JP2009148246A - Method for concentrating microorganism - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for concentrating the objective microorganism from a specimen containing a plurality of components, and to provide a method for carrying out identification of the concentrated microorganism in a short time period. <P>SOLUTION: The method for concentrating the microorganism comprises a step of bringing a carrier in which a sugar chain for selectively binding to the microorganism is immobilized into contact with the microorganism in the specimen, and thereby binding the sugar chain to the microorganism, and a step of concentrating the carrier. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention is a method for concentrating microorganisms, and in particular, the microorganism is a microorganism selected from the group consisting of viruses, bacteria, etc., utilizing the interaction between the microorganism and nanoparticles having a sugar chain immobilized thereon, The present invention relates to a method for concentrating a target microorganism from a specimen containing many components, and a method for identifying the concentrated microorganism in a short time.

  Infectious diseases are diseases that occur in animals and plants by infecting higher animals and plants with microorganisms such as viruses and bacteria. In many cases, this infectious disease is transmitted to the same animal and plant species. For example, in the case of humans, health hazards are caused by the epidemic caused by influenza viruses, and in the case of livestock, crops, ornamental animals and plants, microorganisms that infect each animal and plant can also be transmitted and cause production damage.

  Therefore, identifying microorganisms that infect animals and plants is necessary information for early diagnosis of infectious diseases and for determining treatment and prevention guidelines. In order to identify these microorganisms, immunological techniques, genetic engineering techniques, and the like are conventionally used as identification methods for detecting their own proteins and nucleic acids.

  In addition, it is known that when a virus is infected, the infection starts with the interaction with a sugar chain on the cell membrane of a human cell. Since the interacting sugar chains differ depending on the virus, a specific virus infects human bodies and cells via a specific sugar chain. As a result, there are differences in the symptoms that affect the human body.

For example, as disclosed in Non-Patent Document 1 and Non-Patent Document 2, in herpes virus type 1 and type 2, each isolated virus may interact with sulfated sugars such as heparin and chondroitin sulfate. Are known. In addition, as disclosed in Non-Patent Document 3, it is known that in the lentivirus, the isolated virus interacts with a sulfated sugar such as heparin.
J. et al. Virol. , 1996, 70, 3461-3469 J. et al. Virol. , 2000, 74, 9106-9114 Biotechnol. Bioeng. , 2007, 98, 789-799.

  Microorganisms sample specimens from various substances such as living organisms, pharmaceuticals, foods, drinking water, and river water. However, since the microorganisms in the specimen are extremely small, they may not be detected in the first place. For this reason, it is conceivable to settle the microorganisms by centrifugation, or to concentrate the microorganisms by filter filtration, but these methods also collect contaminants at the same time, thus hindering detection by immunological and genetic engineering techniques. There was a problem to do.

  The present invention has been made in view of the above problems, and its purpose is to perform a method for concentrating a target microorganism from a specimen containing many components, and to identify the concentrated microorganism in a short time. It is to provide a method.

  As a result of intensive studies in view of the above problems, the inventors of the present invention have found that the method for concentrating microorganisms according to the present invention includes a sample containing microorganisms such as viruses and bacteria on a carrier on which sugar chains that specifically interact with microorganisms are immobilized. It is found that the microorganisms can be captured by bringing them into contact with each other, and the microorganisms can be concentrated. Further, by using the concentrated microorganisms, the microorganisms can be detected with high sensitivity by immunological techniques and genetic engineering techniques. As a result, the present invention has been completed.

  The method for concentrating microorganisms according to the present invention comprises a step of bringing the sugar chain and the microorganism into contact with each other by contacting a carrier on which a sugar chain to which the microorganism selectively binds is fixed with the microorganism in the specimen, And a step of concentrating the carrier.

  In the method for concentrating microorganisms according to the present invention, the step of concentrating the carrier includes a step of collecting the carrier by the action of natural sedimentation, centrifugation, filtration, magnetic force or affinity, and purifying the microorganism by washing the collected carrier. It is preferable to include the process to do.

  In the microorganism concentration method according to the present invention, the carrier is preferably nanoparticles.

  In the method for concentrating microorganisms according to the present invention, the microorganism is a microorganism that causes viral infection, bacterial infection, rickettsia infection, chlamydia infection, fungal infection, protozoal infection, or parasitic infection. Is preferred.

  In the method for concentrating microorganisms according to the present invention, the microorganism is preferably a herpes virus, varicella virus, cytomegalovirus, koi herpes virus, lentivirus, or a viral vector used for gene therapy.

  A viral vector is a general name for a virus in which a gene expressing a toxicity is removed from a viral gene and a gene necessary for gene therapy is incorporated. Since the infectivity of the virus itself is maintained, the integrated gene can be introduced into the host by infecting the host cell with the virus. For example, a lentivirus or adenovirus-derived virus vector can be mentioned as an example. The concentration can be carried out in the same manner as general viruses.

  The microorganism identification method according to the present invention is characterized by identifying a microorganism by subjecting the carrier concentrated by the microorganism concentration method according to the present invention to an immunological technique or a genetic engineering technique.

  In the method for concentrating microorganisms according to the present invention, since microorganisms are efficiently concentrated, it is possible to identify even when the amount of microorganisms in a specimen is extremely small and cannot be detected by a normal detection method.

  Hereinafter, the present invention will be specifically described.

  The method for concentrating microorganisms according to the present invention comprises a step of bringing the sugar chain and the microorganism into contact with each other by contacting a carrier on which a sugar chain to which the microorganism selectively binds is fixed with the microorganism in the specimen, And a step of concentrating the carrier.

  Examples of the microorganism include viruses and bacteria. Although it does not specifically limit as said virus, Specifically, herpes virus, influenza virus, AIDS virus, hepatitis B virus, hepatitis C virus, chicken pox virus (VZV), cytomegalovirus (CMV), Examples include adult T lymphocyte leukemia virus, lentivirus, koi herpes virus, norovirus, rotavirus and the like. Examples of the bacterium include intestinal bacteria and ascospores.

  When a virus is used as the microorganism, the virus can be prepared using a conventionally known method. For example, after seed | inoculating the virus used as a measuring object to a cultured cell, it leaves still at 37 degreeC in the presence of a carbon dioxide for 2 to 4 days. Thereafter, the culture supernatant can be filtered, the filtrate can be centrifuged (2,500 rpm, 5 minutes, room temperature), and the supernatant can be collected. Here, a cultured cell capable of being infected with a virus may be appropriately used as the cultured cell. For example, when the virus is a herpes virus, Vero E6 cells can be preferably used.

  The cultured cells can be prepared using a conventionally known method. For example, after culturing a cell to be measured with a well-known culture solution and culture conditions suitable for the cell, the cell may be recovered to a target concentration. The collection method is not particularly limited, but if it is a floating cell, it can be prepared to a desired concentration by centrifugation. Moreover, if it is an adherent cell, it can adjust to a desired density | concentration by centrifuging, after removing a cell from a culture dish using enzyme methods, such as trypsin, and physical methods, such as pipetting.

  Sugar chains with which microorganisms can interact differ depending on the type of microorganism. The “sugar chain to which microorganisms selectively bind” means a sugar chain with which microorganisms can specifically interact. Here, the “interaction” refers to an action such as a hydrogen bond, a hydrophobic bond, an ionic bond, or a van der Waals bond that occurs between a microorganism and a sugar chain.

  The “sugar chain” means a compound in which a plurality of sugars are bonded by glycosidic bonds. The sugar is not particularly limited, and a sialic acid or a sugar having a sulfate group can be preferably used. Examples of the sugar include maltose, lactose, panose, cellobiose, melibiose, manno-oligosaccharide, chitooligosaccharide, and laminari-oligosaccharide. It does not specifically limit as said saccharide | sugar which has sialic acid, Sialyl lactose etc. can be mentioned.

  The sugar chain may be a single oligosaccharide composed of the same sugar or a complex sugar composed of various sugars and derivatives thereof. The oligosaccharides may be various natural sugars obtained by isolation and purification from the natural world, or may be artificially synthesized sugars. The oligosaccharide may be obtained by decomposing a polysaccharide.

  As the sugar chain, for example, heparin, heparan sulfate, chondroitin, chondroitin sulfate, hyaluronic acid, keratan sulfate, dermatan sulfate, chitin, chitosan, β-glucan, mannan and the like can be used.

  The “carrier to which a sugar chain is fixed” is composed of a sugar chain, a linker, and a carrier.

  The linker is not particularly limited as long as it can bind the sugar chain and the carrier. In order to efficiently bind the sugar chain to the carrier, the linker must have an aromatic amino group and a sulfur atom in the molecule. Is preferred. The sulfur atom may be in a state such as a disulfide bond (S—S bond) or a thiol group (SH group). By having a sulfur atom, the linker is easily fixed to the support by a metal-sulfur bond.

The linker is also referred to as a linker compound or a spacer,
General formula (1)

(Wherein a, b, c and d are each independently an integer of 0 or more and 6 or less)
It has the structure represented by. X is a structure having a multi-branched structure comprising three or more hydrocarbon-derived chains having an aromatic amino group at the terminal and optionally having a carbon-nitrogen bond in the main chain, or one chain It has a structure that is a linear structure part.

  The above compound has 1 to 4 aromatic amino groups in the molecule. Further, the amino group and a sugar chain having a reducing end can be easily combined by performing a reductive amination reaction. Therefore, by using the above compound as a linker, 1 to 4 sugar chains can be bound in one linker.

  The linker having the structure represented by the general formula (1) can be produced, for example, by performing a condensation reaction between thioctic acid and an aromatic amino group terminal.

The carrier is preferably a metal, and gold, silver, copper, aluminum, platinum, aluminum oxide, SrTiO ₃ , LaAlO ₃ , NdGaO ₃ , ZrO ₂ or the like can be used as the metal. Of these, gold is more preferable.

  The metal is preferably metal nanoparticles. For example, in order to specifically and efficiently concentrate herpes virus and lentiviral vectors, it is preferable to use metal nanoparticles to which sulfated saccharides such as heparin are immobilized. Metal nanoparticles mean colloidal metal particles having a particle diameter of preferably 1 to 100 nm. When the particle diameter is less than 1 nm, it is difficult to produce nanoparticles, and when the particle diameter exceeds 100 nm, the colloid itself is precipitated, and there is a possibility that reaction with microorganisms is not observed.

  The method for obtaining the metal nanoparticles is not particularly limited. For example, metal nanoparticles can be obtained by adding a reducing agent after dissolving a metal chloride acid and its salts in methanol, water, a mixed solvent thereof or the like using a conventionally known method. Specific examples of the metal chloride acid and its salts include sodium tetrachlorogold (III).

  FIG. 1 is a flowchart illustrating the steps of the present invention. FIG. 1 illustrates a method for concentrating virus from a virus culture supernatant. In FIG. 1, heparin-GNP corresponds to sugar chain-immobilized nanoparticles. In the present specification, when the carrier on which the sugar chain is immobilized is composed of a sugar chain, a linker, and metal nanoparticles, the “carrier on which the sugar chain is immobilized” is referred to as “sugar chain-immobilized nanoparticles”. First, a liquid containing virus (hereinafter referred to as virus liquid) and sugar chain-immobilized nanoparticles are mixed. Next, centrifugation is performed to form a precipitate, and then the supernatant is removed. If the supernatant is removed, the target virus can be concentrated from the virus solution. If the virus is concentrated, it becomes possible to detect the virus with high sensitivity by immunological techniques and genetic engineering techniques that could not be detected by the virus solution.

  The method for producing the “carrier on which the sugar chain is fixed” is not particularly limited, and can be produced by a conventionally known method. For example, a linker molecule (hereinafter referred to as a ligand complex) in which a reducing end of a sugar chain and an amino group of the linker are combined by a reductive amination reaction and a sugar chain is combined is prepared. Furthermore, a “carrier on which a sugar chain is immobilized” can be produced by contacting the ligand complex with a metal as a carrier. The contact can be performed, for example, by mixing the ligand complex with a solution containing a metal.

  The solvent used in the solution containing the metal-containing dispersion medium and the solution containing the ligand complex is not particularly limited, and examples thereof include methanol, water, and mixed solvents thereof.

  When the metal is contained in the solution as a salt, it is preferable to reduce the metal using a reducing agent before mixing the ligand complex with the solution containing the metal. Thereby, it is possible to easily form a bond between the metal and the ligand complex. The reducing agent is not particularly limited, and for example, sodium borohydride, citric acid and its salts, ascorbic acid and its salts, phosphorus, tannic acid and its salts, ethanol, hydrazine and the like can be used. .

  In the case of producing the “carrier having a sugar chain immobilized”, the amount of the ligand complex and the carrier to be used is not particularly limited, but is preferably 1: 1 to 1: 1000 in a molar ratio, more preferably Is preferably 1:10.

  In the method according to the present invention, the aforementioned sugar chain and the microorganism are bound by bringing the “carrier on which the sugar chain is immobilized” into contact with the microorganism in the specimen. Since the sugar chain is a sugar chain that specifically interacts with the microorganism to be concentrated, if the microorganism to be concentrated is contained in the sample, the “carrier on which the sugar chain is immobilized” It will bind specifically.

  The method of performing the “contact” is not particularly limited, and can be performed by a conventionally known method. For example, by mixing a solution containing microorganisms with a solution containing the above “carrier on which a sugar chain is immobilized”, the above “carrier on which a sugar chain is immobilized” is brought into contact with microorganisms in a specimen. Can do. And if the said contact is performed, the said sugar chain and microorganisms will couple | bond.

  The solution containing microorganisms can be prepared by a method such as immersing a swab obtained by rubbing the affected area such as blisters in a buffer, collecting blood / cerebrospinal fluid, and collecting virus culture supernatant. In addition, a solution containing the above “carrier to which a sugar chain is immobilized” can be prepared, for example, by reducing sodium tetrachlorogold (III) with trisodium citrate and mixing the ligand complex solution. .

  The method for concentrating the “carrier on which the sugar chain is fixed” to which microorganisms are bound is not particularly limited. For example, the concentration can be performed by natural sedimentation, centrifugation, filtration, or magnetic force.

  Concentration by natural sedimentation can be performed, for example, by a method such as standing. Concentration by centrifugation can be performed using a conventionally known centrifuge. As conditions for centrifugation, for example, 1,000 to 12,000 rpm, 10 to 30 minutes, 4 ° C. to 25 ° C. are preferable. Concentration by filtration can be performed by a conventionally known method using, for example, an ultrafiltration membrane. For concentration by magnetic force, for example, magnetic nanoparticles are prepared by including iron in metal nanoparticles, and sugar chains are immobilized by the same method to prepare a “carrier on which sugar chains are immobilized”. After mixing, a permanent magnet can be applied from the outside of the container.

  The microorganism is a microorganism capable of infecting a host organism that develops a viral infection, bacterial infection, rickettsia infection, chlamydia infection, fungal infection, protozoal infection, or parasitic infection.

  Viral infections include herpes gingivitis, genital herpes, herpes encephalitis, herpes gourd, chickenpox, shingles, CMV retinitis, influenza, mumps, measles, acute respiratory tract infection, rabies, Ebola, Polio, rubella, Japanese encephalitis, viral gastroenteritis, acquired immune deficiency syndrome, viral hepatitis, etc. Examples of microorganisms that cause viral infection include herpes virus, varicella-zoster virus, cytomegalovirus, influenza virus, mumps virus, measles virus, RS virus, rabies virus, Ebola virus, poliovirus, rubella virus, Japanese encephalitis Examples include viruses, noroviruses, human immunodeficiency viruses, and hepatitis viruses.

  Bacterial infections include acute pharyngitis, impetigo, gonorrhea, Legionella pneumonia, brucellosis, hemorrhagic colitis, typhoid, plague, cholera, food poisoning, gastritis, anthrax, diphtheria, and the like. Examples of microorganisms that cause bacterial infection include Streptococcus pyogenes, Neisseria gonorrhoeae, Legionella, Brucella, Enterohemorrhagic Escherichia coli, Salmonella, Plasmodium, Vibrio parahaemolyticus, Staphylococcus aureus, Helicobacter pylori, Bacillus anthracis, And diphtheria.

  Rickettsia infections include typhus, rash fever, Rocky mountain spotted fever, and Japanese spotted fever. Examples of microorganisms that cause rickettsia infection include rickettsia prowazeki and rickettsia typhi.

  Chlamydia infections include trachoma, inclusion body mucositis, non-gonococcal urethritis, sexually transmitted lymphogranulomatosis, and parrot disease. Examples of microorganisms that cause chlamydial infection include trachoma chlamydia, pneumonia chlamydophila, and parrot disease chlamydophila.

  Fungal infections include candidiasis, cryptococcosis, aspergillosis, histoplasmosis, pneumocystis carinii pneumonia, and the like. Examples of microorganisms that cause fungal infections include Candida albicans, cryptococcus, neofilmans, aspergillus, flavus, histoplasma, capsulatatum, and pneumocystis carini.

  Protozoal infections include amoeba dysentery, amebic spondylitis, and African sleeping sickness. Examples of microorganisms that cause protozoal infections include dysentery amoeba, acanthamoeba, vaginal trichomonas, and Gambia trypanosoma.

  Parasitic infections include roundworm, elephantiasis, schistosomiasis and the like. Examples of microorganisms that cause parasitic infections include roundworms, filariae, and schistosomes.

  The amount of the sugar chain-immobilized nanoparticles used for concentrating the microorganism is preferably 0.1 to 3.0 (/ mm) in the UV-visible absorption spectrum (OD 530 nm) at 530 nm, more preferably 0. 1 to 0.5 (/ mm). The amount of the sugar chain-immobilized nanoparticles used can be appropriately determined according to the purpose.

  In the present invention, in order to perform concentration using a sugar chain-immobilized nanoparticle from a specimen in which microorganisms are present, for example, 0.001 to 1000 mol times the amount of microorganism in the specimen from which sugar chain-immobilized nanoparticles are estimated. In addition, preferably at a ratio of 0.1 to 100 mole times, more preferably at a ratio of 1 to 10 mole times, and after standing at 4 ° C. overnight, centrifugation (10,000 rpm, 40 minutes, Room temperature), the supernatant is removed, and the precipitate containing the microorganisms and sugar chain-immobilized nanoparticles is suspended in ultrapure water and centrifuged again (10,000 rpm, 1 minute, room temperature) to remove the supernatant. This is achieved by removing.

  The microorganisms can be identified by subjecting the carrier concentrated by the method according to the present invention to an immunological technique or a genetic engineering technique. Examples of the immunological technique or genetic engineering technique include Western blotting and real-time PCR. By using an antibody that specifically recognizes a microorganism or a primer having a complementary sequence to the nucleic acid of the microorganism. Microorganisms can be identified. That is, in the present invention, the effect of concentrating microorganisms can be confirmed by Western blotting, real-time PCR, or the like. For example, in order to confirm the effect of concentration by Western blotting, after performing SDS-PAGE by a conventional method, it is transferred to a nitrocellulose membrane. The antibody to be used may be any antibody that selectively recognizes microbial proteins.

  The present invention is not limited to the above-described embodiments, and various modifications can be made within the scope of the claims, and the embodiments can be obtained by appropriately combining technical means disclosed in different embodiments. The form is also included in the technical scope of the present invention.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail through an Example, the scope of the present invention is not limited to these Examples.

(Example 1: Preparation of heparin-immobilized gold nanoparticles)
Since herpes virus was used as the microorganism, heparin was selected as the sugar chain to be immobilized on the nanoparticles. Hereinafter, the herpes virus may be abbreviated as “HSV”.

  The method similar to WO2005 / 0797965 was used as a method for binding heparin to the linker. First, a linker containing thioctic acid and m-phenylenediamine was prepared. Thereafter, a heparin-ligand complex was prepared by immobilizing the linker and heparin on the nanoparticles by a reductive amination reaction.

  Gold nanoparticles are available from Nature. Prepared according to the method of Physical Science, 1973, 241, 20-22.

  Gold nanoparticles and heparin ligand complex were mixed and allowed to stand at room temperature for 1 hour, then purified using a MWCO: 3,500 dialysis membrane, and then centrifuged (10,500 rpm, 40 minutes) to obtain an OD of 530 nm. Prepared heparin-immobilized gold nanoparticles with 0.8 (/ mm).

(Example 2: Confirmation of herpes virus concentration effect using Western blotting)
Heparin-immobilized gold nanoparticles are diluted to a concentration of OD 530 nm = 0.44. Thereafter, 100 μL of heparin-immobilized gold nanoparticles were added to 200 μL of a herpes virus-containing solution, and left at 4 ° C. overnight. Thereafter, the mixture is centrifuged (10,000 rpm, 40 minutes, room temperature), the supernatant is removed, 1 ml of ultrapure water is added to the precipitate containing the virus and heparin-immobilized gold nanoparticles, washed, and centrifuged again. (10,000 rpm, 1 minute, room temperature) to collect the precipitate. A herpes virus suspension was prepared by adding 20 μl of PBS-T (phosphate isotonic buffer containing 5% Tween 20) to the precipitate and suspending it to concentrate the virus.

  Heparin-immobilized gold nanoparticle-untreated herpesvirus solution (described as “untreated” in Table 1), concentrated herpesvirus suspension (described as “precipitate” in Table 1), and removed during centrifugation The obtained supernatant (described as “supernatant” in Table 1) was subjected to SDS-PAGE by a generally known method. Table 1 shows the added virus solution, SDS-PAGE sample preparation buffer (described as “Leammli buffer”), and the amount of SDS-PAGE contained in one lane (described as “Apply amount”). As a running buffer for SDS-PAGE, 10% Tricine and Tricine-SDS buffer were used. Coomassie Brilliant Blue (CBB Stain One: Nacalai Tesque) and Western blotting were used in combination for discrimination at the end of SDS-PAGE and protein visualization. In Western Western blotting, herpes virus-derived protein separated by SDS-PAGE is transferred to a PVDF membrane (0.2 μm MILLIPORE), then the primary antibody is an anti-HSV antibody mouse monoclonal antibody or rabbit polyclonal antibody (biomeda). The secondary antibody was visualized with a BCIP-NBT solution kit (Nacalai Tesque) using anti-mouse IgG or anti-rabbit IgG (SIGMA) labeled with alkaline phosphatase.

  As shown in FIG. 2 (a), as a result of comparing the herpes virus solution untreated with heparin-immobilized gold nanoparticles and the concentrated herpes virus suspension by Coomassie Brilliant Blue staining, the concentrated herpes virus-derived protein was It was clear because most of the background protein was removed, and the removed protein was detected in the supernatant removed during centrifugation.

  FIG. 2 (b) shows the result of Western blotting using a rabbit polyclonal antibody, and a strong signal based on the antibody that specifically binds to the concentrated herpesvirus-derived protein is obtained. It was found that the protein derived from the herpes virus solution not treated with gold nanoparticles and the supernatant removed during centrifugation did not give a signal based on the antibody that specifically binds, and thus were efficiently concentrated. The concentration efficiency of the band was quantified by Gel-Pro Analyzer (Media Cybernetics). The concentration of herpesvirus protein was about 3 compared to the heparin-immobilized gold nanoparticle-untreated herpesvirus culture supernatant. It turned out that it was concentrated twice.

  FIG. 2 (c) shows the results of Western blotting using a mouse monoclonal antibody. Similarly, as a result of analyzing the efficiency of concentration, it was confirmed that the herpes virus suspension was concentrated about 6 times in the concentrated herpes virus suspension compared with the herpes virus solution not treated with heparin-immobilized gold nanoparticles. . From these results, it was revealed that herpes virus can be efficiently concentrated by concentrating herpes virus solution with heparin-immobilized gold nanoparticles.

(Example 3: Examination of herpes virus concentration using real-time PCR)
To 260 μl of a solution prepared by adjusting heparin-immobilized gold nanoparticles to OD 530 nm = 0.78 (/ mm), 10 ml of a herpes virus solution corresponding to 150 PFU / ml was mixed and allowed to stand at 4 ° C. overnight. Thereafter, the mixture was centrifuged (10,000 rpm, 30 minutes, room temperature), and the supernatant was removed. Then, 10 μl of ultrapure water was added to the precipitate containing virus and heparin-immobilized gold nanoparticles and suspended. PFU refers to PLAQUE FORMAT UNIT and is an index that defines the amount of virus.

  The virus suspension is heated at 95 ° C. for 10 minutes to thermally denature the virus, then rapidly cooled to 4 ° C., and then centrifuged again (10,000 rpm, 1 minute, room temperature) to recover the supernatant. A template for use in a real-time PCR machine was used. Further, 10 μl of herpesvirus solution equivalent to 150 PFU / ml was heat-denatured at 95 ° C. for 10 minutes to serve as a control template.

  As a sample to be subjected to real-time PCR, a kit of SYBR Premix EX Taq (registered trademark, Takara Bio Inc.) was used, and the adjustment was performed according to the attached manual. The primer used for the reaction was ACATCATCAACTTCGACTGG (SEQ ID NO: 1) as the forward primer, and CTCAGATCCTCTCTTCTTTGRCC (SEQ ID NO: 2) as the reverse primer, which are complementary to the gene coating gp046 of herpes virus. In addition, gp046 is DNA polymerase catalytic subunit.

  Using a real-time PCR apparatus Thermal Cycler Dice (Takara Bio Inc.), PCR conditions were set at 95 ° C. (10 seconds) for 1 cycle and 95 ° C. (5 seconds) → 60 ° C. (30 seconds) for 40 cycles.

  The result of the above experiment was confirmed by Ct. Ct (Cycle of Threshold) refers to the number of PCR cycles that are repeated until a target template can be detected by a fluorescent signal. That is, as the initial template concentration is higher, the amount of amplification of the target template is increased even with a small Ct, so that a fluorescent signal can be detected. Therefore, when Ct is decreased by 1, this indicates that the initial template amount is doubled.

  Samples A and B in Table 2 represent the herpes virus concentration effect of heparin-immobilized gold nanoparticles in Ct. The Ct of the virus suspension concentrated by heparin-immobilized gold nanoparticles is 21.7, which is a significant decrease compared to Ct = 33.0 of the control sample, which is 2 (33.0 -21.7), that is, about 2500 times concentrated. From these results, it was clarified that the virus is efficiently concentrated by concentrating the herpes virus solution with heparin-immobilized gold nanoparticles.

  Since the microorganism concentration method according to the present invention concentrates microorganisms efficiently, it can be identified even when the amount of microorganisms in the sample is extremely small and cannot be detected by a normal detection method.

(Example 4: Confirmation of concentration effect of chicken pox virus using real-time PCR and examination of concentration of cytomegalovirus)
With respect to 260 μl of a solution prepared by adjusting heparin-immobilized gold nanoparticles to OD 530 nm = 0.78 (/ mm), 150 PFU / ml equivalent of chicken pox virus (hereinafter referred to as “VZV”) or cytomegalovirus (hereinafter referred to as “CMV”). 10 ml of the virus solution containing the mixture was mixed and allowed to stand at 4 ° C. overnight. Thereafter, the mixture was centrifuged (10,000 rpm, 30 minutes, room temperature), and the supernatant was removed. Then, 10 μl of ultrapure water was added to the precipitate containing virus and heparin-immobilized gold nanoparticles and suspended.

  The suspension is heated at 95 ° C. for 10 minutes to thermally denature the virus, then rapidly cooled to 4 ° C., and then centrifuged again (10,000 rpm, 1 minute, room temperature) to recover the supernatant and real time It was set as the template with which it uses for a PCR machine (VZV: sample C CMV: sample E). Further, 10 μl of VZV or CMV virus solution equivalent to 150 PFU / ml corresponding to 150 PFU / ml was heat-denatured at 95 ° C. for 10 minutes, and used as a control template (VZV: sample D CMV: sample F).

  As a sample to be subjected to real-time PCR, a kit of SYBR Premix EX Taq (registered trademark, Takara Bio Inc.) was used, and its preparation was in accordance with the attached manual. Primers used in the reaction were CTCGCCCCTCTCTCTCTC (SEQ ID NO: 3), VZV forward primer, GATGAGGTGGTTGTTTATTGTTC (SEQ ID NO: 4), CMV forward primer was CAAGCGGCCTCTGATACACCA (SEQ ID NO: 5), and reverse primer was: ACTAGGAGAGCAGACTCTCAGAGGAT (SEQ ID NO: 6), which is complementary to the gene that coats VZV gB or CMV pIE2. Using a real-time PCR apparatus Thermal Cycler Dice (Takara Bio Inc.), PCR conditions were set at 95 ° C. (10 seconds) for 1 cycle and 95 ° C. (5 seconds) → 60 ° C. (30 seconds) for 40 cycles. Note that gB means envelope glycoprotein B, and pIE2 means immediate-early transcriptional regulator.

  The result of the above experiment was confirmed by Ct. Samples C to F in Table 2 represent the effect of concentration of VZV or CMV of heparin-immobilized gold nanoparticles by Ct. For VZV, Ct when concentrated by heparin-immobilized gold nanoparticles was 15.4, which was significantly reduced compared to the control sample (Ct = 22.5), 138 times It was shown that it was concentrated to. From these results, it became clear that VZV was efficiently concentrated by concentrating the VZV virus solution with heparin-immobilized gold nanoparticles.

  For CMV, Ct when enriched with heparin-immobilized gold nanoparticles was 23.4, a significant decrease compared to the control sample (Ct = 28.8), 42 times It was shown to be concentrated to From these results, it was revealed that CMV was concentrated efficiently by concentrating the CMV virus solution with heparin-immobilized gold nanoparticles.

(Example 5: Examination of koi herpesvirus concentration using real-time PCR)
A cell culture solution obtained by infecting koi herpes virus in cells derived from rainbow trout fin and cultivated for 2 weeks was diluted 5-fold with PBS to 0.5 ml of a virus solution and heparin-immobilized gold nanoparticles at OD 530 nm = 0.78 (/ mm). The prepared solution was mixed with 6.5 μl and shaken at 4 ° C. for 1 hour. Thereafter, the mixture was centrifuged (10,000 g, 30 minutes, room temperature), the supernatant was removed, and 10 μl of ultrapure water was added to the precipitate containing the virus and heparin-immobilized gold nanoparticles and suspended. The suspension is heated at 95 ° C. for 10 minutes to thermally denature the virus, then rapidly cooled on ice, and then centrifuged again (10,000 rpm, 1 minute, room temperature) to recover the supernatant and real-time PCR It was set as the template used for an apparatus (sample G). Further, 10 μl of the virus solution diluted 5 times as described above was heat-denatured at 100 ° C. for 10 minutes and used as a control template (sample H).

  As a sample to be subjected to real-time PCR, a kit of SYBR Premix EX Taq (registered trademark, Takara Bio Inc.) was used, and the adjustment was performed according to the attached manual. The primer used in the reaction was GACGCCGGGAACCCTTGTG (SEQ ID NO: 7), and the reverse primer was CGGGTTCTTTTTTTGTCCTTGTTT (SEQ ID NO: 8), which are complementary to the genes that coat ORF89 of koi herpesvirus. ORF89 is a hypothetical protein whose function is unknown.

  Using a real-time PCR apparatus Thermal Cycler Dice (Takara Bio Inc.), PCR conditions were set at 95 ° C. (10 seconds) for 1 cycle and 95 ° C. (5 seconds) → 60 ° C. (30 seconds) for 40 cycles.

  The result of the above experiment was confirmed by Ct. Table 2 shows the concentration effect of heparin-immobilized gold nanoparticles in Ct. Due to heparin-immobilized gold nanoparticles, the Ct of the concentrated sample G is 13.3, which is significantly reduced compared to the control sample H (Ct = 20.9), 180 times It was shown to be concentrated. From these results, it was revealed that the virus can be efficiently concentrated by concentrating the koi herpesvirus solution with heparin-immobilized gold nanoparticles.

(Example 6: Examination of lentivirus concentration using a flow cytometer)
To 24 μl of a solution prepared by adjusting heparin-immobilized gold nanoparticles to OD 530 nm = 0.78 (/ mm), 1 ml of a lentiviral solution equivalent to Functional viral titer = 2.5 × 10 ⁵ / ml is mixed at room temperature. Let stand for 30 minutes. After centrifugation (10,000 g or 3,000 g, 30 minutes, 4 ° C.), the supernatant is removed, and then 10 μl of sterilized ultrapure water is added to the precipitate containing the virus and heparin-immobilized gold nanoparticles and suspended. did. The functional viral titer is an index that defines the amount of infectious virus.

To 24 μl of a solution prepared by adjusting heparin-immobilized gold nanoparticles to OD 530 nm = 0.78 (/ mm), 1 ml of lentiviral culture supernatant equivalent to Functional vial titer = 2.5 × 10 ⁵ / ml was mixed, It was allowed to stand at room temperature for 30 minutes. Thereafter, centrifugation (10,000 g or 3,000 g, 30 minutes, 4 ° C.) is performed, and after removing the supernatant, 10 μl of sterilized ultrapure water is added to the precipitate containing the virus and heparin-immobilized gold nanoparticles. It became cloudy. DMEM medium was added to the suspension to infect host cells. Also, 10 μl of lentiviral culture supernatant equivalent to Functional viral titer = 2.5 × 10 ⁵ / ml was used as a control.

As a host cell, 293T cell was used. 293T cells were grown in advance on a 6-well plate so that there were 2 × 10 ⁵ cells / well. When infecting the virus, protamine sulfate was added to the DMEM medium so that the final concentration was 8 μg / ml. The medium was changed 16 hours after the addition of virus, and the infected cells were then cultured for 4 days.

  Cells infected with the virus emit fluorescence. Therefore, the fluorescence intensity emitted by the cells was measured using a flow cytometer Cytoics FC 500 (Beckman Coulter). The sample used for the flow cytometer was adjusted according to the manual attached to the apparatus.

  The result of the above-mentioned experiment was confirmed by the virus functional vital titer (titer). The titer is an index that defines the amount of infectious virus. That is, the higher the concentration of virus having infectivity, the higher the titer. Conversely, the titer becomes smaller as the concentration of the virus capable of infecting is lower.

Table 3 shows the concentration effect of heparin-immobilized gold nanoparticles in titer. The titer when concentrated by heparin-immobilized gold nanoparticles is 3.3 x 10 ⁷ / ml (centrifugation 3,000 g x 30 minutes: sample I) or 5.3 x 10 ⁷ / ml (centrifugation) 10,000 g x 30 min: Sample J), which was significantly increased compared to the control sample (Sample K), indicating that it was concentrated 160-260 times. From these results, it was found that the virus alone can be efficiently concentrated by concentrating the lentivirus culture supernatant with heparin-immobilized gold nanoparticles.

(Example 7: Investigation of influenza virus concentration using real-time RT-PCR using heparin-immobilized gold nanoparticles)
To 2.6 μl of a solution prepared by adjusting heparin-immobilized gold nanoparticles to OD 530 nm = 0.78 (/ mm), 100 μl of an influenza virus solution of 1.0, 0.1, or 0.01 HAU is mixed, It was allowed to stand at room temperature for 30 minutes. Thereafter, the mixture was centrifuged (10,000 × g, 30 minutes, room temperature), and the supernatant was removed. Then, 10 μl of ultrapure water was added to the precipitate containing the virus and heparin-immobilized gold nanoparticles and suspended. The suspension was heat-denatured at 95 ° C. for 10 minutes, rapidly cooled to 4 ° C., and used as a template for a real-time PCR instrument. HAU refers to Hemagglutination Unit and is an index that defines the amount of virus.

  In addition, a virus solution without heparin-immobilized gold nanoparticles was used as a control template.

  The sample used for the real-time PCR machine was a kit of One Step SYBR (registered trademark) PrimeScript (registered trademark) RT-PCR Kit II (registered trademark) (Takara Bio Inc.), and its preparation was according to the attached manual. The primer used for the reaction was GGACTGCAGCGGTAGAGGCTT (SEQ ID NO: 9) and the reverse primer was CCAGCAAATAGCCCCGAAGAA (SEQ ID NO: 10), which are complementary to the gene that coats the M protein of influenza virus.

  Using a real-time PCR device Thermal Cycler Dice (Takara Bio Inc.), the reverse transcription reaction conditions were 42 degrees (5 minutes), 1 cycle of 95 ° C. (10 seconds), and the PCR conditions were 95 ° C. (5 seconds) → 60 ° C. (30 seconds) was set to 40 cycles.

  The result of the above experiment was confirmed by Ct. In the case of 1.0 HAU virus solution, Ct = 29.0 to Ct = 23.7 by adding heparin-immobilized gold nanoparticles, and in the case of 0.1 HAU virus solution, heparin-immobilized gold nanoparticles are added. From Ct = 33.2 to Ct = 27.5, in the case of 0.01 HAU virus solution, the number of cycles is reduced from Ct = 37.5 to Ct = 31.8 by adding heparin-immobilized gold nanoparticles. In DNA, DNA derived from influenza virus was detected. From these results, it became clear that the virus can be efficiently concentrated by concentrating the influenza virus solution with heparin-immobilized gold nanoparticles.

(Example 8: Examination of influenza virus concentration using real-time RT-PCR using sialic acid-containing sugar chain-immobilized gold nanoparticles)
1.0, 0.1, or 0.01 HAU with respect to 3.7 μl of a solution in which sialic acid-containing sugar chain (NeuAcα2-6Galβ1-4Glc) -immobilized gold nanoparticles are prepared at an OD of 530 nm = 0.896 (/ mm) 100 μl of the influenza virus solution was mixed and allowed to stand at room temperature for 30 minutes. Thereafter, the mixture was centrifuged (10,000 × g, 30 minutes, room temperature), and the supernatant was removed. Then, 10 μl of ultrapure water was added to the precipitate containing the virus and the sialic acid-containing sugar chain-immobilized gold nanoparticles and suspended. The suspension was heat-denatured at 95 ° C. for 10 minutes, rapidly cooled to 4 ° C., and used as a template for a real-time PCR instrument.

  In addition, a virus solution to which sialic acid-containing sugar chain-immobilized gold nanoparticles were not added was used as a control template.

  The sample used for the real-time PCR machine was a kit of One Step SYBR (registered trademark) PrimeScript (registered trademark) RT-PCR Kit II (registered trademark) (Takara Bio Inc.), and its preparation was according to the attached manual. The primer used for the reaction was GGACTGCAGCGGTAGAGGCTT (SEQ ID NO: 9) and the reverse primer was CCAGCAAATAGCCCGAAGAA (SEQ ID NO: 10), which are complementary to the gene that coats the M protein of influenza virus.

  Using a real-time PCR device Thermal Cycler Dice (Takara Bio Inc.), the reverse transcription reaction conditions were 42 degrees (5 minutes), 1 cycle of 95 ° C. (10 seconds), and the PCR conditions were 95 ° C. (5 seconds) → 60 ° C. (30 seconds) was set to 40 cycles.

  The result of the above experiment was confirmed by Ct. In the case of 1.0 HAU virus solution, Ct = 27.7 to Ct = 20.2 by adding sialic acid-containing sugar chain-immobilized gold nanoparticles, and in the case of 0.1 HAU virus solution, sialic acid-containing sugar Ct = 28.5 to Ct = 23.5 by adding chain-immobilized gold nanoparticles, and in the case of 0.01 HAU virus solution, Ct = 34.5 by adding sialic acid-containing sugar chain-immobilized gold nanoparticles. From Ct to 27.7, DNA derived from influenza virus was detected with a small number of cycles. From these results, it was revealed that the virus can be efficiently concentrated by concentrating the influenza virus solution with sialic acid-containing sugar chain-immobilized gold nanoparticles.

  The method for concentrating microorganisms according to the present invention comprises a step of bringing the sugar chain and the microorganism into contact with each other by contacting a carrier on which a sugar chain to which the microorganism selectively binds is fixed with the microorganism in the specimen, And the step of concentrating the carrier, whereby the pathogenic microorganism can be efficiently concentrated and identified. Therefore, it is possible to prevent and treat diseases caused by pathogenic microorganisms, and foresee economic damage to products such as livestock and agricultural products, and to prevent such damage. Therefore, the present invention can be widely used in industries such as agriculture, livestock industry, and medical equipment.

It is a flowchart which shows a series of processes of this invention. It is the figure which showed the concentration effect by a heparin fixed gold | metal | money nanoparticle. (A) Results of SDS-PAGE, (b) Results of Western blotting using rabbit polyclonal antibody as anti-HSV antibody (c) Results of Western blotting using mouse monoclonal antibody as anti-HSV antibody.

Claims (6)

  A step of bringing the sugar chain and the microorganism into contact with each other by bringing a carrier on which the sugar chain to which the microorganism selectively binds is fixed, into contact with the microorganism in the specimen; and a step of concentrating the carrier. A method for concentrating microorganisms.   The step of concentrating the carrier includes a step of recovering the carrier by the action of natural sedimentation, centrifugation, filtration, or magnetic force, and a step of purifying the microorganism by washing the recovered carrier. The method of claim 1.   The method according to claim 1 or 2, wherein the carrier is a nanoparticle.   The above microorganism is a microorganism capable of infecting a host organism that causes viral infection, bacterial infection, rickettsia infection, chlamydia infection, fungal infection, protozoal infection, or parasitic infection. The method according to any one of claims 1 to 3.   The method according to claim 4, wherein the microorganism is a herpes virus, varicella virus, cytomegalovirus, koi herpes virus, lentivirus, influenza virus or a viral vector used for gene therapy.   A microorganism identification method comprising identifying a microorganism by subjecting the carrier concentrated by the method according to any one of claims 1 to 5 to an immunological technique or a genetic engineering technique.