JP2009232764A - Detection method of haplotype - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method of experimentally detecting haplotype without using statistical estimation. <P>SOLUTION: The haplotype is detected by using allele-specific PCR reaction, lambda exonuclease reaction, and electrophoresis. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a method for experimentally detecting haplotypes without using statistical estimation.

  A haplotype refers to a combination of two or more SNPs located on a single chromosome. For example, in FIG. 1, when there is a locus 1 and locus 2 of the genome of the individual A, it is said that it has a haplotype of A-T on one chromosome and a haplotype of A-G on the other chromosome. Recent research has revealed that the haplotype is related to the onset of diseases and drug responsiveness (drug efficacy / side effects). For example, N-acetyltransferase 2 (NAT2), which is a drug metabolizing enzyme, can be mentioned. There are three SNPs in the gene encoding this NAT2 enzyme, but the risk of side effects on drugs increases if all three SNPs are not wild type in at least one of the two chromosomes. Therefore, it is very important to accurately detect haplotypes.

  At present, a technique for statistically estimating a haplotype is attracting attention as one used for haplotype analysis. As a method for determining a haplotype when family data is given, there is software such as Linkage Package (for example, see Non-Patent Document 1) and GENEHUNTER (for example, see Non-Patent Document 2). On the other hand, when there is no family data, the maximum likelihood estimation method using the EM algorithm by counting genes assuming Clark's algorithm or Hardy-Weinberg equilibrium (HWE) (for example, non-patented There are various things such as literature 3). However, these methods are only estimates, and the results differ depending on the parameter settings, so it cannot be said that the accuracy is high. In other words, as long as statistics are used, the accuracy cannot be 100%.

  Therefore, it is desired to detect a haplotype by an experimental method without using statistical estimation. Currently, there are sequencers and real-time PCR as representative devices for analyzing SNPs.

  In SNP detection by a sequencer, DNA fragments having different lengths are synthesized by a DNA polymerase by a dideoxy method (Sanger method) using a sample DNA as a template. In this case, the dideoxyribonucleotide is labeled with different fluorescence for each base. When this DNA fragment group is electrophoresed in a polyacrylamide gel, it is classified according to its length. Then, the base sequence is determined from the order of passage by irradiating a position at a certain distance from the starting point of electrophoresis with a laser and measuring the fluorescence of the fluorescence-labeled DNA passing therethrough.

  Such a detection process allows the sequencer to read the entire base sequence, but the pretreatment process is very complicated until it is applied to the apparatus, and if a person skilled in the art does not conduct an experiment, an erroneous result is obtained. May come out. In addition, dideoxyribonucleotides with fluorescent labels are very expensive, and because four kinds of fluorescent dyes are read, the detection mechanism becomes complicated and the apparatus becomes expensive.

  On the other hand, in real-time PCR, the pretreatment process is simple, and no special technique is required, and a correct result can be obtained easily. However, TaqMan Probe, which is a necessary reagent, needs to be labeled with a fluorescent substance and a quenching substance, respectively, which leads to high costs. When analyzing SNPs, it is necessary to prepare two types of TaqMan Probes per SNP, and it is necessary to design TaqMan Probes for each of the target SNPs, which is a very expensive detection method. Furthermore, it is necessary to design a light source or detection system having two wavelengths for detection, which complicates the mechanism of the apparatus and naturally increases the apparatus cost.

  Another method for analyzing polymorphisms is to selectively incorporate nucleotide analogs at the mutation site in the PCR extension reaction step, and then generate a product of a size unique to the polymorphism in the subsequent limited degradation step. There is a method in which polymorphs are determined by separating them according to size (Patent Document 1).

  More specifically, this method uses a natural deoxyribonucleotide triphosphate analog that is resistant to 5 ′ → 3 ′ exonuclease digestion on the base substrate corresponding to the mutation site, as described above. Perform PCR. Subsequently, the PCR product in which the analog is incorporated is digested with 5 ′ → 3 ′ exonuclease into a single-stranded segment, and then removed using a single-stranded DNase enzyme that digests single-stranded DNA, Blunt end fragments are generated. As a result, products having different product lengths according to the polymorphism are produced, so that the polymorphism can be detected by separating the lengths by electrophoresis.

In this method, there is a problem that the operation of the limited decomposition for generating different product lengths depending on the polymorphism is complicated in two steps. However, since there is no need to fluorescently label nucleic acids compared to sequencers and real-time PCR, the cost is reduced.
GM Lathrop et al., "Multilocus linkage analysis in humans: detection of linkage and estimation of recombination," Am. J. Hum. Genet., Vol.37, pp.482-498, 1985 L. Kruglyak, MJ Daly, MP Reeve-Daly and ES Lander, "Parametric and nonparametric linkage analysis: a unified multipoint approach," Am. J. Hum. Genet., Vol.58, pp.1347-1363, 1996 MN Chiano and DG Clayton, "Fine genetic mapping using haplotype analysis and the missing problem," Ann. Hum. Genet., Vol.62, pp.55-60, 1998 Special table 2003-517309

  As described above, there are many methods for examining polymorphisms. However, in these apparatuses and methods, two pieces of chromosome information are collected and detected as one piece of chromosome information, and it is difficult to accurately detect a haplotype that is one piece of chromosome information. As shown in FIG. 2, when it is analyzed that the locus 1 of the individual A is A / A and the locus 2 is T / G, the haplotype on one genome is AT, and the other locus is AT. It can be seen that the haplotype on the genome is AG. However, if the analysis results are genotypes A / C for locus 1 and T / G for locus 2, it is impossible to determine the haplotype of individual B from this analysis result. It is. That is, it is impossible to distinguish the case where the haplotype of the individual B is A-T on one genome and CG on the other genome from the case where one genome is A-G and the other genome is C-T.

  An object of the present invention is to provide a method capable of accurately detecting a haplotype based on test data using a PCR reaction without using statistical estimation.

The method for determining a haplotype of the present invention comprises:
A method for detecting a haplotype of a sample nucleic acid having first and second polymorphic sites,
It has the following processes (1) to (3).
(1) One forward primer selected from two types for wild type and mutant type, each of which specifically amplifies two types of target nucleic acids each having a first polymorphic site of wild type and mutant type , One reverse direction selected from two types, one for wild type and one for mutant type, which specifically amplifies the complementary strands of two types of target nucleic acids, each of which is a wild type and a mutant type, respectively. In the following four systems using two types of primers: PCR amplification of each sample nucleic acid (a) Phosphorylated label on both the 5 ′ end of the forward primer and the reverse primer The first system, not marked with
(B) a second system in which the forward primer is not phosphorylated and the phosphorylated label is attached to the 5 ′ end of the reverse primer;
(C) a third system in which the forward primer is labeled with a phosphorylation at the 5 ′ end and the reverse primer is not labeled with a phosphorylation label at the 5 ′ end; and (d) the forward sequence A fourth system in which phosphorylated labels are attached to both the directional primer and the 5 ′ end of the reverse primer,
(2) A step of fragmenting single-stranded nucleic acid amplified by a primer having a phosphorylated label at the 5 ′ end by treating each amplification product of (1) with lambda exonuclease.
(3) A step of determining a haplotype by detecting in each system the presence or absence of a double-stranded nucleic acid remaining unfragmented as a result of the treatment of (2).

  According to the haplotype detection method of the present invention, it is possible to detect a haplotype experimentally without using statistical estimation. According to the present invention, all possible haplotype combinations can be uniquely determined from the profile of the electrophoresis band.

In the method of the present invention, for each of the first and second two polymorphic sites, the following four types of primers for wild type and mutant type are used when there is one type of mutation.
(I) A primer for amplifying a target nucleic acid whose first polymorphic site is a wild type.
(Ii) A primer for amplifying a target nucleic acid whose first polymorphic site is a mutant type.
(Iii) A primer for amplifying a complementary strand of a target nucleic acid whose second polymorphic site is a wild type.
(Iv) A primer for amplifying a complementary strand of a target nucleic acid whose second polymorphic site is mutated.

When these four types of primers are added to a PCR amplification reaction system for PCR amplification treatment, either one of the primers (i) and (ii) and any one of the primers (iii) and (iv) The following PCR reaction system based on four combinations in which one 5 ′ end is phosphorylated is prepared.
(A) a first system in which both the forward primer and the 5 ′ end of the reverse primer are not phosphorylated.
(B) a second system in which the forward primer is not phosphorylated and the phosphorylated label is attached to the 5 ′ end of the reverse primer;
(C) a third system in which the forward primer is labeled with a phosphorylation at the 5 ′ end and the reverse primer is not labeled with a phosphorylation label at the 5 ′ end; and (d) the forward sequence A fourth system in which phosphorylated labels are attached to both the directional primer and the 5 ′ end of the reverse primer,
Next, in each PCR reaction system described above, PCR amplification is performed using the sample nucleic acid that is the haplotype determination target (step 1). Next, the amplified product obtained in each reaction system is subjected to lambda exonuclease treatment to fragment a single-stranded nucleic acid amplified by a primer with a phosphorylated label at the 5 ′ end (step) 2). As a result of this fragmentation treatment, the haplotype can be determined by detecting the presence or absence of double-stranded nucleic acid remaining unfragmented in each system (step 3).

  The method for determining the two polymorphic sites described above is to design two or more adjacent polymorphic sites of a sample nucleic acid having three or more polymorphic sites or to separate them by designing primers appropriately. It can be used to determine the haplotype of the two polymorphic sites present. Therefore, even when the sample nucleic acid has three or more polymorphic sites, the steps (1) to (1) are performed for each combination of two polymorphic sites obtained by selecting two polymorphic sites from these polymorphic sites. Haplotypes for all polymorphic sites can be determined from the results obtained by performing 3). Furthermore, as will be described later, determination of haplotypes at two polymorphic sites can be performed on a sample nucleic acid derived from two chromosomes, and the determination method for these two chromosomes is performed by the above three or more polymorphic sites. It is applicable also when it has.

  The first and second polymorphic sites are a pair of polymorphic markers that are adjacent to each other among polymorphic markers in a plurality of alleles and a polymorphic marker that is not adjacent to each other among polymorphic markers in a plurality of alleles. Pairs can be selected.

  The basic principle according to the present invention will be described with reference to FIGS.

  In FIG. 3, the target nucleic acid 301 constitutes a double-stranded nucleic acid with its complementary strand 303. The target nucleic acid 301 has a first SNP on the 5 ′ side and a second SNP on the 3 ′ side. Accordingly, the complementary strand 303 has a third SNP corresponding to the first SNP of the nucleic acid 301 on the 3 ′ side and a fourth SNP corresponding to the second SNP of the nucleic acid 301 on the 5 ′ side. It will be. Here, the wild-type nucleotide at the first SNP site of the target nucleic acid 301 is “C”, and the mutant nucleotide is “T”. The wild type nucleotide at the second SNP site of the target nucleic acid 301 is “G”, and the mutant nucleotide is “T”. Therefore, the wild-type nucleotide at the third SNP site of the complementary strand 303 is “G”, the mutant nucleotide is “A”, the wild-type nucleotide at the fourth SNP site is “C”, and the mutant nucleotide is “A”. .

  Next, two types of forward primers 305 and 307 that are allele-specific to the first SNP located on the 5 ′ side of the target nucleic acid 301 are prepared. The first forward primer 305 has a first label 309 at the 5 'end and a wild type nucleotide "C" at the 3' end. The second forward primer 307 has a second label 311 at the 5 'end and a mutated nucleotide "T" at the 3' end. Here, the first label 309 and the second label 311 are labels different from each other. For example, when the first label 309 is a phosphate label, the second label 311 is unlabeled. On the other hand, when the first label 309 is unlabeled, the second label 311 is a phosphate label.

  On the other hand, two types of reverse primers 313 and 315 that are allele-specific for the fourth SNP located on the 5 'side of the complementary nucleic acid 303 of the target nucleic acid are prepared. The first reverse primer 313 has a first label 317 at the 5 'end and a wild type nucleotide "C" at the 3' end. The second reverse primer 315 has a second label 319 at the 5 'end and a mutated nucleotide "A" at the 3' end. Here, the first label 317 and the second label 319 are labels different from each other. For example, when the first label 317 is a phosphate label, the second label 319 is unlabeled. On the other hand, when the first label 317 is unlabeled, the second label 319 is a phosphate label.

  Then, PCR amplification of the target nucleic acid 301 is performed using the first and second forward primers 305 and 307 and the first and second reverse primers 313 and 315. PCR amplification is performed in four biochemical reaction vessels.

  Within the first biochemical reaction vessel, the first label of the first forward primer 305 is unlabeled and the second label of the second forward primer 307 has a phosphate label. The first label of the first reverse primer 313 is unlabeled, and the second label of the second reverse primer 315 has a phosphate label.

  In the second biochemical reaction vessel, the first label of the first forward primer 305 is unlabeled and the second label of the second forward primer 307 has a phosphate label. The first label of the first reverse primer 313 has a phosphate label, and the second label of the second reverse primer 315 is unlabeled.

  In the third biochemical reaction vessel, the first label of the first forward primer 305 has a phosphate label, and the second label of the second forward primer 307 is unlabeled. The first label of the first reverse primer 313 is unlabeled, and the second label of the second reverse primer 315 has a phosphate label.

  In the fourth biochemical reaction solution, the first label of the first forward primer 305 has a phosphate label, and the second label of the second forward primer 307 is unlabeled. The first label of the first reverse primer 313 has a phosphate label, and the second label of the second reverse primer 315 is unlabeled.

  When PCR amplification of the target nucleic acid 301 is performed in the four biochemical reaction containers, the first forward primer 305 is extended because it has a nucleotide “G” at the third SNP site. On the other hand, the second forward primer 307 does not extend because it does not have complementary nucleotides in the first SNP site of the target nucleic acid 301 and the third SNP site of the complementary strand 303. Also, since it has a nucleotide “G” at the second SNP site, the first reverse primer 313 is extended. On the other hand, the second reverse primer 315 does not extend because it does not have complementary nucleotides in the second SNP site of the target nucleic acid 301 and the fourth SNP site of the complementary strand 303.

  As shown in FIG. 4, in the first biochemical reaction vessel when PCR amplification of the target nucleic acid 301 is performed, the first forward primer 305 in which the first label 309 is unlabeled, The first reverse primer 313, in which one label 317 is unlabeled, is extended.

  In the second biochemical reaction vessel, there are a first forward primer 305 in which the first label 309 is unlabeled and a first reverse primer 313 in which the first label 317 is a phosphate label. It is stretched.

  In the third biochemical reaction vessel, a first forward primer 305 in which the first label 309 is a phosphate label and a first reverse primer 313 in which the first label 317 is unlabeled It is stretched.

  In the fourth biochemical reaction vessel, the first forward primer 305 in which the first label 309 is a phosphate label and the first reverse primer 313 in which the first label 317 is a phosphate label. Is expanded.

  Next, a lambda exonuclease reaction is performed on the amplification products generated in the four biochemical reaction vessels. The lambda exonuclease reaction is a reaction in which a double-stranded nucleic acid having a phosphate label at the 5 'end is degraded from the 5' end. Therefore, as shown in FIG. 5, the amplification product having a phosphate label at the 5 'end does not exist in the first biochemical reaction container, and therefore it is not decomposed. In the second biochemical reaction vessel, only the strand extended by the first reverse primer having a phosphate label at the 5 'end is degraded. In the third biochemical reaction vessel, only the strand extended by the first forward primer having a phosphate label at the 5 'end is degraded. In the fourth biochemical reaction vessel, a chain extended by a first forward primer having a phosphorylated label at the 5 ′ end and a first reverse primer having a phosphate label at the 5 ′ end Both strands of the extended strand are broken down.

Next, the amplification product that has finished the lambda exonuclease reaction in the four biochemical reaction vessels is subjected to electrophoresis. An intercalator that detects double strands such as SYBER Green _I is used for detection of the electrophoresis band. Therefore, when the amplification product does not form a double strand, it is not detected. Therefore, when the amplification product in the first biochemical reaction container is subjected to electrophoresis, a band is detected. When the amplification product in the second biochemical reaction vessel is subjected to electrophoresis, no band is detected because there is no strand extended by the first reverse primer and it exists as a single strand. When the amplification product in the third biochemical reaction vessel is subjected to electrophoresis, no band is detected because there is no strand extended by the first forward primer and it exists as a single strand. When the amplification product in the fourth biochemical reaction vessel is subjected to electrophoresis, no band is detected because both strands are degraded by lambda exonuclease as described above.

  The nucleotide at the 3 'end of the primer that is unlabeled at the 5' end of the primer in the container where the electrophoresis band is detected is the haplotype of the target nucleic acid 301. Accordingly, assuming that the target nucleic acid 301 in FIG. 3 is a sample nucleic acid, an electrophoretic band was detected only in the first biochemical reaction container, so that the first SNP of the target nucleic acid 301 was “C”. ”Is determined that the second SNP is“ G ”.

(In case of 2 chromosomes)
Since humans have two chromosomes, two haplotypes can exist. That is, in FIG. 6, 501 is a nucleic acid constituting the first chromosome, and 503 is a nucleic acid constituting the second chromosome. In FIG. 6, the complementary strand of the target nucleic acid 501 and the complementary strand of the target nucleic acid 503 are not shown for simplicity. Each of the target nucleic acid 501 and the target nucleic acid 503 includes a first SNP and a second SNP. Here, the wild-type nucleotide in the first SNP is “C”, the mutant nucleotide is “T”, the wild-type nucleotide in the second SNP is “G”, and the mutant nucleotide is “T”. Suppose. In this case, the haplotype can have 10 combinations as shown in Table 1 below.

  In Table 1 below, the target nucleic acid 501 and the target nucleic acid 503 are referred to as homo-samples when the haplotypes match, and the hetero-samples as mismatches.

  The above-described haplotype detection method according to the present invention includes 5′-end unlabeled primers in the biochemical reaction container in which a band is detected as a result of electrophoretic analysis for all 10 combinations listed in the above table. It can be uniquely determined by the type of nucleotide at the 3 ′ end of

  This will be specifically described below.

  First, in the case of a homo-sample, that is, the combinations of haplotypes are (CG, CG), (CT, CT), (TG, TG) and (TT, TT). T) will be described. In this case, the PCR amplification product obtained using the forward primers 305 and 307 and the reverse primers 313 and 315 is subjected to a lambda exonuclease reaction. As a result of subsequent electrophoresis, the haplotype is clarified from the type of nucleotide at the 3 'end of the unlabeled primer in both directions in the biochemical reaction vessel in which the band was detected.

  On the other hand, in the case of a hetero sample, different results can be obtained depending on the combination of the following haplotypes.

(A) When the combination of haplotypes is (CG, CT) The following two types of amplification products exist in each biochemical reaction vessel.

  1) An amplification product having nucleotide “C” at the site corresponding to the first SNP and nucleotide “G” at the site corresponding to the second SNP.

  2) An amplification product having nucleotide “C” at the site corresponding to the first SNP and nucleotide “T” at the site corresponding to the second SNP.

When the PCR amplification product is subjected to lambda exonuclease reaction and then subjected to electrophoresis, a band is detected when the 5 ′ end is unlabeled and the 3 ′ end nucleotide and the SNP site of the target nucleic acid. Is from a biochemical reaction vessel containing matched primers. Therefore, when the haplotype is (CG, CT), the band is detected from the following two containers.
-The 5 'end is unlabeled, the nucleotide at the 3' end of the first forward primer is "C", the 5 'end is unlabeled, and the nucleotide at the 3' end of the first reverse primer is "G" A biochemical reaction container 1.
-The 5 'end is unlabeled, the nucleotide at the 3' end of the first forward primer is "C", the 5 'end is unlabeled, and the nucleotide at the 3' end of the first reverse primer is "T" The biochemical reaction vessel 2 is

(B) When the combination of haplotypes is (CG, CT) The following two types of amplification products exist in each biochemical reaction vessel.

  3) An amplification product having nucleotide “C” at the site corresponding to the first SNP and nucleotide “G” at the site corresponding to the second SNP.

  4) An amplification product having nucleotide “T” at the site corresponding to the first SNP and nucleotide “G” at the site corresponding to the second SNP.

When the PCR amplification product is subjected to lambda exonuclease reaction and then subjected to electrophoresis, a band is detected when the 5 ′ end is unlabeled and the 3 ′ end nucleotide and the SNP site of the target nucleic acid are This is from a biochemical reaction vessel containing matched primers. Therefore, when the haplotype is (CG, TG), the band is detected from the following two containers.
-The 5 'end is unlabeled, the nucleotide at the 3' end of the first forward primer is "C", the 5 'end is unlabeled, and the nucleotide at the 3' end of the first reverse primer is "G" A biochemical reaction container 1.
The 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the first reverse primer is “G” A biochemical reaction vessel 3.

(C) When the combination of haplotypes is (CG, TT) The following two types of amplification products exist in each biochemical reaction vessel.

  5) An amplification product having nucleotide “C” at the site corresponding to the first SNP and nucleotide “G” at the site corresponding to the second SNP.

  6) An amplification product having nucleotide “T” at the site corresponding to the first SNP and nucleotide “T” at the site corresponding to the second SNP.

When the PCR amplification product is subjected to lambda exonuclease reaction and then subjected to electrophoresis, a band is detected when the 5 ′ end is unlabeled and the 3 ′ end nucleotide and the SNP site of the target nucleic acid are This is from a biochemical reaction vessel containing matched primers. Therefore, when the haplotype is (CG, TT), the band is detected from the following two containers.
-The 5 'end is unlabeled, the nucleotide at the 3' end of the first forward primer is "C", the 5 'end is unlabeled, and the nucleotide at the 3' end of the first reverse primer is "G" A biochemical reaction container 1.
The 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the first reverse primer is “T” A biochemical reaction vessel 4.

(D) When the combination of haplotypes is (CT, TG) The following two kinds of amplification products exist in each biochemical reaction vessel.

  7) An amplification product having nucleotide “C” at the site corresponding to the first SNP and nucleotide “T” at the site corresponding to the second SNP.

  8) An amplification product having nucleotide “T” at the site corresponding to the first SNP and nucleotide “G” at the site corresponding to the second SNP.

When the PCR amplification product is subjected to lambda exonuclease reaction and then subjected to electrophoresis, a band is detected when the 5 ′ end is unlabeled and the 3 ′ end nucleotide and the SNP site of the target nucleic acid are This is from a biochemical reaction vessel containing matched primers. Therefore, when the haplotype is (CT, TG), the band is detected from the following two containers.
-The 5 'end is unlabeled, the nucleotide at the 3' end of the first forward primer is "C", the 5 'end is unlabeled, and the nucleotide at the 3' end of the first reverse primer is "T" The biochemical reaction vessel 2 is
The 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the first reverse primer is “G” A biochemical reaction vessel 3.

(E) When the combination of haplotypes is (CT, TT) The following two types of amplification products exist in each biochemical reaction vessel.

  9) An amplification product having nucleotide “C” at the site corresponding to the first SNP and nucleotide “T” at the site corresponding to the second SNP.

  10) An amplification product having nucleotide “T” at the site corresponding to the first SNP and nucleotide “T” at the site corresponding to the second SNP.

When the PCR amplification product is subjected to lambda exonuclease reaction and then subjected to electrophoresis, a band is detected when the 5 ′ end is unlabeled and the 3 ′ end nucleotide and the SNP site of the target nucleic acid are This is from a biochemical reaction vessel containing matched primers. Therefore, when the haplotype is (CT, TT), the band is detected from the following two containers.
-The 5 'end is unlabeled, the nucleotide at the 3' end of the first forward primer is "C", the 5 'end is unlabeled, and the nucleotide at the 3' end of the first reverse primer is "T" The biochemical reaction vessel 2 is
The 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the first reverse primer is “T” A biochemical reaction vessel 4.

(F) When the combination of haplotypes is (TG, TT) The following two types of amplification products exist in each biochemical reaction vessel.

  11) An amplification product having nucleotide “T” at the site corresponding to the first SNP and nucleotide “G” at the site corresponding to the second SNP.

  12) An amplification product having nucleotide “T” at the site corresponding to the first SNP and nucleotide “T” at the site corresponding to the second SNP.

When the PCR amplification product is subjected to lambda exonuclease reaction and then subjected to electrophoresis, a band is detected when the 5 ′ end is unlabeled and the 3 ′ end nucleotide and the SNP site of the target nucleic acid are This is from a biochemical reaction vessel containing matched primers. Therefore, when the haplotype is (TG, TT), the band is detected from the following two containers.
The 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the first reverse primer is “G” A biochemical reaction vessel 3.
The 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the first reverse primer is “T” A biochemical reaction vessel 4.

  As described above, according to the present invention, the type of haplotype of a hetero sample is determined from the results of allele-specific PCR, lambda exonuclease reaction, and electrophoresis analysis.

(Preparing the target)
An example of an amplification reaction (PCR) of nucleic acid derived from a specimen will be described below. First, an amplification reaction solution is prepared. An example of the composition of the amplification reaction solution is shown below.

--PCR solution composition--
・ Expand Long Enzyme Mix (Roche): 0.3μl
・ Template Genome DNA: ~ 5ng
・ Forward / Reverse Primer: 0.12μM each
・ DNTP (10 mM): 0.7 μl
・ Buffer 1: 2 μl
・ H ₂ O: 11.4 μl
Total: 20μl
The reaction solution having the above composition is subjected to an amplification reaction using a thermal cycler (T3000 thermocycler: Biometra) according to the temperature cycle protocol shown in FIG. After completion of the reaction, the primer is removed using a purification column (QUIAGEN QIAquick PCR Purification Kit: manufactured by QUIGEN), and the amplification product is quantified by electrophoresis (BioAnalyzer: manufactured by Agilent). Primers are designed according to the sequence of the DNA to be detected so that the portion having the haplotype to be determined from the sequence of the DNA to be detected can be amplified.

(Allele-specific PCR)
Allele-specific PCR is performed using the amplified PCR product described above. In amplification, PCR is performed using 5'-terminal phosphate-labeled or unlabeled Primer. An example of the protocol at this time is shown below.

--PCR solution composition--
・ AmpliTaq Gold (Applied Biosystems): 0.2 μl
・ Template Genome DNA: 4 ng
・ Forward / Reverse Primer: 0.06 μM each
・ DNTP mix: 0.2 μM each
・ 10xbuffer: 2.5 μl
・ H ₂ O: 16.3 μl
・ Total: 25 μl
The reaction solution having the above composition is subjected to an amplification reaction using a thermal cycler (T3000 thermocycler: Biometra) according to the temperature cycle protocol of FIG.

  After completion of the reaction, the primer is removed using a purification column (QUIAGEN QIAquick PCR Purification Kit: manufactured by QUIGEN), and the amplification product is quantified by electrophoresis (BioAnalyzer: manufactured by Agilent).

(Lambda exonuclease reaction)
A lambda exonuclease reaction is performed on the aforementioned allele-specific PCR product. An example of the protocol at this time is shown below.

--Lambda exonuclease reaction solution composition--
・ Allele-specific PCR product: ~ 200ng
・ 10 × Strandase Buffer: 1 μl
・ Strandase λ Exonuclease (Novagen): 1μl
・ Total: 10μl
The reaction solution having the above composition is reacted using a thermal cycler according to the following protocol.
--Lambda exonuclease reaction protocol--
37 ° C 20 minutes
70 ℃ 20 minutes (electrophoresis)
The product subjected to the above-described lambda exonuclease reaction is subjected to electrophoresis (BioAnalyzer: manufactured by Agilent) to confirm the presence of a band.

(Example 1) Method for detecting haplotypes of two polymorphic sites The present invention is described in more detail below using examples.

First, as a target preparation, the CYP2D6 region was specifically amplified. Target preparation followed the example implementation described above. The following two sequences were used as primers.
Sequence a) 5 'GTTATCCCAGAAGGCTTTGCAGGCTTCA 3'
Sequence b) 5 'GCCGACTGAGCCCTGGGAGGTAGGTA 3'
Next, allele-specific primers for determining the haplotypes of the first polymorphism C100T and the second polymorphism G310T were designed.
Sequence c) 5 'GGGCTGCACGCTACC 3'-C100TW
Sequence d) 5 'GGGCTGCACGCTACT 3'-C100TM
Sequence e) 5 'TGTATAAATGCCCTTCTCCAGGAC 3'-G310TW
Sequence f) 5 'ATGTATAAATGCCCTTCTCCAGGAA 3'-G310TM
Here, the first forward primer c) has a polymorphic C100T wild type nucleotide “C” at the 3 ′ end. The second forward primer d) also has a polymorphic C100T variant nucleotide “T” at the 3 ′ end. Furthermore, the first reverse primer e) has a nucleotide “C” complementary to the polymorphic G310T wild type nucleotide at the 3 ′ end. The second reverse primer f) also has a nucleotide “A” complementary to the polymorphic G310T mutant nucleotide at the 3 ′ end.

  Each sample shown in Table 2 was subjected to PCR using the above primers, followed by purification and quantification by electrophoresis. Each step of purification and electrophoresis followed an example of an embodiment.

  The amplification product obtained in the above step was subjected to lambda exonuclease reaction. Each step of the lambda exonuclease reaction followed the example embodiment described above. In addition, the lambda exonuclease reaction product obtained in this step was subjected to electrophoresis to determine the haplotype. The electrophoretic analysis followed the example embodiment described above.

  In the following, the analysis results obtained for each specimen are illustrated and the haplotype is determined.

(Allele 1/1)
FIG. 7 shows the results of analysis in the case of using a specimen having all wild types for both C100T and G310T polymorphisms as template DNA. As shown in FIG. 7, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the first forward primer is “C”, the 5 ′ end is unlabeled, and the 3 ′ end of the first reverse primer The product is detected only from the biochemical reaction container 1 whose nucleotide is “G”. Therefore, it can be seen that the first polymorphism C100T of this specimen is both C. It can also be seen that the second polymorphism G310T is both G. From the above, the haplotype of this specimen can be determined as CG or CG. This result is consistent with the sample allele used.

(Allele 10/10)
FIG. 8 shows the results of analysis in the case of using a specimen having a mutant type for both C100T and G310T polymorphisms as template DNA. As shown in FIG. 8, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the second forward primer is “T”, the 5 ′ end is unlabeled, and the 3 ′ end of the second reverse primer The product is detected only from the biochemical reaction container 4 whose nucleotide is “T”. Therefore, it can be seen that the first polymorphism C100T of this specimen is both T. It can also be seen that the second polymorph G310T is T. From the above, the haplotype of this sample can be determined as TT and TT. This result is consistent with the sample allele used.

(Allele 10/1)
FIG. 9 shows the analysis results when a sample having C and T for C100T and G and T for G310T is used as a template DNA. As shown in FIG. 9, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the first forward primer is “C”, the 5 ′ end is unlabeled, and the 3 ′ end of the first reverse primer A product is detected from the biochemical reaction container 1 whose nucleotide is “G”. From this, it can be determined that one of the haplotypes of this specimen is CG. In addition, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the second forward primer is “T”, the 5 ′ end is unlabeled, and the nucleotide at the 3 ′ end of the second reverse primer is “T”. A product is detected from the biochemical reaction vessel 4. From this, it can be determined that one of the haplotypes of this specimen is TT. This result is consistent with the sample allele used.

(Allele 10/2)
FIG. 10 shows the analysis results when a sample having C and T for C100T and T for G310T is used as a template DNA. As shown in FIG. 10, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the first forward primer is “C”, the 5 ′ end is unlabeled, and the 3 ′ end of the second reverse primer A product is detected from the biochemical reaction vessel 2 whose nucleotide is “T”. From this, it can be determined that one of the haplotypes of this specimen is CT. In addition, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the second forward primer is “T”, the 5 ′ end is unlabeled, and the nucleotide at the 3 ′ end of the second reverse primer is “T”. A product is detected from the biochemical reaction vessel 4. From this, it can be determined that one of the haplotypes of this specimen is TT. This result is consistent with the sample allele used.

(Allele 2/1)
FIG. 11 shows the analysis results when using a sample having C for C100T and G and T for G310T as template DNA. As shown in FIG. 11, the 5 ′ end is unlabeled, the nucleotide at the 3 ′ end of the first forward primer is “C”, the 5 ′ end is unlabeled, and the 3 ′ end of the first reverse primer A product is detected from the biochemical reaction container 1 whose nucleotide is “G”. From this, it can be determined that one of the haplotypes of this specimen is CG. Also, the 5 ′ end is unlabeled, the 3 ′ end nucleotide of the first forward primer is “C”, the 5 ′ end is unlabeled, and the 3 ′ end nucleotide of the second reverse primer is “T”. A product is detected from the biochemical reaction vessel 2. From this, it can be determined that one of the haplotypes of this specimen is CT. This result is consistent with the sample allele used.

  As shown in Example 1, the electrophoresis pattern obtained by the method of the present invention matches the pattern expected from the allele. Therefore, a combination of SNPs existing on the same chromosome can be uniquely determined by using the present invention.

(Example 2) Three-site polymorphism haplotype detection method Example 2 shows a three-site polymorphism haplotype detection method. When the polymorphic site is composed of C100T and G214C and G310T, the haplotype is detected in the pair of C100T and G214C, the pair of C100T and G310T, and the pair of G214C and G310T as shown in Example 1. Then, a haplotype is determined by comprehensive judgment from the result of each pair.

  This will be described in detail below.

Target preparation was performed in the same manner as in Example 1. As the allele-specific primers for the first polymorphism C100T and the third polymorphism G310T, the same primers as in Example 1 were used. As an allele-specific primer for the second polymorphism G214C, a primer was designed for haplotype detection with C100T.
Sequence g) 5 'GGTAGGGGAGCCTCAGC 3'-G214CW
Sequence h) 5 'GGTGGGGCATCCTCAGG 3'-G214CM
Next, a primer design for haplotype detection with G310T was performed.
Sequence i) 5 'GAGGGCGGCAGAGGTG 3'-G214CW
Sequence j) 5 'GAGGGCGGCAGAGGTC 3'-G214CM
Here, when detecting the haplotypes of C100T and G214C, the first forward primer c) has the polymorphic C100T wild type nucleotide “C” at the 3 ′ end. The second forward primer d) has a polymorphic C100T variant nucleotide “T” at the 3 ′ end. The first reverse primer g) has a nucleotide “C” complementary to the polymorphic G214C wild type nucleotide at the 3 ′ end. The second reverse primer h) has a nucleotide “G” complementary to the polymorphic G214C variant nucleotide at the 3 ′ end.

  In detecting the haplotypes of G214C and G310T, the first forward primer i) has a polymorphic G214C wild type nucleotide “G” at the 3 ′ end. The second forward primer j) has a polymorphic G214C wild type nucleotide “C” at the 3 ′ end. The first reverse primer e) has a nucleotide “C” complementary to the polymorphic G310T wild type nucleotide at the 3 ′ end. The second reverse primer f) has a nucleotide “A” complementary to the variant nucleotide of polymorphism G310T at the 3 ′ end.

  C100T and G310T haplotypes were detected in the same manner as in Example 1. PCR amplification is performed in 12 biochemical reaction vessels as follows.

  The first to fourth biochemical reaction vessels contain primers for detecting the haplotypes of C100T and G214C. The fifth to eighth biochemical reaction vessels include primers for detecting the haplotypes of G214C and G310T. The primers for detecting the haplotypes of C100T and G310T were the same as in Example 1.

  In the first biochemical reaction vessel, the 5 ′ end is unlabeled and the forward primer has a C100T wild-type nucleotide at the 3 ′ end, and the 5 ′ end is phosphate-labeled and the C100T mutation is at the 3 ′ end. Having a forward primer with type nucleotides. There is a reverse primer having an unlabeled 5 'end and a G214C wild type nucleotide at the 3' end, and a reverse primer having a phosphate label at the 5 'end and a G214C mutant nucleotide at the 3' end.

  In the second biochemical reaction vessel, the 5 ′ end is unlabeled and the forward primer has a C100T wild-type nucleotide at the 3 ′ end, and the 5 ′ end is phosphate-labeled and the C100T mutation is at the 3 ′ end. Having a forward primer with type nucleotides. The 5′-end has a phosphate-labeled reverse primer having a G214C wild-type nucleotide at the 3′-end, and the 5′-end has an unlabeled reverse primer having a G214C mutant-type nucleotide at the 3′-end.

  In a third biochemical reaction vessel, the 5 ′ end is phosphate-labeled and the forward primer has a C100T wild-type nucleotide at the 3 ′ end, and the 5 ′ end is unlabeled and the C100T mutation is at the 3 ′ end. Having a forward primer with type nucleotides. There is a reverse primer having an unlabeled 5 'end and a G214C wild type nucleotide at the 3' end, and a reverse primer having a phosphate label at the 5 'end and a G214C mutant nucleotide at the 3' end.

  In the fourth biochemical reaction vessel, the 5 ′ end is phosphate-labeled and the forward primer has a C100T wild-type nucleotide at the 3 ′ end, and the 5 ′ end is unlabeled and the C100T wild-type at the 3 ′ end. Having a forward primer with type nucleotides. The reverse primer has an unlabeled 5 'end and a G214C wild-type nucleotide at the 3' end, and a reverse primer has an unlabeled 5 'end and a G214C mutant nucleotide at the 3' end.

  In the fifth biochemical reaction vessel, the 5 ′ end is unlabeled and the forward primer has a G214C wild-type nucleotide at the 3 ′ end, and the 5 ′ end is phosphate-labeled and the G214C mutation is at the 3 ′ end. Having a forward primer with type nucleotides. The 5′-end has an unlabeled reverse primer having a G310T wild-type nucleotide at the 3 ′ end, and the 5′-end has a phosphate-labeled reverse primer having a G310T mutant nucleotide at the 3 ′ end.

  In a sixth biochemical reaction vessel, the 5 ′ end is unlabeled and the forward primer has a wild type nucleotide of G214C at the 3 ′ end, and the 5 ′ end is phosphate-labeled and the G214C mutation at the 3 ′ end. Having a forward primer with type nucleotides. There is a reverse primer having a phosphate label at the 5 'end and a wild type nucleotide of G310T at the 3' end, and a reverse primer having an unlabeled 5 'end and a mutant nucleotide of G310T at the 3' end.

  In the seventh biochemical reaction vessel, the 5 ′ end is phosphate-labeled and the forward primer has a G214C wild-type nucleotide at the 3 ′ end, and the 5 ′ end is unlabeled and the G214C mutation is at the 3 ′ end. Having a forward primer with type nucleotides. The 5′-end has an unlabeled reverse primer having a G310T wild-type nucleotide at the 3 ′ end, and the 5′-end has a phosphate-labeled reverse primer having a G310T mutant nucleotide at the 3 ′ end.

  In the eighth biochemical reaction vessel, the 5 ′ end is phosphate-labeled and a forward primer having the G214C wild-type nucleotide at the 3 ′ end, and the 5 ′ end is unlabeled and the G214C wild-type at the 3 ′ end. Having a forward primer with type nucleotides. The 5 ′ end is unlabeled and has a reverse primer having a G310T wild type nucleotide at the 3 ′ end, and the 5 ′ end is unlabeled and has a reverse primer having a G310T mutant nucleotide at the 3 ′ end.

  Each sample shown in Table 3 was subjected to purification and quantification by electrophoresis after PCR using the above primers. The purification and electrophoresis steps followed the example embodiment described above.

  The amplification product obtained in the above step was subjected to lambda exonuclease reaction. Each step of the lambda exonuclease reaction followed the example embodiment described above. The lambda exonuclease reaction product obtained in this step was subjected to electrophoresis to determine the haplotype. The electrophoretic analysis followed the example embodiment described above.

  In the following, the analysis results obtained for each specimen are illustrated and the haplotype is determined.

(Allele 1/1)
FIGS. 12 and 13 show the analysis results when specimens having all wild-types are used for both C100T and G214C and G310T polymorphisms as template DNA. FIG. 12 shows the analysis results of C100T and G214C haplotypes. As shown in FIG. 12, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “C”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. The product is detected only from the biochemical reaction vessel 1 "." FIG. 13 shows the haplotype analysis results of G214C and G310T. As shown in FIG. 13, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “G”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. The product is detected only from the biochemical reaction vessel 5 "." Therefore, it can be seen that the first polymorphism C100T of this specimen is both C. It can also be seen that the second polymorphism G214C is both G. It can also be seen that the third polymorph G310T is both G. From the above, the haplotype of this sample can be determined as CGG and CGG. This result is consistent with the sample allele used.

(Allele 10/10)
FIGS. 14 and 15 show the analysis results when specimens having all variants of C100T and G214C and G310T polymorphisms are used as template DNA. FIG. 14 shows the haplotype analysis results of C100T and G214C. As shown in FIG. 14, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “T”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. The product is detected only from the biochemical reaction vessel 3 "." On the other hand, FIG. 15 shows the analysis results of the haplotypes of G214C and G310T. As shown in FIG. 15, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “G”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “T”. The product is detected only from the biochemical reaction vessel 6 "." Therefore, it can be seen that the first polymorphism C100T of this specimen is both T. It can also be seen that the second polymorphism G214C is both G. It can also be seen that the third polymorph G310T is T. . From the above, the haplotype of this specimen can be determined as TGT and TGT. This result is consistent with the sample allele used.

(Allele 10/1)
FIGS. 16 and 17 show the analysis results when specimens having mutants for all of C100T and G214C and G310T polymorphisms are used as template DNA. FIG. 16 shows the haplotype analysis results of C100T and G214C. As shown in FIG. 16, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “C”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. A product is detected from the biochemical reaction vessel 1. A biochemical reaction vessel in which the nucleotide at the 3 'end of the forward primer which is unlabeled at the 5' end is "T" and the complementary nucleotide at the 3 'end of the reverse primer which is unlabeled at the 5' end is "G" The product is also detected from 3.

  On the other hand, FIG. 17 shows the haplotype analysis results of G214C and G310T. As shown in FIG. 17, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “G”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. A product is detected from the biochemical reaction vessel 5. A biochemical reaction vessel in which the nucleotide at the 3 'end of the forward primer which is unlabeled at the 5' end is "G", and the complementary nucleotide at the 3 'end of the reverse primer which is unlabeled at the 5' end is "T" The product is detected from 6.

  As shown in FIG. 9 where C100T and G310T haplotypes were detected, the 5 ′ end was unlabeled, the 3 ′ end nucleotide of the forward primer was “C”, the 5 ′ end was unlabeled, and the first reverse direction A product is detected from the biochemical reaction vessel 1 in which the complementary nucleotide at the 3 ′ end of the primer is “G”. A biochemical reaction vessel in which the 3 ′ end nucleotide of the forward primer which is unlabeled at the 5 ′ end is “T”, and the complementary nucleotide at the 3 ′ end of the reverse primer which is unlabeled at the 5 ′ end is “T”. From 4 a product is detected.

  Judging from the above, the haplotypes of this specimen can be determined as C-G-G and T-G-T. This result is consistent with the sample allele used.

(Allele 10/2)
FIGS. 18 and 19 show the results of analysis in the case of using a specimen having a mutant type for all of C100T and G214C and G310T polymorphisms as template DNA. FIG. 18 shows the haplotype analysis results of C100T and G214C. As shown in FIG. 18, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “C”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “C”. A product is detected from the biochemical reaction vessel 2. A biochemical reaction vessel in which the nucleotide at the 3 'end of the forward primer which is unlabeled at the 5' end is "T" and the complementary nucleotide at the 3 'end of the reverse primer which is unlabeled at the 5' end is "G" The product is also detected from 3.

  FIG. 19 shows the analysis results of G214C and G310T haplotypes. As shown in FIG. 19, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “C”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “T”. A product is detected from the biochemical reaction vessel 8. A biochemical reaction vessel in which the nucleotide at the 3 'end of the forward primer which is unlabeled at the 5' end is "G", and the complementary nucleotide at the 3 'end of the reverse primer which is unlabeled at the 5' end is "T" The product is detected from 6.

  As shown in FIG. 10 where C100T and G310T haplotypes were detected, the 5 ′ end was unlabeled, the 3 ′ end nucleotide of the forward primer was “C”, the 5 ′ end was unlabeled, and the first reverse direction A product is detected from the biochemical reaction vessel 2 in which the complementary nucleotide at the 3 ′ end of the primer is “T”. A biochemical reaction vessel in which the 3 ′ end nucleotide of the forward primer which is unlabeled at the 5 ′ end is “T”, and the complementary nucleotide at the 3 ′ end of the reverse primer which is unlabeled at the 5 ′ end is “T”. From 4 a product is detected.

  Judging from the above, the haplotypes of this specimen can be determined as C-C-T and T-G-T. This result is consistent with the sample allele used.

(Allele 2/1)
FIGS. 20 and 21 show the results of analysis when specimens having all of the mutant types of C100T and G214C and G310T polymorphisms are used as template DNA. FIG. 20 shows the haplotype analysis results of C100T and G214C. As shown in FIG. 20, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “C”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. A product is detected from the biochemical reaction vessel 1. A biochemical reaction vessel in which the 3 ′ end nucleotide of the 5 ′ end unlabeled forward primer is “C” and the 5 ′ end unlabeled reverse primer 3 ′ end complementary nucleotide is “C”. The product is detected from 2.

  FIG. 21 shows the analysis results of the haplotypes of G214C and G310T. As shown in FIG. 21, the nucleotide at the 3 ′ end of the forward primer unlabeled at the 5 ′ end is “G”, and the complementary nucleotide at the 3 ′ end of the reverse primer unlabeled at the 5 ′ end is “G”. A product is detected from the biochemical reaction vessel 5. A biochemical reaction vessel in which the 3 ′ end nucleotide of the 5 ′ end unlabeled forward primer is “C” and the 5 ′ end unlabeled reverse primer 3 ′ end complementary nucleotide is “T”. The product is detected from 8.

  As shown in FIG. 11, in which C100T and G310T haplotypes were detected, the 5 ′ end was unlabeled, the 3 ′ end nucleotide of the forward primer was “C”, the 5 ′ end was unlabeled, and the first reverse direction A product is detected from the biochemical reaction vessel 1 in which the complementary nucleotide at the 3 ′ end of the primer is “G”. A biochemical reaction vessel in which the nucleotide at the 3 'end of the forward primer which is unlabeled at the 5' end is "C" and the complementary nucleotide at the 3 'end of the reverse primer which is unlabeled at the 5' end is "T" The product is detected from 2.

  Judging from the above, the haplotypes of this specimen can be determined as C-G-G and C-C-T. This result is consistent with the sample allele used.

  As shown in Example 2, the electrophoresis pattern obtained by the method of the present invention matches the pattern expected from the allele. Therefore, a combination of SNPs existing on the same chromosome can be uniquely determined by using the present invention.

It is explanatory drawing of a haplotype. It is explanatory drawing of a haplotype. It is explanatory drawing of the detection principle of the haplotype which concerns on this invention. It is explanatory drawing of the amplification product obtained by PCR amplification concerning FIG. It is explanatory drawing after the lambda exonuclease process after the PCR amplification which concerns on FIG. It is explanatory drawing of the haplotype in the case of two chromosomes. It is a figure which shows the analysis result (C100T and G310T haplotype) of the allele 1/1 sample. It is a figure which shows the analysis result (C100T and G310T haplotype) of the allele 10/10 sample. It is a figure which shows the analysis result (C100T and G310T haplotype) of the allele 10/1 sample. It is a figure which shows the analysis result (C100T and G310T haplotype) of the allele 10/2 sample. It is a figure which shows the analysis result (Haplotype of C100T and G310T) of the allele 2/1 sample. It is a figure which shows the analysis result (Haplotype of C100T and G214C) of the allele 1/1 sample. It is a figure which shows the analysis result (G214C and G310T haplotype) of the allele 1/1 sample. It is a figure which shows the analysis result (Haplotype of C100T and G214C) of allele 10/10 sample. It is a figure which shows the analysis result (G214C and G310T haplotype) of allele 10/10 sample. It is a figure which shows the analysis result (Haplotype of C100T and G214C) of the allele 10/1 sample. It is a figure which shows the analysis result (G214C and G310T haplotype) of the allele 10/1 sample. It is a figure which shows the analysis result (Haplotype of C100T and G214C) of the allele 10/2 sample. It is a figure which shows the analysis result (G214C and G310T haplotype) of the allele 10/2 sample. It is a figure which shows the analysis result (Haplotype of C100T and G214C) of the allele 2/1 sample. It is a figure which shows the analysis result (G214C and G310T haplotype) of the allele 2/1 sample. It is a figure which shows the temperature conditions in PCR reaction. It is a figure which shows the temperature conditions in PCR reaction.

Explanation of symbols

301: target nucleic acid 303: complementary strand 305 of the target nucleic acid 305: first forward primer 307: second forward primer 309: first label 311 modified to the first forward primer: second forward direction Second label 313 modified to primer: first reverse primer 315: second reverse primer 317: first label modified to first reverse primer 319: second reverse primer Modified second label 501: Nucleic acid constituting the first chromosome 503: Nucleic acid constituting the second chromosome

Claims (4)

A method for detecting a haplotype of a sample nucleic acid having first and second polymorphic sites,
It has the following processes (1) to (3).
(1) One forward primer selected from two types for wild type and mutant type, each of which specifically amplifies two types of target nucleic acids each having a first polymorphic site of wild type and mutant type , One reverse direction selected from two types, one for wild type and one for mutant type, which specifically amplifies the complementary strands of two types of target nucleic acids, each of which is a wild type and a mutant type, respectively. (A) Phosphorylated label on both the forward primer and the 5 ′ end of the reverse primer in the following four systems using the two types of primers: The first system, not marked with
(B) a second system in which the forward primer is not phosphorylated and the phosphorylated label is attached to the 5 ′ end of the reverse primer;
(C) a third system in which the forward primer is labeled with a phosphorylation at the 5 ′ end and the reverse primer is not labeled with a phosphorylation label at the 5 ′ end; and (d) the forward sequence A fourth system in which phosphorylated labels are attached to both the directional primer and the 5 ′ end of the reverse primer,
(2) A step of fragmenting single-stranded nucleic acid amplified by a primer having a phosphorylated label at the 5 ′ end by treating each amplification product of (1) with lambda exonuclease.
(3) A step of determining a haplotype by detecting in each system the presence or absence of a double-stranded nucleic acid remaining unfragmented as a result of the treatment of (2).   A pair of polymorphic markers adjacent to each other from among polymorphic markers in a plurality of alleles and a pair of polymorphic markers not adjacent to each other from among polymorphic markers in a plurality of alleles are used as the first and second polymorphic sites. The method for determining a haplotype according to claim 1 selected.   The sample nucleic acid has three or more polymorphic sites, and for each combination obtained by selecting two polymorphic sites from these polymorphic sites, the steps (1) to (3) are respectively performed, The haplotype determination method according to claim 1, wherein the haplotype is determined.   The method for determining a haplotype according to claim 1, wherein the sample nucleic acid is derived from two chromosomes.

Images