG. 3). In aff3, Kr-h1 was hardly induced by ecdysone (20E), and the synergistic effect of JH and 20E was not observed, but in K6 cells, induction of Kr-h1 gene was observed even with 20E alone, In addition, a synergistic induction effect by JH and 20E was observed. Thus, although the difference of the response of Kr-h1 gene to 20E was observed depending on the cell line, the remarkable induction effect of Kr-h1 by JH was common to the cultured silkworm cultured cells.
Next, aff3 and BmN4 cells were used to examine the Kr-h1 gene expression after JH treatment over time (FIG. 4). As a result, all cells were remarkably induced 30 minutes after treatment with JH analog (mesoprene 10 μM), and peaked at 2 hours. The level of expression induction was about 5 times higher for aff3 than for BmN4. When aff3 cells were used to examine the concentration responsiveness to mesoprene and JHI (cultured for 2 hours), a concentration-dependent response was observed in each case (FIG. 5). In addition, induction was observed at very low concentrations of 10 nM for mesoprene and 10 pM for JH I (Fig. 5).
In order to compare the difference in inducibility of Kr-h1 gene to JH due to the difference in cell types, culture for 2 hours in medium with or without JH (mesoprene 10 μM) and expression of Kr-h1 We investigated (Figure 6). As a result, the ratio of the induction of Kr-h1 gene expression in the medium containing JH to the additive-free medium was only 3 times in Drosophila S2 cells, 24 times in silkworm BmN4 cells, and 390,000 times in aff3 cells. A remarkable induction effect was observed.
From the above results, it was revealed that in silkworm cultured cells, Kr-h1 gene was remarkably induced by JH at a low concentration in a short time.
Furthermore, when the induction of Kr-h1 gene expression by JH-I or mesoprene (1 μM) in various silkworm cultured cells was examined, all cells were treated with Kr-h1 gene despite the low dose of JH-I or mesoprene. Significant induction of expression was observed (Figure 7). This result suggests that the expression of the Kr-h1 gene in lepidopteran insects is remarkably induced by JH.

[Example 4] Cloning of BmKr-h1 promoter and preparation of reporter construct
[Method]
Based on the predicted BmKr-h1 gene sequence, forward primers (BmKrh1_Pro-F2-attB1, BmKrh1_Pro-F3-attB1, BmKrh1_Pro-) are located approximately 4.7k, 4.0k, and 2.8kb upstream from the transcription start point of BmKr-h1. F4-attB1) was designed with reverse primers (BmKrh1_Pro-R2-attB2, BmKrh1_Pro-R1-attB2) immediately above the translation start point and at the 5 ′ end of the second exon (FIG. 8). Using these forward and reveres primers in combination, the BmKr-h1 promoter region (including some introns) is amplified by PCR using silkworm genomic DNA as a template and KOD FX DNA polymerase (TOYOBO). And subcloned into the plasmid vector pDONR221 (Invitrogen).
Separately, to construct a luciferase reporter assay vector, pGL4.14 (Promega) multicloning site (EcoRV site) pIB / V5-His-DEST (Invitrogen) attB2 sequence (609-2292) ) Was inserted to construct a plasmid pGL4.14-DEST.
The fragment containing the BmKr-h1 promoter region subcloned above was subcloned into a luciferase reporter assay vector pGL4.14-DEST using a gateway system, sequenced, and subjected to the dual luciferase reporter assay described in the next section. The name of each reporter construct, the type of primer used for preparation, and the position of the corresponding BmKr-h1 gene promoter are shown in FIG.

Reporter assay
Evaluation of JH inducibility of the Kr-h1 promoter was performed using the Dual-Luciferase Reporter Assay System (Promega). As an internal standard reporter vector, a plasmid pIZT-rluc is constructed by inserting the pRL-null (Promega) Renilla luciferase gene (rluc) downstream of the IE2 promoter of pIZT / V5-His-DEST (invitrogen). It was. Using the Transfast ^TM Transfection Reagent (Promega), a test reporter vector in which the sequence near the transcription start point of Kr-h1 and an internal standard reporter vector pIZT-rluc (Renilla luciferase) are inserted into the firefly luciferase reporter vector pGL4.14. Transfect the cultured cells at the same time, leave them for a certain period of time (usually 24 hours), replace with medium supplemented with JH, etc., and then leave them for a certain period of time (usually 24 hours), collect the cells, and perform a dual luciferase assay It was. For the measurement, a 1420 ARVO multi-label counter (PerkinElmer) was used. The activity of the test promoter was determined by the measured value of firefly luciferase / measured value of Renilla luciferase.

[result]
A luciferase reporter construct containing BmKr-h1 upstream, the first exon, and a partial region of intron was prepared, and dual luciferase assay was performed using aff3 cells to examine the responsiveness to JH (FIG. 9).
As a result, the constructs pGL4.14_-4741 / + 116, pGL4.14_-4041 / + 116, pGL4.14_-2763 / + 116) including about 4.7k, 4.0k, 2.8k upstream from the translation start point. In each case, almost the same strong JH responsiveness was observed (FIG. 9). On the other hand, the upstream 4.7k or 4.0k and intron-containing constructs (pGL4.14_-4741 / + 968, pGL4.14_-4041 / + 968) were also responsive to JH, but their transcription levels included introns. It was weaker than the one without it (Figures 9 and 10).
Next, using a construct containing about 4.0k upstream and intron (pGL4.14_-4041 / + 968) and a construct containing about 2.8k upstream (pGL4.14_-2763 / + 116), JH and ecdysone (20E ) Was examined (FIG. 11). In pGL4.14_-4041 / + 968, weak JH induction and induction by 20E alone were observed, and when both were mixed, stronger induction was observed. On the other hand, pGL4.14_-2763 / + 116 was strongly induced by JH alone, but not induced by 20E alone, whereas 20E tended to suppress the induction by JH.
From the above results, it was found that there is a sequence (JH response sequence; JHRE) that responds to JH alone in the region (SEQ ID NO: 10) of about 2.8k (-2763 / + 116) immediately above the translation start point. . On the other hand, it was suggested that the intron contains a 20E-inducible sequence and a sequence that suppresses transcription induction from the upstream region.

Using a reporter construct pGL4.14_-2763 / + 116 that showed remarkable JH responsiveness, JH induction was examined over time. As a result, in the medium containing JH (mesoprene), reporter induction was observed after 4 hours. Recognized and increased gradually up to 48 hours (Figure 12). On the other hand, in the medium containing no JH, the reporter activity remained at a low level almost unchanged up to 48 hours (FIG. 12).
As a result of examining the response of pGL4.14_-2763 / + 116 to various types of JH, JH I and JH II showed strong responses of almost the same level in a wide range of 10 ^-5 to 10 ^-9 M (Fig. 13). ). In JH III and mesoprene, strong responses were observed at 10 ⁻⁵ to 10 ⁻⁷ M, but responses tended to decrease at 10 ⁻⁸ to 10 ⁻⁹ M.
All the above data are the results of investigation using silkworm aff3 cells. Next, it was examined whether similar responses were observed in other cells.
In BmN4 cells, the reporter construct pGL4.14_-4041 / + 968 containing introns showed about 5-fold JH responsiveness, and even in constructs containing no introns, induction by JH was seen about twice as much ( Figure 14). Also in the cultured cell Sf9 derived from sweet potato, about five times as high JH responsiveness was recognized by reporter construct pGL4.14_-4041 / + 968 containing an intron. Although the reporter activity decreased in the construct containing no intron, induction by JH was observed about 2-3 times (FIG. 15). From these results, it was suggested that the BmKr-h1 intron (SEQ ID NO: 15) contains a sequence related to JH responsiveness. In Drosophila cultured cells S2, none of the tested constructs were induced by JH (FIG. 16).
From the above results, it became clear that the JH responsiveness of the BmKr-h1 promoter shows clear JH responsiveness in all lepidopteran insect cells examined, although there are differences depending on the cell type. In addition, among the above tests, aff3, K6, Oyanagi2, and C129 cells have significantly higher JH responsiveness, especially the combination of aff3 cells and pGL4.14_-2763 / + 116 shows the best JH responsiveness It became clear.

[Example 5] Identification of JH response element (JHRE) contained in BmKr-h1 promoter
[Method]
Since a strong JH-inducing activity was observed in the construct (pGL4.14_-2763 / + 116) containing about 2.8k upstream of BmKr-h1, a reporter plasmid containing a part of this region was prepared, and the reporter assay was repeated. The JH response area was narrowed down.
[result]
In order to identify the JH response element (JHRE) contained in the approximately 2.8k region (-2763/116) upstream of BmKr-h1, various constructs in which a part thereof was cut out were prepared, and the reporter assay was repeated.
As shown in FIGS. 10 and 11, when the -4041 / -2649, -2763 / -1695 and -1966 / -839 regions are directly connected to the reporter plasmid pGL4.14 without a promoter, -4041 / -2649 And -1966 / -839 showed no transcriptional activation ability and no significant responsiveness to JH and 20E, but -2763 / -1695 did not have an authentic transcription initiation site, but was responsive to JH Expression was observed.
When the -2763 / + 116 region was sequentially cut from the 5 ′ side and assayed, -1978/116 and shorter constructs did not show significant JH responsiveness (FIG. 17). On the other hand, all of the constructs containing -2565 / + 116, -2347 / + 116, -2165 / + 116 showed the same level of JH responsiveness as the original -2763 / + 116 (Fig. 18). This suggests that JHRE is present in the region from −2165 to +116, and that the promoter sequence near the transcription start site is not necessarily essential for JH responsiveness.
Next, various constructs in which the sequence at the center of -2165 / + 116 was deleted were prepared by inverse PCR and assayed (FIG. 19). As a result, the fragment of -2165 / -1999 was obtained regardless of the length of the sequence near the transcription start point (-285 / + 116, -192 / + 116, -111 / + 116, and -49 / + 116). All the constructs that were included showed a fairly strong JH responsiveness. JH responsiveness was maintained even with -2165 / -2049, which was further cut away from the upstream region, but responsiveness disappeared with -2165 / -2094. When comparing the promoter region near the transcription start point, the combination of the construct with -49 / + 116 and the upstream region showed the highest JH responsiveness, and the combination of -2165 / -1999 and -49 / + 116 The same level of JH induction as that of -2165 / + 116 was observed (Fig. 19).
The assay was performed by further excising the upstream part (JHRE) of the contract containing -2165 / -1999 and -49 / + 116. As a result, JH responsiveness was lost in all those cut from -2089 or shorter than 5 '(Fig. 20). On the other hand, when JHRE was shaved from the 3 'side, the responsiveness did not change until -2025, and the JH responsiveness decreased as JHRE decreased with -2045, -2068 (Figure 20). .
In the results of FIG. 20, a clear JH response is seen in the construct containing -2165 to --2068, suggesting that at least one major JHRE is contained in this sequence fragment. In order to obtain high JH responsiveness, it is preferable to include a sequence 3 ′ from −2165 to −-2068, more preferably −2165 to −2045, more preferably −2165 to −2025, It was shown that high JH inducibility can be obtained. In particular, the combination of the -2165 / -2025 JHRE region and the -49 / + 116 region (SEQ ID NO: 14) reveals that JH inducibility almost equivalent to the original -2763 / + 116 is obtained. It was.

[Example 6] Analysis of JHRE and BmKr-h1 promoter region
GTG, which may actually play a role in transcriptional regulation in this region to reveal the sequence that contributes to the JH response in the JHRE region of BmKr-h1 (-2165 / -2025), A reporter vector in which CAC, GAG, and CTC sequences were converted to AAA or TTT sequences was prepared, and JH responsiveness was verified by a reporter assay using cultured silkworm cells (aff3) (FIGS. 21 and 22). As a result, in the wild type, about 22-fold response was observed by JH treatment, but when _-2105 CACAC, _-2082 GTG (Fig. 21) and _-2089 CGCG (Fig. 22) were mutated, JH caused Although the induction rate decreased to 5 times or less, JH responsiveness was not lost. _{As -2105} CACAC, _-2105 CAC, _-2103 CAC, _-2089 CGCG, _-2082 GTG, etc. still _show JH induction, the region -2080 or upstream contributes to the enhancement of JH responsiveness. However, it was judged not essential for JH responsiveness. In addition, since JH responsiveness was not lost by mutation at -2062 or downstream site, JH responsive elements essential for JH responsiveness may be included within the range of -2079 / -2063. It was suggested. Considering that JH responsiveness is observed up to -2068 (FIG. 20), it is suggested that the sequence of -2079 / -2068 (SEQ ID NO: 39) is sufficient for JH response. And when _-2073 CACGTGT and _-2076 CTC were mutated, the JH induction rate decreased significantly. From the above results, in BmKr-h1 JHRE region (-2165 / -2025), sequences essential for JH responsiveness are localized at sites -2076 and -2073. It was suggested that -2105 / -2068 (SEQ ID NO: 38) performs an important function.

  As a result of analyzing the sequence of the promoter region of the Kr-h1 gene (TcKr-h1) of Kokunu Stomodoki (TcKr-h1), a sequence that completely matches -2076 / -2068 (CTCCACGTG) of JHRE of BmKr-h1 was found. It was issued. Thus, when a reporter assay using aff3 cells was performed using the upstream sequence of TcKr-h1 containing this site, remarkable JH responsiveness was confirmed (FIG. 25). Based on the above, -2076 / -2068 (CTCCACGTG; SEQ ID NO: 42) of BmKr-h1 is an essential sequence of the JH response element (JHRE), and this sequence plays a major role in the JH response of the Kr-h1 gene. It has been suggested. An identical sequence was also found in the intron I region of the α isoform corresponding to the upstream of the β isoform transcription start site, which was confirmed to be involved in JH responsiveness in the above experiment. As described above, the same sequence is conserved among completely different insects, suggesting that the JH response by JHRE is common in insects.

  Subsequently, the specificity of the promoter in the JH response was analyzed. Swapping the promoter region of BmKr-h1 (-49/116) selected in the above example, and the promoter regions of the silkworm actin A3 gene (BmA3) and HSP70 gene (BmHSP70), and using the reporter assay using aff3, JH The responsiveness was verified. As a result, the response to JH was confirmed even when promoters of other genes were used (FIG. 26), indicating that a specific promoter is not essential in the JH response.

[Example 7] Identification of JH signaling molecule interacting with JHRE
In order to identify the trans factor group that interacts with JHRE of BmKr-h1, a plasmid in which a luciferase reporter gene is introduced downstream of JHRE (-2165 / -2025 & -49 / 116) and the expression of candidate trans factor groups The reporter assay was performed by co-transfection of the plasmid into cultured cells, and the effect on the inducibility by JH was verified. The trans-factors include Met (methoprene tolerant), ARNT (aryl hydrocarbon nuclear receptor translocator), and bHLH-PAS family transcription factors including HIF 1α (Hypoxia-inducible factor 1α), and molting hormone USP (ultraspiracle), a subunit of the receptor, was selected, and these cDNAs were cloned from silkworms and used. The cultured cells used were Drosophila S2 cultured cells whose response of Kr-h1 to JH was lower than that of silkworm cultured cells (about 2.5 times). As a result, when the reporter plasmid was introduced alone, no significant induction of reporter activity by JH was observed, but when BmMet2 was co-transfection, very high induction (about 20 times) by JH was observed ( Figure 27). On the other hand, no significant increase in JH responsiveness was observed when co-transfection with other factors. From the above results, it was shown that BmMet2 interacts with the JH response element in a JH-dependent manner.

Subsequently, in order to clarify the function of BmMet2 in the JH signaling pathway, one-hybrid analysis was performed using a cultured mammalian cell line that does not have an endogenous JH receptor. First, in order to verify whether BmMet2 has JH-dependent transcriptional activation ability, a plasmid (gal4-DBD_BmMet2) that expresses the fusion protein of GAL4 DNA-binding domain and BmMet2 was prepared, and adenovirus major late promoter A reporter assay was performed by co-transfection into a cultured cell line derived from human kidney (HEK293) together with a UAS-luciferase plasmid (pG5luc vector, Promega) in which 5 copies of GAL4 binding site (UAS) were incorporated in tandem upstream.
As a result, a strong response to JH (about 13 times) was confirmed in the experimental group into which gal4-DBD_BmMet2 was introduced, despite surprisingly being mammalian cells (FIG. 28). This result indicates that transcriptional activation by Met is not dependent on insect cells. In addition, when gal4-DBD was co-transfection, no induction by JH occurred, suggesting that Met is imparted with transcription activation ability in a JH-dependent manner.

  Further, the gal4-DBD region was deleted from the expression plasmid of gal4-DBD_BmMet2, and a wild-type BmMet2 expression plasmid (pBIND_BmMet2_-gal4) and four JHRE luciferase reporter plasmids pGL4.14_-2165 / -2025 & -49 / 116 , PGL4.14_-2763 / 116, pGL4.14_JHRE × 4 & TK, or pGL4.14_JHRE × 5 & -49 / 116 (pGL4.14_JHREx4 & TK: a sequence of 4 -128 / -2045 in tandem + Tymidine kinase promoter, pGL4.14_JHREx5 & -49/116: Either -2128 / -2045 (SEQ ID NO: 36) arranged in tandem + BmKr-h1 -49/116 promoter) was co-transfected into HEK293 and a reporter assay was performed. . As a result, when BmMet2 was introduced, the reporter activity was induced 2.4 times in any of the reporters in the JH-treated group compared with no treatment (FIG. 29). Induction by JH did not occur in the control group into which VP16-AD or gal4-DBD was introduced.

  It is highly unlikely that mammalian cells, HEK293 cells, have endogenous molecules that function as JH receptors. Therefore, it was suggested that Met accepts JH alone, binds directly to JHRE, is imparted with transcription activation ability in a JH-dependent manner, and induces transcription of downstream genes. This result demonstrates for the first time that Met is a direct receptor for JH, and that only this single component can accept JH and activate JHRE-mediated transcription.

[Example 8] Analysis of JH responsiveness using TcKr-h1 JHRE
It was investigated whether the JH response by Met was observed in the same way with the JHRE of Kokunu Stomodoki. Drosophila S2 cells and silkworm aff3 cells were seeded in 96-well plates at 1.5 × 10 ⁵ / well and cultured at 25 ° C. for 24 hours in schneider medium containing 10% FBS or IPL41 medium containing 10% FBS. Transfect 0.2 g of reporter plasmid (pGL4.14_Tckrh1_pro) containing -477 / + 106 of TcKr-h1 and pIZT-Rluc 0.002 μg as an internal standard using TransFast ^™ (Promega) 0.6 μl at 25 ° C. for 24 hours, Thereafter, 10 μM of mesoprene was added, and luciferase assay was performed after incubation at 25 ° C. for 24 hours. As a result, since a strong JH response was observed in S2 cells expressing BmMet2, it was confirmed that the JHRE of TcKr-h1 also showed a JH response in the presence of the Met protein in the same manner as JHRE of BmKr-h1 ( (Figure 30).
Similar experiments were performed using human cells (HEK293). HEK293 cells were seeded in a 96-well plate at 0.2 × 10 ⁵ / well and cultured at 37 ° C. for 48 hours in a MEM medium containing 10% FBS and 0.1 mM non-essential amino acid (NEAA). 0.2 μg of reporter plasmid containing -477 / + 106 of TcKr-h1, 0.2 μg of gal4-DBD_BmMet2 expression plasmid (pcDNA_BmMet2) or wild type BmMet2 (pBIND_BmMet2_-gal4) 0.2 μg, and internal standard reporter vector Co-transfection (37 ° C, 48h) was performed using 0.2µg of pRL-TK (Promega) using Lipofectamine 2000 (0.5µg), and 0.1µM of JHI was added (37 ° C, 24h), followed by dual luciferase assay. As a control, an empty vector (pcDNA_none) not encoding Met2 was used. As a result, a clear JH response was observed in all HEK293 expressing Met protein, so JHRE of TcKr-h1 is similar to that of BmKr-h1 in human cells in the presence of Met protein. Was confirmed (FIG. 31).

[Example 9] JH dose response of transcriptional activity by JHRE
It was investigated using HEK293 cells whether JHRE's JH response was also seen in a dose-dependent manner in mammalian cells. PGL4.14_-2165 / -2025 & -49 / 116 and BmMet2 expression vector (pBIND_BmMet2_-) on HEK293 (0.2 × 10 ⁵ / well, 96 well plate) cultured in 200 μl of MEM + 0.1 mM non-essential amino acid (NEAA) + 10% FBS gal4) is co-transfection (48h) using Lipofectamine 2000 with the internal standard reporter vector pRL-TK, JH treatment (JHI, II, III, MT (methoprene), MF (methyl farnesoate), FA (Farnesoic acid) ), 24h) and a dual luciferase assay was performed. As a result, various JHs showed clear dose response. FIG. 33 shows the dose-dependent characteristics of JH-induced expression of endogenous BmKr-h1 in silkworm cells aff3. The difference in responsiveness due to various JHs in human cells is in good agreement with that of endogenous BmKr-h1 in aff3. The assay system using JHRE used insect cells even when cells other than insects were used. It shows that the assay can be reproduced.

  According to the present invention, genes and proteins having high responsiveness to JH, DNAs containing the JHRE of the genes, and uses thereof are provided. By using the expression of the gene or protein of the present invention or transcriptional activation by JHRE as an index, JH can be detected quickly and with high sensitivity. In particular, since the expression of the gene is induced by JH at a very high efficiency even in cultured cells, it has become possible to construct a high-throughput screening system using not only individuals but also cultured cells. Moreover, if the JHRE of the present invention is used, an expression control system using JH can be constructed.

Claims (31)

A DNA comprising SEQ ID NO: 42 or a sequence in which one base thereof is substituted, having an activity of increasing transcription in response to juvenile hormone or an activity of binding to a Met (Methoprene-tolerant) protein. The DNA according to claim 1, wherein the DNA is any one of the following (a) to (d).
(A) In a transcriptional regulatory region of a juvenile hormone responsive gene, this is a sequence excised so as to include a sequence in which SEQ ID NO: 42 or one base thereof is substituted, and increases transcription in response to juvenile hormone. DNA comprising a sequence having activity or activity to bind to a Met (Methoprene-tolerant) protein.
(B) a DNA comprising a sequence obtained by substituting, deleting, and / or adding one or more bases in the DNA of (a), wherein the activity or Met ( Methoprene-tolerant) DNA that has the activity of binding to proteins.
(C) DNA having 90% or more identity with the DNA sequence of (a) above and having an activity of increasing transcription in response to juvenile hormone or binding to a Met (Methoprene-tolerant) protein .
(D) DNA that hybridizes with the probe prepared from the DNA of (a) above under stringent conditions, and binds to an activity that increases transcription in response to juvenile hormone or a Met (Methoprene-tolerant) protein DNA having the activity of The DNA according to claim 1 or 2, wherein the gene is Kr-h1 (Kruppel homolog 1) or a homologous gene thereof. SEQ ID NO: 9, 10, 11, 12, 31, 34, 35, 36, 37, 38, 39, or a fragment thereof having juvenile hormone responsiveness, according to any one of claims 1 to 3. DNA. The DNA according to any one of claims 1 to 4, wherein a heterologous promoter and / or a heterologous gene is operably linked. A vector comprising the DNA according to any one of claims 1 to 5. A composition for expression of juvenile hormone response, comprising the vector according to claim 6. A transformant comprising the DNA according to any one of claims 1 to 5 or a vector containing the DNA. The transformant according to claim 8, wherein a Met (Methoprene-tolerant) gene is introduced. The transformant according to claim 8 or 9, which is an insect cell or a mammalian cell. A juvenile hormone-responsive transcription enhancer comprising the DNA according to any one of claims 1 to 5. Use of the DNA according to any one of claims 1 to 5 as a juvenile hormone response element. Use of the DNA according to any one of claims 1 to 5 for binding to a Met (Methoprene-tolerant) protein. Use of the DNA according to any one of claims 1 to 5 in expression control by juvenile hormone, an agonist or antagonist thereof. An expression control method comprising the step of bringing a juvenile hormone, an agonist or an antagonist thereof into contact with a cell into which the DNA according to any one of claims 1 to 5 has been introduced. (A) DNA according to any one of claims 1 to 5, and (b) (i) juvenile hormone, an agonist or antagonist thereof, and / or (ii) a nucleic acid encoding Met (Methoprene-tolerant) A kit comprising a cell into which the nucleic acid has been introduced. A method for assaying juvenile hormone action, comprising a step of detecting the transcriptional activity of the DNA according to any one of claims 1 to 5. 18. The method according to claim 17, wherein the step is performed in the presence of a test compound, thereby detecting a test compound's promoting or inhibiting effect on the action of juvenile hormone. 19. The method according to claim 18, further comprising the step of selecting a compound that increases the transcriptional activity of the DNA, wherein the method is carried out in screening for a compound that increases the action of juvenile hormone. 19. The method according to claim 18, wherein the step is performed in the further presence of juvenile hormone or an agonist thereof, thereby detecting the activity of a test compound that reduces the action of juvenile hormone. 21. The method of claim 20, further comprising the step of selecting a compound that reduces the transcriptional activity of the DNA, wherein the method is performed in screening for a compound that decreases the action of juvenile hormone. 22. A method according to any of claims 17 to 21 performed in an assay or screening for insecticidal compounds. DNA described in the following (a) to (c).
(A) DNA comprising a silkworm gene encoding the amino acid sequence of SEQ ID NO: 2 or 4, or a homologous gene sequence in lepidopterous insects, and having juvenile hormone responsiveness.
(B) A DNA having juvenile hormone responsiveness, comprising a sequence obtained by substituting, deleting, and / or adding one or several bases in the sequence described in (a) above.
(C) DNA having a juvenile hormone responsiveness, comprising a natural sequence that hybridizes under stringent conditions with a probe prepared from the sequence described in (a) above. A protein comprising an amino acid sequence encoded by the DNA of claim 23. 25. An immunogenic polypeptide comprising a continuous 8 amino acid fragment or more of the protein of claim 24. A nucleic acid comprising at least 15 consecutive bases of SEQ ID NO: 1 or 3 or a complementary sequence thereof, or hybridizing under stringent conditions to SEQ ID NO: 1 or 3 or a complementary sequence thereof; Nucleic acid used as a primer. A polypeptide comprising an antibody or an antigen-binding fragment thereof that specifically binds to the protein of claim 24. A detection agent for juvenile hormone, comprising a nucleic acid according to claim 26, or a polypeptide comprising the antibody or antigen-binding fragment thereof according to claim 27. A kit comprising (a) a nucleic acid according to claim 26, or a polypeptide comprising the antibody or antigen-binding fragment thereof of claim 27, and (b) juvenile hormone, an agonist or antagonist thereof. A method of activating transcription of DNA in non-insect eukaryotic cells, comprising the step of binding a Met (Methoprene-tolerant) protein or a fusion protein of the protein and a DNA binding protein to DNA. A transcription activator in non-insect eukaryotic cells, comprising a Met (Methoprene-tolerant) protein, a fusion protein of the protein and a DNA-binding protein, or a nucleic acid encoding either of them.