JP2009183283A - METHOD FOR PRODUCING MICROORGANISM, METHOD FOR PRODUCING GLYCOPROTEIN AND METHOD FOR PRODUCING beta-GLUCAN - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing a microorganism having recovered proliferation potency which has been decreased by gene disruption or gene mutation. <P>SOLUTION: Disclosed is the method for producing a microorganism having recovered proliferation potency which has been decreased by gene disruption or gene mutation, wherein the method includes a step of introducing a gene having a gluconeogenesis-promoting ability into the microorganism having proliferation potency having decreased by gene disruption or gene mutation, and the gene having a gluconeogenesis-promoting ability is one or more genes selected from the group consisting of CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1 and ADH2. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for producing a microorganism in which the growth ability impaired by gene disruption or gene mutation is recovered by forcibly expressing a specific gene. More specifically, the present invention relates to the production of a microorganism whose growth ability has been restored, such as a glycosynthetic gene-disrupted yeast strain or a glycosynthetic gene-mutated yeast strain by forcibly expressing a gene that promotes gluconeogenesis such as CAT8. For methods.

  The technology for adding sugar chains to recombinant proteins is an extremely important issue in the development and production of glycoproteins that are used as pharmaceutical raw materials. Demand for glycoprotein drugs such as antibody drugs is increasing as a therapeutic agent for many diseases. However, conventional production of glycoprotein drugs using cultured animal cells requires high cost and safety for serum components, and it is difficult to add sugar chains that are equivalent or uniform to those in the human body. There are problems such as. Therefore, the development of an alternative host equipped with a system for supplying high-quality glycoproteins as a raw material for pharmaceuticals in a safe and inexpensive manner instead of animal cells is desired. In order to meet such social needs, many groups around the world have attempted to develop a host capable of efficiently producing glycoproteins.

  Yeast is an excellent host for producing useful glycoproteins. For example, GlycoFi (SR Hamilton et al., Science, 2006) has developed a human sugar chain producing strain in methanol-utilizing yeast (Pichia pastoris). In addition, the AIST group (Y. Chiba et al., JBC, 1998) is developing human-type sugar chain producing strains in Saccharomyces cerevisiae. Yeast can not only make full use of molecular biological techniques such as gene manipulation, but also can be easily scaled up to a large-scale culture system because of its high growth rate, and protein can be produced at a lower cost than protein production systems using animal culture cells. Can produce.

  In particular, a pamphlet having an och1 disruption (Δoch1), an mnn1 disruption (Δmnn1), and an mnn4 disruption (Δmnn4) is disclosed in International Publication WO01 / 014522 (see Patent Document 1 below). That is, in the international publication WO01 / 014522, among genes involved in the biosynthesis of an outer sugar chain specific to yeast, a gene encoding an α-1,6 mannosyltransferase (OCH1 ), Whether the function of the gene encoding Mn-1, mannoseyltransferase that adds mannose to the non-reducing end of the sugar chain (MNN1), and the gene controlling the addition of mannose-1-phosphate (MNN4) are destroyed? , Or yeast mutants in which any mutations are introduced into these genes are disclosed. Since these yeast strains are excellent in the production of glycoproteins containing mammalian sugar chains, they are considered useful for the development of pharmaceuticals.

  In order to avoid the addition of yeast-type sugar chains, human-type glycoprotein-producing yeast strains developed by this technology are affected by the disruption of yeast sugar chain synthesis-related genes, and have high temperature sensitivity (ts property). Shows a decrease in proliferative capacity (B. Choi et al., PNAS, 2003). This yeast not only has a significantly lower ability to grow and produce proteins than wild-type yeasts, but also cannot be further modified to synthesize a variety of sugar chains. I can't respond.

  By the way, β-glucan, which is a kind of polysaccharide, activates macrophages, NK cells, T cells, and killer T cells that attack infected cells and cancer cells in the body, and enhances immunity and resistance. It is known to have. This immunity-enhancing effect increases the ability to eliminate bacteria and foreign substances that have entered the body, and even if it is infected, it has the ability to suppress disease. In addition, such an increase in immunity can be expected to suppress allergic reactions and suppress tumors such as cancer. Actually, various clinical studies have revealed antitumor properties. Furthermore, effects such as a decrease in blood glucose level, diuretic action, blood pressure adjustment, and a decrease in blood cholesterol and triglyceride levels can be obtained.

  Yeast (especially baker's yeast) has long been used as a fermented food and is extremely safe as a food. Since baker's yeast normally contains about 45% β-glucan in the cell wall, it has been commercialized as a health supplement targeted at an immune enhancing effect. Baker's yeast β-glucan is mainly used by extracting it from the cell wall. Β-glucan derived from baker's yeast has already been sold as a pharmaceutical product in the United States as zymosan.

  In order to obtain more β-glucan from the cell wall of yeast, it is necessary to culture a large amount of yeast. In addition, after culture, high-efficiency extraction of β-glucan is required, but this operation is not easy because it requires special techniques. Therefore, development of a method capable of producing such yeast-derived β-glucan by omitting such a process as much as possible and further easily and inexpensively is desired.

International Publication WO01 / 014522 Pamphlet

  An object of the present invention is to provide a method for producing a microorganism that recovers the growth ability of a microorganism whose growth ability has decreased due to gene disruption or gene mutation.

  An object of the present invention is to provide a method for producing a yeast that recovers the growth ability of a budding yeast or the like whose growth ability has been reduced by disruption of a sugar chain synthesis gene or mutation of a sugar chain synthesis gene. Another object of the present invention is to provide a method for producing β-glucan using such a plasmid containing a gene that restores growth ability, yeast that has been restored to growth ability, and yeast that has been restored to growth ability. To do.

  An object of the present invention is to provide a method for producing a glycoprotein having a mammalian sugar chain, using a yeast whose growth ability has been recovered as described above.

  The present invention basically enhances the gluconeogenic system by introducing a CAT8 gene or the like into a microorganism whose growth ability has been reduced by gene disruption or gene mutation, and has a function reduced by gene disruption or gene mutation. It is based on the embodiment that can be recovered.

  Specifically, the present inventors obtained the budding yeast gene disruption strain TIY20 shown in the following reference examples, and YAB100 and YAB101 in which mutations were introduced into the TIY20 by an unbalanced mutation introduction method. TIY20 is a budding yeast gene-disrupted strain that has been modified to produce a human-like high mannose-type sugar chain. TIY20 was temperature-sensitive due to gene disruption, became drug-sensitive, and further had a reduced proliferation ability. On the other hand, YAB100 and YAB101 recovered the function impaired by gene disruption. This restoration of function is thought to be caused by a mutation in some gene. Therefore, exhaustive gene expression analysis using TIY20 and YAB100 and YAB101 microarrays was performed to comprehensively examine genes whose expression in YAB100 or YAB101 is higher than that of TIY20. As a result, the expression of 24 genes was induced more than 3 times that of TIY20.

  V. As shown in Haurie et al. (V. Haurie et al., 2001, JBC, 276, 76-85), 9 of these 24 genes are genes related to gluconeogenesis, and these 9 genes are CAT8 transcription factors. Expression is induced downstream. Therefore, the CAT8 gene was forcibly expressed in TIY20 to induce the expression of genes downstream of CAT8. As a result, we succeeded in recovering the decrease in proliferative ability and drug sensitivity of TIY20. Therefore, by introducing a gene involved in gluconeogenesis and enhancing the gluconeogenesis system, it is considered that the function impaired by gene disruption can be recovered.

  In the examples, it was demonstrated that β-glucan can be produced in large quantities, and the ability of a budding yeast gene-disrupted strain capable of producing glycoproteins having mammalian sugar chains can be recovered. Yeast produced by a simple method, a method for producing glycoprotein using the yeast, a method for producing β-glucan using the yeast, and the like can also be provided.

Specifically, the above problem can be solved by the following invention.
The first aspect of the present invention includes a step of introducing a gene having a function of promoting gluconeogenesis into a microorganism whose growth ability has been reduced by gene disruption or gene mutation, and the gene having a function of promoting gluconeogenesis is , {CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1, and ADH2}, one or more genes selected from the group consisting of, recovered from the reduced proliferation ability due to gene disruption or gene mutation The present invention relates to a method for producing a microorganism.

  In this way, by introducing a gene having a function of promoting gluconeogenesis into a microorganism whose growth ability has been reduced by gene disruption or gene mutation, a microorganism having a function reduced by gene disruption or gene mutation is recovered. Will be able to.

  A preferred embodiment of the first aspect of the present invention is the production method as described above, wherein the microorganism whose growth ability is reduced by gene disruption or gene mutation is a yeast whose growth ability is reduced by gene disruption or gene mutation. . Examples of yeast in this utilization mode include budding yeast, fission yeast, or methanol-assimilating yeast. Since yeast is easy to genetically manipulate, it is possible to easily produce yeast that has recovered the growth ability reduced by gene disruption or gene mutation by using yeast as a microorganism.

  In a preferred embodiment of the first aspect of the present invention, the microorganism whose growth ability is reduced by gene disruption or gene mutation is a budding yeast whose growth ability is reduced by gene disruption or gene mutation. is there. Examples of microorganisms in this utilization mode include budding yeast gene-disrupted strains.

  Specifically, does the microorganism whose proliferation ability is reduced by the gene disruption or gene mutation have one or more disruptions selected from the group consisting of {och1 disruption, mnn1 disruption, mnn4 disruption, and arg3 disruption}? Or a budding yeast gene-disrupted strain having och1 disruption, mnn1 disruption, and mnn4 disruption. Thereby, the budding yeast which produces a mammalian glycoprotein efficiently can be manufactured.

  In a preferred embodiment of the first aspect of the present invention, the gene having a function of promoting gluconeogenesis is CAT8, and the microorganism whose growth ability is reduced by the gene disruption or gene mutation is och1 disruption, mnn1 disruption, and It is the manufacturing method as described above, which is a gene disrupted strain of budding yeast having mnn4 disruption. As demonstrated by the examples described later, the proliferative ability can be restored by introducing the CAT8 gene into a budding yeast gene-disrupted strain having och1 disruption, mnn1 disruption, and mnn4 disruption with reduced proliferative ability. .

  The second aspect of the present invention relates to a method for producing a glycoprotein, comprising a step of obtaining a yeast whose growth ability has been recovered by the above-described yeast production method. A preferred embodiment of the present invention is a method for producing a glycoprotein, comprising a step of obtaining a budding yeast whose growth ability has been recovered by any of the production methods described above.

  Since yeast is an excellent host for producing useful glycoproteins, it is easy to scale up to a large-scale culture system by using yeast that has recovered the growth ability reduced by gene disruption or gene mutation. The glycoprotein can be produced efficiently.

  {A budding yeast gene-disrupted strain having one or more disruptions selected from the group consisting of {och1 disruption, mnn1 disruption, mnn4 disruption, and alg3 disruption}, particularly a budding yeast having och1 disruption, mnn1 disruption, and mnn4 disruption Since the gene-disrupted strains are excellent in producing glycoproteins containing mammalian sugar chains, it is possible to efficiently produce high-quality glycoproteins by recovering the growth ability reduced by gene disruption. Become.

  Furthermore, as demonstrated by the examples described later, a budding yeast gene-disrupted strain into which CAT8 has been introduced as a gene having a function of promoting gluconeogenesis can recover the growth ability. The budding yeast gene-disrupted strain described in the Examples is a strain modified to produce a mammalian glycoprotein. Therefore, glycoproteins can be easily and efficiently produced by restoring their growth ability.

  The 3rd side surface of this invention is related with the manufacturing method of (beta) -glucan including the process of obtaining the yeast which recovered the growth ability with said yeast manufacturing method. A preferred embodiment of the present invention is a method for producing β-glucan, which comprises a step of obtaining a budding yeast whose growth ability has been recovered by any of the production methods described above. β-glucan is mainly extracted from the cell wall of yeast. By making the glycosynthetic gene nonfunctional by disruption or mutation, the content of β-glucan in the yeast cell wall increases. Furthermore, by restoring the growth ability of the sugar chain gene-disrupted strain, its efficiency increases. Therefore, β-glucan can be efficiently produced by using yeast whose growth ability has been recovered.

  The fourth aspect of the present invention is a yeast gene disruption strain having och1 disruption, mnn1 disruption, and mnn4 disruption, into which a gene having a function of promoting gluconeogenesis has been introduced, the function of promoting the gluconeogenesis The gene having the above-mentioned gene relates to a yeast gene disruption strain that is one or more genes selected from the group consisting of {CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1, and ADH2}. Specifically, the gene-disrupted strain of yeast described above, into which a CAT8 gene has been introduced as a gene having a function of promoting gluconeogenesis. A budding yeast is mentioned as a yeast of this utilization aspect.

  A fifth aspect of the present invention relates to a plasmid containing a CAT8 gene, which is used to avoid high temperature sensitivity or to reduce drug sensitivity of a sugar chain synthesis gene disrupted yeast strain or a sugar chain synthesis gene mutant yeast strain. About. As demonstrated in the examples described later, by using this plasmid, the high temperature sensitivity of the gene-disrupted yeast strain or the gene mutant yeast strain can be avoided, and the drug sensitivity can be reduced.

  As a specific yeast, yeast deposited under the accession number “FERM AP-21445” at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology. This yeast is obtained by introducing a plasmid containing the CAT8 gene into a budding yeast gene-disrupted strain and recovering its growth ability. By using this yeast whose growth ability has been recovered, glycoproteins or β-glucan can be efficiently produced.

  ADVANTAGE OF THE INVENTION According to this invention, the manufacturing method of microorganisms which recovers the growth ability of the microorganisms which the growth ability etc. fell by gene disruption or gene mutation can be provided.

  ADVANTAGE OF THE INVENTION According to this invention, the manufacturing method of yeast which recovers the growth ability of yeasts, such as budding yeast with which the growth ability fell by sugar chain synthesis gene disruption or sugar chain synthesis gene mutation, can be provided. In addition, according to the present invention, there are provided a plasmid containing a gene whose growth ability has been restored as described above, a yeast whose growth ability has been restored, and a method for producing β-glucan using the yeast whose growth ability has been restored. Can do.

  ADVANTAGE OF THE INVENTION According to this invention, the manufacturing method of the glycoprotein which has a mammalian type sugar chain using the yeast manufacturing method which recovered the above proliferative properties can be provided.

FIG. 1 is an agarose gel electrophoresis photograph replacing the drawing. FIG. 2 is an agarose gel electrophoresis photograph replacing the drawing. FIG. 3 is a photograph of a synthetic medium (uracil deficient) instead of the drawing and a plate with hygromycin added to the same medium. FIG. 4 is a photograph of a synthetic medium replaced with a drawing and a plate with hygromycin added to the synthetic medium. FIG. 5 is an SDS gel electrophoresis photograph replacing the drawing for examining the N-linked sugar chain length. FIG. 6 shows O.D. in KID3-22 strain (−) and KID08-08-1 strain (+) cells. It is the photograph of the agarose electrophoresis replaced with drawing which shows the result of forced expression of minutaCAT8 gene. It is the photograph replaced with drawing which shows recovery | restoration of the high temperature sensitivity which KID3-22 by CAT8 forced expression shows.

  Embodiments of the present invention will be described below. The first aspect of the present invention includes a step of introducing a gene having a function of promoting gluconeogenesis into a microorganism whose growth ability has been reduced by gene disruption or gene mutation, and the gene having a function of promoting gluconeogenesis is , CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1, and ADH2 are one or more genes selected from the group consisting of one or more genes, and a method for producing a microorganism that has recovered its growth ability reduced by gene mutation About.

  Examples of “microorganisms whose growth ability is reduced by gene disruption or gene mutation” include yeast, budding yeast, fission yeast, or methanol-assimilating yeast, and yeast gene mutants or gene disruption strains. . Specifically, a gene disrupted strain of Saccharomyces cerevisiae is preferable as the “microorganism whose growth ability is reduced by gene disruption or gene mutation”. Examples of the budding yeast gene-disrupted strain include strains having one or more disruptions selected from the group consisting of {och1 disruption, mnn1 disruption, mnn4 disruption, and alg3 disruption}. Examples of the budding yeast gene-disrupted strain include a budding yeast gene-disrupted strain having och1 disruption, mnn1 disruption, and mnn4 disruption. Specifically, gene disruption strains such as TIY19 strain or TIY20 strain described later can be mentioned. As the “microorganism whose growth ability is reduced by gene disruption or gene mutation”, yeast that produces the glycoprotein or β-glucan having a mammalian sugar chain in a high yield is preferable.

  As described above, in the following reference examples, comprehensive gene expression analysis by TIY20, YAB100, and YAB101 microarrays is performed to comprehensively list genes whose expression is increased in YAB100 or YAB101 compared to TIY20. did. As a result, 24 genes showed expression induction more than 3 times compared with TIY20. V. As shown in Haurie et al. (V. Haurie et al., 2001, JBC, 276, 76-85), 9 of these 24 genes are genes related to gluconeogenesis, and these 9 genes are CAT8 transcription factors. Expression is induced downstream. Therefore, the CAT8 gene was forcibly expressed in TIY20 to induce the expression of genes downstream of CAT8. As a result, we succeeded in recovering the decrease in proliferative ability and drug sensitivity of TIY20. Therefore, by introducing a gene involved in gluconeogenesis and enhancing the gluconeogenesis system, it is considered that the function impaired by gene disruption can be recovered.

  Specific “genes having a function of promoting gluconeogenesis” include any one or more of CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1, and ADH2. Examples of the “method for introducing genes having a function of promoting gluconeogenesis” include a method for introducing these genes by a known method. Specific examples of the “method of introducing a gene having a function of promoting gluconeogenesis” include a method of transformation using a plasmid containing CAT8.

  Thus, by introducing a gene having a function of promoting gluconeogenesis, the gluconeogenesis system can be enhanced. That is, in the present invention, the growth ability reduced by gene disruption or gene mutation can be recovered by enhancing the gluconeogenic system for microorganisms whose growth ability has been lowered by gene disruption or gene mutation.

  In addition, a plasmid containing “a gene having a function of promoting gluconeogenesis” (preferably a plasmid containing a CAT8 gene) has a high temperature sensitivity of a sugar chain synthetic gene disrupted yeast strain or a sugar chain synthetic gene mutant yeast strain. It can be used effectively to avoid or restore drug sensitivity. Such a plasmid can be easily produced according to a known method. Then, by using this plasmid to amplify and transform a “gene having a function of promoting gluconeogenesis”, a yeast strain whose temperature sensitivity has been reduced or drug sensitivity has been recovered and growth ability has been recovered has been recovered. Obtainable.

  The yeast used in the present invention is not particularly limited as long as it is generally called yeast, and budding yeast, fission yeast, and the like can be appropriately used. Typical yeasts include those belonging to the family Saccharomycesaceae or Schizosaccharomycesaceae. More specific yeasts are widely used as eukaryotic model organisms, and include Saccharomyces cerevisiae, a kind of budding yeast, and Schizosaccharomyces pombe, a kind of fission yeast. can give. Examples of other yeast that can be used in the present invention include black yeast (Aureobasidium pullulans).

  In addition, you may use methanol assimilation yeast as yeast in this invention. Specific examples of methanol-assimilating yeast include Pichia pastoris, Ogataae minata, Candida boyinini, Pichia methanolica, or morseola. can give. Among these, Pichia pastoris or Ogataea minuta is a preferred methanol-assimilating yeast. For Pichia pastoris, see, for example, Water Verken et al. , Applied and Environmental Microbiology, Vol. 70, no. 5, 2004, pp 2639-2646.

  Methanol-utilizing yeast In minuta, a double disruption strain (Δoch1Δalg3) having och1 disruption and alg3 disruption has been reported. O. The minuta Δoch1Δalg3 double disruption strain has poor growth, grows only under osmotic pressure control, and exhibits a phenotype similar to that of the budding yeast sugar chain gene disruption strain. O. Minuta has a CAT8 gene as in budding yeast. As shown in Examples described later, O.D. In a methanol-utilizing yeast such as a minuta sugar chain gene disruption strain, a phenotype caused by gene disruption or gene mutation can be recovered by forcibly expressing a gene having a function of promoting gluconeogenesis such as CAT8 gene. it can.

  Although the budding yeast demonstrated in the Example is preferable as the yeast used in the present invention, the present invention is not particularly limited to the budding yeast, and can be widely applied to all yeasts such as fission yeast and methanol-assimilating yeast. In particular, for fission yeast, as shown in the reference example, the growth ability and high-temperature sensitivity (ts property) of the sugar chain-deficient strain have been successfully recovered by imbalanced mutagenesis as in the case of budding yeast. For fission yeast, it is known that, like budding yeast, disruption of a specific gene can effectively prevent the addition of mannose to sugar chains and produce glycoproteins having mammalian sugar chains. (Takehiko Yoko-o et al., FEBS Letters 489 (2001) 75-80; Clinton E. Ballow et al., Proc. Natl. Acad. Sci. USA Vol. 91. , Biochemical and Biophysical Research Communications 330 (2005) 813-820; Sandra Fanchitti et al., Journal of Cell Biology, Vol. 143, No. 3, 1988, pp 625-636, JP 2001-161376).

  The yeast gene-disrupted strain used in the present invention is not particularly limited as long as it is a strain in which some gene in wild-type yeast is disrupted. A strain in which any gene is disrupted generally has a lower resistance to high temperature and proliferation than wild-type yeast. A specific gene disruption strain will be described below.

  Japanese Patent No. 3091851 discloses an OCH1 gene disruption strain (Δoch1), and further a double disruption strain (Δoch1 Δmnn1) having a mnn1 disruption (for example, see Example 1 of the publication). That is, when the yeast gene disruption strain used in the present invention is a double disruption strain (Δoch1 Δmnn1), such a double disruption strain may be obtained according to the method described in the publication. According to the publication, if such a double-disrupted strain is used, a high amount of a high-mannose glycoprotein having the same core-type sugar chain as that produced by mammalian cells such as humans or this sugar chain structure is produced in a large amount. And it is said that it can be produced with high purity. In the method for producing yeast of the present invention, if this double disruption strain is used, high temperature sensitivity is avoided and the growth property is restored, so that the same core type sugar chain as high mannose produced by mammalian cells is effectively obtained. And so on.

  Japanese Patent No. 3091851 discloses a triple disruption strain (Δoch1 Δmnn1 Δmnn6) having och1 disruption, mnn1 disruption, and mnn6 disruption (for example, see Example 1 of the publication). That is, when the yeast gene disruption strain used in the present invention is a triple disruption strain (Δoch1 Δmnn1 Δmnn6) or the like, those strains may be obtained according to the method described in the publication. According to the publication, by using such a triple disruption strain, a high-mannose glycoprotein having the same core type sugar chain as this human mannose produced by mammalian cells such as humans or this sugar chain structure can be obtained. It is said that it can be produced in large quantities and with high purity. In the yeast production method of the present invention, if these strains are used, high temperature sensitivity is avoided and proliferative properties are restored, so that the same core type sugar chain as high mannose produced by mammalian cells can be effectively obtained. It can be produced. Furthermore, according to the technique disclosed in the publication, a double disrupted strain in which the OCH1 gene and the MNN1 gene are disrupted can be obtained.

  JP-A-9-266792 discloses a quadruple disruption strain in which the functions of the MNN4 gene and the KRE2 gene are disrupted in addition to the Δoch1 Δmnn1 disruption. As disclosed in the publication, for example, a sporulation medium in which mutant strains and gene disruption strains having different mating types are joined together to produce diploid cells lacking a nitrogen source [for example, F. Sherman, Methods in Enzymology, vol. 194, p. 17 (1991)] to create various mutant or disrupted strains by meiosis, separating the four spores produced thereby individually under a microscope and examining their phenotypes. Can do.

  Internationally published WO 01/014522 (Patent Document 1) discloses a triple disruption strain having och1 disruption (Δoch1), mnn1 disruption (Δmnn1) and mnn4 disruption (Δmnn4). That is, among genes involved in the biosynthesis of an outer sugar chain specific to yeast, a gene (OCH1) encoding α-1,6 mannosyltransferase that performs the first extended addition reaction, mannose at the non-reducing end of the sugar chain Disclosed is a gene-disrupted yeast strain in which the function of the gene (MNN1) encoding α-1,3 mannosyltransferase that adds mannose and the gene (MNN4) that controls addition of mannose-1-phosphate is disrupted. TIY20 used in the examples of the present invention has a mat different from that of TIY19 disclosed in the literature, and is obtained from the same clone by four-molecule analysis. Tetramolecular analysis can be performed, for example, according to a method described in Dan Burke et al. (Translated by Junichi Ohya et al., Yeast Genetic Experiment Manual, published on Mar. 10, 2002).

  International Publication WO01 / 014522 (Patent Document 1) discloses a budding yeast disruption strain into which disruption including och1 disruption, mnn1 disruption, mnn4 disruption and alg3 disruption is introduced, as well as OCH1 gene, MNN1 gene, MNN4 gene And a gene-disrupted strain of Saccharomyces cerevisiae in which the ALG3 gene is disrupted. In addition, in this publication, in addition to the mutant traits resulting from gene disruption, an auxotrophic mutant trait selected from the group consisting of ura3 mutation, his3 mutation, leu3 mutation, leu2 mutation, ade2 mutation, trp1 mutation, and can1 mutation. A yeast mutant strain having According to the publication, these mutant strains can easily introduce foreign genes using an auxotrophic selection marker. By using these mutant strains, mammalian sugar chains or mammalian sugar chains can be obtained. It is disclosed that a glycoprotein having a large amount can be produced with high purity. Therefore, in the method for producing yeast of the present invention, if the mutant strain disclosed in the publication is used, the proliferative ability and the like are recovered, so that it is considered that mammalian glycoproteins can be produced effectively. Furthermore, it is considered that the mutant strains whose growth properties have been restored in this way produce β-glucan with high efficiency.

  Therefore, for example, as a gene function-deficient strain such as a yeast gene disruption strain or a gene mutation strain, it has one or more disruptions selected from the group consisting of {och1 disruption, mnn1 disruption, mnn4 disruption, and alg3 disruption} Or a strain having one or more mutations selected from the group consisting of {och1 mutation, mnn1 mutation, mnn4 mutation, and arg3 mutation}. Not only a gene-disrupted strain caused by gene disruption but also a gene-mutated strain caused by gene mutation has a problem similar to the above. Therefore, the method of the present invention can be effectively used not only for the gene-disrupted strains demonstrated in the Examples but also for gene mutant strains. More specific strains include yeast strains that have och1 disruption, mnn1 disruption, and mnn4 disruption. “Having och1 disruption, mnn1 disruption, and mnn4 disruption” means having other gene disruption in addition to och1 disruption, mnn1 disruption, and mnn4 disruption, and introducing other mutations. May be. The yeast gene disruption strain having och1 disruption, mnn1 disruption, and mnn4 disruption may be a triple disruption strain having only och1 disruption, mnn1 disruption, and mnn4 disruption gene disruption. According to the present invention, it is possible to obtain a yeast that avoids high-temperature sensitivity or recovers its growth ability, and thereby can produce β-glucan and glycoprotein with high efficiency. Among gene function-deficient strains such as gene disruption strains and gene mutant strains, yeast gene disruption strains having only och1 disruption or och1 disruption and other gene disruptions can be preferably used. JP 2001-161376 discloses an och1 disruption strain (Δoch1) of fission yeast that has lost the function of the glycosyltransferase gene och1 + of fission yeast. In the present invention, an och1 disruption strain (Δoch1) of fission yeast may be used as a gene disruption strain of yeast. Therefore, for example, even when fission yeast is used as the yeast, a gene-disrupted strain having only och1 disruption or och1 disruption and other gene disruptions can be preferably used.

  In the present invention, basically, the specific gene described above is forcibly expressed in a microorganism such as yeast. In order to express a specific gene in yeast, an expression cassette is constructed by inserting a promoter upstream and a terminator downstream, and this is introduced into an expression vector. If the promoter and terminator are already present in the expression vector into which the gene is introduced, only the fusion gene may be introduced between the promoter and the terminator without constructing the expression cassette.

  The promoter in the expression cassette is not particularly limited as long as it is a promoter that is generally used in a yeast expression system and can express a fusion gene introduced into a transformed yeast. For example, PGK, GAP, TPI, GAL1 , GAL10, ADH2, PHO5, and CUP1, among which GAP promoter is preferable.

  On the other hand, the terminator is generally used in yeast expression systems, and any terminator may be used as long as it is present downstream of the introduced fusion gene to enable transcription termination, and examples thereof include ADH1, TDH1, TFF, and TRP5.

  The expression vector for introducing the expression cassette is not particularly limited as long as it is generally used in yeast expression systems. As specific expression vectors, plasmids derived from E. coli (eg, pBR322, pBR325, pUC12, and pUC13), plasmids derived from Bacillus subtilis (eg, pUB110, pTP5, and pC194), plasmids derived from yeast (eg, pSH19, and pSH15), bacteriophages such as λ phage, animal viruses such as retrovirus and vaccinia virus, and insect pathogenic viruses such as baculovirus can be used, and yeast-derived plasmids can be preferably used.

  The plasmid used for yeast transformation is not particularly limited as long as it is a plasmid that can be used for yeast transformation, for example, yeast episome plasmid abbreviated as YEp, abbreviated as YRp. Yeast self-replicating plasmid (yeast replicating plasmid) and the like. The yeast episomal plasmid vector is a vector that contains the 2μ plasmid sequence inherent in yeast and can be replicated in host yeast cells using its origin of replication. The yeast episomal expression vector used in the present invention preferably contains at least the ARS sequence of the yeast 2μ plasmid sequence and can be propagated extrachromosomally in the host yeast. Specific plasmids include YEp51, pYES2, YEp351, YEp352 and pREP.

  The yeast episomal expression vector is preferably a shuttle vector that can be propagated inside the Escherichia coli so that subcloning can be performed in recombinant Escherichia coli, and more preferably includes a selection marker gene such as an ampicillin resistance gene. The expression vector also contains a marker gene that allows selection of yeast clones by auxotrophy or drug resistance when recombinant yeast is produced. Examples of the marker gene include HIS3, TRP1, LEU2, URA3, ADE2, CAN1, SUC2, LYS2, and CUP1 (edited by Taiji Oshima, Biochemical Experimental Method 39, Yeast Molecular Genetics Experimental Method, 119-144). (1996)). These are merely examples, and may be appropriately selected according to the genotype of the yeast strain used as the host for gene transfer. A series of techniques relating to the construction of the above-described fusion gene expression plasmid can be appropriately carried out by those skilled in the art with reference to the description in Examples below or by conventional techniques.

  A promoter, enhancer, splicing signal, poly A addition signal, selection marker, SV40 replication origin, DNA encoding a tag, and the like may be added to the expression vector. The expression vector may be a fusion protein expression vector. Commercially available fusion protein expression vectors include pGEX series (Amersham Pharmacia Biotech), pET CBD Fusion System 34b-38b (Novagen), pET Dsb Fusion Systems 39b and 40b (Novagen), and pET GST Fst GST 42 (Novagen).

  In the present invention, examples of host yeast transformed with the gene expression vector include those using yeast belonging to the genus Saccharomyces and Candida, but are not particularly limited. Examples of Saccharomyces yeasts include Saccharomyces cerevisiae KK4 strain, Y334 strain, Inv-Sc1 strain, and W303 strain.

  In order to transform yeast with a fusion gene expression vector, a known method may be appropriately used. Examples of methods for transforming yeast with a fusion gene expression vector include the following methods. A known method such as treatment with lithium phosphate, addition of DNA and PEG and incubation, or electroporation can be used (Becker and Guarente, Methods Enzymol., 194, 182-187 (1991)). In addition, spheroplast cells in which cell walls have been digested with enzymes are incubated with PEG and DNA in the presence of calcium ions derived from calcium dichloride or the like (Hinen et al., Proc. Natl. Acad. Sci. USA, 75: 1929 (1978)), and a method of performing transformation by irradiating cells with DNA-attached particles (Fox TD et al., 1988. Plasmid can stable transform). yeast mitochondria racking endogeneous mtDNA.Proc.Nat.Acad.Sci.85: 7288-7292) may be used.

  A yeast transformation method (Japanese Patent No. 3682530) including a step of maintaining a logarithmically growing yeast cell in a solution containing a gene to be introduced into the yeast cell and polyethylene glycol may be used.

  An appropriate selection marker may be used for screening for transformed yeast. An example is one that uses a gene involved in metabolism on the chromosomal DNA of the host cell. That is, by using a host cell that does not function the above gene on the chromosomal DNA by appropriate means such as mutation, and transforming an expression vector containing the corresponding normal gene, Those which can be screened by growing only cells are preferred. Specifically, a selection marker gene that is widely used such as URA3 and LEU2 as described above is connected to an expression vector. In the case of the chromosomal integration type (YIp type), these genes also serve as screening markers.

  The transformed yeast transformed may be cultured according to a known method. Specifically, it is cultured overnight in 5 ml of medium, repeatedly scaled up to 20 ml, 50 ml, and 100 ml, and the culture is repeated in a state where yeast can be divided for a period of about one week. The method for culturing the transformed yeast can be carried out according to the usual method used for culturing yeast. As the medium, a medium containing a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by yeast and capable of efficiently cultivating the transformant may be used. Specifically, YPD medium, YPG medium, YPDG medium YPAD medium, glucose synthesis minimum medium (SD), iodine-added minimum medium (SMM), Hartwell complete medium (HC), GAL fermentation test medium, sporulation medium, or the like can be used as appropriate. In addition, for example, a synthetic medium (carbon source, nitrogen source, inorganic salt, amino acid) added with various medium components supplied by Difco and excluding amino acids that can be supplied by markers necessary for plasmid replication and maintenance. , Vitamins and the like) (Sherman, Methods Enzymol., 194, 3-57 (1991)).

  It is appropriate to adjust the pH of the medium to 6-8. The pH may be adjusted by controlling the amount of inorganic or organic acid, alkali solution, urea, calcium carbonate, ammonia or the like added. The culture is performed at 28 to 32 ° C., preferably 30 ° C., for 1 to 1 month, for example, 1 day to 3 days or less, or about one week (for example, 5 days to 10 days) according to a conventional method. May be carried out while appropriately adding. In particular, it is desirable to add KCl and sorbitol and culture at 30 ° C. in order to efficiently culture the TIY20 strain. However, in order to apply a gentle selection pressure, the culture may be performed in a medium to which KCl and sorbitol are not added. . In order to obtain a gentle selection pressure, the culture may be performed at a temperature slightly higher than 30 ° C. such as 31 ° C. to 35 ° C. (or 32 ° C. to 33 ° C.).

Yeast that has recovered its growth ability Yeast that has recovered its growth ability means a yeast produced by the above-described production method. Specific examples include budding yeast, fission yeast, or methanol-assimilating yeast that produce glycoproteins having mammalian sugar chains. More specifically, a yeast obtained by introducing a specific gene in a known gene-disrupted strain or a gene-disrupted strain that can be produced from a known gene-disrupted strain according to a known method is exemplified.

Glycoprotein having a mammalian sugar chain Examples of glycoproteins in the present specification include glycoproteins having a mammalian sugar chain. Any glycoprotein having a mammalian sugar chain may be produced by the above-mentioned known gene disruption strains, and any method described in this specification may be used for isolating and purifying glycoproteins from gene disruption strains. A method disclosed in these documents or a known method may be appropriately used. For example, after the culture is completed, the cells are collected by centrifugation and suspended in an aqueous buffer solution. Thereafter, the cells are crushed using an ultrasonic crusher, a French press, a homogenizer, a dynomill or the like as appropriate to obtain a cell-free extract. The cell-free extract thus obtained may be centrifuged to obtain a supernatant, and glycoproteins may be extracted from the supernatant. Examples of protein extraction methods include solvent extraction methods, salting out methods such as ammonium sulfate, precipitation methods using organic solvents, anion exchange chromatography methods using resins such as diethylaminoethyl-sepharose, and affinity chromatography methods.

  In the present specification, Man represents mannose, and GlcNAc represents N-acetylglucosamine. An asterisk (*) indicates a site capable of phosphorylation. Specific examples of glycoproteins having mammalian sugar chains include glycoproteins having an oligosaccharide chain represented by the following formula (I) or (II) as an asparagine-linked sugar chain.

Yeasts that produce β-glucan with high efficiency Examples of yeasts that produce β-glucan with high efficiency include yeasts produced by the production method described above, as well as yeasts that have recovered their growth potential. Examples of yeasts that produce β-glucan with high efficiency include budding yeast, fission yeast, or methanol-assimilating yeast that produce β-glucan with high efficiency. More specifically, a yeast obtained by forcibly expressing a predetermined gene in a known gene-disrupted strain or a gene-disrupted strain that can be produced from a known gene-disrupted strain according to a known method can be mentioned.

[beta] -glucan [beta] -glucan may be any one produced by the aforementioned known gene disruption strain. For example, specific β-glucan types include β-1,3-D-glucan and β-1,6 / 1,3-D glucan. As a method for isolating and purifying β-glucan from a gene-disrupted strain (particularly from a yeast cell wall), a known method can be appropriately used. For example, after the culture is completed, the obtained culture (cell) is collected by centrifugation and suspended in an aqueous buffer solution. Next, the cells are crushed using an ultrasonic crusher, a vortex mixer, a French press, a homogenizer, a dyno mill or the like as appropriate to obtain a cell lysate. The resulting cell lysate is centrifuged to collect pellets (including cell walls) (resuspension, centrifugation, and pellet recovery are repeated as appropriate. Extraction is performed, for example, by Magnelli P. et al., Analytical Biochemistry 301.). 136-150 (2002).

Description of deposited strain The YAB100 strain obtained in the reference example described below has been deposited with the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology as of July 11, 2006 under the deposit number: FERM P-20955. .
YAB101 strain obtained in a reference example to be described later has been deposited at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology as an accession number: FERM P-20956 since July 11, 2006.
The C2-11 strain obtained in a reference example to be described later has been deposited at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology as of December 27, 2006 under the accession number: FERM P-21145.
The TIY <CAT8 strain obtained in the examples described later has been deposited at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology as a deposit number: FERM AP-21445 since December 27, 2006.
KID08-08-1 obtained in the examples described later has been deposited at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology as of January 8, 2009 under the accession number: FERM AP-21757. .

Reference Example 1 Production of Plasmid pAB100 Introducing Mutant Pol3 DNA Fragment The plasmid pAB100 was constructed by cloning the mutant pol3 DNA fragment into the SacI-SalI site of the multicopy vector YEP352GAP2 for budding yeast as follows. The amino acid sequence of Pol3 is shown in SEQ ID NO: 15, and the base sequence of DNA encoding Pol3 is shown in SEQ ID NO: 16, but the pol3-01 mutant gene obtained in this example is the 962nd base in SEQ ID NO: 16. Is substituted from A to C, and the 968th base is substituted from A to C. That is, a mutation was introduced such that the amino acid residue encoded by the base sequence from the 961st to the 969th base sequence of SEQ ID NO: 16 was replaced from DIE to AIA. The amino acid sequence of pol3-01 thus obtained is shown in SEQ ID NO: 17, and the base sequence of the DNA encoding the pol3-01 mutant gene is shown in SEQ ID NO: 18.

  Specifically, the AMY128-1 strain (MATαpol3-01, ura3-52, leu2-1, lys1-1, ade2-1, his1-7, hom3-10, trp1- known as a natural mutator) 289) as a template, PCR reaction (forward primer: 5′-AGCTCGAGTCTC (SacI) ATGAGTGAAAAAGAATCCCTTCCCCATG-3 ′ (SEQ ID NO: 1), reverse primer: 5′-GCATCGCGCCGC (NotI) TTACCATTGTCTAATTGTTCCT No. 3 2)), the pol3-01 mutant gene was amplified, and the amplified fragment was cloned into the SacI-NotI site of the pYES2 vector (the resulting plasmid was pYE). Was named 2-pol3-01.). Further, the pol3-01 mutant gene is digested with restriction enzymes SacI and XhoI so that the pol3-01 mutant gene can be expressed under the control of the GAPDH promoter, and the SacI-SalI site of the YEp352GAP-II vector is digested. (The plasmid thus obtained was named pAB100).

Acquisition of a high-temperature resistant strain of a sugar chain-modified strain Saccharomyces cerevisiae sugar chain-modified strain TIY20 (matα och1 :: hisG mnn1 :: hisG mnn4 :: hisG) is transformed with the plasmid pAB100 obtained as described above Converted. TIY20 was obtained by four-molecule analysis from the same clone as TIY19 disclosed in International Publication WO01 / 014522 (Patent Document 1). The obtained transformant (TIY20 / pAB100) was added to a budding yeast synthetic medium SD-U (6.7 g Yeast nitrogen base with amino acids) (Difco laboratories), 20 g glucose, 0.77 g. CMS-URA (Sunrise Science Products) (liquid) was cultured under controlled conditions so that it could divide as much as possible. Culturing was carried out at 37 ° C. for 3 days, and the colonies that had grown were caught, and in order to remove pAB100 from the obtained strain, complete medium YPAD (10 g Yeast extract (Difco laboratories), 20 g peptone (Dito) fco), 0.2 g adenine sulfate (Sigma), 20 g Glucose / 1 L), and then cultured to collect 20 single colonies each of which obtain colonies that cannot grow on the SD-U medium. did.

Reference Example 2 Analysis of sugar chain length added to protein invertase in yeast 9 strains obtained in Reference Example 1 (C15, C27, C28, C30, C3-20, C4-1, C3-3-1, C3-7-2 In order to examine the N-linked sugar chain length of C3-3-9), the N-linked sugar chain length added to the invertase produced in yeast was examined by the following method. Each strain was cultured in 5 ml of YPAD and then cultured in 5 ml of YPSuc (10 g Yeast extract (Difcolaboratories), 20 g of peptone (Difco), 10 g of sucrose / 1 L) for 3 hours or more, and the bacteria were collected. The collected bacteria were 50 μl of SDS-PAGE sample buffer (15% Glycerol, 0.125 M Tris-HCl (pH 6.8), 2 mM PMSF, 3% SDS, 0.1% Bromophenol blue, 1% 2-mercaptoethanol) and glass. Beads were added and vortexed. After centrifuging at 15,000 rpm for 5 minutes, 5 μl of each supernatant was electrophoresed on 5% SDS-PAGE (100 V, 3 hours). The gel was transferred to a reaction solution (3.4 g sucrose, 3 ml 3M Na-acetate / 100 ml), incubated at 37 ° C. for 30 minutes, and then washed twice with deionized water. Transferred to staining solution (2 g NaOH, 50 mg triphenyltetrazole chloride / 50 ml) and boiled until color developed. As a result, it was found that the N-linked sugar chains added to the 9 strains of invertase obtained had the same sugar chain length as the parent strain TIY20.

Analysis of Growth Recovery Efficiency Next, the growth recovery efficiency of the strain obtained in Reference Example 1 was analyzed. After culturing with 5 ml of YPAD at 30 ° C., it was transferred to 10 ml of YPAD so that OD600 was 0.1, and cultured at 30 ° C. or 37 ° C. Bacteria were collected at each time point and examined for OD600. As a result, it can be seen that among the nine strains analyzed, C4-1 and C3-20 have a higher growth rate at 30 ° C. than TIY20. It can also be seen that TIY20 hardly grew at 37 ° C., but C4-1 (YAB100) and C3-20 (YAB101) recovered the growth ability.

Reference Example 3. Sugar chain structure analysis The sugar chain structure of the mannoprotein in the strain obtained in Reference Example 1 was analyzed. Bacteria cultured in 50 ml were collected, washed with water, suspended in 8 ml of 100 mM citrate buffer (pH 7.0), and autoclaved at 121 ° C. for 2 hours. The supernatant was collected by centrifugation, 24 ml of cold ethanol was added, and the mixture was allowed to stand at −20 ° C. for 30 minutes, and then centrifuged to collect the precipitate. After suspending in water, the protein solution was adjusted to 3 mg / ml, and treated with 5 μl Glycopeptidase F (4450 manufactured by Takara Bio Inc.). After incubation at 37 ° C. for 17 hours, water was added to 100 μl, phenol / chloroform / isoamyl alcohol (25/24/1) was added and stirred well, and the supernatant was collected by centrifugation (phenol chloroform extraction). Chloroform was added to the collected liquid, stirred, and centrifuged to collect the supernatant (chloroform extraction) and dried up. After the pyridylamination was performed on the dried-up sample using Pyridylamine manual kit (4480, manufactured by Takara Bio Inc.), it was subjected to seven phenol chloroform extractions to remove excess reagents. After chloroform extraction, the supernatant was dried up, dissolved in water, HPLC (Class-VP manufactured by Shimadzu Corp., column, TOSOH TSK-GEL AMIDE-80 (φ4.6 mm × 250 mm), flow rate, 1 ml / min. , Detection, 320 nm (excitation), 400 nm (fluorescence), buffer A, acetonitrile, buffer B, 200 mM TEAA (elution of each sugar by increasing the buffer concentration), buffer B gradient conditions, 0-40 minutes, 30 → 60 %, 40-50 minutes, 30%). As a result, it was found that various numbers of mannose were added in the wild strain W303-1B. On the other hand, in all of the obtained strains, a peak showing a sugar chain structure consisting of the same eight mannoses as the parent strain TIY20 was observed as a main peak. This indicates that the mutant strain in the example has a so-called mammalian sugar chain.

Reference Example 4 Chitinase analysis The secretion efficiency of the protein secreted from the strain obtained in Reference Example 1 was analyzed. 40 mg wet chitin (Sigma) was added to the supernatant of the bacteria cultured in 40 ml and stirred overnight at 4 ° C. The chitin was collected by centrifugation and washed 3 times with PBS. After suspending in 100 μl SDS-PAGE sample buffer and treating at 100 ° C. for 10 minutes, 10 μl was subjected to SDS-PAGE and lectin blotted with ConA-biotin (Seikagaku Corporation). Detection was performed by Streptavidin-HRP (Seikagaku Corporation). Immobilon Western Chemiluminescent HRP Substrate (Millipore) was used as a detection reagent, and Fuji Film LAS1000 was used as a detection device. As a result, it can be seen that in TIY20, although the secretion efficiency is about 50% of the wild type strain, the secretion efficiency is recovered in the obtained strain. In particular, in C4-1 and C3-20, the secretion efficiency recovered to the same level as the wild type strain. Therefore, the obtained strain C4-1 was deposited as YAB100, and C3-20 as YAB101.

Reference Example 5 α-Galactosidase A activity measurement (verification of foreign gene expression)
A vector (pRS4-GAP-αGalA) (Chiba, Y. et al., Glycobiology, 12, 821-828, 2002) having an expression cassette in which the human α-galactosidase A gene is linked downstream of the GAPDH promoter is C4-1 ( YAB100), C3-20, C3-7-2, and C27, respectively. After culturing the obtained transformant, the culture solution (including bacteria) was used as an enzyme source. After 5 minutes of reaction at 37 ° C. using 5 mM 4-MU-α-galactopyranoside as a substrate, the reaction was stopped by adding 200 μl of a reaction stop solution (0.2 M glycine buffer (pH 10.7)). The measurement was performed using a microplate reader for fluorescence (MTP-32, Ex: 365 nm, Em: 450 nm, manufactured by Corona). As a result, in the TIY20 strain, α-galactosidase was inactivated, whereas C3-20, C3-7-2 and C4-1 (YAB100) showed good α-galactosidase A activity, particularly C3-20. And C3-7-2 show higher α-galactosidase A activity than wild type W303-1B.

Reference Example 6 Monosaccharide analysis of yeast cell wall Yeast C4-1 (YAB100) and C3-7-2 obtained in Reference Example 1 were shake-cultured at 5 ° C. for 15 hours at 30 ° C., and then the bacteria were centrifuged (4000 rotations). The cells were collected by suspending in 1 ml of 10 mM Tris-HCl buffer (pH 7.5, 1 mM PMSF) and centrifuging (4000 rpm for 5 minutes). The cells were washed by performing this operation three times. The suspension was resuspended in 0.1 ml of the above Tris-HCl buffer, glass beads were added to the liquid surface, and the mixture was stored at -20 ° C for 1 hour. After disrupting the cells with a vortex mixer, only the cell disruption solution was recovered, and the pellet was recovered by centrifugation (1000 g, 10 minutes). The pellet (cell wall) was suspended in 1 ml of 1M NaCl and centrifuged. This operation was repeated three times to wash the pellet. Next, it was washed 3 times with 1 ml of 1 mM PMSF. Resuspended in 0.2 ml 1 mM PMSF.

  50 μl of sterile ultrapure water was added to 50 μl of the cell wall suspension, 100 μl of 4M TFA was added, and the mixture was incubated at 100 ° C. for 4 hours. After completely evaporating the solvent in a vacuum dryer, 100 μl of 0.2 M ammonium acetate and 10 μl of acetic acid were added and incubated at room temperature for 30 minutes. After drying in a vacuum dryer, 100 μl of 0.2M ammonium acetate and 10 μl of acetic acid were added and incubated at room temperature for 30 minutes. The suspension was transferred to a PA tube and dried. The PA labeling was performed using a PA Labeling Kit (PALSTATION Pyridylation Reagent Kit for monosaccharide analysis (TaKaRa)). HPLC was performed with column: TSK-GEL SUGAR AX type (TOSHO), solvent: 0.7 M potassium borate (pH 9.0): acetonitrile = 9: 1, 65 ° C., flow rate: 0.3 ml / min. The composition ratio of monosaccharides was calculated from the peak area ratio. The percentage of glucose in TIY20 strain was as high as about 80% compared to the percentage of glucose in WT (about 45%), but C4-1 (YAB100) and C3-7-2 strains had higher glucose levels. The ratio (90% or more) is shown. Although it was considered technically very difficult to produce a yeast with a high β-glucan content ratio such that the glucose ratio exceeded about 80%, the ratio of glucose was more than about 10%. Was improved.

EXAMPLES Next, although an Example is given and this invention is demonstrated in detail, this invention is not limited to these.
1. The Saccharomyces cerevisiae TIY20 strain, which is a gene disruption strain for searching for a gene whose expression is induced in the YAB100 strain, exhibits temperature sensitivity and poor growth. On the other hand, as described in the above Reference Example, the YAB100 strain obtained by introducing the mutation using the unbalanced mutation introducing method using the DNA polymerase mutation of the TIY20 strain recovered the growth ability. Therefore, in order to search for a causative gene that restores a phenotype such as growth delay in the YAB100 strain, gene expression comparison analysis with YAB100, TIY20 and the wild type strain W303-1B was analyzed with a microarray.

  YAB100, TIY20, and W303-1B strains were cultured in a 5 ml YPAD liquid medium at 30 ° C. for 15 hours before shaking. From these cultures, YAB100 was added at OD600 = 2.4 U, TIY20 was added at OD600 = 5 U, W303-1B = 0.3 U to 10 ml of YPAD liquid medium, and cultured with shaking at 34 ° C. for 15 hours. All of these cells were collected, washed with sterilized water, 200 μl of Sepazole (Nacalai Tesque) and glass beads were added, and the cells were crushed by vortexing vigorously. After transferring the cell disruption solution to a new tube, 800 μl of Sepazole was added, and after stirring, the mixture was allowed to stand at room temperature for 5 minutes. 200 μl of chloroform was added and mixed by inversion, left standing at room temperature for 3 minutes, and then centrifuged at 12,000 g for 15 minutes at 4 ° C. The aqueous phase was transferred to another tube, 500 μl of isopropanol was added, mixed and allowed to stand at room temperature for 10 minutes. The supernatant was removed by centrifugation at 12,000 × g for 5 minutes at 4 ° C. 75% ethanol was added to the pellet. After washing, the ethanol was discarded, dried for 10 minutes, and dissolved in 200 μl of DEPEC-treated water. Further, the same amount of phenol: chloroform: isoamyl alcohol = 50: 48: 2 was added, and after mixing, the mixture was centrifuged at 15,000 g for 5 minutes at room temperature. Transfer the aqueous phase to a new tube, add 2.5 volumes of 100% ethanol and 1/10 volume of 3M LiCl, allow to stand at −80 ° C. for 30 minutes, and then centrifuge at 4 ° C., 15,000 g for 15 minutes. did. The supernatant was discarded, the pellet was washed with 70% ethanol, dried well, and then dissolved in 100 μl of sterile milliQ water. To prevent genomic DNA contamination, 5 μl of DNase I reaction buffer (Invitrogen Deoxyribonuclease I, Amplification Grade), 2 μl of DNAase I, Amp grade (Invitrogen), and 13 μl of MilliQ water are added to 30 μl of the RNA sample obtained above. And left at 23 ° C. for 15 minutes. Add 4 μl of 25 mM EDTA, heat at 65 ° C. for 10 minutes, add the same amount of phenol: chloroform: isoamyl alcohol = 50: 48: 2, mix, and centrifuge at 15,000 × g for 5 minutes at room temperature. separated. The aqueous phase was transferred to a new tube, 2.5 volumes of 100% ethanol and 1/10 volume of 3M LiCl were added, allowed to stand at −80 ° C. for 30 minutes, then 15 ° C. at 4 ° C., 15,000 × g. Centrifuge for minutes. The supernatant was discarded, the pellet was washed with 70% ethanol, dried well, and then dissolved in 30 μl of sterile milliQ water. These RNA samples were subjected to microarray analysis using a contracted microarray analysis service (Hokkaido System Science Co., Ltd.) manufactured by Agilent. The W303-1B RNA was fluorescently labeled with Cy5, TIY20, and YAB100 RNA with Cy3, hybridized to the Yeast oligo DNA microarray, and scanned with an Agilent Technologies Microarray Scanner at 10 μm resolution.

  In the expression comparison of YAB100 and TIY20 mRNA, it was found that the expression of the genes listed in Table 1 was transcriptionally induced in the YAB100 strain and the YAB101 strain. In order to confirm whether or not these gene groups were actually induced in the YAB100 strain, the expression of the genes was confirmed by reverse transcription PCR reaction using mRNA obtained by the same method as described above as a template. For reverse transcription PCR reaction, MLS1 forward primer: 5′-CCTGTCCATCGGAGGGGTGTTCATGC-3 ′ (SEQ ID NO: 3), reverse primer: 5′-GGGCACACATCCAGAGCTCTGAGCCC-3 ′ (SEQ ID NO: 4), ICL2 forward primer: 5′-CACCCAATTGTGCGCTGTC-3 (SEQ ID NO: 5), reverse primer: 5′-CTTGCTTATTGACAGGGCTGGATC-3 ′ (SEQ ID NO: 6), PCL1 forward primer: 5′-CGCCAGTAACGGATGAC-3 ′ (SEQ ID NO: 7), reverse primer: 5′-GTACCTAGGCCCAGGC-3 ′ ( SEQ ID NO: 8), YOX1 forward primer: 5′-CACCACTCTCTG AGCG-3 '(SEQ ID NO: 9), reverse primer: 5'-GGTGTGGATGAGCGCC-3' was used (SEQ ID NO: 10).

A reaction solution for the reverse transcription PCR reaction was prepared as follows.
2 × reaction buffer: 6.25 μl
Template mRNA 500ng
10 μM forward primer: 0.25 μl
10 μM reverse primer: 0.25 μl
RT / Platinum Taq Mix: 0.25 μl
Sterilized milli-Q water: xμl
50μl total

The reaction conditions were one cycle of cDNA synthesis (50 ° C 30 minutes, 94 ° C 2 minutes), 18 cycles of PCR synthesis (94 ° C 15 seconds, 55 ° C 30 seconds, 72 ° C 1 minute), and 1 cycle (72 ° C 10 minutes). . 6 μl of these amplification products were applied to a 2.0% agarose gel and electrophoresed at 100 V for 20 minutes (electrophoresis buffer: Trisbase 24.2 g, acetic acid 5.71 ml, EDTA · 2Na (2H ₂ O) 1.86 g / 500 ml ) As shown in FIG. 1, it was found that messages of ICL2, MLS1, PCL1, and YOX1 were induced in YAB100 compared to TIY20. Although not shown, among 24 genes whose expression is increased by YAB100 compared to TIY20, 9 genes (SFC1, PUT4, MLS1) among genes induced by the Cat8 transcription factor that induces the expression of genes that function in gluconeogenesis , CIT2, FBP1, STL1, ICL1, ACH1, and ADH2) were found to be induced in YAB100 at an expression level of about 5 to 11 times. Furthermore, it was found that PCL1 encoding G1 cyclin is also expressed.

2. Construction of plasmid YEp352GAP-II-CAT8 into which CAT8 gene has been introduced Since many of the genes induced to induce expression in Cat8 are induced in YAB100, the ability of TIY20 to proliferate by forcibly expressing Cat8 in TIY20 It was possible that phenotypes that are inappropriate for protein production such as decrease in drug sensitivity and drug sensitivity could be recovered. Therefore, a CAT8 forced expression plasmid was constructed and transformed into TIY20.
The DNA fragment of CAT8 was cloned into the SacI-SmaI site of the multicopy vector YEp352GAP-II for forced expression of budding yeast as follows to construct the plasmid YEp352GAP-II-CAT8.

  A CAT8 fragment was amplified by PCR reaction using the genomic DNA of Saccharomyces cerevisiae strain W303-1B as a template. For the PCR reaction, forward primer: 5'-GTTTGAGCTCC (SacI) ATGGCAAAATAATATTCTGATCGACAAGG-3 '(SEQ ID NO: 11), reverse primer: 5'-GTTTCCCGGG (SmaI) TTATTGGCGTTTGCCCATTGGAATAATC-3 (sequence No. 11). The obtained amplified fragment was cloned into the TA cloning site of TA cloning vector pCR2.1-TOPO (Invitrogen K4500-01). This vector was digested with restriction enzymes SacI and SmaI, and the resulting CAT8 fragment was cloned into the SacI-SmaI site of the YEp352GAP-II vector (the plasmid thus obtained was named YEp352GAP-II-CAT8). This plasmid can express the CAT8 gene under the control of the GAPDH promoter.

3. Recovery of growth ability and drug sensitivity of CAT8 forced expression TIY20 strain Plasmid YEp352GAP-II-CAT8 (including uracil marker gene) obtained as described above was transformed into budding yeast strain W303-1B or TIY20 strain, Each transformant (WT <CAT8 and TIY <CAT8 strains) was obtained. As explained above, the strain TIY <CAT8 is a deposited strain. Moreover, the strain which introduce | transduced empty YEp352GAP-II vector into the W303-1B strain or TIY20 strain as each control strain was also obtained (WT <Vec and TIY <Vec strain). WT <Vec, WT <CAT8, TIY <Vec, TIY <CAT8 1 clone of 5 ml of SD-ura + KCl liquid medium (6.7 g Yeast nitrogen base without aminoacids (Difco Laboratories), 7 Glucose) After culturing at 30 ° C. (Sun rise Science Products, 0.22 g Adenine sulfate / 1 L with KCl to a final concentration of 0.3 M) and obtaining mRNA in the same manner as in Example 1 above, The expression of mRNA of CAT8 was confirmed by copying PCR.For reverse transcription PCR reaction, CAT8 forward primer: 5′-CACAGCTCGCACCACAG-3 ′ (SEQ ID NO: 13), reverse primer: 5′-GAAGCCGTGGTGCTGGC-3 ′ (SEQ ID NO: 14) was used under the same conditions as described above, and it was found that CAT8 was forcibly expressed in the wild type strain and the TIY20 strain, as shown in FIG. .

WT <Vec, WT <CAT8, TIY <Vec strains, 1 clone each, and TIY <CAT8 strain 3 clones were cultured in 5 ml of SD-ura + KCl liquid medium. Then, OD600 was stepwise diluted to 1.0~1.0x10 ^-4. These bacterial solutions were added to SD-ura + KCl plate (20 g / 1 L Agar was added to the above SD-ura + KCl, hereinafter referred to as SD-ura plate) or YPAD plate containing 5 mg / 1 L hygromycin B (10 g Yeast extract, 20 g Peptone, 20 g Glucose, 0 6 μl each was spotted on 2 g Adenine, 20 g Agar / 1 L (hereinafter referred to as “hygromycin plate”), and statically cultured at 30 ° C. The photographs of the SD-ura plate after 2 days of culture and the hygromycin plate after 5 days of culture are shown in FIG. When the wild type strain W303-1B was the host, the growth of the CAT8 expression strain (W303 <CAT8) tended to be slightly delayed compared to the empty vector introduced strain (W303 <Vec). On the other hand, when the TIY20 strain was the host, it was found that the CAT8 expression strain (TIY <CAT8) grew better than the empty vector-introduced strain (W303 <Vec) (FIG. 3a). Furthermore, it was found that by introducing the CAT8 gene into the TIY20 strain, the hygromycin B sensitivity exhibited by the TIY20 strain was reduced (FIG. 3b).

4). Phenotype of TIY20 strain from which CAT8 expression plasmid was removed The above-mentioned TIY <CAT8 strain 3 clones (uracil non-requiring) were passaged twice in YPAD medium, and the strain that lost the plasmid and became uracil-requiring was selected and obtained. did. The W303-1B strain, the TIY20 strain and the above-described vector-removed strain were cultured at 30 ° C. in 5 ml of SDall + KCl medium (20 mg Uracil / 1 L in the above SD-ura + KCl medium), and then OD600 was 1.0 to 1.0 × 10 ^−4. Serial dilution was made so that These bacterial solutions were spotted 6 μl each on an SD all + KCl plate (20 g / 1 L Agar was added to the above SD all + KCl, hereinafter referred to as SD all plate) or hygromycin plate, and statically cultured at 30 ° C. FIG. 4 shows photographs of the SD all plate after 2 days of culture and the hygromycin plate after 5 days of culture. It was found that the growth of the vector-removed strain with TIY <CAT8 was slightly delayed as compared with TIY20 (FIG. 4a). Furthermore, it was found that these vector-removed strains showed strong hygromycin B sensitivity similar to the TIY20 strain (FIG. 4b). From these results, it was considered that the growth improvement and the decrease in hygromachine B sensitivity observed in the strain TIY <CAT8 were caused by forced expression of the CAT8 gene.

5. Analysis of sugar chain length added to yeast invertase In order to examine the N-linked sugar chain length of the three strains (C1, C3, C5) obtained in Example 3, it was added to the invertase produced in yeast. The N-linked sugar chain length was examined by the following method. Each strain was cultured in 5 ml of YPAD and then cultured in 5 ml of YPSuc (10 g Yeast extract (Difcolaboratories), 20 g of peptone (Difco), 10 g of sucrose / 1 L) for 3 hours or more, and the bacteria were collected. The collected bacteria were 50 μl of SDS-PAGE sample buffer (15% Glycerol, 0.125 M Tris-HCl (pH 6.8), 2 mM PMSF, 3% SDS, 0.1% Bromophenol blue, 1% 2-mercaptoethanol) and glass. Beads were added and vortexed. After centrifugation at 15,000 × g for 5 minutes, 5 μl of each supernatant was electrophoresed on 5% SDS-PAGE (100 V, 3 hours). The gel was transferred to a reaction solution (3.4 g sucrose, 3 ml 3M Na-acetate / 100 ml), incubated at 37 ° C. for 30 minutes, and then washed twice with deionized water. Then, it moved to the dyeing | staining liquid (2g NaOH, 50mg triphenyltetrazol chloride / 50ml), and boiled until it developed color. The result is shown in FIG. FIG. 5 is an SDS gel electrophoresis photograph replacing the drawing for examining the N-linked sugar chain length. The lanes in FIG. 5 show W303-1B, TIY20, C1, C3, and C5 from the left. From FIG. 5, it was found that the N-linked sugar chain added to the obtained three strains of invertase has the same sugar chain length as TIY20 which is the parent strain.

6). KID08-08-1 strain O.D. Confirmation of forced expression of minutaCAT8 gene
The Ogataea minuta- derived CAT8 gene is present on the genome of Ogataea minuta , and its sequence is shown in SEQ ID NO: 19. Next, for the region encoding this CAT8 gene, the region encoding the N-terminal side 1.5 kb was expressed as primer A 5′-CCGGTCGACATGGCACATCATTGGCAGCGAT-3 ′ (SEQ ID NO: 20) and primer B 5′-TCAGACAGTACAGCAGCTCCATGGTAGGTGA-3 ′ (SEQ ID NO: 21 ), And the region encoding 1.8 kb on the C-terminal side using primer C 5′-TCACTACCCATGGAGCTGCTGTACGTCTGA-3 ′ (SEQ ID NO: 22) and primer D 5′-AGCATGCATTCACCACCCGGTCATGGTGCTCT-3 ′ (SEQ ID NO: 23) Amplified by PCR using the subcloned region containing CAT8 as a template.

The PCR product obtained with primers A and B was digested with SalI and NcoI sites, embedded in the SalI / NcoI sites of plasmid for cloning of E. coli pRS306 (Stratagene Inc.) to construct the plasmid pRS306-OmCAT8N. In addition, the PCR product obtained by primer C (SEQ ID NO: 22) and primer D (SEQ ID NO: 23) was cleaved at the NcoI site and EcoT 22I site, and the NcoI / EcoT 22I site of the plasmid pRS306 (Stratagene) for Escherichia coli was cloned. Incorporation, plasmid pRS306-OmCAT8C was constructed. Next, pRS306-OmCAT8N was cleaved with SalI and NcoI , pRS306-OmCAT8C was cleaved with NcoI and EcoT 22I , respectively, and incorporated into the SalI / EcoT22I site of the O.minuta expression vector pOMEGPU1 to construct plasmid pOMEGPU-OmCAT8.

This plasmid pOMEGPU-OmCAT8 was cleaved with NotI and transformed into O. minuta KID3-22 strain ( Δalg3Δoch1 ) (published at the 2005 Agricultural Chemical Society of Japan). Transformation was performed by electroporation (PCT / JP03 / 05464). After transformation, spread in SD-Ura (2% glucose, 0.17% Yeast Nitrogen Base w / o amino acids (manufactured by Difco), uracil, nucleobase and amino acid mixture (20-400 mg / L) medium, A transformant was obtained by culturing for 2 days at 30 ° C. The transformant was scraped from the plate and confirmed to be integrated on the chromosome by a simplified PCR method suspended in a PCR reaction solution, and KID08-08-1. It was a stock.

RT-PCR of mRNA
Total RNA was extracted from KID3-22 strain and KID08-08-1 strain using commercially available SV TotalRNA Isolation System (Promega). Reverse transcription PCR was performed on 500 ng of the obtained total RNA using primer C (SEQ ID NO: 22) and primer E 5′-TTCCTCTCTTGACCGGGGCAGAGCCG-3 ′ (SEQ ID NO: 24).

  Reverse transcription PCR was performed using One Step RNA PCR Kit (Takara Bio Inc.) according to the protocol. The reaction was performed at 50 ° C. for 30 minutes, then at 95 ° C. for 15 minutes, followed by 25 cycles of 94 ° C. for 15 seconds, 65 ° C. for 15 seconds, and 72 ° C. for 1 minute. Quantitative analysis was performed. As a result, almost no signal was observed in the KID3-22 strain (CAT8 (−) in FIG. 6), whereas a signal was observed in the KID08-08-1 strain (CAT8 (+) in FIG. 6). From these results, it was confirmed that CAT8 was excessively expressed in the KID08-08-1 strain (FIG. 6).

7). Recovery of high temperature sensitivity exhibited by KID3-22 by forced expression of CAT8 O.D. obtained as described above . minuta KID3-22 strain and a 5 mL KID08-08-1 strain YPAD liquid culture medium (10g Yeastextract, 20g Peptone, 20g Glucose, 0.2g Adenine) and cultured in. Then, it diluted stepwise so that OD600 might be 1.0-1.0 * 10 < ^-4 >. These bacterial solutions were spotted 5 μl each on a YPAD plate (20 g / 1 L Agar was added to the above YPAD, hereinafter referred to as a YPAD plate), and statically cultured at 30 ° C., 33 ° C. and 34 ° C. A photograph of the YPAD plate after 5 days in culture is shown in FIG. It was found that the high temperature sensitivity exhibited by the KID3-22 strain was reduced by introducing the CAT8 gene into the KID3-22 strain (FIG. 7).

  The yeast having improved growth ability and the method for producing the same according to the present invention can obtain a yeast having excellent growth ability and glycoprotein production ability, and can be applied not only to budding yeast, fission yeast and methanol-utilizing yeast, but also to yeast in general. Can be widely applied.

  The yeast that produces β-glucan of the present invention with high efficiency and a method for producing the same can obtain a yeast that is more excellent in β-glucan-producing ability than conventionally known yeasts. It can be widely applied not only to yeasts but also to yeast in general.

  The present invention can be used in the pharmaceutical industry because it can be effectively used for production of glycoprotein and β-glucan using yeast.

Claims (18)

Including a step of introducing a gene having a function of promoting gluconeogenesis into a microorganism whose growth ability has been reduced by gene disruption or gene mutation, and the gene having a function of promoting gluconeogenesis,
Recovered the growth ability reduced by gene disruption or gene mutation, which is one or more genes selected from the group consisting of {CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1, and ADH2} A method for producing microorganisms.   The production method according to claim 1, wherein the microorganism whose growth ability is reduced by gene disruption or gene mutation is yeast whose growth ability is reduced by gene disruption or gene mutation.   The production method according to claim 1, wherein the microorganism whose growth ability is reduced by gene disruption or gene mutation is budding yeast, fission yeast, or methanol-assimilating yeast whose growth ability is reduced by gene destruction or gene mutation.   The production method according to claim 1, wherein the microorganism whose growth ability is reduced by gene disruption or gene mutation is a budding yeast whose growth ability is reduced by gene disruption or gene mutation.   The production method according to claim 1, wherein the microorganism whose growth ability is reduced by the gene disruption or gene mutation is a budding yeast gene disruption strain. Microorganisms whose growth ability is reduced by the gene disruption or gene mutation
The production method according to claim 1, which is a budding yeast gene-disrupted strain having one or more disruptions selected from the group consisting of {och1 disruption, mnn1 disruption, mnn4 disruption, and alg3 disruption}. Microorganisms whose growth ability is reduced by the gene disruption or gene mutation
a gene disrupted strain of Saccharomyces cerevisiae having och1 disruption, mnn1 disruption, and mnn4 disruption,
The manufacturing method according to claim 1.   The gene having a function of promoting gluconeogenesis is CAT8, and the microorganism whose growth ability is reduced by the gene disruption or gene mutation is a budding yeast gene disruption strain having och1 disruption, mnn1 disruption, and mnn4 disruption. The manufacturing method according to claim 1.   A method for producing a glycoprotein, comprising a step of obtaining a yeast whose growth ability has been recovered by the production method according to claim 2.   A method for producing a glycoprotein, comprising a step of obtaining a budding yeast whose growth ability has been recovered by the production method according to any one of claims 6 to 8.   The manufacturing method of (beta) -glucan including the process of obtaining the yeast which recovered the growth ability with the manufacturing method of Claim 2.   The manufacturing method of (beta) -glucan including the process of obtaining the budding yeast which recovered the growth ability with the manufacturing method in any one of Claims 6-8. A gene having a function of promoting gluconeogenesis was introduced,
A gene-disrupted strain of yeast having och1 disruption, mnn1 disruption, and mnn4 disruption, the gene having a function of promoting gluconeogenesis,
A yeast gene disruption strain that is one or more genes selected from the group consisting of {CAT8, SFC1, PUT4, MLS1, CIT2, FBP1, STL1, ICL1, ACH1, and ADH2}.   The yeast gene-disrupted strain according to claim 13, wherein a CAT8 gene is introduced as the gene having a function of promoting gluconeogenesis.   The yeast-disrupted strain according to claim 13 or 14, wherein the yeast is a budding yeast.   A plasmid containing the CAT8 gene, which is used to avoid high temperature sensitivity or to reduce drug sensitivity of a sugar chain synthetic gene disrupted yeast strain or a sugar chain synthetic gene mutant yeast strain.   Yeast deposited under the accession number “FERM AP-21445” at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology.   Yeast deposited under the accession number “FERM AP-21757” at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology.

Images