JP2009063353A - Diagnostic drug of acute ischemic disease - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for discriminating easily and quickly whether an object is affected by an acute ischemic disease or not. <P>SOLUTION: Blood originated in an object suspected to be affected by an acute ischemic disease is brought into contact with an antibody for recognizing ADAMTS (ADisintegrin And Metalloprotea with Thrombospondin motifs), and a formed complex is detected. Possibility of being affected by an acute ischemic disease, a time until the disease is developed, seriousness of the symptom or the like can be discriminated by the concentration of ADAMTS in blood. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a diagnostic agent for acute ischemic disease. Specifically, the present invention relates to a method for detecting a biomarker in the blood of a subject suspected of having an acute ischemic disease, and an acute ischemic disease diagnostic kit and diagnostic agent used in the method.

  Accurate diagnosis of acute ischemia is extremely important for treating acute ischemic diseases such as myocardial infarction and cerebral infarction, for which there is no effective treatment method only at an early stage. Conventionally, for the diagnosis of myocardial infarction, increased expression of creatine kinase (hereinafter referred to as CK), troponin-T (hereinafter referred to as TnT), and heart-derived fatty acid binding protein (hereinafter referred to as H-FABP) has been used as an index. (See Non-Patent Document 1). These proteins are myocardial contractile proteins and cell membrane proteins, and deviate into the blood as a result of myocardial damage due to acute ischemia (hereinafter collectively referred to as myocardial deviating enzymes).

  As described above, the myocardial deviation enzyme is widely used as a biomarker for myocardial infarction. However, CK and TnT are extremely high in sensitivity and specificity after 6 hours from the onset of myocardial infarction, but have a low positive rate in the diagnosis in the acute phase. On the other hand, although H-FABP shows a positive result at 1.5 hours after onset, there are many false positives such as a positive result in heart failure other than ischemic, and it is difficult to apply for the purpose of determining the cause of the disease early.

  It is known that extracellular matrix (ECM) plays an important role in the healing process after acute myocardial infarction. Myocardial remodeling is performed after myocardial infarction by dramatically changing ECM molecules between accumulation and degradation, and various biological substances such as proteases, their inhibitors, and growth factors are involved in ECM reconstruction. Has been reported. In particular, in this process, it is known that the expression of matrix metalloprotease (MMP) is enhanced and activated.

  The role of angiogenic growth factors in acute myocardial infarction is also attracting attention because the formation and development of collateral blood vessels (angiogenesis) also affects myocardial remodeling after myocardial infarction. Vascular endothelial cell growth factor (VEGF) is a vascular endothelial mitogen and is thought to be involved in angiogenesis. VEGF expression is enhanced within 1 hour after coronary artery ligation.

ADAMTS (A D isintegrin A nd M etalloprotease with T hrombo s pondin motifs) is a recently discovered MMP. ADAMTS is not expressed in normal tissues but is induced by LPS stimulation and recognizes a wide variety of different substrates than MMPs.

  ADAMTS has been reported not only to degrade ECM but also to function as an angiogenesis inhibitor. For example, ADAMTS-1 and 8 have been reported to have an anti-angiogenic action (see Non-Patent Document 2), and ADAMTS-1 suppresses angiogenesis induced by FGF-2 and is induced by VEGF. It has been reported to inhibit angiogenesis. Furthermore, ADAMTS-1 is known to bind to VEGF and inhibit phosphorylation of its receptor VEGFR2 (see Non-Patent Document 2).

Based on these findings, the present inventors hypothesized that ADAMTS is involved in acute myocardial infarction, and in the rat myocardial infarction model, ADAMTS-1 is mainly in the myocardial infarction region and marginal region. It was found that it is highly expressed in vascular endothelial cells and cardiomyocytes (see Non-Patent Documents 3 and 4).
Circ. J. et al. 2006 Apr; 70 (4): 419-25. J. et al. Biol. Chem. 1999 Aug 13; 274 (33): 23349-23357. Connective Tissue, 34, 87 (2002) J. et al. Biochem. 136, 439-446 (2004)

  An object of the present invention is to provide means capable of detecting an acute ischemic disease such as myocardial infarction whose early diagnosis greatly affects the treatment or prognosis of the disease at an early stage of onset.

  The present inventors have intensively studied to solve the above problems, and that ADAMTS, which is a kind of MMP, is secreted into the blood in the early stage of the onset of myocardial infarction patients, and in the blood of patients without acute ischemia. Verified that it is not secreted. As a result, they found that ADAMTS can be a novel biomarker of acute ischemia, and have completed the present invention.

That is, the present invention is as follows.
[1] The following steps:
(1) a step of contacting blood derived from a subject suspected of having an acute ischemic disease and an antibody that recognizes ADAMTS; and (2) a step of detecting the complex formed in the above step (1);
A method for detecting ADAMTS in a subject, comprising:
[2] The method according to [1], wherein the ADAMTS is ADAMTS-1.
[3] The method according to [1] or [2], wherein the antibody is a monoclonal antibody.
[4] The acute ischemic disease is from ischemic heart disease, ischemic brain disease, ischemic lung disease, renal infarction, acute mesenteric artery occlusion, acute arterial occlusion, retinal artery occlusion and retinal vein occlusion The method according to any one of [1] to [3], which is at least one disease selected.
[5] A kit for diagnosing acute ischemic disease, comprising an antibody that recognizes ADAMTS.
[6] The kit according to [5], wherein ADAMTS is ADAMTS-1.
[7] A diagnostic agent for acute ischemic disease comprising an antibody that recognizes ADAMTS as an active ingredient.
[8] The diagnostic agent according to [7], wherein ADAMTS is ADAMTS-1.
[9] The kit or diagnostic agent according to any one of [5] to [8], wherein the antibody is a monoclonal antibody.
[10] Acute ischemic disease is from ischemic heart disease, ischemic brain disease, ischemic lung disease, renal infarction, acute mesenteric artery occlusion, acute arterial occlusion, retinal artery occlusion and retinal vein occlusion The kit or diagnostic agent according to any one of [5] to [9], which is at least one disease selected.

  The detection method of the present invention is a biomarker of acute ischemia that is transiently secreted into the blood only during acute ischemia and is not found to be secreted in other ischemic conditions such as chronic ischemia. Is based. According to the detection method of the present invention, it is possible to determine whether or not the subject suffers from an acute ischemic disease at the beginning of the onset. In addition, this method can be a powerful diagnostic tool that makes it possible to define a treatment policy in the acute phase without showing false positives, unlike the detection methods using myocardial deviation enzymes that have been widely used so far.

  According to the detection method of the present invention, since the detection target is ADAMTS, ADAMTS secreted in blood accompanying acute ischemia in various tissues including the heart can be detected easily and rapidly. Therefore, by using this detection result, not only myocardial infarction but also urgent diseases such as cerebral infarction and pulmonary infarction can be determined at the acute stage.

  By using the detection method of the present invention, the blood concentration of ADAMTS can be measured. Then, by combining with other ischemic disease markers, it is possible to predict the time since the onset of acute ischemic disease, the severity of the disease, and the like.

  Furthermore, the diagnostic kit and diagnostic agent of the present invention can be a tool suitable for the above-described detection method of the present invention, and can easily, rapidly and accurately diagnose whether or not the patient is suffering from an acute ischemic disease. .

Hereinafter, the present invention will be described in detail.
1. Method for detecting ADAMTS The method for detecting ADAMTS of the present invention comprises the following steps:
(1) a step of contacting blood derived from a subject suspected of having an acute ischemic disease and an antibody that recognizes ADAMTS; and (2) a step of detecting the complex formed in the above step (1);
It is characterized by including.

Process (1)
Step (1) is a step in which blood from a subject suspected of having an acute ischemic disease is brought into contact with an antibody that recognizes ADAMTS to form a complex.

In the present specification, the “acute ischemic disease” refers to a disease that occurs when blood supply to a tissue is suddenly interrupted due to occlusion, sclerosis, convulsions, blood circulation disorder, or the like, resulting in hypoxia. .
Specific examples of the “acute ischemic disease” include ischemic heart disease (unstable angina, myocardial infarction, acute coronary syndrome, etc.), ischemic brain disease (cerebral infarction, TIA, etc.), ischemic lung disease (Such as pulmonary infarction), renal infarction, acute mesenteric artery occlusion, acute arterial occlusion, retinal artery occlusion, retinal vein occlusion, ischemic bowel disease (such as ischemic colitis) and the like.

  The subject in the step (1) means a subject to be determined whether or not it suffers from an acute ischemic disease, specifically an animal. The animal is not particularly limited as long as it has the possibility of suffering from an acute ischemic disease, and includes all animals having blood vessels. Among them, laboratory animals such as mice, rats, guinea pigs and rabbits, Pets such as dogs and cats, domestic animals such as cows, pigs and chickens, and humans are preferred, and humans are particularly preferred.

“ADAMTS” in the present invention refers to a secretory ADAM that is an enzyme having both snake venom metalloprotease and disintegrin domains (ADAM) and further has a thrombospondin domain. Nineteen types of ADAMTS have been identified in previous studies.
The ADAMTS in the present invention is not particularly limited, and both known ADAMTS and ADAMTS to be discovered in the future are targeted. Among them, ADAMTS-1 and ADAMTS-9 are preferable, and ADAMTS-1 is more preferable.

  ADAMTS, in particular ADAMTS-1, is secreted into the blood in a short time after onset by vascular endothelial cells during acute ischemia, so that it is possible to quickly determine whether or not the subject is suffering from acute ischemic disease. Suitable as a biomarker. Therefore, in the method for detecting ADAMTS of the present invention, “blood” derived from a subject suspected of having an acute ischemic disease is used as a detection sample.

  As the “blood derived from a subject suspected of having an acute ischemic disease” used in the step (1), blood derived from any tissue can be assumed. Examples of such tissues include brain, heart (circulatory organ), lung (respiratory organ), intestine (digestive organ), liver, kidney, spleen, and the like. As long as there is, there is no particular limitation.

Blood is preferably collected from blood vessels derived from tissues in or near the above tissues, but is present in the subject as long as normal blood circulation is achieved in tissues other than those that have suffered acute ischemia. Blood may be collected from any blood vessel. As a blood collection method, a method known per se can be applied.
The collected blood may be used in this step as it is, but it is used as a liquid component (plasma) from which cell components (red blood cells, white blood cells, platelets, etc.) have been separated using methods known per se, such as centrifugation and filtration. It is preferable to use in the process. It is also preferable to use in this step as a liquid component (serum) obtained by coagulating blood to separate platelets and coagulation factors. In the present specification, “blood” is a concept including plasma, serum and the like obtained by the above operation.

  The subject-derived blood thus obtained is brought into contact with an antibody that recognizes ADAMTS to form a complex.

In the present specification, the “antibody recognizing ADAMTS” only needs to have an ability to bind to ADAMTS, and may be either a polyclonal antibody or a monoclonal antibody, but a monoclonal antibody is preferable. Such antibodies also include fragments of antibody molecules such as F (ab ′) ₂ , Fab ′, or Fab fractions. As these antibodies, antibodies prepared by a method known per se using ADAMTS, preferably ADAMTS-1, as an immunogen can be used, and commercially available antibodies can also be used. When recombinant ADAMTS-1 is used as an antigen, recombinant ADAMTS-1 can be prepared, for example, by the following method.

  A gene encoding ADAMTS-1 (GeneBank number: NM_006988) is incorporated into an appropriate vector, inserted into an appropriate host for transformation, and the desired recombinant ADAMTS-1 is transformed from the culture supernatant of this transformation. Obtainable. The host cell is not particularly limited, and various host cells conventionally used in genetic engineering techniques such as Escherichia coli, Bacillus subtilis, yeast, plant or animal cells can be used.

Moreover, these antibodies may be directly or indirectly labeled with a labeling substance. Examples of labeling substances include fluorescent substances (eg, FITC, rhodamine), radioactive substances (eg, ¹⁴ C, ³ H), enzymes (eg, alkaline phosphatase, peroxidase), and colored particles (eg, metal colloid particles, colored latex). Can be mentioned.

  If it is such an antibody, only 1 type of antibody may be used in this process, and 2 or more types may be used.

The “antibody recognizing ADAMTS” can be used in a soluble state in which nothing else is bound, but it is preferably bound to a solid phase. Such “solid phases” include plates (eg, microwell plates), tubes, beads (eg, plastic beads, magnetic beads), chromatographic carriers (eg, Sepharose ™), membranes (eg, nitrocellulose membrane) , PVDF film), gel (eg, polyacrylamide gel), metal film (eg, gold film) and the like. Of these, plates, beads, membranes, and metal films are preferably used, and plates are most preferably used because of easy handling. Examples of the bond include covalent bond, ionic bond, physical adsorption, and the like, and are not particularly limited. However, covalent bond and / or physical adsorption are preferable because sufficient bond strength can be obtained. The solid phase may be directly bonded to the solid phase or indirectly bonded to the solid phase using a substance known per se. For example, when an antibody is bound to a gold film, a self-assembled monolayer is formed on the gold surface using a specific bond between a thiol group of 4,4′-dithiodibutyric acid (DDA) and gold, An antibody can be bound to a gold film by binding an active ester group formed by adding water-soluble carbodiimide and N-hydroxysuccinimide to the carboxyl group of the immobilized DDA end to the amino group of the antibody. it can.
Furthermore, in order to suppress non-specific adsorption and non-specific reaction, a phosphate buffer solution such as bovine serum albumin (BSA) or bovine milk protein is brought into contact with the solid phase, and the solid phase surface portion not coated with the antibody is removed. Blocking with the BSA or bovine milk protein is generally performed.

  In this step, the “antibody recognizing ADAMTS” and the “ADAMTS” contained in blood derived from a subject suspected of having an acute ischemic disease are obtained by contacting the blood and an antibody recognizing ADAMTS in a reaction container. As long as these can interact by mixing, the embodiment, order, specific method and the like are not particularly limited. The contact is made, for example, by adding the blood to a plate on which “an antibody recognizing ADAMTS” is immobilized.

  The time for maintaining such contact may be a time sufficient for the antibody that recognizes ADAMTS to bind to ADAMTS contained in blood derived from a subject suspected of acute ischemic disease to form a complex. Although it is not particularly limited, it is usually several seconds to several tens of hours, and preferably from 1 minute to 2 hours, and most preferably from 2 minutes to 30 from the viewpoint of promptly determining whether or not it is an acute ischemic disease. Minutes. Moreover, as temperature conditions which perform a contact, it is 4 to 50 degreeC normally, 4 to 37 degreeC is preferable and the room temperature of about 15 to 30 degreeC is the most preferable. Furthermore, the pH condition for carrying out the reaction is preferably 5.0 to 9.0, particularly preferably the neutral range of 6.0 to 8.0.

Step (2)
Step (2) is a step of determining whether ADAMTS is present in the blood by detecting the complex formed in step (1).

The above detection is performed by detecting “ADAMTS” or “an antibody recognizing ADAMTS” contained in the complex.
For this detection, enzyme immunoassay (EIA method), immunochromatography, latex agglutination, radioimmunoassay (RIA), fluorescence immunoassay (FIA), luminescence immunoassay, surface plasmon resonance assay ( SPR method) can be used. Among these, the EIA method, the immunochromatography method, the FIA method, and the SPR method are preferable from the viewpoint of ease of operation and rapidity.

  When the EIA method is selected as the detection method in step (2), the EIA method is a sandwich enzyme-linked immunosorbent solid phase assay (sandwich ELISA method) using two types of “antibodies that recognize ADAMTS”. preferable. Such a sandwich ELISA method is excellent in specificity to an antigen because it uses two types of antibodies.

  The two types of “antibodies that recognize ADAMTS” for performing the sandwich ELISA method may be any combination of monoclonal antibodies, a combination of polyclonal antibodies, or a combination of a monoclonal antibody and a polyclonal antibody.

A method using an avidin-biotin reaction is applicable as a kind of sandwich ELISA method. In this method, for example, ADAMTS in plasma or serum is captured by any solid-phased “antibody recognizing ADAMTS”, and between the captured ADAMTS and “antibody recognizing ADAMTS” labeled with biotin. To carry out an antigen-antibody reaction. The time required for the reaction is preferably 1 minute to 2 hours, more preferably 2 minutes to 30 minutes, from the viewpoint that rapid measurement is required. Next, enzyme-labeled streptavidin is added to cause the avidin-biotin reaction. The time required for such a reaction is preferably 5 minutes to 1 hour, more preferably 15 minutes to 30 minutes, from the viewpoint that rapid measurement is required. Subsequently, ADAMTS is detected by detecting this enzyme.
The above-described biotin label “an antibody recognizing ADAMTS” can be produced by binding biotin and “an antibody recognizing ADAMTS” by a method known per se. For example, biotin and “an antibody recognizing ADAMTS” can be bound using a commercially available biotin labeling kit. A commercially available enzyme-labeled streptavidin can be preferably used.

A sandwich ELISA method using an enzyme-labeled antibody can also be applied. In this method, for example, ADAMTS in blood is captured with any solid-phased “antibody recognizing ADAMTS”, and an antigen antibody between the captured ADAMTS and an enzyme-labeled “antibody recognizing ADAMTS” Let the reaction take place. The time required for the reaction is preferably 1 minute to 2 hours, more preferably 2 minutes to 30 minutes, from the viewpoint that rapid measurement is required. Subsequently, ADAMTS is detected by detecting this enzyme.
The enzyme-labeled antibody can be produced by binding (labeling) an enzyme and “an antibody recognizing ADAMTS” by a method known per se, for example, the glutaraldehyde method, the maleimide method, or the like.

  Furthermore, a sandwich ELISA method using a secondary antibody is also applicable from the viewpoint of versatility. In this method, for example, ADAMTS in blood is captured with any solid-phased “antibody that recognizes ADAMTS”, and the captured ADAMTS and “ADAMTS derived from an animal species different from the solid-phased antibody” are obtained. An antigen-antibody reaction is carried out with “the antibody to be recognized” (described as the primary antibody in this paragraph). The time required for the reaction is preferably 1 minute to 2 hours, more preferably 2 minutes to 30 minutes, from the viewpoint that rapid measurement is required. For example, if the solid-phased “antibody recognizing ADAMTS” is derived from a rabbit, the primary antibody is reacted with an antibody derived from an animal species other than a rabbit, for example, a mouse. Subsequently, an antigen-antibody reaction is performed between the primary antibody and the enzyme-labeled “antibody recognizing the Ig domain of the primary antibody” (described as a secondary antibody in this paragraph). The time required for the reaction is preferably 1 minute to 2 hours, more preferably 2 minutes to 30 minutes, from the viewpoint that rapid measurement is required. Finally, ADAMTS is detected by detecting this enzyme. A commercially available enzyme-labeled secondary antibody can be preferably used.

  Examples of the “enzyme” in enzyme-labeled streptavidin and enzyme-labeled antibody include peroxidase, alkaline phosphatase, glucose oxidase, β-galactosidase and the like.

  As the substrate agent used for the detection of the enzyme, an appropriate one is selected according to the selected labeling enzyme. For example, when peroxidase is selected as an enzyme, o-phenylenediamine (OPD), tetramethylbenzidine (TMB) or the like is used, and when alkaline phosphatase is selected, p-nitrophenyl phosphate (PNPP) or the like is used. used. As the reaction stop solution and substrate solution, conventionally known ones can be appropriately used without particular limitation depending on the selected enzyme.

  Even when the sandwich ELISA method is not used, detection can be performed by applying a normal ELISA method. For example, in step (1), ADAMTS in blood derived from a subject is bound to a solid phase in the same manner as described above, and then an antigen-antibody reaction is performed with the labeled “antibody recognizing ADAMTS” to form a complex. Let it form. The time required for the reaction is preferably 1 minute to 2 hours, more preferably 2 minutes to 30 minutes, from the viewpoint that rapid measurement is required. ADAMTS can then be detected using a technique that depends on the label.

  When immunochromatography is selected as the detection method in step (2), blood is developed from the lower part of the membrane against “ADAMTS-recognizing antibody” solid-phased on a water-absorbing substrate such as a nitrocellulose membrane. Thus, ADAMTS is captured, and an antigen-antibody reaction is performed between the captured ADAMTS and the labeled “antibody recognizing ADAMTS”. The time required for the reaction is preferably 1 minute to 2 hours, more preferably 2 minutes to 30 minutes, from the viewpoint that rapid measurement is required. ADAMTS can be detected using a technique according to the label.

  The two types of “antibodies that recognize ADAMTS” for performing immunochromatography may be any combination of monoclonal antibodies, a combination of polyclonal antibodies, or a combination of a monoclonal antibody and a polyclonal antibody.

When the FIA method is selected as the detection method in the step (2), a sandwich ELISA similar to the above method using an antibody in which the enzyme bound to the “antibody recognizing ADAMTS” used in the EIA method is replaced with a fluorescent substance I do. Next, ADAMTS is detected by detecting the fluorescent substance using a commercially available measuring instrument, a fluorescence microscope, a confocal microscope, or the like.
As the fluorescent substance, chemical substances such as APC, PE, Cy2, Cy3, Cy5, ECD, FITC, PerCP, Alexa (registered trademark) Fluor, fluorescein, and rhodamine can be preferably used. The chemical substance can be labeled on the antibody by a method known per se.

  When the SPR method is selected as the detection method in the step (2), the antibody on the surface of the metal film (sensor chip) on which the antibody that recognizes ADAMTS is solid-phased in advance, and ADAMTS in the blood that flows on the surface of the metal film Is detected as a time-dependent change of surface plasmon resonance. When performing the SPR method, the “antibody recognizing ADAMTS” to be immobilized on a metal film to be a sensor chip may be one kind, and may be a monoclonal antibody or a polyclonal antibody. Moreover, as a measuring instrument used for the detection of SPR, a commercially available measuring instrument can be preferably used.

  As one specific example, when the EIA method is applied, blood collected from a patient suspected of having an acute ischemic disease is shaken at room temperature for a certain time, and then centrifuged to obtain plasma. Next, this plasma is dispensed onto a microplate on which any “antibody recognizing ADAMTS” is immobilized, and left at room temperature for a certain period of time. The plate is washed to remove unreacted antigen, and then the biotinylated antibody solution is dispensed onto the plate and allowed to stand for a certain time to form a complex. Further, the plate is washed to remove unreacted antibodies, and then a peroxidase-labeled streptavidin solution is dispensed onto the plate and reacted at room temperature for a predetermined time. After washing the plate, the complex is detected by reacting with a chromogenic substrate solution such as TMB. That is, when color development is recognized after reaction with the TMB solution, it can be determined that ADAMTS is present in the blood, and a patient having the blood can be determined to be suffering from acute ischemic disease.

As another specific example, when immunochromatography is applied, the plasma or plasma diluted with physiological saline or the like is immersed in a test piece and developed. The test piece is formed by laminating a granular label holding carrier and a carrier for absorbing a liquid sample made of filter paper on one end of a strip-shaped antibody-immobilized support through one end. A water-absorbing carrier made of filter paper is laminated on one upper end side through one end. The above-mentioned antibody-immobilized support is one in which an “antibody recognizing ADAMTS” that undergoes an antigen-antibody reaction with ADAMTS is immobilized on a nitrocellulose sheet. The solid phase is formed by applying the antibody solution onto a nitrocellulose sheet and drying. The solid-phased antibody recognizes ADAMTS in the developed plasma and can capture a complex of ADAMTS and the above-mentioned antibody labeled in a granular form. Therefore, if the “antibody recognizing ADAMTS” is immobilized on a line on an antibody-immobilized support, the line is colored with a granular label, and it is determined that ADAMTS is present in the blood. It is possible to determine that a patient having the blood suffers from an acute ischemic disease.

2. Acute ischemic disease diagnostic kit The present invention provides an acute ischemic disease diagnostic kit containing an antibody that recognizes ADAMTS. The “antibody recognizing ADAMTS” in the present invention can be prepared by the same method as the “antibody recognizing ADAMTS” in the “1. ADAMTS detection method”.
The kit may contain reagents in addition to the antibody that recognizes ADAMTS, and these reagents and the like may be included together with the antibody that recognizes ADAMTS in advance or stored in separate containers. May be. Examples of reagents include buffers for diluting treatment solutions and antibodies, secondary antibodies, labeling substances (eg, fluorescent dyes, enzymes), reaction vessels, positive controls (eg, recombinant ADAMTS), negative controls, solid phases And instructions describing the test protocol. These elements can be mixed in advance if necessary. By using the kit, diagnosis of acute ischemic disease is simple, rapid and highly accurate.

  In the kit of the present invention, the antibody that recognizes ADAMTS is preferably an antibody that recognizes ADAMTS-1.

3. Acute ischemic disease diagnostic agent The present invention provides an acute ischemic disease diagnostic agent comprising an antibody recognizing ADAMTS. The “antibody recognizing ADAMTS” is an active ingredient in the diagnostic agent of the present invention, and can be prepared by the same method as the “antibody recognizing ADAMTS” in “1. ADAMTS detection method”.

  The diagnostic agent of the present invention may consist of only an antibody that recognizes ADAMTS, or may contain a pharmaceutically acceptable carrier. As a pharmaceutically acceptable carrier, when preparing the diagnostic agent of the present invention as a solution, various carriers conventionally used as pharmaceutical materials, such as diluents, solvents, solubilizers, suspending agents, isotonicity, etc. An agent, a buffering agent, etc. may be included. Furthermore, it is preferable to add a surfactant such as Tween 20 (registered trademark) in order to prevent antibody aggregation. Those blending ratios can be appropriately determined by those skilled in the art.

  Whether or not the patient is suffering from acute ischemic disease can be diagnosed by adding the diagnostic agent thus prepared to blood collected from the subject and detecting ADAMTS. By using the diagnostic agent, diagnosis of acute ischemic disease is simple, quick and highly accurate.

  In the diagnostic agent of the present invention, the antibody recognizing ADAMTS is preferably an antibody recognizing ADAMTS-1.

  Hereinafter, the present invention will be described more specifically with reference to reference examples and examples. The following are typical reference examples and examples, and the present invention is not limited to them. Various applications are possible without departing from the technical idea of the present invention.

[Reference Example 1] Detection of ADAMTS-1 mRNA in hypoxic cultured cells (1) Cell culture Human coronary artery endothelial cell line (HCAEC) is an EBM-2 medium (manufactured by Takara Bio Inc.) containing 10% FCS. Human umbilical vein endothelial cells (HUVEC) are EBM-2 medium (produced by Cambridge) containing 10% FCS, monkey kidney cell line (COS7) is a DMEM medium containing 10% FCS (produced by Sigma), The cardiomyocyte cell line (H9C2) was cultured in DMEM medium (Sigma) containing 10% FCS, and the porcine aorta smooth muscle cell line (SMC) was cultured in DMEM medium (Sigma) containing 10% FCS.

(2) Hypoxic culture and extraction of ADAMTS-1 mRNA 3 × 10 ⁵ cells were cultured in a carbon dioxide incubator in a sub-confluent state and filled with nitrogen gas to reduce hypoxia (1 % O ₂ ). The cells were cultured for 1 hour, 3 hours, 6 hours and 24 hours respectively, and RNA of each cell was extracted by the AGPC method.

(3) Measurement of ADAMTS-1 mRNA expression level ADAMTS-1 mRNA expression level was measured by a real-time PCR method using a LightCycler rapid thermal cycler system (Roche). Specifically, cDNA was synthesized using mRNA as a template and reverse transcriptase (Reverse transcriptase, SS-II Invitrogen), ADAMTS-1-specific primers were designed, and real-time PCR reaction was performed. Quantification was performed using α-tubulin as an internal standard.

The results are shown in FIG. ADAMTS-1 was upregulated in hypoxic vascular endothelial cells. In particular, when HUVEC was used, it was found that the expression was remarkably enhanced in the hypoxic state in the acute phase (1 to 3 hours). On the other hand, in the cells of other tissues, there was no significant difference in the expression level of ADAMTS-1 in the hypoxic state.
Upper primer: CACTCTGCCGGAACTTTGC (SEQ ID NO: 1)
Lower primer: GCATCATCATGTGGCATGTTA (SEQ ID NO: 2)

[Example 1] Detection of ADAMTS-1 (1) Preparation of antibody-immobilized plate 100 μL of rabbit anti-ADAMTS-1 antibody (1.0 μg / mL, manufactured by Sigma) was added to a 96-well microplate (manufactured by NUNK). / Well and allowed to stand overnight at 4 ° C. to allow the antibody to bind to the plate surface. After wells were washed twice with 0.01% Tween20-containing phosphate buffer (PBST), phosphorus containing 2% BSA (manufactured by Sigma) was used to suppress adsorption to nonspecific plates and nonspecific reactions. Acid buffer was added at 150 μL / well and allowed to stand at room temperature for 2 hours to block the plate. Next, the wells were washed three times with PBST to prepare an ADAMTS-1 antibody-immobilized plate.

(2) Detection of recombinant ADAMTS-1 and preparation of calibration curve For recombinant ADAMTS-1, commercially available recombinant ADAMTS-1 was purchased (R & D) and used. The recombinant ADAMTS-1 solution (in 1% BSA-PBST, pH 7.4) was added to the plate prepared in (1) at a concentration of 100 μL / well and allowed to stand at room temperature for 2 hours. -1 antibody and recombinant ADAMTS-1 were combined. After washing the wells three times with PBST, mouse anti-ADAMTS-1 antibody (2.0 μg / mL, manufactured by R & D) was added at 100 μL / well and allowed to stand at room temperature for 2 hours to allow recombinant ADAMTS-1 in the complex. A mouse anti-ADAMTS-1 antibody was bound to. After the wells were washed 3 times with PBST, POD-labeled anti-mouse IgG antibody (2000-fold diluted, manufactured by MBL) was added at 100 μL / well, and the mixture was allowed to stand at room temperature for 2.0 hours. After the wells were washed 3 times with PBST, TMB solution was added at 100 μL / well and left at room temperature for 15 minutes to develop the remaining POD.
The reaction was stopped by adding 100 μL / well of 1N hydrochloric acid, and the absorbance at 450 nm was measured. Each absorbance against the recombinant ADAMTS-1 concentration was plotted to prepare a calibration curve. The results are shown in FIG.

[Example 2] Detection of ADAMTS-1 using human serum as a sample Operation similar to that of Example 1 using serum of patients suffering from various diseases as a sample instead of the recombinant ADAMTS-1 solution The absorbance was measured. Based on the calibration curve prepared in Example 1, the ADAMTS-1 concentration in the serum of each patient was calculated. The results are shown in Table 1.

  ADAMTS-1 concentrations in healthy subjects, patients with stable angina, chest pain patients and patients complaining of chest discomfort were below detection sensitivity, but patients with myocardial infarction showed very high concentrations of ADAMTS-1. Therefore, it is possible to diagnose whether or not the patient is in an acute ischemic disease state using the ADAMTS-1 concentration in blood as an index.

  According to the detection method of the present invention, ADAMTS, which is a novel biomarker of acute ischemia, can be detected simply and rapidly. Further, by using the kit for diagnosing acute ischemia or the diagnostic agent for acute ischemia of the present invention, it is possible to simply, rapidly and accurately diagnose whether or not the patient is suffering from an acute ischemic disease.

It is a figure which shows the ADAMTS-1 mRNA expression level of each cell in a hypoxic state. The vertical axis represents the relative intensity, and the horizontal axis represents the time during which each cell was in a hypoxic state. It is a calibration curve showing the relationship between absorbance and ADAMTS-1 concentration.

Claims (10)

The following steps:
(1) a step of contacting blood derived from a subject suspected of having an acute ischemic disease and an antibody that recognizes ADAMTS; and (2) a step of detecting the complex formed in the above step (1);
A method for detecting ADAMTS in a subject, comprising:   The method of claim 1, wherein the ADAMTS is ADAMTS-1.   The method according to claim 1 or 2, wherein the antibody is a monoclonal antibody.   The acute ischemic disease is selected from ischemic heart disease, ischemic brain disease, ischemic lung disease, renal infarction, acute mesenteric artery occlusion, acute arterial occlusion, retinal artery occlusion and retinal vein occlusion The method according to any one of claims 1 to 3, wherein the method is at least one disease.   A kit for diagnosing acute ischemic disease, comprising an antibody that recognizes ADAMTS.   The kit according to claim 5, wherein the ADAMTS is ADAMTS-1.   A diagnostic agent for acute ischemic disease comprising an antibody that recognizes ADAMTS as an active ingredient.   The diagnostic agent of Claim 7 whose ADAMTS is ADAMTS-1.   The kit or diagnostic agent according to any one of claims 5 to 8, wherein the antibody is a monoclonal antibody.   The acute ischemic disease is selected from ischemic heart disease, ischemic brain disease, ischemic lung disease, renal infarction, acute mesenteric artery occlusion, acute arterial occlusion, retinal artery occlusion and retinal vein occlusion The kit or diagnostic agent according to any one of claims 5 to 9, which is at least one disease.

Images