JP2009178073A - Method for detection of abnormal fat accumulation and method for screening antiobesic substance by using d-dopachrome tautomerase, and agent for treatment-prevention of obesity - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for the early detection of abnormal fat accumulation and the adjustment and maintenance of the fat accumulation to an optimum level, thereby solving the grave problem for the contemporary people that obesity caused by the abnormal accumulation of fat, especially excessive accumulation of fat is principal cause of all diseases inducing lifestyle-related diseases such as diabetes, cardiopathy and arteriosclerosis and, nevertheless, there is no established radical therapeutic method and only alimentary therapy and exercise therapy are used as a countermeasure at present. <P>SOLUTION: Provided are a method for the detection of abnormal fat accumulation including the measurement of the expression quantity of D-dopachrome tautomerase (DDT) in a sample derived from a living body, a reagent for the detection of abnormal fat accumulation, a method for screening an antiobesic substance and an agent for the treatment or prevention of obesity containing DDT or a nucleic acid encoding DDT as an active component. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to the use of D-dopachrome totemerase (DDT) and nucleic acids encoding it in connection with abnormal fat accumulation, especially obesity. More specifically, the present invention relates to a method for detecting abnormal fat accumulation including measurement of DDT gene expression level in a biological sample, a reagent for detecting abnormal fat accumulation, a method for screening an anti-obesity substance, and a therapeutic / preventive agent for obesity.

  Obesity is defined as a condition in which adipose tissue has increased abnormally, and its cause is not genetic but largely due to environmental factors. Obesity is a major cause of all diseases that cause other lifestyle-related diseases such as diabetes, heart disease, arteriosclerosis, and is a serious problem for modern people.

  Adipose tissue is mainly composed of fat cells. Adipocytes are proliferated and differentiated from fat-free cells called fat precursor cells into fat cells containing fat droplets under the action of cell growth factors and differentiation inducers. In the context of preadipocytes, adipocytes are sometimes called mature adipocytes.

  In recent years, it has become clear that adipose tissue not only has a function of storing fat, but also synthesizes and secretes various physiologically active substances. These physiologically active substances are called adipocytokine. In particular, adipocytokine production abnormalities occur in adipose tissue of obese individuals, and it is known that systemic sugar / lipid metabolism is seriously affected. For example, genes encoding LIPE (hormone sensitive lipase), FASN (fatty acid synthase) and perilipin are specifically expressed in mature adipocytes derived from obesity. On the other hand, it is known that the expression level of the gene encoding leptin is reduced in mature adipocytes derived from obese (Patent Document 1).

  As described above, there are many genes and proteins that are known to be associated with obesity. There are also many inventions related to pharmaceutical compositions that regulate the expression of such obesity-related factors for the purpose of preventing and treating obesity. For example, a therapeutic / preventive agent for obesity containing gingerols as an active ingredient for increasing the expression of adiponectin whose blood concentration decreases when it becomes obese (Patent Document 1), an activity of suppressing lipoprotein lipase (LPL) And a novel single polypeptide (Patent Document 2), a test method for a factor that regulates the expression of cysteine dioxygenase (COD) associated with obesity, and a screening method (Patent Document 3).

  In addition, according to Non-Patent Document 1, one of the genes whose expression level was observed to decrease in obese mice compared to lean mice was D-dopachrome tautomerase, DDT). DDT is a 12 KDa intracellular protein ubiquitous in various tissues and an enzyme that converts D-dopachrome to 5,6-dihydroxyindole. Macrophage migration inhibitory factor (MIF), which has a tautomerase activity that converts D-dopachrome to 5,6-dihydroxyindole-2-carboxylic acid, and DDT have high homology and structural similarity Has also been pointed out (Non-Patent Document 1).

  There are still many unclear points about the physiological functions of dopachrome tomerase such as DDT and MIF. For example, a method using the DDT activity of MIF for the diagnosis and treatment of male infertility (Patent Document 4) is known. However, there are still many unclear points regarding the relationship between DDT expression and adipocytes, and there is no report on the use of DDT for the purpose of examination, treatment or prevention of obesity.

JP2006-249064 JP-A-6-277065 JP 2006-6231 A WO 03/065979 Sanchez et al., Proteomics (Germany), 2003, Volume 3, p.1500-1520

  Fat accumulation abnormalities, particularly obesity caused by excessive fat accumulation, is a major cause of various diseases that cause other lifestyle-related diseases such as diabetes, heart disease and arteriosclerosis, and is a serious problem for modern people. However, the fundamental treatment method has not been established, and the current situation is using diet therapy and exercise therapy. Therefore, a method for early detection of fat accumulation abnormality and adjusting and maintaining the fat accumulation amount to an appropriate amount has been desired.

  An object of the present invention is to use a D-dopachrome tomerase (DDT) or a nucleic acid encoding the same in order to solve the above-mentioned problems, and a method for detecting a fat accumulation abnormality, for detecting a fat accumulation abnormality The object is to provide a reagent, a method for screening an anti-obesity substance, and a therapeutic / preventive agent for obesity.

  By using DDT, which is a novel adipocytokine, it becomes possible to study from a new viewpoint the mechanism of adipocyte differentiation and the mechanism of lipolysis by mature adipocytes, leading to the establishment of a method for treating obesity. it can.

  As a result of many years of deep insight and trial and error, the present inventors have found that DDT is secreted by small adipocytes at the early stage of differentiation, but is secreted by enlarged mature adipocytes. I discovered that. By using such characteristics, DDT can be used to discriminate between mature fat cells that are good and enlarged mature fat cells that are bad. Moreover, since the amount of DDT secretion decreases in enlarged mature adipocytes, it is considered that a DDT protein, a nucleic acid encoding it, or a substance that enhances the expression of the DDT gene is effective for the treatment or prevention of obesity.

According to the present invention, the following items [1] to [6] are provided as means for solving the above-described problems.
[1] The expression level of the D-dopachrome totomerase gene in the biological sample is measured, and the measured value is compared with the expression level of the D-dopachrome tomatomerase gene of a healthy person as a reference value. A method for detecting abnormal fat accumulation, including determining that excessive fat accumulation has occurred when lower than a reference value.
[2] A reagent for detecting abnormal fat accumulation, including a reagent for detecting D-dopachrome tomatomerase.
[3] A screening method for anti-obesity substances,
(1) treating mature adipocytes with a test substance;
(2) The expression level of the D-dopachrome tomerase gene in the treated mature adipocytes is measured, and (3) the measured value in (2) above is the D- in mature adipocytes not treated with the test substance. A method comprising identifying the test substance as an anti-obesity substance when the expression level of the dopachrome tote merase gene is increased compared to the expression level.
[4] A therapeutic / preventive agent for obesity comprising D-dopachrome tomerase or a nucleic acid encoding the same as an active ingredient.
[5] A therapeutic / preventive agent for obesity containing, as an active ingredient, a substance that enhances the expression of the D-dopachrome totomerase gene in mature adipocytes.
[6] A therapeutic / preventive agent for obesity containing the anti-obesity substance identified by the method of Item 3 as an active ingredient.

Hereinafter, the present invention will be described in detail.

Fat accumulation abnormality detection method and detection reagent
The present invention relates to a new use of DDT and a nucleic acid encoding the same, utilizing the characteristics of D-dopachrome tomerase (DDT) as a novel adipocytokine. As one aspect, a method for detecting abnormal fat accumulation and a reagent for detection, including measurement of the expression level of a D-dopachrome tomerase gene in a biological sample, are provided.

  When the present inventors examined the correlation between DDT and clinical data, the amount of DDT gene expression in mature adipocytes in visceral adipose tissue, waist diameter, body weight, BMI, visceral fat area, fasting blood glucose, serum A negative correlation was found between sex fat (TG) values and serum uric acid levels. In addition, a negative correlation was observed between the DDT gene expression level in mature adipocytes in the subcutaneous fat tissue and the waist diameter, BMI, and serum TG concentration (see Example 1 of the present application). Furthermore, the present inventors have found that DDT is not expressed in preadipocytes and is expressed in mature adipocytes, but the amount of DDT expression decreases as fat droplets enlarge (see Example 6). reference). According to these findings, since the expression level of the DDT gene decreases in a state where the fat cells accumulate excessive fat, the expression level of the DDT gene is an index of abnormal fat accumulation.

  The biological sample used in the detection method of the present invention is a mammal-derived sample and is not particularly limited as long as the expression level of the DDT gene can be measured. Examples include adipose tissue, adipocytes isolated from adipose tissue, serum, and the like. Adipose tissue includes visceral adipose tissue and subcutaneous adipose tissue. According to the study by the present inventors, there is no significant difference in the amount of DDT expression in visceral adipose tissue and subcutaneous adipose tissue (see Example 4 and FIG. 3 of this application). reference). Therefore, when using adipose tissue or adipocytes contained therein as a biological sample, either visceral adipose tissue or subcutaneous adipose tissue may be used.

  What is necessary is just to measure the expression level of the DDT gene in a biological sample in one of two stages, the transcription level to RNA and the translation level to protein. When measuring the expression level of the DDT gene at the level of transcription to RNA, the amount of DTT gene mRNA present in the biological sample may be measured, and the method for measuring the amount of mRNA is not particularly limited. The base sequence of the DDT gene is known (for example, the base sequence of the DDT translation region shown in SEQ ID NO: 1), and a DDT detection probe can be designed based on this base sequence. As a detection probe, a probe that is the full length or a part of the antisense strand of a nucleic acid (DNA, RNA, cDNA) encoding DDT and has a length that can be established as a probe (for example, 15 bases or more) is used. can do. When the biological sample is adipose tissue, the expression level of the DDT gene can be measured by an in situ hybridization method, an in situ PCR method using an anti-DDT antibody described later, or the like.

  When measuring the DDT gene expression level at the level of translation into protein, the abundance of DDT in the biological sample may be measured. The DDT to be measured may be a full-length protein, but may be a partial peptide as long as it has characteristics specific to DDT. The method for measuring the abundance of DDT is not particularly limited, and examples thereof include an immunological detection method using an anti-DDT antibody. The anti-DDT antibody can be prepared by a known method using the full length or fragment of the DDT protein, but a commercially available antibody such as the DDT-GST monoclonal antibody (manufactured by Abnova) used in the examples of the present application is used. May be. Specifically, the abundance of DDT protein in a biological sample can be measured by immunostaining of adipose tissue using an anti-DDT antibody or isolation / purification of DDT from adipose tissue. It is also conceivable to quantify the DDT protein based on the enzyme activity of DDT.

  When using fat cells or serum as a biological sample, the amount of DDT mRNA or DDT abundance can be obtained by a method that can be employed in step (2) of the screening method described later, for example, RT-PCR or Northern blotting. Can be measured as the DDT gene expression level.

  When detecting a fat accumulation abnormality by the detection method of the present invention, the measured value of the DDT gene expression level is compared with the DDT gene expression level of a healthy person as a reference value, and the measured value is lower than the reference value In addition, it is determined that excessive fat accumulation occurs. The expression level of the DDT gene of a healthy person serving as a reference value is a value measured for a sample of the same kind that is collected from a healthy organism (that is, having a normal fat accumulation ability) that is the same species as the organism from which the organism-derived sample is collected. And The “same sample” means the same type of tissue or cell as the biological sample. The measurement method used for measuring the reference value may not be the same as the method used for detecting fat accumulation abnormality, but is preferably the same method in order to reduce variations such as measurement errors. A measured value lower than the reference value is considered to represent excessive fat accumulation, but if the measured value is 40% or less of the reference value, more preferably 20% or less, excessive fat accumulation has occurred, It can be determined that this is likely to occur.

  Excessive fat accumulation in a biological sample means that the organism that provided the biological sample is already obese or is likely to become obese. Therefore, the detection method of the present invention can be used as a method for diagnosing obesity.

Furthermore, the present invention provides a reagent for detecting abnormal fat accumulation including a reagent for DDT detection.
The reagent for DDT detection contained in the reagent for detecting abnormal fat accumulation of the present invention is not particularly limited as long as it is a reagent that can be used for measuring the expression level of the DDT gene in the method for detecting abnormal fat accumulation of the present invention. For example, the nucleic acid probe (DNA or RNA) for detecting DDT mRNA, the antibody for detecting DDT protein, and the substrate for measuring the enzyme activity of DDT described above in relation to the method for measuring the expression level of DDT gene Etc.

By measuring the expression level of the DDT gene in the biological sample using the reagent for detecting abnormal fat accumulation of the present invention, it is possible to detect an organism that is obese or is likely to become obese. Therefore, the detection reagent of the present invention can be used as a diagnostic agent for obesity.

In another aspect of the present invention, the present invention comprises (1) treating mature adipocytes with a test substance, (2) measuring the expression level of the DDT gene in the treated mature adipocytes, and (3) When the measured value of (2) is higher than the expression level of the DDT gene in mature adipocytes not treated with the test substance, the test substance is identified as an anti-obesity substance. The screening method of an anti-obesity substance including this is provided.

  In step (1) of the screening method of the present invention, mature adipocytes are treated with a test substance. The mature adipocytes used for screening are not particularly limited, and may be mature adipocytes collected from a biological sample or mature adipocytes prepared by inducing differentiation of preadipocytes. The mature fat cells may be mature fat cells that are enlarged and have a reduced DDT expression level. When adipose precursor cells or mature adipocytes are collected from a biological sample, they can be collected from visceral fat (mesenteric fat), subcutaneous fat, or the like. In addition, the preadipocytes can be cryopreserved. For example, 3T3-L1 cells, 3T3-F442A cells, and HIB1B cells are commercially available for research and are easily available. Examples of the method for inducing differentiation of adipose precursor cells include a method of culturing adipose precursor cells in a medium to which a differentiation inducer such as insulin, dexamethasone, or isobutylmethylxanthine is added. A commercially available medium prepared in advance for differentiation induction may be used.

  There is no particular limitation on the test substance used in the screening method of the present invention, and not only a low molecular compound but also any substance such as a polynucleotide, protein or peptide can be applied.

  The method for treating mature adipocytes with a test substance is not particularly limited, and for example, mature fat cells may be cultured in the presence of the test substance. There is no particular limitation on the culture method in this case, and a general animal cell culture method can be applied as it is. As the medium, for example, a medium obtained by appropriately adding a component such as calf serum to a basic medium such as Dulbecco's modified Eagle medium (DMEM) or RPMI1640 can be used. Moreover, you may use the culture medium prepared beforehand for commercially available fat cell culture | cultivation.

  The abundance of the test substance (amount added to the cultured adipocytes) and the schedule for addition to the cultured adipocytes can be appropriately selected in consideration of the solubility, physical properties, characteristics, etc. of the test substance. It is preferable to select from a range that does not inhibit cell growth. For example, what is necessary is just to add so that the final concentration of a to-be-tested substance may exist in the range of 0.001-500 micromol. Specifically, the test substance can be dissolved in a culture solution, added to the cell culture supernatant so that the final concentration is within the above range, and the cells can be further cultured for 1 to 3 days. When the test substance is a water-insoluble substance such as fatty acid, it can be added to the cultured cells after being suspended in an appropriate solution by ultrasonic treatment.

  In step (2), the expression level of the DDT gene in the treated mature adipocytes is measured. The expression level of the DDT gene can be measured in two stages: the transcription level to RNA and the translation level to protein. When measuring the expression level of DTT at the level of transcription to RNA, the amount of mRNA of the DTT gene is measured. The measurement sample at this time can be prepared by extracting total RNA from mature adipocytes. When extracting total RNA from mature adipocytes, a known method can be used, for example, extraction can be performed by the guanidine thiocyanate / cesium chloride method. In addition, total RNA can be easily extracted by using a commercially available RNA extraction kit. The method for measuring the amount of mRNA of the DTT gene is not particularly limited as long as it can specifically quantify the mRNA of the DTT gene. For example, RT-PCR, quantitative PCR, DNA microarray, Northern blot, etc. are used. be able to. In particular, RT-PCR is very suitable because it can easily and rapidly measure the amount of mRNA of the DTT gene. Primers for performing RT-PCR can be designed based on the base sequence of a known DTT gene (for example, the base sequence of SEQ ID NO: 1 of the present application). An example of such a primer is the primer (SEQ ID NO: 2 and 3) used in Example 4 of the present application.

  On the other hand, when the expression level of the DTT gene is measured by protein quantification, either the amount of DTT in the mature adipocyte or the amount of DTT secreted by the mature fat cell can be measured. When measuring the amount of intracellular DTT, an extract of mature adipocytes can be used as a measurement sample. For example, after collecting mature adipocytes by a method such as centrifugation, the cells can be disrupted by hypotonic treatment or mechanical treatment to obtain a cell extract. The obtained cell extract may be subjected to pretreatment such as rough purification as necessary. When measuring the amount of DTT secreted by mature adipocytes, for example, a culture supernatant or a concentrate thereof may be used as a measurement sample. As a method for measuring the amount of DTT, any method capable of specifically measuring DTT may be used. For example, immunoassay using a commercially available DTT-specific antibody or Western blotting can be used. Examples of the immunoassay include enzyme immunoassay (ELISA), radioimmunoassay (RIA), and fluorescent immunoassay (FIA).

  Subsequently, in step (3), the measurement value of (2) is compared with the expression level of the DDT gene in mature adipocytes not treated with the test substance. The expression level of the DDT gene in mature adipocytes not treated with the test substance is measured by the same method as the measurement value of (2) above (that is, the expression level of DDT gene in mature fat cells treated with the test substance). To do. In order to reduce the influence on measurement values such as measurement errors and to make a more accurate comparison, the measurement values should be corrected with internal standards, both with and without test substances. It is desirable to compare.

As described above, DDT expression is not found in preadipocytes, but is increased in small adipocytes at the early stage of differentiation and decreased in enlarged mature adipocytes. DDT expression is closely related to hypertrophy of mature adipocytes, and an increase in DDT expression is thought to lead to prevention or reduction of hypertrophy (ie, fat accumulation) of mature adipocytes. Therefore, in the present invention, a test substance that increases the expression level of the DDT gene in mature adipocytes is identified as an anti-obesity substance. The anti-obesity substance identified by the screening method of the present invention is useful as an active ingredient of an obesity treatment / prevention agent described later. Anti-obesity substances that affect the expression of the DDT gene are considered useful for studying the mechanism of adipocyte differentiation and the mechanism of lipolysis by mature adipocytes from a new perspective.

In another aspect, the present invention relates to the treatment / prevention of obesity comprising, as an active ingredient, DDT or a nucleic acid encoding the same, or a substance that enhances the expression of the DDT gene in mature adipocytes. Provide the agent. As described above, DDT expression is not present in preadipocytes, but is increased in small adipocytes at the early stage of differentiation and decreased in enlarged mature adipocytes. Since there is a negative correlation between the abundance of DDT and hypertrophy of mature adipocytes, DDT, a nucleic acid encoding it, or a substance that increases the expression level of the DDT gene is administered to the patient, and the enlarged maturation By increasing the amount of DDT present in fat cells, fat cell hypertrophy can be reduced or prevented, and as a result, obesity can be treated and prevented.

  The DDT used as an active ingredient of the therapeutic / prophylactic agent of the present invention is not particularly limited as long as it has a function as an adipocytokine. Therefore, not only the full-length DDT protein but also a partial peptide thereof can be used.

  A substance that enhances the expression of the DDT gene can also be used as an active ingredient of the therapeutic / prophylactic agent of the present invention. The substance that enhances the expression of the DDT gene is preferably an anti-obesity substance identified by the screening method of the present invention.

  The therapeutic / prophylactic agent of the present invention can be administered orally or parenterally to mammals such as humans. When administered orally, there are no particular limitations on the dosage form of the therapeutic / prophylactic agent of the present invention, and it can be used in conventional forms such as tablets, capsules, syrups and suspensions. When administered parenterally, the therapeutic / prophylactic agent of the present invention can be used in the form of a usual solution such as a solution, emulsion, suspension or the like. Examples of the method for parenteral administration of the therapeutic / prophylactic agent of the above-described form include an injection method, a suppository method for rectal administration, and the like.

  The therapeutic / prophylactic agent of the present invention may contain pharmaceutically acceptable carriers, excipients, binders, stabilizers, diluents and the like in addition to the active ingredients, and when used in an injection form May be added with acceptable buffering agents, solubilizing agents, isotonic agents and the like.

  The nucleic acid encoding DDT used as the active ingredient of the therapeutic / prophylactic agent of the present invention is not particularly limited as long as it is a nucleic acid encoding DDT having a function as an adipocytokine, and may be DNA or RNA. In addition to full-length nucleotide sequences, cDNA and partial sequences can also be used. Based on known gene therapy techniques, drugs containing such nucleic acids can be prepared. By introducing such a drug into a cell or living body and increasing the expression level of DDT, it is conceivable to reduce or prevent hypertrophy of mature adipocytes and to prevent or treat obesity.

  The dose of the therapeutic / prophylactic agent of the present invention should be appropriately selected based on the age, sex, weight, disease level, current DDT level, type of active ingredient, dosage form, etc. of the mammal to be administered. Can do. The daily dose can be administered once or divided into several times.

The therapeutic / prophylactic agent of the present invention includes other suitable anti-obesity agents such as appetite suppressant, intestinal absorption inhibitor, digestive enzyme inhibitor, metabolically enhanced hormone agent, fat synthesis inhibitor, insulin secretion inhibitor and the like. You may use together. Furthermore, it can be used in combination with diet therapy and exercise therapy. In this case, the activity or effect of treatment with other anti-obesity drugs alone as well as the effect of treatment with other anti-obesity therapies alone may be enhanced.

  Hereinafter, the present invention will be specifically described with reference to examples. However, the present invention is not limited to the following examples.

Correlation between D-dopachrome tomelase and clinical data In order to examine the correlation between D-dopachrome tomatomerase (DDT) and clinical data related to obesity, visceral adipose tissue and subcutaneous adipose tissue were analyzed from the same patient. Collected (20 patients). A portion of the collected adipose tissue was fractionated into mature adipocytes and stromal-vascular fraction (SVF) cells, and total RNA was extracted from each of the entire adipose tissue, mature adipocytes, and SVF cells. Adipose tissue fractionation and total RNA extraction were performed in the same manner as in Example 4 described later.

  CDNA was synthesized from the extracted total RNA, and the amount of DDT mRNA was measured by real-time RT-PCR. Correlation analysis of the obtained DDT mRNA amount with clinical parameters including waist diameter, body weight, BMI, visceral fat area, fasting blood glucose, serum triglyceride (triglyceride, TG) value, serum uric acid value, This was done by calculating the number of relationships with SPSS 14.0J for windows (SPSS). The fat area was measured using Fat Scan V3.0 (N2 System).

As a result, a negative correlation was observed between the DDT gene expression level in mature adipocytes in visceral adipose tissue and waist diameter, body weight, BMI, visceral fat area, fasting blood glucose, serum TG value and serum uric acid level. A negative correlation was observed between the DDT gene expression level in mature adipocytes in subcutaneous adipose tissue and the waist diameter, BMI, and serum TG value.

Expression of DDT with FLAG tag added to C-terminus To confirm whether DDT is a secreted protein, DDT with FLAG tag added to C-terminus (DDT-CFLAG) was expressed in 293FT cells It was verified whether a FLAG antibody positive signal was observed in Kiyoshi.

  SGBS cells, which are human adipose precursor cells, were differentiated into adipocytes in the same manner as in Example 5 described later, cDNA was prepared therefrom, and human DDT translation region cDNA (SEQ ID NO: 1) was amplified by PCR. Next, an expression plasmid pcDNA3.1 + (manufactured by Invitrogen) having a DNA encoding a FLAG tag inserted between BamHI and EcoRI is prepared, and a translation region cDNA of human DDT is inserted between HindIII and BamHI of the plasmid. Thus, human DDT was subcloned (DDT-CFLAG expression vector). In addition, as a control experiment, an empty vector, a vector incorporating a gene for the secreted protein YKL-40 (positive control), and a vector incorporating a non-secreting parafibromin (PFC) gene (negative control) are also available. did.

  In 6-well dishes, 293FT cells were cultured to 80% confluence using DMEM containing 10% FBS as the medium. Two wells of cells were prepared for each vector. Using 0.5 μg of expression vector per well, the expression vector was introduced into the cells according to the protocol of Effectene Transfection Reagent (manufactured by QIAGEN).

  24 hours after the introduction of the expression vector, 1 well of cells was dissolved in a cell lysis buffer (50 mM Tris-Cl (pH 8.0), 150 mM NaCl, 0.1% Nonidet P-40) to recover the cell lysate. This was used as an expression confirmation sample. For the remaining 1 well, the well was washed 3 times with PBS 24 hours after the introduction of the expression vector. Next, 2 ml of DMEM not containing FBS was added and the cells were further cultured for 24 hours, and the culture supernatant was recovered in the same manner as described above. 20 μl of the collected culture supernatant was stored as a culture supernatant sample for Western blotting.

  The rest of the collected culture supernatant was centrifuged at 2,000 rpm, and the resulting supernatant was filtered with a 0.45 μm filter. Next, 4 times the amount of cold acetone (8 ml) was added, and the mixture was allowed to stand at −80 ° C. for 1 hour and then centrifuged at 10,000 rpm. The supernatant was discarded, and the remaining precipitate was suspended in 50 μl of PBS (PBS-T) containing 0.1% Triton-X to obtain a concentrated culture supernatant.

  Cell lysates, culture supernatants prepared from DDT-CFLAG expression vector-introduced cells and control experiments (cells introduced with empty vector, cells introduced with YKL-40 expression vector and cells introduced with PFC expression vector), Western blotting was performed on the concentrated culture supernatant. Specifically, after adding 1/4 amount of 5 × SDS buffer to each sample and boiling, each sample was developed by SDS-PAGE using 15% acrylamide gel. The developed protein band was transferred to Immobilon-P (Millipore) PVDF membrane, diluted 2,000-fold with mouse anti-FLAG monoclonal antibody (SIGMA), and diluted 80,000-fold with HRP-labeled anti-mouse IgG. The PVDF membrane was incubated with (GE Healthcare), and the band bound to the antibody was detected using Immobilon Western Chemiluminescent HRP Substrate (Millipore). The results are shown in FIG.

As is clear from FIG. 1, a positive signal of the secretory protein YKL40 as a control was observed in the culture supernatant stock solution and the concentrated culture supernatant (lanes 7 and 11) of 293FT cells, but the DDT signal was the culture supernatant stock solution. It was not observed in (lane 6). However, a DDT signal was observed from the concentrated culture supernatant (lane 10). This revealed that DDT was secreted into the culture supernatant in a small amount.

Detection of DDT using anti-human DDT antibody Visceral adipose tissue and subcutaneous adipose tissue collected from the same patient were each treated with collagenase, and mature adipocytes were isolated. The isolated mature adipocytes were subjected to collagen gel embedding culture using 10% NCS-Ham's F12 medium according to the protocol of Cellmatrix collagen gel culture kit (Nitta Gelatin).

  For the cultured visceral fat-derived mature adipocytes and subcutaneous fat-derived mature adipocytes, a sample for confirming expression, a culture supernatant and a concentrated culture supernatant were prepared in the same manner as in Example 2. Next, Western blotting was performed in the same manner as in Example 2 except that an anti-human DDT antibody diluted by 1000 times (DDT-GST monoclonal antibody, manufactured by Abnova) was used instead of the mouse anti-FLAG monoclonal antibody. In addition, in order to confirm that the anti-human DDT antibody recognizes DDT, the cell lysate and culture supernatant of the DDT-CFLAG expression vector-introduced cell prepared in Example 2 were also used as samples and further diluted 1000 times. Western blotting using the mouse anti-FLAG monoclonal antibody was also performed. The results are shown in FIG.

As is clear from FIG. 2, it is possible to detect a DDT positive signal from a culture supernatant of a collagen gel-embedded culture of mature adipocytes isolated from visceral adipose tissue and mature adipocytes isolated from subcutaneous adipose tissue. could not. This result indicates that the secreted concentration of DDT is very low.

Identification of DDT expressing cells in adipose tissue (1)
Visceral adipose tissue and subcutaneous adipose tissue were collected from the same patient (the number of patients was 20). Finely cut 1 to 2 g of adipose tissue with scissors and add to MEM medium containing 0.2% collagenase (Collagenase S-1; Nitta Gelatin) and 0.2% BSA, and slowly at 37 ° C. for 20 minutes. Stir to obtain a cell suspension. The obtained cell suspension was filtered through a mesh filter (10 ⁴ × 121 μm; manufactured by Kyodo Riko Co., Ltd.) and centrifuged at 900 rpm for 2 minutes. The uppermost layer of the centrifuged sample was collected as a mature adipocyte fraction, and the precipitate was collected as an SVF cell fraction. Each fraction was washed twice with 10% NCS-Ham's F12 medium, and then total RNA was extracted. Total RNA extraction from mature adipocytes was performed with RNeasy Lipid Tissue Kit (QIAGEN), and total RNA extraction from SVF cells was performed using Trizol (Invitrogen).

CDNA synthesis was performed from 0.5 μg of total RNA in a 20 μl system using Primescript RT reagent Kit (TaKaRa). The synthesized cDNA was diluted with 20 μl of TE buffer, and 1 μl of the diluted cDNA was subjected to real-time RT-PCR using Power SYBR Green PCR Master Mix (manufactured by Applied Biosystems), and the amount of DDT mRNA was measured. RT-PCR was performed by denaturing at 95 ° C. for 10 minutes, followed by 45 cycles of 95 ° C. for 15 seconds and 60 ° C. for 1 minute. Three types of GAPDH, TBP, and HPRT1 were used as internal standards, and the amount of DDT mRNA was corrected. The primers used for measuring the amount of mRNA of DDT, GAPDH, TBP and HPRT1 have the following sequences.
DDT :
Forward: TCCATCCTGGGCAAACCTG (SEQ ID NO: 2)
Reverse: GGGCTAGCTCCTTGGTGAGAAAC (SEQ ID NO: 3)
GAPDH :
Forward: GAAGGTGAAGGTCGGAGTC (SEQ ID NO: 4)
Reverse: GAAGATGGTGATGGGATTTC (SEQ ID NO: 5)
TBP :
Forward: TGCTGCGGTAATCATGAGGATA (SEQ ID NO: 6)
Reverse: TGAAGTCCAAGAACTTAGCTGGAA (SEQ ID NO: 7)
HPRT1 :
Forward: GGCAGTATAATCCAAAGATGGTCAA (SEQ ID NO: 8)
Reverse: GTCAAGGGCATATCCTACAACAAAC (SEQ ID NO: 9)

The results are shown in FIG. (Note that the number of samples used was 20, but three of them were not included in the results of FIG. 3 because the measured value of the internal standard substance was small.)
As is clear from FIG. 3, it was confirmed that the expression of DDT mRNA was higher in the mature adipocyte fraction than in the SVF fraction. Regarding the DDT mRNA expression level of the mature adipocyte fraction, no significant difference was observed between visceral fat and subcutaneous fat.

Identification of DDT expressing cells in adipose tissue (2)
SGBS cells, a human adipose precursor cell line, were cultured and induced into mature adipocytes. Specifically, differentiation medium (DMEM / HAM = 1: 1, 0.01 mg / ml transferrin, 20 nM insulin, 10 μM cortisol, 200 pM thyroid hormone (T3), 25 nM) was cultured in a 6-well dish to 100% confluence. Dexamethasone, 500 μM IBMX, 2 μM troglitazone) was added and cultured for 4 days, and then the medium was replaced with maintenance medium (DMEM / HAM = 1: 1, 0.01 mg / ml transferrin, 20 nM insulin, 10 μM cortisol, 200 pM T3). And further cultured. The maintenance medium was changed every 3 days.

  Cells on the 9th day from the start of differentiation induction were washed 3 times with PBS and fixed with 10% formalin for 10 minutes. Fixed cells were washed 3 times with PBS and incubated with 0.2% Triton-X for 10 minutes. After washing the cells 3 times with PBS, mouse DDT monoclonal antibody (Abnova) diluted 250 times or mouse Pref-1 antibody (R & D Systems) diluted 250 times was added thereto and allowed to react for 2 hours. It was. Mouse Pref-1 antibody was used to detect preadipocytes. After washing with PBS three times, Alexa488-labeled goat anti-mouse IgG (Molecular Probe) was added and reacted at 37 ° C. for 30 minutes. The cells were washed 6 times with PBS and then observed under an inverted microscope (TE2000U, Nikon). DAPI staining for staining cell nuclei was also performed. Fluorescent images were taken using a DIGITAL SIGHT DS-L1 (Nikon) under an exposure time of 1 second. The results are shown in FIG.

As is clear from FIG. 4, cells with lipid droplets developed DDT-Alexa488 positive, but no positive signal was observed from preadipocytes. From these results, it was confirmed that DDT is expressed in mature adipocytes.

Changes in DDT expression in induction of differentiation of preadipocytes SGBS cells, which are human adipose precursor cell lines, were cultured in the same manner as in Example 5 and induced into mature adipocytes. Cells were sampled on the 0th, 3rd, 6th, 9th and 12th days from the start of induction, and their total RNA was extracted. Total RNA was extracted using ISOGEN (Nippon Gene) as an RNA extraction reagent.

  For the extracted total RNA, the amount of DDT mRNA was measured by real-time RT-PCR in the same manner as in Example 4. At that time, GAPDH was used as an internal standard. The results are shown in FIG. Moreover, the observation photograph in the visible light of the SGBS cell of the 6th day, the 9th day, and the 12th day from the start of induction | guidance | derivation is shown to (B) of FIG.

It is clear from FIG. 5B that fat cells are enlarged in fat cells as the number of days after differentiation induction elapses. Further, from the results of FIG. 5A, the DDT gene expression increased from the 3rd day of the induction start, reached the peak on the 6th day, and thereafter, as the fat droplets of the adipocytes increased, the DTT gene There is a tendency for the expression of to decrease.

Preparation of recombinant human DDT cDNA of SGBS cells differentiated into adipocytes was prepared, and the translation region cDNA (SEQ ID NO: 1) of human DDT was amplified therefrom by PCR. Next, human DDT translation region cDNA was inserted between BamHI-NotI of expression vector pGEX6p-3 (GE Healthcare) to construct a DDT-GST fusion protein expression vector.

  Escherichia coli strain BL21 (TaKaRa) was transformed with the DDT-GST fusion protein expression vector. The transformed cells were cultured with 500 ml of LB medium containing ampicillin at a final concentration of 50 μg / ml until the OD 600 nm reached 0.5. Subsequently, IPTG was added to a final concentration of 0.5 mM, and the mixture was cultured with shaking at 16 ° C. overnight. The culture solution was centrifuged at 6,000 rpm for 10 minutes to collect the precipitate (bacteria) and suspended in 10 ml of sonication buffer (50 mM Tris-Cl (pH 8.0), 50 mM NaCl, 1 mM EDTA, 1 mM DTT). The bacterial cell suspension was subjected to ultrasonic treatment to disrupt E. coli. Triton-X was added thereto so that the final concentration was 1%, followed by centrifugation. The obtained supernatant was recovered as a solubilized fraction, and the precipitate was suspended in 10 ml of PBS-T to obtain an insoluble fraction. When SDS-PAGE of the solubilized fraction and the insoluble fraction was performed, a band was confirmed from the soluble fraction to a size (37 kDa) estimated to be a DDT-GST fusion protein.

  Glutathione Sepharose 4B (manufactured by GE Healthcare) was packed in a column at 4 ° C. and equilibrated with PBS-T in an amount 5 times the column volume. The soluble fraction was added thereto, and the column was washed with PBS-T in an amount 5 times the column volume. 160 U PreScission protease (GE Healthcare) was added to the column and incubated at 4 ° C. for 16 hours to separate GST and DDT in the column. DDT was eluted with 4 ml of sonication buffer, and this eluted fraction was added to a fresh Glutathione Sepharose 4B packed column, and the flow-through fraction was collected as a DDT fraction. Purification of DDT was confirmed by SDS-PAGE and CBB staining, Western blotting with anti-DDT antibody, and mass spectrometry.

  Finally, DTT was desalted with 5 ml of Zeba Desalt Spin Column (Pierce), and the buffer was replaced with PBS. When protein was quantified by the Bradford method, 4 ml of a 2.5 mg / ml (200 μM) DDT solution was obtained. This solution was used as a purified DDT fraction.

  Purified DDT fraction, concentrated culture supernatant of SGBS cells on day 3, day 6, day 9 and day 12 from the start of differentiation induction, cell lysate on day 9 from the start of differentiation induction, and Example 2 The cell lysate of DDT-CFLAG expression vector-introduced cells prepared in the same manner was subjected to Western blotting using a DDT antibody. The results are shown in FIG.

As is clear from FIG. 6, a strong signal was obtained with the DDT antibody from the purified DDT fraction (lane 6). This result indicates that DDT was successfully purified.

Effect of DDT on gene expression in mature adipocytes Using a 6-well dish, SGBS cells, a human adipose precursor cell line, were induced to differentiate into mature adipocytes as in Example 5. After 9 days from the start of differentiation induction, the cells were washed 3 times with PBS, and then any of the following components were added to the cultured cells: 2 ml DMEM (DMEM), 100 ng / ml GH (GH), 2.5 μg / ml Recombinant DDT (DDT), purified YKL-40 diluted to 1000 times (possibly traced) (YKL), 50% macrophage culture supernatant (Mphage CM), 50% DDT-CFLAG expression 293FT culture supernatant (DDT- FT CM) and 50% vector expression 293FT culture supernatant (V FT CM). The above concentration is the final concentration, and DMEM was also added so that the volume of the additive was 2 ml.

  After addition of the components, the cells were further cultured for 24 hours, and total RNA was extracted from each cell using ISOGEN (Nippon Gene). Next, the following gene expression levels were measured by mRNA quantification: aP2, PPARγ, adiponectin, leptin, AEBP-1, LIPE (hormone sensitive lipase), INSR (insulin receptor), PLIN (perilipin), GLUT4, DGAT2 (Diacylglycerol O-acyltransferase homolog 2), FASN (fatty acid synthase), GPAM (glycerol 3-phosphate acyltransferase), MCP-1 and IL-6. Specifically, cDNA synthesis was performed from 0.5 μg of total RNA using a Primescript RT reagent Kit (TaKaRa) in a 20 μl system. The synthesized cDNA was diluted with 20 μl of TE buffer, and 1 μl of the diluted cDNA was subjected to real-time RT-PCR using Power SYBR Green PCR Master Mix (manufactured by Applied Biosystems), and the amount of mRNA of each gene was measured. RT-PCR was performed by denaturing at 95 ° C. for 10 minutes, followed by 45 cycles of 95 ° C. for 15 seconds and 60 ° C. for 1 minute. The amount of mRNA was corrected using GAPDH as an internal standard. The results are shown in FIGS. 7A to 7C.

As is apparent from FIGS. 7A to 7C, even when mature adipocytes are treated with DDT, aP2 gene, PPARγ gene, adiponectin gene, leptin gene, and AEBP-1 which is a preadipocyte marker There was no change in the gene (FIG. 7A). As for the gene group related to lipid metabolism, the expression level of the LIPE gene increased by about 2 times by the treatment with recombinant DDT (FIG. 7B). In addition, there was no change in the expression of the INSR gene, the PLIN gene, the GLUT4 gene, the DGAT2 gene, the FASN gene, and the GPAM gene (FIG. 7B). Furthermore, there was no effect on gene expression of MCP-1 and IL-6, which are inflammatory cytokines (FIG. 7C).

  By using D-dopachrome tomelase (DDT), a novel adipocytokine, it is possible to study from a new perspective on the adipocyte differentiation mechanism, fat accumulation by mature adipocytes, and lipolysis mechanism. It can also lead to the establishment of treatment methods.

A 293FT cell (DDT-CFLAG) into which a vector expressing DDT with a FLAG tag added at the C-terminal was introduced, and a control experiment cell (a cell into which an empty vector was introduced (Vector), a cell into which a YKL-40 expression vector was introduced) Western blotting using a FLAG antibody for cell lysates, culture supernatants and concentrated culture supernatants prepared from (YKL40CHA) and cells introduced with PFC expression vectors (PFCFLAG)]. Lanes 1 to 4: cell lysate, lanes 5 to 8: culture supernatant (CM), lanes 9 to 12: concentrated culture supernatant (CM conc.), Samples in a group consisting of 4 lanes The order is Vector, DDT-CFLAG, YKL40CHA, and PFCFLAG. (A) Western blotting using an anti-human DDT antibody, and (B) for culture supernatant and concentrated culture supernatant prepared from mature adipocytes derived from visceral adipose tissue and mature adipocytes derived from subcutaneous adipose tissue, and (B) ) Western blotting performed with anti-FLAG antibody. Lane 1: cell lysate of 293FT cells introduced with an empty vector, lane 2: cell lysate of 293FT cells introduced with a DDT-CFLAG expression vector, lane 3: culture supernatant of mature adipocytes derived from visceral adipose tissue, Lane 4: culture supernatant of mature adipocytes derived from subcutaneous adipose tissue, lane 5: concentrated culture supernatant of mature adipocytes derived from visceral adipose tissue, lane 6: concentrated culture supernatant of mature adipocytes derived from subcutaneous adipose tissue. Comparison of DDT gene expression level in mature adipocyte fraction and SVF cell fraction prepared from visceral adipose tissue and subcutaneous adipose tissue, respectively. The expression level of the DDT gene was measured as the amount of mRNA, and was corrected using the amount of mRNA in the internal standard. (A) to (C) are results using different internal standards, (A) is GAPDH, (B) is TBP, and (C) is HPRT1. Alexa488 fluorescent immunostaining of mature adipocytes induced to differentiate SGBS cells. (A) Results using mouse DDT monoclonal antibody, and (B) Results using mouse Pref-1 antibody. Variation in DDT expression in inducing differentiation of SGBS cells into mature adipocytes. (A) Changes in the expression level of DDT gene in cells on days 0, 3, 6, 9, and 12 from the start of differentiation induction. (B) Photo of observation of SGBS cells with visible light on the 6th, 9th and 12th days from the start of differentiation induction. Western blotting of purified recombinant DDT with anti-human DDT antibody. Lanes 1-4: Concentrated culture supernatant of SGBS cells on days 3, 6, 9, and 12 from the start of differentiation induction, Lane 5: Cell lysate of SGBS cells on day 9 from the start of differentiation induction Lane 6: purified recombinant DDT, lane 7: cell lysate of 293FT cells introduced with the DDT-CFLAG expression vector. Effect of DDT on gene expression of mature adipocytes. DMEM only (DMEM), GH (GH), recombinant DDT (DDT), purified YKL-40 (YKL), macrophage culture supernatant (Mphage CM), culture supernatant of DDT-CFLAG expression 293FT cells (DDT-FT CM) Alternatively, mature adipocytes are cultured in the presence of a culture supernatant (V FT CM) of vector-expressing 293FT cells, and the expression levels of the aP2 gene, AEBP-1 gene, leptin gene, adiponectin gene and PPARγ gene are measured as the amount of mRNA. The values corrected using the amount of GAPDH mRNA measured as an internal standard are shown. Effect of DDT on gene expression of mature adipocytes. DMEM only (DMEM), GH (GH), recombinant DDT (DDT), purified YKL-40 (YKL), macrophage culture supernatant (Mphage CM), culture supernatant of DDT-CFLAG expression 293FT cells (DDT-FT CM) Alternatively, mature adipocytes are cultured in the presence of the culture supernatant (V FT CM) of vector-expressing 293FT cells, and the expression levels of INSR gene, PLIN gene, GLUT4 gene, DGAT2 gene, FASN gene, GPAM gene and LIPE gene are expressed in mRNA. The value corrected by using the amount of GAPDH mRNA measured as an internal standard was shown. Effect of DDT on gene expression of mature adipocytes. DMEM only (DMEM), GH (GH), recombinant DDT (DDT), purified YKL-40 (YKL), macrophage culture supernatant (Mphage CM), culture supernatant of DDT-CFLAG expression 293FT cells (DDT-FT CM) Alternatively, mature adipocytes are cultured in the presence of the culture supernatant (V FT CM) of vector-expressing 293FT cells, the expression levels of MCP-1 gene and IL-6 gene are measured as mRNA levels, and GAPDH measured as an internal standard The value corrected using the amount of mRNA is shown.

SEQ ID NO: 2: Forward primer for detecting DDT mRNA SEQ ID NO: 3: Reverse primer for detecting DDT mRNA SEQ ID NO: 4: Forward primer for detecting GAPDH mRNA SEQ ID NO: 5: Reverse primer for detecting GAPDH mRNA SEQ ID NO: 6: TBP mRNA Forward primer for detection SEQ ID NO: 7: Reverse primer for detecting TBP mRNA SEQ ID NO: 8: Forward primer for detecting HPRT1 mRNA SEQ ID NO: 9: Reverse primer for detecting HPRT1 mRNA

Claims (6)

Measure the expression level of the D-dopachrome totomerase gene in the biological sample, and compare the measured value with the expression level of the D-dopachrome tomatomerase gene of the healthy person as the reference value. A method for detecting abnormal fat accumulation, including determining that excessive fat accumulation has occurred.   A reagent for detecting abnormal fat accumulation, which includes a reagent for detecting D-dopachrome tomerase. An anti-obesity substance screening method,
(1) treating mature adipocytes with a test substance;
(2) The expression level of D-dopachrome tomerase gene in the treated mature adipocytes is measured, and (3) the measured value in (2) above is the D- in mature adipocytes not treated with the test substance. A method comprising identifying the test substance as an anti-obesity substance when the expression level of the dopachrome tote merase gene is increased compared to the expression level.   A therapeutic / preventive agent for obesity, comprising D-dopachrome tomerase or a nucleic acid encoding the same as an active ingredient.   A therapeutic / preventive agent for obesity comprising, as an active ingredient, a substance that enhances the expression of a D-dopachrome tomerase gene in mature adipocytes.   A therapeutic / preventive agent for obesity comprising an anti-obesity substance identified by the method of claim 3 as an active ingredient.