JP2009089605A - Method for predicting crisis of late side effect in radiotherapy of breast cancer - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for predicting the crisis of a late side effect in the radiotherapy of breast cancer. <P>SOLUTION: This method for predicting the crisis of the late side effect in the radiotherapy of the breast cancer is characterized by comprising (1) a process for obtaining a genome DNA sample from a breast cancer patient, (2) a process for identifying the combination of bases existing at the prescribed positions of a genome sequence in the obtained genome DNA sample, and (3) a process for predicting the crisis risk of the late side effect on the basis of the information obtained in the process (2). <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for accurately predicting the onset of late side effects from radiation therapy for breast cancer.

  Currently, surgical treatment, chemotherapy and radiation therapy are typical treatment methods for cancer. Among these, radiotherapy is an excellent treatment method in that the radiation can be directed to the affected area and is less invasive. However, since some patients may develop side effects after radiation treatment and QOL may decrease, development of a method capable of predicting the risk of developing side effects before the start of treatment has been demanded. In response to such a demand, the present inventors have developed various methods that can predict the risk of developing side effects in advance (see Patent Documents 1 and 2).

JP 2006-87375 A JP 2007-116905 A

Breast cancer is a cancer frequently diagnosed in women around the world, and the number of patients is increasing. Radiation therapy is an effective treatment method for breast cancer treatment and is generally performed after breast-conserving surgery.
However, in some patients, side effects such as skin disorders (late side effects) may develop after a long period of time since radiation therapy, and this has been a problem in terms of patient QOL. Did not exist.

  The inventors of the present invention focused on single nucleotide polymorphisms (SNPs) that allow patients to be genetically individualized, and as a result, a plurality of SNPs present in each of the 10 genes are breast cancer. It was found to be related to the development of late side effects from radiation therapy. The present invention has been made based on this finding.

（３）工程（２）で同定した組み合わせが、下記：

のいずれかに該当する場合、副作用発症の危険性が高いと予測し、
工程（２）で同定した組み合わせが、下記：

のいずれかに該当する場合、副作用発症の危険性が低いと予測する工程
を含むことを特徴とする方法
に関するものである。 That is, the present invention
A method for predicting the onset of late side effects from radiation therapy in breast cancer patients,
(1) obtaining a genomic DNA sample from a breast cancer patient;
(2) Identifying one or more of the following base combinations a to j in the obtained genomic DNA sample:

(3) The combination identified in step (2) is:

If any of these are true, predict that the risk of developing side effects is high,
The combinations identified in step (2) are:

In the case of any of the above, the present invention relates to a method including a step of predicting that the risk of developing a side effect is low.

  The method of the present invention can accurately predict the risk of developing late side effects due to radiation therapy that leads to a reduction in QOL in breast cancer patients, as shown in the Examples described later. Therefore, by using the method of the present invention, it is possible to predict the appropriateness of radiotherapy for individual breast cancer patients in advance and to plan an optimal treatment method for the patient.

Hereinafter, the present invention will be described in more detail.
The method of predicting the onset of late side effects due to radiation therapy for breast cancer patients of the present invention includes the following steps:
(1) obtaining a genomic DNA sample from a breast cancer patient;
(2) In the obtained genomic DNA sample, a step of identifying a combination of bases present at a predetermined position of the genomic sequence, and (3) onset of late side effects based on the information obtained in step (2) It includes the process of predicting the risk.

Process (1)
Breast cancer refers to carcinoma that occurs in breast tissue. Specific examples include ductal cancer and lobular cancer. The present invention is directed to breast cancer to which radiation therapy is applied. As long as radiation therapy can be applied, the stage is not limited. However, invasive cancer, metastatic cancer, and recurrent cancer are excluded, and only primary cancer is targeted.
A breast cancer patient refers to a human suffering from breast cancer. The patient's gender is limited to female, but age is not important.
A genomic DNA sample can be collected from any part of a breast cancer patient as long as any of the 10 types of base combinations described below can be measured. Specific examples include blood, skin, oral mucosa, hair, tissue excised by surgery, and the like. Blood is preferable in terms of ease of preparing a genomic DNA sample.
A genomic DNA sample can be prepared from genomic DNA extracted from a collected tissue or the like according to a method generally used in the art. Examples of the preparation method include the use of a QIAGEN DNA Blood Mini Kit.

Step (2)
The combinations of bases to be identified are 10 types a to j shown in Table 1 below.

  In the above table, “genomic DNA sequence” refers to the base sequence of human genomic DNA. The base position in each combination is the position in the genomic DNA sequence registered in GenBank with an accession number starting with “NC_”. For example, the combination a means the 7239965th base and the 7249542th position in the genomic DNA sequence registered in GenBank as the accession number “NC — 000007.12”.

  In combination a, the 7239965th base and 7249542th base in the genomic DNA sequence registered in GenBank as accession number “NC — 000007.12” are identified.

  Regarding the 7239965th base of the genomic DNA sequence NC — 000007.12, the 7239965th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 1 below.

(SEQ ID NO: 1)
GGGCATGGGTGTGTTCAAATAAAACTCTATTTACAAAAACAGGTAGCAGGCCAGGTTTGGTCCATGGGTCCTCAAACTGTGCTGACCCTAGTCCTCCACAAGCTACAAGTGTTTTTTTAC
"A / G"
TTTATAAAGGATTGTTTAAGAAGAAGATGCAACAGAAACCACATGAGACCCAAAAAGCCAAAAATATTTTATTTCTAGTTCTTTACAGAAAGGGTTTGCTAACTTTTGGGTTGGAGAAGG

  In the sequence of SEQ ID NO: 1, the base surrounded by "" (the 121st base of SEQ ID NO: 1) corresponds to the 7239965th base of the genomic DNA sequence NC_000007.12. “A / G” means that the base at the position is A or G.

  Regarding the 7249542 base of the genomic DNA sequence NC — 000007.12, the 7249542 base and the 240 bp base sequence before and after that are shown in SEQ ID NO: 2 below.

(SEQ ID NO: 2)
AGAGAATATTGTTTCATTTAAAAATACTTTCCACAGTTTCACTTGGTTTCACCAATTTCAATTGGTTTTAAATCATTAGGATGTCTAAGTAAACTATTGATTTCTTCCACAGGTCTAGTA
"C / T"
ATTAGGTTCCTCTGCTTTACCTTGCCATCTTTAATGTTTGTATTCTTTTAAAATTAGCTGGTCCTTTATAAGTATGTAAATATTGTAGCTAGCAATGTGCTGTTTATTAACAATACCTGT

  In the sequence of SEQ ID NO: 2, the base surrounded by “” (the 121st base of SEQ ID NO: 2) corresponds to the 7249542 base of the genomic DNA sequence NC_000007.12. “C / T” means that the base at the position is C or T.

  The 7239965th base and the 7249542th base in the genomic DNA sequence NC_000007.12 are present in the C1GALT1 gene. The C1GALT1 gene is a gene known to be located at locus 7p14-p13 on the human chromosome.

  In combination b, the 3066618th and 30707825th bases in the genomic DNA sequence registered in GenBank as the accession number “NC — 000003.10” are identified.

  The 3066618th base of the genomic DNA sequence NC_000003.10 and the base sequence of 240 bp before and after that base are shown in SEQ ID NO: 3 below.

(SEQ ID NO: 3)
GTGTAAATTTTGTGATGTGAGATTTTCCACCTGTGACAACCAGAAATCCTGCATGAGCAACTGCAGCATCACCTCCATCTGTGAGAAGCCACAGGAAGTCTGTGTGGCTGTATGGTAAGC
"A / G"
AGCCTTTTAAGAAGTTATTCTTTCTTTTCCCCTTTTTACATAATGTATTCTCATAGTACACACAGTCAGTGTATCTCTGTCTCCTAAATGTAAACACCTGTTCCATTTCCCTTTCCTTTA

  In the sequence of SEQ ID NO: 3, the base surrounded by “” (the 121st base of SEQ ID NO: 3) corresponds to the 30606418th base of the genomic DNA sequence NC_000003.10. “A / G” means that the base at the position is A or G.

  Regarding the 30707825th base of the genomic DNA sequence NC_000003.10, the 30707825th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 4 below.

(SEQ ID NO: 4)
AGCACAGCTGCCACCAGCACAAACCCCCCACCACCCTTTCCACATGGAACTGGCTGGCCTGCAGCAGCAGGCACTCAGTCAGCACATGTTAAATGCACAGGCACTTTTGGACCCTGCTTG
"A / C"
ACTCACTATAGCAACAAGGTCAGCAGGCCACCTTGCCTTCCGCGGAGCCCACCAACTCATGGTGCCCTTTGGATCTCTTTCCCGCTACAGGGCATCCAGATGGTGTGTGAGACGTTGACT

  In the sequence of SEQ ID NO: 4, the base surrounded by "" (the 121st base of SEQ ID NO: 4) corresponds to the 30707825th base of the genomic DNA sequence NC_000003.10. “A / C” means that the base at the position is A or C.

  The bases of 30606418th and 30707825th in the genomic DNA sequence NC_000003.10 are present in the TGFBR2 gene. The TGFBR2 gene is a gene known to be located at locus 3p22 on the human chromosome.

  In the combination c, the 135424917th and 135434557th bases in the genomic DNA sequence registered in GenBank as the accession number “NC_000005.8” are identified.

  Regarding the 135424917th base of the genomic DNA sequence NC_000005.8, the base sequence of the 135424917th base and 240 bp before and after it are shown in SEQ ID NO: 5 below.

(SEQ ID NO: 5)
GCTGTCCGCGCGATTCCCAGCACTCCTCTTACAGCATCTCACCTCAGTGTATGTTCCTTGCCTCCAGTGCAGTTGAACCTCAGTCCTGCCTCTCCTCATGTGTGCATTCACCTTTCTTGG
"C / T"
GCTCTCTCCCCATGGGCCAAGTTCTACCATGAGTTATGAAACATTATGGAGAAAACATGTCTTTGGAAATGTGAGCCAGAAAGCCCACCAGTGCCCCTCAGTCACGGTTGTTATGAATGA

  In the sequence of SEQ ID NO: 5, the base surrounded by “” (the 121st base of SEQ ID NO: 5) corresponds to the 135424917 base of the genomic DNA sequence NC_000005.8. “C / T” means that the base at the position is C or T.

  Regarding the 135434557th base of the genomic DNA sequence NC_000005.8, the base sequence of the 135434557th and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 6.

(SEQ ID NO: 6)
TGCTTCATCTTTAGCAGGTGACTCCACCCTCTAACCCTTCTGGGGAGGAAGTTTCATGCTTGGAGGGTTTTTCCCCATTCCCAGGATCCTAATTCTATTAGAAGAAAGTCTGAGATTTGG
"A / G"
AGTAGCAGAGACAGAGGGGAAAGACTTATGATTAAATGTCCTCATTTGGGCGGAAATGAGTTTTTGAGTGAACAGATGGAAAACTACTCTCTTCTCCTGTCAGTGGGGCGGGTGAGTCCC

  In the sequence of SEQ ID NO: 6, the base surrounded by "" (the 121st base of SEQ ID NO: 6) corresponds to the 135434557th base of the genomic DNA sequence NC_000005.8. “A / G” means that the base at the position is A or G.

  The bases 135424917 and 135434557 in the genomic DNA sequence NC_000005.8 are present in the TGFBI gene. The TGFBI gene is a gene known to be located at locus 5q31 on the human chromosome.

  In combination d, the 35145821st, 35155484th and 35207894th bases in the genomic DNA sequence registered in GenBank as accession number “NC — 000011.8” are identified.

  Regarding the 35145821 base of the genomic DNA sequence NC_000011.8, the 35145821 base and the base sequence of 240 bp before and after it are shown in SEQ ID NO: 7 below.

(SEQ ID NO: 7)
ATAAACACTGTAAAAATAAAAAATTTGGAGAGCTTACCAGTGCTTCTGGCTGCCCAAGTGGTTTGTGTGTGGTTGACTCCCAGGAGCTCAATCACTTTGGGTGCAGTCCACCCAGAGAGC
"C / T"
ATGTTCCAGCTACATCAACCTGGAGCCTTAGCTTGGTCAGTCTAGATTTTTGGGTTTGGCTGCAGACATCTCGTAATGTCACAAGGACAGCCTGTGTCCTTGGTGACCCAACCCTGGGCC

  In the sequence of SEQ ID NO: 7, the base surrounded by “” (the 121st base of SEQ ID NO: 7) corresponds to the 35145821 base of the genomic DNA sequence NC_000011.8. “C / T” means that the base at the position is C or T.

  Regarding the 35155484th base of the genomic DNA sequence NC — 000011.8, the base sequence of the 35155484th base and the 240 bp base sequence thereof are shown in SEQ ID NO: 8 below.

(SEQ ID NO: 8)
GAAAGTTATTAAGCTATATTATATTAAGATATATTATTTTTGGGAGCCCTGAGAGGGCTCCTACCAGTTATTCTAGAGCTGCATAGAGCCTTCCTCAAACTATGGCTCCAAGCAAGATAA
"A / T"
CACAACAAGCAAGGACTTTATTTTTTGAATTTCCAATGGCCTTGCGGTAAGCGGTGCACAAGAAGAGCAAGCCACGGTGGCAATCACAGTGAATTGTTGTGGTTCGATTTGTTTTCACTA

  In the sequence of SEQ ID NO: 8, the base surrounded by “” (the 121st base of SEQ ID NO: 8) corresponds to the 35155484th base of the genomic DNA sequence NC_000011.8. “A / T” means that the base at the position is A or T.

  Regarding the 35207894th base of the genomic DNA sequence NC_000011.8, the 35207894th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 9 below.

(SEQ ID NO: 9)
TGATCGCCAACCTTTCCCCCACCAGCTAAGGACATTTCCCAGGGTTAATAGGGCCTGGTCCCTGGGAGGAAATTTGAATGGGTCCATTTTGCCCTTCCATAGCCTAATCCCTGGGCATTG
"C / T"
TTTCCACTGAGGTTGGGGGTTGGGGTGTACTAGTTACACATCTTCAACAGACCCCCTCTAGAAATTTTTCAGATGCTTCTGGGAGACACCCAAAGGGTGAAGCTATTTATCTGTAGTAAA

  In the sequence of SEQ ID NO: 9, the base surrounded by “” (the 121st base of SEQ ID NO: 9) corresponds to the 35207894th base of the genomic DNA sequence NC_000011.8. “C / T” means that the base at the position is C or T.

  In the genomic DNA sequence NC_000011.8, the 35145821 base, the 35155484 base, and the 35207894 base are present in the CD44 gene. The CD44 gene is a gene known to be located at locus 11p13 on the human chromosome.

  In the combination e, the 46521446th, 46526339th, 46552136th and 46556349th bases in the genomic DNA sequence registered in GenBank as the accession number “NC_000019.8” are identified.

  Regarding the 46521446th base of the genomic DNA sequence NC_000019.8, the 46521446th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 10 below.

(SEQ ID NO: 10)
CTTGAGTGTAGAGGGAGGGGGGACTCTACCCTTCTCAGCCCCACCAGCCCCCCTCTGCCCAACCACAATTTTCCCTTCCTCCGCCTTCCTCTCCCTCTCCTGTTTACACTCCCCAAATGC
"A / G"
CACAGGCTGTTATCATGGGTCCTGAGTCATCCCACACACAGCCTGCCCCAGCGTCCCTGCCCCCAGCTGGCCGCAGGGCCCGCCCCATGGAGCCCCCTGCCGCCCTGGGCTAATGGGAGC

  In the sequence of SEQ ID NO: 10, the base surrounded by “” (the 121st base of SEQ ID NO: 10) corresponds to the 46521446th base of the genomic DNA sequence NC_000019.8. “A / G” means that the base at the position is A or G.

  Regarding the 46526339th base of the genomic DNA sequence NC_000019.8, the 46526339th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 11 below.

(SEQ ID NO: 11)
GGCTCCGAGGCTGGGTGGTGTTTACGTGATGGGCTGACACTTTCTCTATTTGTATCTGTGTATATGTGGGCTGCAGCTGCTGCCAAATGACACAGCCCATGTGTTACGGGCCCTGCAGGA
"A / G"
TCTCTGTGTGTCCACGGCGGCTCTGAGAGGTGAATATTTGTGTAGTGTGGGGCACCGTCCGTGTTTCCCGCCGTGTGAGTGTGTCTGCATGTGTACACGCACCACATCCTCATAGGGCTG

  In the sequence of SEQ ID NO: 11, the base surrounded by “” (the 121st base of SEQ ID NO: 11) corresponds to the 46526339th base of the genomic DNA sequence NC_000019.8. “A / G” means that the base at the position is A or G.

  Regarding the 46552136th base of the genomic DNA sequence NC_000019.8, the base sequence of the 46552136th base and 240 bp before and after it are shown in SEQ ID NO: 12 below.

(SEQ ID NO: 12)
AGGAGGGGGACCCAGAACGGAAGGAGAGTCAGGCTGGGAAACAAGGTAGGAGAAGAGGGTCTGTCAACATGGGGGCCTCCGGAGGGTGTCAGTGGGAGGAGGGGGCAACAGGACACCTGA
"A / G"
GGATGGAAGGGTCAGGAGGCAGACACCTGTAAGAATTGCTCTCCTTTACTGAGCACCTCCCATGTGGCTAAGCAGCCTCCTGTCACTCAACACCCTGCGACCCCATACATTTACTGTCCC

  In the sequence of SEQ ID NO: 12, the base surrounded by “” (the 121st base of SEQ ID NO: 12) corresponds to the 46552136th base of the genomic DNA sequence NC_000019.8. “A / G” means that the base at the position is A or G.

  Regarding the 46556349th base of the genomic DNA sequence NC — 000019.8, the 46556349th base and the base sequence of 240 bp before and after it are shown in SEQ ID NO: 13 below.

(SEQ ID NO: 13)
CTTCCTCTCCCATGATAACCCACTAATCCATTAACCCATTAATCCATGAATGGGTAATGAGCATAGTGAGCACGGGATAAGTCTTCAATATCATTTTATTACGATTCTCACCCCATATTT
"A / T"
CAAGCCTAGTCCAAGGATTAAGATGGGGCCAAGGGTACCCTCCAGGAGCGCATCCTGAAACACACATAACAATTTCGATCCTACTGAGGGGTGATAATGATAGCTAAAATGCACTGAGTG

  In the sequence of SEQ ID NO: 13, the base surrounded by “” (the 121st base of SEQ ID NO: 13) corresponds to the 46556349th base of the genomic DNA sequence NC_000019.8. “A / T” means that the base at the position is A or T.

  The 46521446th base, the 46526339th base, the 46552136th base and the 46556349th base in the genomic DNA sequence NC_000019.8 are present in the TGFB1 gene. The TGFB1 gene is a gene known to be located at locus 19q13.1 on the human chromosome.

  In the combination f, the 115189788th and 115192811th bases in the genomic DNA sequence registered in GenBank as the accession number “NC — 000009.10” are identified.

  Regarding the 115189788th base of the genomic DNA sequence NC — 000009.10, the 115189788th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 14 below.

(SEQ ID NO: 14)
GCTGTATTCCCAGGACCCAGCACTGAACCTAGGAACAGAGCAGAGATTCTCAAAAAGTATCTCCTGAATAAAAAGTGTTTGTGGTGGTGGCACCTCTAGCAGTCAGGAACTCCCTCTTTG
"C / T"
CTCTGAGTTTTGATCCTCAGGCAGTATTTATGCTGGTTAATGAGTAATTCTTCTCTGGGTTTATGGTTCAGAGTAGAATAGGAGACCTCAGGCAGCCTGGCAACCTCTGGCCTCGTGGGA

  In the sequence of SEQ ID NO: 14, the base surrounded by “” (the 121st base of SEQ ID NO: 14) corresponds to the 115189788th base of the genomic DNA sequence NC_000009.10. “C / T” means that the base at the position is C or T.

  Regarding the 115192811th base of the genomic DNA sequence NC_000009.10, the 115192811th base and the base sequence of 240 bp before and after it are shown in SEQ ID NO: 15 below.

(SEQ ID NO: 15)
CACCTGCCTTGGCATACGCCAATGCCACCTCAGCCAGCCGCTGGCGGCTCTCCTCAGCCCGGAATGCTCCGTTTTCACTCAGGAGCCCTTCAGGACAGATGACTGGGTTTTGGGGAGCAC
"C / G"
TTGGGCCCTGGCCTGTCCCCACCCTGTTGAGAAGTGGGCAGTAGGAGTGTGGGTGGCAGCAGGGCTGGTGGGAGGGAGGGAACTCACCGCAGTGACCATGGGAGGTGTAGGGACACAGGC

  In the sequence of SEQ ID NO: 15, the base surrounded by “” (the 121st base of SEQ ID NO: 15) corresponds to the 115192811th base of the genomic DNA sequence NC_000009.10. “C / G” means that the base at the position is C or G.

  The 115189788th base and the 115192811th base in the genomic DNA sequence NC_000009.10 are present in the ALAD gene. The ALAD gene is a gene known to be located at locus 9q33.1 on the human chromosome.

  In combination g, the 216582933-th, 216609934-th, 216635452-th, 216655820-th, 216663084-th and 216671332-th bases in the genomic DNA sequence registered in GenBank as the accession number “NC_000001.9” are identified.

  Regarding the 216582933 base of the genomic DNA sequence NC — 000001.9, the 216582933 base and the 240 bp base sequence around it are shown in SEQ ID NO: 16 below.

(SEQ ID NO: 16)
AGAGACCCCGGCACATAAGACCTCCATTAAATATAGAGATGAAAAGGCATTATAAGAGCCATTTAATAGAAGAAATGATTCATTTACGGTTACCAGGGAGACAGCTCTAGCAATCTTGCC
"G / T"
GTTAGGTCTTCAAAGAACTGATCATTTGAGAGGTGGAAAGGGGCTCCTCCTCTCCTGCTATACTCACTTACTGCACTTACCCATTCCAGAAGCTTTTACCAATACCTCCCGTCTTACCCT

  In the sequence of SEQ ID NO: 16, the base surrounded by “” (the 121st base of SEQ ID NO: 16) corresponds to the 216582933 base of the genomic DNA sequence NC_000001.9. “G / T” means that the base at the position is G or T.

  Regarding the 216609934th base of the genomic DNA sequence NC_000001.9, the base sequence of the 216609934th base and 240 bp before and after that are shown in SEQ ID NO: 17 below.

(SEQ ID NO: 17)
TGAAATGAGGTCATAAGCCAGAGAATTTGTAAAACTATGTCTCTTATCAGTCCAAAAAGAATTTCTGTGGGACTGAAGTTTGCTTTCTAATTCTTAAGCTTTGAACAGGAAGACTTTACAC
"G / T"
GGGATGTTGGTGTTATTTCTTCATCCATCTGTACAAGAAACATGAGTTGAGCCTACTGTGTGCCAGGTGATAGGTGTAAGAAAACTGCATAGATCCTGTCCTCAGGGAGCCTGCACTTAG

  In the sequence of SEQ ID NO: 17, the base surrounded by “” (the 121st base of SEQ ID NO: 17) corresponds to the 216609934 base of the genomic DNA sequence NC_000001.9. “G / T” means that the base at the position is G or T.

  With respect to the 216356452 base of the genomic DNA sequence NC_000001.9, the base sequence of the 216354542 base and 240 bp before and after that are shown in SEQ ID NO: 18 below.

(SEQ ID NO: 18)
CTTATCTCTAGTGGAGGAGGAGCTGCTGCCTTGTTATTTTATTTGTATTTTGTTGCCACCACGCTCCATTGCATGTGTTGGTGTTTCTGCCTGGCGTGGTAGTCATACCTTCAACTCAGG
"A / G"
CTCCTTTGCACAGAAGGCAGGATATTATACTGAAAAGCTTTGGATTCAAAGGCTAGCCTCACTTCGACTTTAGCCCAAAGTTATTTTACTTTCCTCACTCTTGATTTATTTTCTTTTCTT

  In the sequence of SEQ ID NO: 18, the base surrounded by “” (the 121st base of SEQ ID NO: 18) corresponds to the 216356452 base of the genomic DNA sequence NC_000001.9. “A / G” means that the base at the position is A or G.

  Regarding the 216655820th base of the genomic DNA sequence NC_000001.9, the base sequence of the 216655820th base and 240 bp before and after that are shown in SEQ ID NO: 19 below.

(SEQ ID NO: 19)
AGCATATCAGAGTGGGAAAGGAGGAGACCTTTGCAGCCAGTCAGCCCTTTCTCTGAACCTCAGTTTTTCATCTGAAACTGGAGATAACATTTCTTGCCTAATGAGTTCCTGTGAGGAGAA
"C / T"
GCCTAGGTTAAGTGTCTGGCACACAAGATGCGGAAGGAGTAGGTTACTGTCAGGATTTTTCTTGTCATCTTGAACATGGTTCATATTTCCCCTAAGGTTGGCTTGTGATTCTAAAACCAC

  In the sequence of SEQ ID NO: 19, the base surrounded by "" (the 121st base of SEQ ID NO: 19) corresponds to the 216655820th base of the genomic DNA sequence NC_000001.9. “C / T” means that the base at the position is C or T.

  Regarding the 216663084th base of the genomic DNA sequence NC_000001.9, the 216663084th base and the base sequence of 240 bp before and after it are shown in SEQ ID NO: 20 below.

(SEQ ID NO: 20)
CTTTGAATGAGGGTAAAAGGCTCCTCCAAAGCCAATGAAAGCCTTCCAGAGTATGGATGTGGGAGTGATGTGTTGGAGAATCATTTGTTCCTGCTGTAGGTAAGCCAAGAAATGCTCACA
"A / G"
GAGTGTGTTCTCTGTGCCTGTCTGCCTGAGAGAAAATCTTGGTCTTTAATAACACGGTTTTGACCTAGAGAGTCAGATTTCTCCAAAATTAATCAATGAATATGTATTCTACCAGTGTCA

  In the sequence of SEQ ID NO: 20, the base surrounded by “” (the 121st base of SEQ ID NO: 20) corresponds to the 216663084th base of the genomic DNA sequence NC_000001.9. “A / G” means that the base at the position is A or G.

  Regarding the 216671332 base of the genomic DNA sequence NC_000001.9, the 216671332 base and the 240 bp base sequence before and after that are shown in SEQ ID NO: 21 below.

(SEQ ID NO: 21)
AGTGCTCTGTGGTTGAGGAAGCTCTTATCGTAGTTCTCCTAGTAGGATTTAAAAGAGAAAAAGCTTCAGAGTCTCTTTGCTGCTCTTTGGACTCTTTCCAAGTAAGATAATCTAAATGTA
"C / T"
TCCTTTTCTATAAGGTGGAAGATTTATATAGATTTGGCATTATGTGTCTTTTCTGCTTATTTGGTCGATATGGCCATAATTTTTAAAAATTCTGTGTCTTTAGTGAAACTGGACATATAT

  In the sequence of SEQ ID NO: 21, the base surrounded by “” (the 121st base of SEQ ID NO: 21) corresponds to the 216671332 base of the genomic DNA sequence NC_000001.9. “C / T” means that the base at the position is C or T.

  The 216582933 base, 216609934 base, 216635452 base, 216655820 base, 216663084 base, and 216671332 base in the genomic DNA sequence NC_000001.9 are present in the TGFB2 gene. The TGFB2 gene is a gene known to be located at locus 1q41 on the human chromosome.

  In the combination h, the bases 7402241 and 736993 in the genomic DNA sequence registered in GenBank as the accession number “NC — 000017.9” are identified.

  Regarding the 7402241th base of the genomic DNA sequence NC_000017.9, the 7402241st base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 22 below.

(SEQ ID NO: 22)
CCTGTTGTCCCCACCCCAGGTGCACTTTGATGAGGGGAAGGCTGTCTACCTGAAGCTGGACTTGCTGGTGGATGGTGTGCTGGCCCTGCGCTGCCTGGAGGAATTCTCAGCCACTGCGGC
"C / G"
AGTTCCCTCGGGCCCCAGCTCCGCCTCTGCCAGGTGTCTGGTCTGTTGGCCCTGCGGCCAGGGTCCTCCCTGCGGATCCGCACCCTCCCCTGGGCCCATCTCAAGGCTGCCCCCTTCCTC

  In the sequence of SEQ ID NO: 22, the base surrounded by “” (the 121st base of SEQ ID NO: 22) corresponds to the 7401241 base of the genomic DNA sequence NC — 000017.9. “C / G” means that the base at the position is C or G.

  The 774093rd base of the genomic DNA sequence NC_000017.9 and the 240bp base sequence before and after that are shown in SEQ ID NO: 23 below.

(SEQ ID NO: 23)
TGAGGCATCTCGGGGGCAGGGGAGGGCTGGGAAGGCAGGCTGGCTGGGACCCTCGCATCTTAACCTAACCTTGACCCTCTTTCCATGAGCAGAGTTCCGATGCCCTGGAAGCCTGGGAGA
"A / G"
TGGGGAGAGATCCCGGAAAAGGAGAGCAGTGCTCACCCAAAAACAGAAGAGTGAGGCTTCCAGGGTGCAGCAGGGGTGGGAGGTGATCAAGCAGCGTGGGGATTGTAAGCCCGAGTCAGG

  In the sequence of SEQ ID NO: 23, the base surrounded by “” (the 121st base of SEQ ID NO: 23) corresponds to the 7403693 base of the genomic DNA sequence NC_000017.9. “A / G” means that the base at the position is A or G.

  In the genomic DNA sequence NC_000017.9, the 7402241th base and the 7436933rd base are present in the TNFSF13 gene. The TNFSF13 gene is a gene known to be located at locus 17p13.1 on the human chromosome.

  In combination i, bases 55573981 and 55613084 in the genomic DNA sequence registered in GenBank as the accession number “NC — 000019.8” are identified.

  Regarding the 55573981 base of the genomic DNA sequence NC_000019.8, the 55573981 base and the base sequence of 240 bp before and after the 55573981 base are shown in SEQ ID NO: 24 below.

(SEQ ID NO: 24)
TCACGGTACTGCCCCCTCCACAACCTTGAGTGTGACGGTCCCAATGGGGTAGAGCCAGCTGGGCCATCACCCAGGGTGTGGGAGAATGAGGCTCCAGAGGGCAGGGGCTTTGGGAAGAGG
"A / G"
TCCCCCAGGGTGCAGGCTTGGCCTCAAGGTGGCCACCCAGACTTAGGCTCACAAAGACCTGGGAGTGACCCTGGTCTCCTGTGTCCCAGCCCTGGCCCCTGGGCGCAGACCCCCAGTCCC

  In the sequence of SEQ ID NO: 24, the base surrounded by “” (the 121st base of SEQ ID NO: 24) corresponds to the 55573981 base of the genomic DNA sequence NC_000019.8. “A / G” means that the base at the position is A or G.

  Regarding the 55613084th base of the genomic DNA sequence NC — 000019.8, the 55613084th base and the base sequence of 240 bp before and after it are shown in SEQ ID NO: 25 below.

(SEQ ID NO: 25)
ACCAGGAGCAGCTCCTGCGGCGCTTCGGACCCCCTGGACCTGAGGCCTGGTGACCTTGCAAGCATCCCATGGGGCGGGGGCGGGACCAGGGAGAATTAATAAAGTTCTGGACTTTTGCTA
"C / T"
ATGGTGCTTTGTGGTCTCTGGGGGACACTGTCTGGTTTCATAAGCCCTGGCCTTGGCTGGGACCCTCCTGAGGCCCGCACCGCCCCTCATCCTCAGCAAAAGCCCCCGGACTCCCACCTG

  In the sequence of SEQ ID NO: 25, the base surrounded by “” (the 121st base of SEQ ID NO: 25) corresponds to the 55613084th base of the genomic DNA sequence NC_000019.8. “C / T” means that the base at the position is C or T.

  The 55573981 base and 55613084 base in the genomic DNA sequence NC_000019.8 are present in the POLD1 gene. The POLD1 gene is a gene known to be located at locus 19q13.3 on the human chromosome.

  In the combination j, the 1559779450th, 159781045th and 159784323th bases in the genomic DNA sequence registered in GenBank as the accession number “NC_000005.8” are identified.

  With respect to the 1559779450th base of the genomic DNA sequence NC_000005.8, the base sequence of the 1559779450th base and 240 bp before and after that is shown in SEQ ID NO: 26 below.

(SEQ ID NO: 26)
GTAGAATTTCTTGTGATTTTTTTTTTTCTTTGTGCTTTCTATTCTGGTTGTTCTCCCCCTCCCCCCCATAACGTGTATCCTTTTTGAATGTAAAAGTAAAAGTAGCTACCATTCCTGCCT
"C / T"
AATAAAATAGCCCAACATAATAGAATCTATTTTTTTCGTATTAAGAATTTGCAATACCTGGAGTTTAGGAACATAAATATTAATTTTGCTTTTACAGGGCAGTAGATGAAGAAACAGTGT

  In the sequence of SEQ ID NO: 26, the base surrounded by “” (the 121st base of SEQ ID NO: 26) corresponds to the 1559779450th base of the genomic DNA sequence NC_000005.8. “C / T” means that the base at the position is C or T.

  Regarding the 159781045th base of the genomic DNA sequence NC_000005.8, the 159781045th base and the base sequence of 240 bp before and after it are shown in SEQ ID NO: 27 below.

(SEQ ID NO: 27)
GTCCTAAGATTAGGGAACGATCAGTTCGTTCTTAATCATAAGCATAAGAGAATGACTCAAACGCTGCTGTTTGATCTACCTGTACTTACATTTCTTCTTAATTTTAAATTCTTCTCTGCT
"A / C"
GTATTCTTTAGACCCAACATTGGTTGTTTCCCCTATTTCTTCAATATTTCTATTTATTTTCCATCCTTTTTACAGGGTCATCTAAATAAAAATATCTTAAAGCAATAAACCATTGTTATT

  In the sequence of SEQ ID NO: 27, the base surrounded by “” (the 121st base of SEQ ID NO: 27) corresponds to the 159781045th base of the genomic DNA sequence NC_000005.8. “A / C” means that the base at the position is A or C.

  Regarding the 159784323-th base of the genomic DNA sequence NC_000005.8, the 159784323-th base and the base sequence of 240 bp before and after that are shown in SEQ ID NO: 28 below.

(SEQ ID NO: 28)
TGGACAGTCTTTCTCACAAGGCTTTTAGAAGTGAGCTTTATGTCAAGTTGAGCAATGCCTGAGAGTAATTTGGTAGGATTATTTCTTTGGTTTGAAAAATCTACATAAGACAGTGAAGAC
"A / G"
TGTTTTTCAAATTTCTTCAACCTGCTACATGTATCTGAAGTATTTTCTGTTTTGGAAACAGCTTTTCAAGCTTTAATTTACTCAACCATTTCAGGAGAAGCTACTGTGTGTCAGGCATCC

  In the sequence of SEQ ID NO: 28, the base surrounded by “” (the 121st base of SEQ ID NO: 28) corresponds to the 159784323 base of the genomic DNA sequence NC_000005.8. “A / G” means that the base at the position is A or G.

  The 159779450th base, the 159781045th base and the 159784323th base in the genomic DNA sequence NC_000005.8 are present in the PTTG1 gene. The PTTG1 gene is a gene known to be located at locus 5q35.1 on the human chromosome.

  In Table 1, for example, for the combination a, the types of bases present at the 7239965th position and 7249542th position of the genomic DNA sequence NC_000007.12 are identified.

  In the present invention, if one of the combinations a to j is identified, the onset can be predicted. However, it is preferable to identify one or more combinations in terms of further improving the prediction accuracy.

  Among these combinations, the combination a (C1GALT1 gene), the combination b (TGFBR2 gene), the combination c (TGFBI gene), and the combination d (CD44 gene) are preferable, and the combination a (C1GALT1 gene) is preferable. Gene) is particularly preferred.

  As a method for identifying a base, a method generally used in the technical field can be used without particular limitation as long as it can accurately identify the type of base at a specific site in a genomic DNA sequence. it can. Specific examples include a technique based on primer extension, a technique based on hybridization, a technique based on DNA cleavage, a technique based on ligation, and the like.

As a technique based on primer extension, for example, a single-base primer extension method (Syvanen, AC et al., Genomics, 8, 684-692 (1990)) or a MALDI-TOF / MS method (Ross, P) using the same. Nat Biotechnol, 16, 1347-1351 (1998); Buetow, KH et al., Proc Natl Acad Sci USA, 98, 581-584 (2001); SNP gene polymorphism strategy, Kenichi Matsubara Yoshiyuki, Nakayama Shoten, pages 106-117), allele-specific primer extension method (Uggozzoli, L. et al., Genet Anal Tech Appl, 9, 107-112 (1992)), APEX method (in the arrayed primer) extension, Shumaker, JM et al., Hum Mutat, 7, 346-354 (1996)). Among these, the MALDI-TOF / MS method is preferable because it can easily process a large amount of samples simultaneously.
A specific example of the technique based on primer extension is the MassARRAY system (Sequenom).

  As a method based on hybridization, for example, TaqMan PCR method (Livak, KJ et al., PCR Methods Appl., 4, 357-362 (1995); SNP gene polymorphism strategy, Kenichi Matsubara, Yoshiyuki Tsuji, Nakayama Shoten 94-105) and allele specific oligonucleotide (ASO) hybridization method (Baner, J. et al., Nucleic Acids Res, 26, 5073-5078 (1998)).

  As a technique based on DNA cleavage, for example, the Invader method (Lyamichev, V. et al., Nat Biotechnol, 17,292-296 (1999); SNP gene polymorphism strategy, Kenichi Matsubara, Yoshiyuki Tsuji, Nakayama Shoten, 94- 105).

  As a method based on ligation, for example, RCA (rolling circle amplification) method (Lizardi, PM et al., Nat Genet, 19, 225-232 (1998); Magnus J., TECHNOLOGY DEVELOPMENT FOR GENOME AND POLYMORPHISM ANALYSIS, 23- 24 (2003), Karolinska University Press, Stockholm, Sweden; SNP gene polymorphism strategy, Kenichi Matsubara, Yoshiyuki Tsuji, Nakayama Shoten, pp. 118-127).

  In addition, PCR-SSCP (single-strand conformation polymorphism) method (Genomics, 12, 139-146 (1992); Oncogene, 6, 1313-1318 (1991); PCR Methods Appl, 4 275-282 (1995)), a method using restriction fragment length polymorphism (RFLP), a PCR-RFLP method, and the like.

Step (3)
In this step, the risk of developing late side effects due to radiation therapy for breast cancer patients is predicted based on the base information obtained in step (2).
Radiotherapy is generally postoperative radiotherapy performed on breast tissue after surgery, but preoperative radiotherapy and radiotherapy for the purpose of alleviating disease states may also be the subject of the present invention. it can.
Examples of the types of radiation include X-rays, γ-rays, heavy particle beams, β-rays, α-rays, and neutron beams. X-ray, γ-ray and heavy particle beam are preferred.
The dose is appropriately determined according to the patient's condition, but is generally 50 Gy.
Late side effects refer to side effects that develop after 3 months have passed since radiation therapy. Specific symptoms of side effects include skin disorders, leukopenia and general fatigue. The present invention can more accurately predict the onset of skin disorders.
Examples of skin disorders include radioactive dermatitis and hair loss. The present invention can predict the onset of radioactive dermatitis more accurately.
The determination of the onset of late side effects due to radiation therapy in breast cancer patients can be performed according to RTOG / EORTC Radiation Therapy Oncology Group and European Organization for Research and Treatment of Cancer (RTOG / EORTC).

Prediction of the occurrence of side effects is specifically performed by the following steps.
When the combination of bases identified in step (2) is a, b, c, d, e, g, h or j in Table 1, the identified base combinations correspond to the base combinations shown in Table 2 below. It is determined whether or not to do. If applicable, predict high risk of late side effects from radiation therapy for breast cancer.

表中の塩基の表示につき、Ａはアデニン、Ｔはチミン、Ｇはグアニン、Ｃはシトシンを意味する。

In the table, A represents adenine, T represents thymine, G represents guanine, and C represents cytosine.

For example, when step (2) is performed on the combination a, if the base present at the 7239965th position in the genomic DNA sequence NC — 000007.12 is A and the base present at the 7249542th position in the same sequence is T, side effects Predict that the risk of developing is high.
In addition, when the genomic DNA sample identified in the step (2) is the combination d, “the base present at the 35145821th in the genomic DNA sequence NC_000011.8 is T, and the base present at the 35155484th is T; And the base present at the 35207894th is T ", or" the base present at the 35145821th in the genomic DNA sequence NC_000011.8 is C, the base present at the 35155484th is T, and 35207894 If it falls under any of the cases where the second base is C, it is predicted that the risk of developing side effects is high.

  Here, “the risk of late-onset side effects is high” means that the subject from which the genomic DNA sample is derived is a combination of base types that have the highest risk of late-stage side effects in breast cancer patients (see the table below). 4 to the combination of the uppermost bases in Table 13), which is statistically higher than the patient having the combination.

  When the base combination identified in the step (2) is f, g or i in Table 1, it is determined whether or not the identified base combination corresponds to the base combination shown in Table 3 below. If applicable, it is predicted that the risk of developing late side effects due to radiation therapy for breast cancer is low (it can also be understood that “it is difficult to develop side effects” or “resistant to the development of side effects”).

表中の塩基の表示は表２と同じ。

The base display in the table is the same as in Table 2.

  Here, “the risk of developing late side effects is low” means that the subject from which the genomic DNA sample is derived is a combination of base species that are most likely to develop late side effects in breast cancer patients (see the table below). 4 to the combination of the uppermost bases in Table 13) is a case where it is statistically low as compared with a patient having.

  The prediction results regarding late-stage side effects that were obtained in accordance with the present invention are based on the expected therapeutic effects and the like, so that the final decision on the suitability of radiotherapy in breast cancer patients, and the development of the optimal treatment method for the patient, will be made. Can help.

(Example)
Next, the effects of the present invention will be specifically described by way of examples, but the present invention is not limited to the examples.

In this example, the relationship between the combination of base species at a plurality of specific sites (SNP sites) shown in Table 1 and the onset of late side effects after radiation therapy was statistically evaluated for breast cancer patients. This example was performed using genomic DNA samples collected from 397 radiation-treated human breast cancer patients (women) who obtained informed consent for the evaluation.
First, analysis of medical data was performed, and the incidence of late side effects caused by radiation therapy was classified into 2 groups (onset and not onset) with the presence or absence of radioactive dermatitis occurring within 6 months after 8 months from the start of radiotherapy. did. Radioactive dermatitis was judged based on RTOG / EORTC delayed radiation response system.
For each group of patients, the base types of combinations a to j shown in Table 1 were identified.
The DNA sample was prepared based on a conventional method.
The identification of the base was performed by a method based on mass spectrometry, specifically, MassARRAY system (Sequenom).

The results for each combination are shown in Tables 4 to 13, respectively.

Columns A to F in Tables 4 to 13 show the following contents.
Column A: Shows the base combination of a specific site (SNP site) in the genome sequence that is an index for predicting the occurrence of side effects.
For example, in Table 4, “AC” indicates that the 7239965th base in the genomic DNA sequence NC — 000007.12 is A and the 7249542th base is C. For example, in Table 10, “GGACGT” means that the 216582933 base in the genomic DNA sequence NC_000001.9 is G, the 216609934 base is G, the 216356452 base is A, and the 216655820 base is C, 216663084 base is G, and 216671332 base is T.

Column B: Shows the ratio (%) of each base combination in patients who did not develop side effects. Percentage is the number of chromosomes of the patient who did not develop side effects (the total number of chromosomes is twice the number of patients because humans have two identical chromosomes), and the number of chromosomes that have the relevant base combination. The ratio of numbers.
For example, in Table 4, when the total number of chromosomes of patients who did not develop side effects is 100%, the ratio of chromosomes having the combination “AC” is 73%, and the ratio of chromosomes having the combination “AT” is 20%. , Which means that the proportion of chromosomes having the combination “GC” is 7%.

Column C: Shows the percentage (%) of each base combination in patients who developed side effects. The ratio refers to the ratio of the number of stainings having the relevant base combination to the total number of chromosomes of patients who have developed side effects.
For example, in Table 4, when the total number of chromosomes of patients who have developed side effects is 100%, the ratio of chromosomes having the combination “AC” is 62%, and the ratio of chromosomes having the combination “AT” is 34%. It means that the proportion of chromosomes having “GC” is 4%.

  Column D: Shows the p value by the permutation method. If the p-value is 0.05 or less, they can be evaluated as having a significant difference.

  Column E: represents the odds ratio. The odds ratio indicates the risk of developing a side effect when it has a factor (when it is determined that the risk of developing a side effect is higher than the combination of bases serving as an index), and when there is no factor (is an index) It is a value obtained by dividing by the risk of developing a side effect when it is determined that the risk of developing a side effect is lower than the combination of bases. The odds ratio indicates that the higher the value, the higher the risk of developing side effects. On the other hand, the lower the odds ratio, the lower the risk of developing side effects. In this example, the odds ratios of other combinations are calculated based on the combination of the uppermost base in each table. For example, Table 4 is based on the base combination “A-C”.

  Column F: indicates a 95% confidence interval. In the table, since it is used as a reference for comparison (data of the combination of the top bases for each gene), the base combination ratio is “0” (data of the base combination “TGGCGT” of the gene TGFB2) ), There are some data for which a 95% confidence interval cannot be obtained (indicated by “−” in each table).

From Table 4 to Table 8, Table 10, Table 11 and Table 13, a breast cancer patient having any of the base combinations shown in Table 14 has a base combination whose odds ratio is a reference (the base of the top row in each table). It is understood that the risk of developing side effects after radiation treatment is significantly higher than for patients with other combinations. The reason why the odds ratio is not calculated for the combination “TGGCGT” of the base species of the combination g (Table 10) is because there was no non-onset person having the combination. However, since the p value is 0.05 or less, it is understood that there is a significant difference in the occurrence of side effects due to the combination.

In addition, from Table 9, Table 10, and Table 12, breast cancer patients having any of the base combinations shown in Table 15 are more than the base combinations based on the odds ratio (the top base combinations in each table). It is understood that it is significantly lower and the risk of developing side effects after radiation treatment is lower than patients with other combinations.

  The present invention can predict the onset of late side effects before radiotherapy for breast cancer. Therefore, the present invention can be used to formulate an optimal treatment method for individual breast cancer patients.

Claims (11)

A method for predicting the onset of late side effects from radiation therapy in breast cancer patients,
(1) obtaining a genomic DNA sample from a breast cancer patient;
(2) Identifying one or more of the following base combinations a to j in the obtained genomic DNA sample:

(3) The combination identified in step (2) is:

If any of these are true, predict that the risk of developing side effects is high,
The combinations identified in step (2) are:

If any of the above is true, the method includes a step of predicting that the risk of developing side effects is low. In the combination a,
The 7239965th base in the genomic DNA sequence NC_000007.12 is the 121st base in the base sequence represented by SEQ ID NO: 1, and
The method according to claim 1, wherein the 7247542 base in the genomic DNA sequence NC_000007.12 is the 121 base in the base sequence represented by SEQ ID NO: 2. In the combination b,
The 3061618th base in the genomic DNA sequence NC_000003.10 is the 121st base in the base sequence represented by SEQ ID NO: 3, and
The method according to claim 1, wherein the 30707825th base in the genomic DNA sequence NC_000003.10 is the 121st base in the base sequence represented by SEQ ID NO: 4. In the combination c,
In the genomic DNA sequence NC_000005.8, the 135424917th base is the 121st base in the base sequence represented by SEQ ID NO: 5, and the 135434557th base in the genomic DNA sequence NC_000005.8 is the base represented by SEQ ID NO: 6 The method according to claim 1, which is the 121st base in the sequence. In the combination d,
The base of 35145821 in the genomic DNA sequence NC_000011.8 is the 121st base in the base sequence represented by SEQ ID NO: 7,
The 35155484th base in the genomic DNA sequence NC_000011.8 is the 121st base in the base sequence represented by SEQ ID NO: 8, and the 35207894th base in the genomic DNA sequence NC_000011.8 is the base represented by SEQ ID NO: 9 The method according to claim 1, which is the 121st base in the sequence. In the combination e,
The 46521446th base in the genomic DNA sequence NC_000019.8 is the 121st base in the base sequence represented by SEQ ID NO: 10,
The 46526339th base in the genomic DNA sequence NC_000019.8 is the 121st base in the base sequence represented by SEQ ID NO: 11,
The 46552136th base in the genomic DNA sequence NC_000019.8 is the 121st base in the base sequence represented by SEQ ID NO: 12, and the 46556349th base in the genomic DNA sequence NC_000019.8 is the base represented by SEQ ID NO: 13 The method according to claim 1, which is the 121st base in the sequence. In the combination f,
The 115189788th base in the genomic DNA sequence NC_000009.10 is the 121st base in the base sequence represented by SEQ ID NO: 14, and the 115192811th base in the genomic DNA sequence NC_000009.10 is the base represented by SEQ ID NO: 15 The method according to claim 1, which is the 121st base in the sequence. In the combination g,
The 216582933 base in the genomic DNA sequence NC_000001.9 is the 121 base in the base sequence represented by SEQ ID NO: 16,
The 216609934th base in the genomic DNA sequence NC_000001.9 is the 121st base in the base sequence represented by SEQ ID NO: 17,
The 216354542nd base in the genomic DNA sequence NC_000001.9 is the 121st base in the base sequence represented by SEQ ID NO: 18,
The 216655820th base in the genomic DNA sequence NC_000001.9 is the 121st base in the base sequence represented by SEQ ID NO: 19,
The 216663084 base in the genomic DNA sequence NC_000001.9 is the 121st base in the base sequence represented by SEQ ID NO: 20, and the 216671332 base in the genomic DNA sequence NC_000001.9 is the base represented by SEQ ID NO: 21 The method according to claim 1, which is the 121st base in the sequence. In the combination h,
In the genomic DNA sequence NC_000017.9, the 7401241th base is the 121st base in the base sequence represented by SEQ ID NO: 22, and the 774093rd base in the genomic DNA sequence NC_000017.9 is the base represented by SEQ ID NO: 23 The method according to claim 1, which is the 121st base in the sequence. In the combination i,
The 55573981 base in the genomic DNA sequence NC_000019.8 is the 121st base in the base sequence represented by SEQ ID NO: 24, and the 55613084 base in the genomic DNA sequence NC_000019.8 is the base represented by SEQ ID NO: 25 The method according to claim 1, which is the 121st base in the sequence. In the combination j,
The 1559779450th base in the genomic DNA sequence NC_000005.8 is the 121st base in the base sequence represented by SEQ ID NO: 26;
The 159781045th base in the genomic DNA sequence NC_000005.8 is the 121st base in the base sequence represented by SEQ ID NO: 27, and the 159784323th base in the genomic DNA sequence NC_000005.8 is the base represented by SEQ ID NO: 28. The method according to claim 1, which is the 121st base in the sequence.