JP2009034043A - New yeast strain having high productivity of s-adenosylmethionine and method for producing the same - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a new yeast strain capable of safely producing a large quantity of AdoMet and a method for producing the new yeast strain. <P>SOLUTION: The invention provides a yeast having a mutant S-adenosylhomocysteine hydrolase gene introduced by a self cloning method. The mutant gene codes a protein having an amino acid sequence obtained by the substitution, deletion, insertion and/or addition of one or more amino acids in the amino acid sequence shown by the sequence No.2. The protein has lowered S-adenosylhomocysteine hydrolysis activity compared with the protein having the amino acid sequence shown by the sequence No.2. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

The present invention relates to a novel yeast strain that highly produces S-adenosylmethionine (hereinafter referred to as AdoMet) and a method for producing the same. More specifically, the present invention relates to a novel sake yeast mutant that highly produces AdoMet and a method for producing the same.

  In recent years, alcoholic liver disease (ALD), which manifests as symptoms such as fatty liver, fibrosis, cirrhosis, and hepatocellular tumor, is a major cause of illness and death worldwide. At present, the relationship between such alcoholic liver disease and AdoMet is drawing attention.

  AdoMet is a physiological compound that exists throughout living tissues and participates in numerous biological reactions as a methyl donor or enzyme activator in the synthesis and metabolism of hormones, neurotransmitters, phospholipids, and proteins. AdoMet is metabolized by three metabolic pathways: methyl group transfer, sulfur group transfer, and aminopropyl group transfer.

  AdoMet has been found to have a therapeutic effect on various liver diseases. For example, Non-Patent Document 1 describes that in research using baboons, liver damage caused by ethanol was alleviated by administration of AdoMet. Non-Patent Document 2 describes that administration of AdoMet significantly reduced the mortality rate of cirrhotic patients. Non-Patent Document 3 describes that administration of AdoMet alleviates rat liver damage caused by hepatotoxins such as carbon tetrachloride and acetaminophen.

  AdoMet is known to be involved in the generation of various brain neurotransmitters. Therefore, it has an excellent therapeutic effect in the treatment of depression and the like. For example, Non-Patent Document 4 describes the effect of AdoMet administration on depressed patients. For depressed patients, the effects of parenteral and oral administration of 200-1600 mg / d AdoMet were significantly better than the conventional antidepressant placebo and similar to tricyclic antidepressants. Moreover, administration of AdoMet synergistically enhances the effects of tricyclic antidepressants, with a faster time to begin to work than conventional antidepressants. AdoMet has little decrease in therapeutic effect and less side effects in long-term use.

  AdoMet also has a significant therapeutic effect on osteoarthritis. For example, Non-Patent Document 5 describes the results of a comparative study of the therapeutic effects of AdoMet on osteoarthritis with placebo and non-steroidal anti-inflammatory agents in terms of pain relief, functional recovery, and side effects. As a result, AdoMet had the same therapeutic effect as non-steroidal anti-inflammatory agents in reducing pain and restoring function. AdoMet also did not have the side effects often seen with non-steroidal anti-inflammatory drugs.

  AdoMet is known to be involved in protection against hypomethylation in cells. In cancer cells, hypomethylated sites and hypermethylated sites of DNA on the chromosome are universally found. This hypomethylated site on the chromosome is considered to be a characteristic of cancer cells. That is, an increase in AdoMet concentration in the cell stimulates the reaction of DNA methyltransferase. This DNA methyltransferase is considered to protect the chromosome from hypomethylation by hypermethylating DNA on the chromosome.

  For example, Non-Patent Document 5 describes the results of a demethylation activity test. In the demethylation activity test, CMV-GFP plasmid was introduced into HEK293 cells to detect demethylation of this plasmid. Expression of CMV-GFP on this CMV-GFP plasmid is achieved by demethylation of the CMV-GFP. Therefore, in Non-Patent Document 5 described above, intracellular demethylation is detected in the presence of AdoMet or adenosylhomocysteine, using the expression of CMV-GFP in NEK293 cells as an index. In addition, in the presence of AdoMet or adenosylhomocysteine, the influence on demethylase (Methylated DNA binding protein 2 / DNA demethylase: MBD2 / dMTase) is also examined in a test tube. As a result, it was shown that adenosylhomocysteine has no inhibitory effect on demethylase, whereas AdoMet directly inhibits the demethylase reaction. The above demethylation test also showed that AdoMet inhibits demethylation in cells. Therefore, AdoMet has been shown to directly inhibit the demethylase reaction in cells resulting in DNA hypermethylation.

  Patent Document 1 discloses amino sugars, glucosaminoglycans, and S-adenones as compositions that can promote anti-inflammatory action, cartilage protection action, cartilage regulation action, cartilage stabilization action, and cartilage metabolism action. A composition comprising silmethionine is disclosed.

  AdoMet becomes a S-adenosyl homocysteine (hereinafter referred to as AdoHcy) after donating a methyl group. AdoHcy is hydrolyzed into adenosine and homocysteine by AdoHcy hydrolase. The gene encoding AdoHcy hydrolase has been isolated from various biological species and is very well conserved across species. For example, Patent Document 2 discloses an AdoHcy hydrolase gene isolated from dendritic cells. Patent Document 3 discloses a plant in which expression of an AdoHcy hydrolase gene is suppressed.

  As described above, AdoMet has been found to have a wide range of therapeutic effects on various diseases, and therefore mass production of AdoMet is desired. For this production system, a prokaryotic organism such as E. coli and a method using a eukaryotic organism such as yeast can be mentioned as main options. Production systems using E. coli are most popular. Certainly, E. coli is easy to operate. On the other hand, yeast is more complicated to operate and has a slower growth rate than E. coli. However, yeast is easier to mass culture and is very suitable for mass production.

Thus, production of AdoMet in yeast has been desired from the viewpoint of mass production. For example, Patent Documents 4 and 5 disclose a method for producing AdoMet using a yeast mutant. Patent Document 6 describes that by introducing a mutation into a methionine metabolic enzyme containing an AdoHcy hydrolase gene, AdoMet accumulates more in the mutagenized strain than in the wild type strain. However, such a yeast mutant approach using a foreign gene is one of the useful means, but the safety of a foreign gene or a selectable marker gene to the human body is unknown, and a novel bacterium existing in the body is new. Due to the possibility of acquiring traits, there are significant limitations for industrial applications.
Lieber CS et al., Hepatology February 1990; 111: 65-72 Lieber CS, Annu Rev Nutr. 2000; 20: 395-430 Gasso M et al., J Hepatol. August 1996; 25: 200-205 Soeken KL et al., J Fam. Pract May 2002, 51: 425-430 Detich N et al. Biol. Chem June 2003, 6.20812-20820 Japanese translation of PCT publication No. 2002-516866 JP-T-2002-513276 International Publication No. 96/14734 Pamphlet Japanese Patent Publication No. 4-55677 Japanese Patent Publication No. 4-33439 JP-A-2005-261361

  As described above, AdoMet is useful as a therapeutic agent for a wide variety of diseases such as liver disease, depression treatment, osteoarthritis, cancer treatment, etc., but it is produced in a large amount and safely enough to be industrially applicable. There is currently no method.

  Therefore, it is an object of the present invention to realize safe mass production of AdoMet for which no effective mass production method has been established at present. In particular, it is an object of the present invention to provide a novel yeast strain that safely produces large amounts of AdoMet.

  It is also an object of the present invention to provide a method for producing a novel yeast strain that can safely produce a large amount of such AdoMet.

  The present inventors have discovered that AdoMet is produced by a mutant sake yeast strain in a larger amount than expected by introducing a mutation into the S-adenosylhomocysteine hydrolase gene in sake yeast. Furthermore, after extensive studies, the inventors succeeded in producing a new mutant yeast strain that can safely produce a large amount of AdoMet by introducing a mutation into the S-adenosylhomocysteine hydrolase gene in a sake yeast strain by self-cloning. Was completed.

In order to solve the above-described problems, the present invention provides the following items.
(Item 1) A yeast having a mutant S-adenosylhomocysteine hydrolase gene introduced by a self-cloning method, wherein the mutant gene is a substitution of one or more amino acids in the amino acid sequence represented by SEQ ID NO: 2, Which encodes a protein having an amino acid sequence containing deletions, insertions and / or additions, which protein has reduced S-adenosylhomocysteine hydrolysis activity compared to a protein having the amino acid sequence shown in SEQ ID NO: 2. Have yeast.
(Item 2) The yeast according to item 1, wherein the yeast is sake yeast.
(Item 3) The yeast according to item 2, wherein the sake yeast is FERM P-21305.
(Item 4) The yeast according to item 1, wherein the yeast is diploid.
(Item 5) The yeast according to Item 1, comprising the marker gene for self-cloning.
(Item 6) The yeast according to item 1, wherein the yeast is diploid or higher order polyploid,
(I) a mutant gene encoding a protein having reduced S-adenosylhomocysteine hydrolyzing activity as compared with a protein having the amino acid sequence shown in SEQ ID NO: 2, wherein the mutant gene is represented by SEQ ID NO: 2 A mutant gene encoding an amino acid sequence comprising one or more amino acid substitutions, deletions, insertions and / or additions in the amino acid sequence shown; and (ii) a disrupted S-adenosylhomocysteine hydrolase gene. The protein encoded by the disrupted gene is a protein that does not have S-adenosylhomocysteine hydrolyzing activity, where the gene has one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2. Disrupted, encoding amino acid sequences containing substitutions, deletions, insertions and / or additions Gene,
Having yeast.
(Item 7) The yeast according to item 1, wherein the yeast is a diploid or a higher polyploid,
(I) a mutant gene encoding a protein having reduced S-adenosylhomocysteine hydrolyzing activity as compared with a protein having the amino acid sequence shown in SEQ ID NO: 2, wherein the mutant gene is represented by SEQ ID NO: 2 A mutant gene encoding an amino acid sequence comprising one or more amino acid substitutions, deletions, insertions and / or additions in the amino acid sequence shown; and (ii) a nucleic acid encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid whose S-adenosylhomocysteine hydrolyzing activity of the encoded protein is equivalent to the S-adenosylhomocysteine hydrolyzing activity of a protein having the amino acid sequence shown in SEQ ID NO: 2,
Having yeast.
(Item 8) The yeast according to item 1, wherein the mutation is a T279I point mutation.
(Item 9) A method for producing a yeast that accumulates metabolites, including a step of introducing mutations into an enzyme gene that decomposes metabolites using a self-cloning method,
Wherein the metabolite-degrading activity of the protein encoded by the mutant gene is reduced compared to the protein encoded by the wild-type enzyme gene.
(Item 10) The method according to item 9, wherein at least two kinds of markers for self-cloning are used, wherein:
(I) transforming the yeast using a first self-cloning method with a first marker and a first mutant gene; and (ii) a second self with a second marker and a second mutant gene. Further transforming the yeast transformant obtained in (i) using a cloning method,
Including the method.
(Item 11) The method according to item 10, wherein the first mutant gene and the second mutant gene are the same.
(Item 12) The method according to item 10, wherein the first mutant gene is different from the second mutant gene.
(Item 13) The method according to item 9, wherein at least two kinds of markers for self-cloning are used, wherein:
(I) transforming the yeast using a first self-cloning method with a first marker and a first mutant gene; and (ii) using a second self-cloning method with a second marker, A step of further transforming the yeast transformant obtained in (i),
Including the method.
(Item 14) The method according to item 9, wherein the metabolite is S-adenosylmethionine.
(Item 15) The method according to item 9, wherein the yeast is sake yeast.
(Item 16) The method according to item 14, wherein the mutation is a substitution, deletion, insertion and / or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2.
(Item 17) The method according to item 16, wherein the mutation is a T279I point mutation.
(Item 18) Yeast produced by the method according to any one of items 9 to 17.
(Item 19) A composition for eating and drinking comprising the yeast according to any one of items 1 to 8 or item 18.
(Item 20) A pharmaceutical composition comprising the yeast according to any one of items 1 to 8 or item 18.
(Item 21) The culture solution of yeast according to any one of items 1 to 8 or item 18.
(Item 22) A composition for eating and drinking comprising the culture solution according to item 21.
(Item 23) A pharmaceutical composition comprising the culture medium according to item 21.

  The present invention provides a novel yeast strain that safely and in large quantities produces AdoMet useful as a therapeutic agent for a wide variety of diseases such as liver disease, depression treatment, osteoarthritis, and cancer treatment.

  The invention will now be described, by way of example, with reference to the accompanying drawings, where appropriate. Throughout this specification, it should be understood that the singular forms also include the plural concept unless specifically stated otherwise. In addition, it is to be understood that the terms used in the present specification are used in the meaning normally used in the art unless otherwise specified. Thus, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification, including definitions, will control.

  The embodiments provided below are provided for a better understanding of the present invention, and the scope of the present invention should not be limited to the following description. It will be apparent to those skilled in the art that appropriate modifications can be made within the scope of the present invention with reference to the description in the present specification.

  The present inventors have discovered that AdoMet is produced by a mutant sake yeast strain in a larger amount than expected by introducing a mutation into the S-adenosylhomocysteine hydrolase gene in sake yeast. Furthermore, after extensive studies, the inventors succeeded in producing a new mutant yeast strain that can safely produce a large amount of AdoMet by introducing a mutation into the S-adenosylhomocysteine hydrolase gene in a sake yeast strain by self-cloning. Was completed.

  According to the present invention, yeast having a mutant S-adenosylhomocysteine hydrolase gene (FERMP-19715 strain) having a mutant S-adenosylhomocysteine hydrolase gene of about 8 times to about 12 times that of sake yeast having no S-adenosylhomocysteine hydrolase gene mutation. A new yeast strain that produces AdoMet in large quantities about 74 to 90 times greater than that of AdoMet. Since the novel yeast strain of the present invention is prepared by self-cloning, AdoMet produced by this yeast strain is very safe for human consumption. One of the new yeast strains of the present invention was deposited at the Patent Organism Consignment Center, National Institute of Advanced Industrial Science and Technology as deposit number FERM P-21305 (deposit date: June 14, 2007). However, the present invention is not limited to this FERM P-21305 strain, and all AdoMet high-producing yeast strains produced by the method of the present invention are within the scope of the present invention.

In the present invention, the mutation introduced into the S-adenosylhomocysteine hydrolase gene was a recessive mutation. Sake yeast is diploid, but it was common knowledge in the field that it is difficult to obtain recessive mutants with diploid. In the present invention, at least two types of marker genes for self-cloning are used,
(I) transforming the yeast using a first self-cloning method with a first marker and a first mutant gene; and (ii) a second self with a second marker and a second mutant gene. Further transforming the yeast transformant obtained in (i) using a cloning method,
It was possible to obtain a recessive mutant strain in diploid sake yeast.

(In vivo methionine metabolism and methionine metabolism enzymes)
FIG. 2 shows an outline of the methionine metabolic pathway. In vivo, methionine is metabolized by the following reaction.
(A) Conversion to S-adenosylhomocysteine (AdoHcy) by transmethylation of S-adenosylmethionine (AdoMet).
(B) S-adenosylhomocysteine (AdoHcy) is hydrolyzed to adenosine and homocysteine.
(C) From homocysteine to methionine.
(D) Methionine receives an adenosyl group from ATP in vivo and becomes S-adenosylmethionine (AdoMet).

  Methionine is produced by the reaction pathways (a) to (c) above. In addition, S-adenosylmethionine (AdoMet) is generated again by the reaction (d), and methionine is generated through the reactions (a) to (c).

  Moreover, the homocysteine produced | generated by reaction of (b) turns into cysteine through cystathionine.

  Such metabolism of methionine in the living body is carried out by catalysis of various enzymes (methionine metabolic enzymes). For example, S-adenosylhomocysteine hydrolase is an enzyme that catalyzes the hydrolysis reaction (b). Further, methionine synthase or betaine-homocysteine methyltransferase is known as an enzyme that catalyzes the reaction (c). As an enzyme that catalyzes the reaction (d), methionine adenosyltransferase is known.

(Mution of methionine metabolic enzyme)
In the yeast mutant of the present invention, typically, a methionine metabolic enzyme is mutated. Here, the mutated methionine metabolic enzyme is not particularly limited as long as it is an enzyme involved in the methionine metabolism, and may be any yeast mutant strain in which the methionine metabolic enzyme is mutated. Such mutation of the methionine metabolic enzyme occurs as a result of mutation in the gene encoding the enzyme. The yeast mutant according to the present invention has a mutation in a methionine metabolic enzyme, thereby causing an abnormality in the methionine metabolic system. As a result, AdoMet, which is one of methionine metabolites, accumulates in the cell.

  In the present invention, a preferred methionine metabolic enzyme into which a mutation is introduced is S-adenosylhomocysteine hydrolase. S-adenosylhomocysteine hydrolase is also known as S-adenosylcyhomoseine hydratase, and catalyzes the hydrolysis of S-adenosylhomocysteine in the methionine metabolic system as described above, and is a precursor of methionine. It is an enzyme involved in the production of homocysteine. The amino acid sequence of S-adenosylhomocysteine hydrolase without mutation (hereinafter referred to as wild-type S-adenosylhomocysteine hydrolase) is shown in SEQ ID NO: 2. The mutant S-adenosylhomocysteine hydrolase possessed by the yeast mutant of the present invention has one or more amino acids in the amino acid sequence of the wild-type S-adenosylhomocysteine hydrolase shown in SEQ ID NO: 2. Any amino acid sequence consisting of a substitution, deletion, insertion, and / or addition is not particularly limited.

  As an example of the mutation of S-adenosylhomocysteine hydrolase in the present invention, the 836th cytosine (c) in the wild type S-adenosylhomocysteine hydrolase gene (SEQ ID NO: 1) is changed to thymine (T). The point mutation to be substituted (point mutation from 279 threonine (Thr) to isoleucine (Ile) in the amino acid sequence of wild-type S-adenosylhomocysteine hydrolase (SEQ ID NO: 2)) is included. It is not limited.

  Compositions comprising AdoMet produced by the novel yeast strains of the present invention alleviate liver damage (eg, reduce mortality due to cirrhosis) (eg, Lieber CS. Role of S-adenosyl-L-methionine in The Hepatol 1999; 30: 1155-9; Williams R, Lieber CS. The roll of SAme in the treatment of the disease. , Fernandez de Paz J, et al, S-Adenoylmethionine in alcohol olive liver cirrhosis: a randomized, placebo-controlled, double-blind, multicenter clinical trial.J hepatol 1999; 30: 1081-9, etc. Lipinski JD, Comety JE, et al.S-Adenosylmethionine: a literature review and preliminary report.Ala J MedAci Sci 1988; 25: 306-13; . A review of its therapeutic potential in liver dysfunction and affective disorders in relation to its physiological role in cell metabolism Drugs 1989; 38:. 389-416; Bressa GM S-Adenosyl-L-methionine (SAMe) as antidepressant: meta-analysis of clinical studies. Acta Neurol Scan 1994; 154: 7-14, etc.) and useful for the treatment of arthritis (eg, Bradley JD, Flusher D, Katz BP, et al. Intravenous loading with S-adenosylmethine (SAM) followed by oral SAM therapies with patients with knee osteothritis. J Rhematol 1994; 21: 905 et al. of osteoarthritis: review of the clinical studies. Am J Med 1987; 83: 60-5), reducing pain in osteoarthritis, promoting functional recovery in osteoarthritis, anti-inflammatory effects Promote, promote cartilage protection, promote cartilage regulation, promote cartilage stabilization, promote cartilage metabolism, improve Alzheimer's disease (eg, Morison, L D., Smith, D.D., and Kish, S.J., Brain S-adenosylmethionine levels are severed in Alzheimer's disease.J.Neu. ochem., 67, 1328-1331 (1996)), can improve peripheral neuropathy or myelopathy due to HIV infection (eg Keating JN, Trimble KC, Mulcahy F, Scott JM, Weir DG, Evidence). of brain methyltransferase inhibition and early brain evolution in HIV-positive patents. Lancet, 337, 935-939, (1991); Sureties R, Hyland K, Smith I .; Central central system methyl-group metabolism in children with neurological complications of HIV infection. Lancet, 335, 619-621 (1990); Castagna A, Le Grazie C, Accordini A, Giulidri P, Cavalli G, Bottiglieri T, Lazarin A. , Crebrospinal fluid S-adenosyl-methionine (SAMe) and glutation contentions in HIV effect: effect of parental treatment with SAMe. , Neurology, 45, 1678-1683 (1995)), etc. (this useful effect is not limited to those listed here). Any edible composition (eg, health food or supplement) or pharmaceutical composition (eg, pharmaceutical) comprising AdoMet produced by the yeast strain of the present invention is within the scope of the present invention. The present invention also relates to a culture solution of the novel yeast strain of the present invention. In another aspect, the present invention relates to any food-drinking composition (eg, health food or supplement) or pharmaceutical composition (eg, pharmaceutical product) comprising this culture medium.

(Definition)
In the present specification, “gene” refers to a sequence of a certain length of nucleic acid present in a cell, which is a factor that defines a genetic trait. In the present invention, the gene may or may not define a genetic trait. In the present specification, a gene refers to a gene that is normally present in the genome, but is not limited thereto, and may include an extrachromosomal sequence, a mitochondrial sequence, and the like. Many genes are usually arranged in a certain order on the chromosome. Those that define the primary structure of a protein are called structural genes, and those that influence the expression are called regulatory genes (for example, promoters). As used herein, “gene” may refer to “polynucleotide”, “oligonucleotide” and “nucleic acid” and / or “protein” “polypeptide”, “oligopeptide” and “peptide”. In the present specification, the gene typically referred to is the S-adenosylhomocysteine hydrolase gene. In the present specification, the “open reading frame” or “ORF” of a gene is one of three frameworks when the base sequence of the gene is divided into 3 bases, having a start codon, and halfway A reading frame that has a certain length without a stop codon and may actually encode a protein. In the present specification, genes include structural genes and regulatory genes unless otherwise specified. Therefore, for example, when referring to the S-adenosyl homocysteine hydrolase gene, transcription of the structural gene of the S-adenosyl homocysteine hydrolase gene and the promoter of the S-adenosyl homocysteine hydrolase gene, etc. Includes both regulatory sequences for translation. In the present invention, it is understood that regulatory sequences such as transcription and / or translation as well as structural genes are also useful as the gene to which the present invention is directed. Also herein, “gene product” refers to “polynucleotide”, “oligonucleotide”, “nucleic acid” and “nucleic acid molecule” and / or “protein” “polypeptide”, “oligopeptide” expressed by a gene. And “peptide”. A person skilled in the art can easily understand what a gene product is, depending on the situation.

  As used herein, the terms “polynucleotide”, “oligonucleotide”, and “nucleic acid” are used interchangeably herein and refer to a polymer of nucleotides of any length. Unless otherwise indicated, a particular nucleic acid sequence may also be conservatively modified (eg, degenerate codon substitutes) and complementary sequences, as well as those explicitly indicated. Is contemplated. Specifically, a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosine residue. (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-). 98 (1994)).

  Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by the generally accepted single letter code.

The character codes are as follows.
(amino acid)
3 letter symbol 1 letter symbol Meaning Ala A Alanine Cys C Cysteine Asp D Aspartic acid Glu E Glutamic acid Phe F Phenylalanine Gly G Glycine His H Histidine Ile I Isoleucine Lys K Lysine Leu L Leucine Mine M M Arg R Arginine Ser S Serine Thr T Threonine Val V Valine Trp W Tryptophan Tyr Y Tyrosine Asx Asparagine or Aspartate Glx Glutamine or Glutamate Xaa Unknown or other amino acids.
(base)
Symbol Meaning
a adenine g guanine c cytosine t thymine u uracil r guanine or adenine purine y thymine / uracil or cytosine pyrimidine m adenine or cytosine amino group k guanine or thymine / uracil keto group s guanine or cytosine w adenine or thymine / uracil b guanine or cytosine Thymine / uracil d adenine or guanine or thymine / uracil h adenine or cytosine or thymine / uracil v adenine or guanine or cytosine n adenine or guanine or cytosine or thymine / uracil, unknown or other base.

  In the present specification, “expression” of a gene, polynucleotide, polypeptide or the like means that the gene or the like undergoes a certain action in vivo to take another form. Preferably, a gene, polynucleotide or the like is transcribed and translated into a polypeptide form. However, transcription and production of mRNA can also be an aspect of expression. More preferably, such polypeptide forms may be post-translationally processed.

As used herein, “self-cloning” refers to introducing DNA that does not correspond to “heterologous DNA” into a host,
(1) The DNA donor and the host are not heterogeneous;
(2) Not all types of physiologically active genes (gene DNA encoding a polynucleotide or polypeptide having physiological activity, promoter, terminator, marker, etc.) contained in the vector are heterogeneous;
The case where both (1) and (2) are clear is pointed out.

  In the present specification, “heterologous DNA” means DNA derived from a strain not included in the species to which the host belongs.

  In contrast to “self-cloning”, “recombinant DNA technology” refers to the production of a recombinant molecule of DNA that can be replicated in a living cell and a heterologous DNA, which is then transferred to the living cell. Is a technology to replicate This term also includes a technique using a living cell into which a recombinant molecule of DNA has been transferred (hereinafter referred to as “recombinant”) as a result of applying this technique. However, the case where a living cell having a gene configuration equivalent to that of a living cell into which a recombinant DNA molecule has been transferred exists in nature is excluded.

  Many attempts have been made to use recombinant DNA technology to improve the ability to produce useful substances in an organism or to provide new traits that produce a substance. However, substances produced by organisms produced by such recombinant DNA technology may have some dangers, particularly those that are taken into the human body, and at present, their industrial use is large. Limited. This risk includes the safety of selectable markers such as antibiotic resistance genes (eg, bacteria in the human body can acquire the antibiotic resistance trait), and the synthesis of unexpected impurities in the host by heterologous gene transfer. Can be mentioned. In this regard, the novel mutant yeast strain of the present invention has been mutated by self-cloning, and there is no such risk (safety evaluation of foods and food additives using recombinant DNA technology by the Ministry of Health, Labor and Welfare). According to the guidelines)). Therefore, the novel mutant yeast strain of the present invention and the AdoMet produced thereby are safe and its industrial value is extremely great.

  In the present specification, the “vector” refers to any nucleic acid substance used when DNA is introduced into a host. A “vector” as used herein is typically a DNA fragment intended to be introduced into a host.

  As used herein, “self-cloning method” refers to any DNA molecule that is intended to be introduced into a host and does not correspond to “heterologous DNA”. In the present specification, the “marker gene for self-cloning” is typically a selection marker derived from a host gene (for example, Ura3 or His3), an enzyme that degrades a metabolite introduced with a host-derived mutation. It refers to a gene (for example, a mutant S-adenosylhomocysteine hydrolase gene), but is not limited thereto. The “marker gene for self-cloning” can be introduced into a host by a method well known in the art. Examples of this method include, but are not limited to, the lithium acetate method, the PEG method, and the spheroplast method as well as the transformation methods described in the following examples.

  As used herein, “mutation” refers to a difference in traits observed between cells or the population of the same origin. That is, a mutation refers to a trait caused by a difference in gene configuration including a point mutation of a gene or a chromosomal abnormality such as translocation / duplication or deletion.

  As used herein, “substitution, addition or deletion” of a polypeptide or polynucleotide is a substitution of an amino acid or a substitute thereof, or a nucleotide or a substitute thereof, respectively, with respect to the original polypeptide or polynucleotide. , Adding or removing. Such substitution, addition, or deletion techniques are well known in the art, and examples of such techniques include site-directed mutagenesis techniques. The number of substitutions, additions or deletions may be any number as long as it is one or more, and the number is increased as long as the intended function is retained in the variant having the substitution, addition or deletion. be able to. For example, such a number can be one or several, and preferably can be within 20%, within 10%, or less than 100, less than 50, less than 25, etc. of the total length.

  The above “substitution, deletion, insertion and / or addition of one or more amino acids” means substitution, deletion, insertion and / or addition by a known mutant protein production method such as site-directed mutagenesis. It means that as many amino acids as possible (preferably 10 or less, more preferably 7 or less, and even more preferably 5 or less) are substituted, deleted, inserted, and / or added.

  In this specification, “yeast” is a general term for unicellular fungi (so-called fungi), and generally grows by budding or division. In the present invention, typically, the yeast is the budding yeast Saccharomyces cerevisiae, and in a particular aspect, the yeast of the present invention is a sake yeast. In the present specification, “sake yeast” is also referred to as “brewing yeast” or “association yeast”, and these terms are used interchangeably herein. In the present specification, “sake yeast” specifically refers to Saccharomyces cerevisiae sake Kyokai No. 7 (a / α ura3Δ :: LYS4 / ura3Δ :: LYS4 his3 / his3; RAK2359) (Association No. 7 mutant, hereinafter referred to as K7-RAK2359).

  In the present specification, “yeast mutant” means a yeast cell or a population of yeast cells in which the mutation has occurred. Moreover, the yeast mutant is not limited to those in which mutation has occurred in one gene, and includes multiple yeast mutants in which mutation has occurred in a plurality of genes. The mutation may be a mutation that induces mutation such as UV irradiation or ethylmethanesulfonic acid (EMS) treatment, a natural mutation, or a genetic recombination method. A protein / gene having a mutation is referred to as a “mutant protein / gene”. In contrast, a yeast strain having no mutation is referred to as a “wild type yeast strain”, and a protein / gene or the like having no mutation is referred to as a “wild type protein / gene”.

  The yeast mutant of the present invention may be a yeast mutant having a dominant mutation or a recessive mutation, but is preferably a recessive mutation. The term “recessive mutation” as used herein refers to a mutation in which a polyploid obtained by multiplying a yeast wild body and a yeast mutant strain has a phenotype of the polyploid that substantially matches that of the yeast wild body. . The “dominant mutation” refers to a mutation in which the phenotype of the polyploid is almost the same as that of a yeast mutant.

  Yeast mutants having such recessive mutations have a phenotype almost identical to that of wild-type yeast by introducing a wild-type allele into the cell. That is, the phenotype of the yeast mutant is complemented by the wild type allele. “Multiplication” means joining yeasts of different mating types (for example, a type and α type in budding yeast).

  In the present specification, “reduced S-adenosylhomocysteine hydrolase activity” means that the S-adenosylhomocysteine hydrolase activity of S-adenosylhomocysteine hydrolase is reduced. This reduction is determined by measuring the amount of S-adenosylhomocysteine as described in the examples. In certain embodiments, S-adenosylhomocysteine hydrolase activity is reduced when the amount of S-adenosylhomocysteine in the culture has increased at least about 2-fold. In another embodiment, the amount of S-adenosylhomocysteine in the culture has been increased by at least about 3-fold, and the S-adenosylhomocysteine hydrolase activity is reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture has been increased by at least about 4-fold, and the S-adenosylhomocysteine hydrolase activity is reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture has been increased by at least about 5-fold, and the S-adenosylhomocysteine hydrolase activity is reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture has been increased by at least about 6-fold, and the S-adenosylhomocysteine hydrolase activity is reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture has increased by at least about 7-fold, and the S-adenosylhomocysteine hydrolase activity has been reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture has been increased by at least about 8-fold, and the S-adenosylhomocysteine hydrolase activity has been reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture has been increased by at least about 9-fold, and the S-adenosylhomocysteine hydrolase activity has been reduced. In another embodiment, the amount of S-adenosylhomocysteine in the culture was increased by at least about 10-fold, and the S-adenosylhomocysteine hydrolase activity was reduced.

  As used herein, “diploid” refers to an individual having two sets of genomes. In yeast, there are two mating types, a-type and α-type. The a-type strain and the α-type strain are joined to each other to fuse each other's cell membrane and then the nucleus, thereby producing a diploid. In the present specification, “high-order polyploid” refers to an individual having an arbitrary polyploidy of three times or more.

  In the present specification, the “marker gene” refers to a gene that functions as an index for selecting a host cell containing an introduced vector. Selection markers include, but are not limited to, auxotrophic markers, fluorescent markers, luminescent markers, and drug resistance selection markers. Examples of the “auxotrophic marker” include, but are not limited to, uracil auxotrophic marker gene, histidine auxotrophic marker gene, leucine auxotrophic marker gene, tryptophan auxotrophic marker, adenine auxotrophic marker, and the like. “Fluorescent markers” include genes encoding fluorescent proteins such as green fluorescent protein (GFP), blue fluorescent protein (CFP), yellow fluorescent protein (YFP) and red fluorescent protein (dsRed). It is not limited. “Luminescent markers” include, but are not limited to, genes encoding photoproteins such as luciferase. Examples of the “drug resistance selection marker” include neomycin phosphotransferase, which is a resistance gene for neomycin, kanamycin, paromomycin, aminoglycoside phosphotransferase gene, which is a G418 resistance gene, and hygromycin B phosphotransferase gene, which is a hygromycin B resistance gene. For example, but not limited to. In the present invention, auxotrophic markers are typically used, and in particular, uracil auxotrophic markers, histidine auxotrophic markers and the like are used.

  In the present specification, the “metabolite” refers to an arbitrary substance in which a molecule taken into the living body is changed by the action of an enzyme or the like in the living body. In the present invention, this metabolite is S-adenosylhomocysteine (AdoHcy), but is not limited thereto. In the present specification, “metabolite-degrading activity” refers to the activity of an enzyme to decompose a specific metabolite. As used herein, this metabolite is AdoHcy, and this enzyme is S-adenosylhomocysteine hydrolase, but is not limited thereto.

  In the present specification, the “composition” refers to any substance containing the novel yeast strain of the present invention. Examples of the composition of the present invention include, but are not limited to, a culture solution or a health food containing the novel yeast strain of the present invention.

  As used herein, “health food” refers to any product that is also referred to as a supplement and is said to be good for health. The health food of the present invention includes any of the novel yeast strains of the present invention, AdoMet produced using the novel yeast strains of the present invention, or a culture solution of the novel yeast strains of the present invention. Products are included. The health food of the present invention is typically sold with the effect of AdoMet displayed. The effects of AdoMet include relieving liver damage (for example, reducing mortality due to cirrhosis), having a therapeutic effect on depression, being useful in the treatment of arthritis, and pain in osteoarthritis. Reduce, promote functional recovery in osteoarthritis, promote anti-inflammatory action, promote cartilage protection, promote cartilage regulation, promote cartilage stabilization, cartilage metabolism Examples include, but are not limited to, promoting action, improving Alzheimer's disease, and improving peripheral neuropathy or myelopathy due to HIV infection.

  As used herein, “homology” of genes refers to the degree of identity of two or more gene sequences with respect to each other. Therefore, the higher the homology between two genes, the higher the sequence identity or similarity. Whether two genes have homology can be examined by direct sequence comparison or, in the case of nucleic acids, hybridization methods under stringent conditions. When directly comparing two gene sequences, the DNA sequence between the gene sequences is typically at least 50% identical, preferably at least 70% identical, more preferably at least 80%, 90% , 95%, 96%, 97%, 98% or 99% are identical, the genes are homologous.

  As used herein, “stringent hybridization conditions” refers to well-known conditions commonly used in the art. Such a polynucleotide can be obtained by using colony hybridization method, plaque hybridization method, Southern blot hybridization method or the like using a polynucleotide selected from among the polynucleotides of the present invention as a probe. Specifically, polynucleotides that hybridize under stringent conditions are hybridized at 65 ° C. in the presence of 0.7 to 1.0 M NaCl using a filter on which colony or plaque-derived DNA is immobilized. Then, a 0.1- to 2-fold concentration of SSC (saline-sodium citrate) solution (composition of 1-fold concentration of SSC solution is 150 mM sodium chloride and 15 mM sodium citrate) under the conditions of 65 ° C. It means a polynucleotide that can be identified by washing the filter. Hybridization was performed in Molecular Cloning 2nd ed. , Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford Universe. Here, the sequence containing only the A sequence or only the T sequence is preferably excluded from the sequences that hybridize under stringent conditions. The “hybridizable polynucleotide” refers to a polynucleotide that can hybridize to another polynucleotide under the above hybridization conditions. Specifically, the hybridizable polynucleotide is a polynucleotide having at least 60% homology with the base sequence of DNA encoding a polypeptide having the amino acid sequence specifically shown in the present invention, preferably 80% The polynucleotide which has the above homology, More preferably, the polynucleotide which has 95% or more of homology can be mentioned.

  In this specification, comparison of base sequence identity and calculation of homology are calculated using BLAST, which is a sequence analysis tool, using default parameters. The identity search can be performed using NCBI BLAST, for example. In the present specification, the identity value usually refers to a value when the BLAST is used and aligned under default conditions. However, if a higher value is obtained by changing the parameter, the highest value is the identity value. When identity is evaluated in a plurality of areas, the highest value among them is set as the identity value.

  As used herein, “fragment” refers to a polypeptide or polynucleotide having a sequence length of 1 to n−1 with respect to a full-length polypeptide or polynucleotide (length is n). The length of the fragment can be appropriately changed according to the purpose. For example, the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 and more amino acids, and lengths expressed in integers not specifically listed here (eg, 11 etc.) are also suitable as lower limits obtain. In the case of polynucleotides, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 200, 300, 400, 500, 600, 600, 700, 800 , 900, 1000 and more nucleotides, and lengths expressed in integers not specifically listed here (eg, 11 etc.) may also be appropriate as lower limits.

(Manufacture of composition for eating and drinking)
The suitable aspect of this invention is a composition for eating and drinking. Typically, a pharmaceutical composition or a food or drink composition containing AdoMet produced by the novel yeast strain of the present invention as an active ingredient is used as it is as a liquid, gel or solid food, for example, a health food, Supplements, nutritional supplements, juices, soft drinks, coffee, tea, Japanese tea, oolong tea, vegetable juice, natural fruit juice, milk drinks, milk, soy milk, sports drinks, near-water drinks, nutritional drinks, coffee drinks, cocoa, Soup, dressing, mousse, jelly, yogurt, pudding, sprinkle, infant formula, processed milk, sports drink, energy drink, cake mix, bread, pizza, pie, crackers, biscuits, cakes, cookies, spaghetti, macaroni, pasta, Udon, soba, ramen, candy, soft candy, gum Powdered or liquid dairy products such as chocolate, rice cake, potato chips, snacks, ice cream, sorbet, cream, cheese, milk powder, condensed milk, milk beverages, buns, oysters, mochi, rice cakes, soy sauce, sauce, noodle soup, sauce , Soup stock, stew base, soup base, compound seasoning, curry base, mayonnaise, ketchup, retort curry, retort stew, retort soup, retort bowl, canned, ham, hamburger, meatball, croquette, dumpling, Add to pilaf, rice balls, frozen and refrigerated foods, chikuwa, rice cakes, bento rice, sushi, baby milk, baby food, baby food, sports food, etc., and if necessary, form dextrin, lactose, starch, etc. Processed into pellets, tablets, granules, etc., with gelatin, fragrances, pigments, etc. Coating to be formed into a capsule can be used as health foods and nutritional supplements and the like. The amount of the yeast, AdoMet or culture solution of the present invention in these foods or food / beverage compositions is difficult to define uniformly depending on the type and state of the food or composition, but the AdoMet content is 10 to 5000 mg / 1 meal, preferably 100-1000 mg / meal, about 10-100% in the case of supplements (preferably 30-100%, more preferably 50-100%, even more preferably 80-100%) In the case of beverages or general foods, it may be about 0.01% or less.

(Pharmaceutical composition)
The present invention also provides for the administration of an effective amount of a therapeutic agent to a subject to alleviate liver damage, reduce mortality due to cirrhosis, have a therapeutic effect on depression, treat arthritis, In order to reduce pain in osteoarthritis, to promote functional recovery in osteoarthritis, to promote anti-inflammatory action, to promote cartilage protection action, to promote cartilage regulation action, to promote cartilage stabilization action A pharmaceutical composition for promoting, promoting cartilage metabolism, improving Alzheimer's disease, or improving peripheral neuropathy or myelopathy due to HIV infection is provided. By therapeutic agent is meant a composition of the invention in combination with a pharmaceutically acceptable carrier type (eg, a sterile carrier).

  The therapeutic agent is considered to be a medical practice standard (GMP = good) taking into account the clinical condition of the individual patient (especially the side effects of the therapeutic agent alone treatment), the site of delivery, the method of administration, the dosage regimen and other factors known to those skilled in the art. Formulate and dose in a manner consistent with medical practice. Therefore, the target “effective amount” in the present specification is determined by taking such consideration into consideration.

  As a general suggestion, the total pharmaceutically effective amount of orally administered therapeutic agent per dose is in the range of about 2 μg / kg / day to 1000 mg / kg / day of patient body weight, as described above. This is left to therapeutic discretion. More preferably, for the extracts of the present invention, this dose is at least 10 mg / kg / day, most preferably between about 20 mg / kg / day and about 1000 mg / kg / day for humans. Also, as a general suggestion, the total pharmaceutically effective amount of the therapeutic agent administered parenterally per dose is in the range of about 0.2 μg / kg / day to 250 mg / kg / day of patient weight. As noted above, this is left to therapeutic discretion. More preferably, for the extract of the invention, this dose is at least 1 mg / kg / day, most preferably between about 5 mg / kg / day and about 25 mg / kg / day for humans.

  For example, the recommended daily dose of AdoMet for the treatment of liver disorders (eg cholestasis) is 800 mg parenterally or 1600 mg orally. For parenteral administration in depression, AdoMet in an amount of 200-400 mg / day may be given over 15-20 days. For oral treatment, it is typically in the AdoMet dose range of 400-1600 mg / day.

  Therapeutic agents are orally, rectally, parenterally, in the bath, vaginally, intraperitoneally, topically (such as by powders, ointments, gels, drops, or transdermal patches), by mouth, orally or by nasal spray Can be administered. A typical route of administration of the pharmaceutical composition of the present invention is oral administration.

  “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulant or any type of formulation adjuvant.

  The therapeutic agents of the present invention are also suitably administered by a sustained release system. Suitable examples of sustained release therapeutic agents are oral, rectal, parenteral, intracisternal, intravaginal, intraperitoneal, topical (such as by powder, ointment, gel, infusion, or transdermal patch), It can be administered by mouth or as an oral or nasal spray. “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulant or any type of formulation adjuvant. The term “parenteral” as used herein refers to modes of administration including intravenous and intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injections and infusions.

  The therapeutic agents of the present invention are also suitably administered by a sustained release system. Suitable examples of sustained release therapeutic agents include suitable polymer materials (eg, semipermeable polymer matrices in the form of molded articles (eg, films or microcapsules)), suitable hydrophobic materials (eg, in acceptable quality oils). Or an ion exchange resin, and poorly soluble derivatives (eg, poorly soluble salts).

  Sustained release matrices include polylactide (US Pat. No. 3,773,919, EP 58,481), a copolymer of L-glutamic acid and γ-ethyl-L-glutamate (Sidman et al., Biopolymers 22: 547-556 (1983)). ), Poly (2-hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res. 15: 167-277 (1981), and Langer, Chem. Tech. 12: 98-105 (1982)), ethylene vinyl Acetate (Langer et al., Ibid.) Or poly-D-(-)-3-hydroxybutyric acid (EP133,988).

  Sustained release therapeutic agents also include the therapeutic agents of the present invention encapsulated in liposomes (generally, Langer, Science 249: 1527-1533 (1990); Treat et al., Liposomes in the Infectious Disease and Cancer, Loop, -See Berstein and Fiddler (eds.), Liss, New York, pages 317-327 and 353-365 (1989)). Liposomes containing therapeutic agents can be prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. USA 82: 3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. USA 77: 4030-4034 (1980); EP52,322; EP36,676; EP88,046; EP143,949; EP142,641; Japanese Patent Application No. 83-118008; US Pat. No. 4,485,045 And 4,544,545 and EP 102,324. Usually, liposomes are small (about 200-800 cm) unilamellar type, where the lipid content is greater than about 30 mol% cholesterol, and the selected proportion is adjusted for optimal therapeutic agents.

  In still further embodiments, the therapeutics of the invention can be delivered by a pump (Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987); Buchwald et al., Surgary 88: 507 ( 1980); Saudek et al., N. Engl. J. Med. 321: 574 (1989)).

  Other controlled release systems are discussed in the review by Langer (Science 249: 1527-1533 (1990)).

  For parenteral administration, in one embodiment, in general, the therapeutic agent is toxic to the recipient in the desired degree of purity, in a pharmaceutically acceptable carrier, i.e. the dosage and concentration used. It is formulated by mixing in a unit dosage injectable form (solution, suspension or emulsion) with one that is not and compatible with the other ingredients of the formulation. For example, the formulation preferably does not include oxidation and other compounds known to be harmful to therapeutic agents.

  Generally, formulations are prepared by contacting the therapeutic agent uniformly and intimately with liquid carriers or finely divided solid carriers or both. Next, if necessary, the product is shaped into the desired formulation. Preferably, the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Nonaqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as are liposomes.

  The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such substances are not toxic to the recipient at the dosages and concentrations used, such as phosphate, citrate, succinate, acetic acid and other organic acids or their salts. Buffering agents; antioxidants such as ascorbic acid; low molecular weight (less than about 10 residues) polypeptides (eg, polyarginine or tripeptides); proteins such as serum albumin, gelatin or immunoglobulins; polyvinylpyrrolidone Hydrophilic polymers such as: amino acids such as glycine, glutamic acid, aspartic acid or arginine; monosaccharides, disaccharides and other carbohydrates including cellulose or derivatives thereof, glucose, mannose or dextrin; chelating agents such as EDTA Sugar sugars such as mannitol or sorbitol Lumpur; counterions such as sodium; and / or polysorbate include nonionic surfactants such as poloxamers or PEG.

  The therapeutic agent is typically formulated in such vehicles at a concentration of about 10 mg / ml to 1000 mg / ml, preferably 50 to 1000 mg / ml, at a pH of about 6-9. It is understood that by using the specific excipients, carriers or stabilizers described above, salts are formed.

  Any drug to be used for therapeutic administration may be in a state free of organisms / viruses other than viruses as an active ingredient, that is, in a sterile state. Aseptic conditions are easily achieved by filtration through sterile filtration membranes (eg, 0.2 micron membranes). In general, the therapeutic agent is placed in a container having a sterile access port, for example, an intravenous solution bag or vial with a stopper puncturable with a hypodermic needle.

  The therapeutic agents are typically stored in unit dose or multi-dose containers, such as sealed ampoules or vials, as an aqueous solution or lyophilized formulation for reconstitution. As an example of a lyophilized formulation, a 10 ml vial is filled with 5 ml of a sterile filtered 5% (w / v) aqueous therapeutic agent and the resulting mixture is lyophilized. The lyophilized therapeutic agent is reconstituted with bacteriostatic water for injection to prepare an infusion solution.

  The present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more components of the therapeutic agent of the present invention. A notice of the form prescribed by a government agency that regulates the manufacture, use or sale of a medicinal product or biological product may be attached to such a container, and this notice may be attached to the government regarding the manufacture, use or sale for human administration. Represents institutional approval. In addition, the therapeutic agent may be used in combination with other therapeutic compounds.

  The therapeutic agents of the present invention can be administered alone or in combination with other therapeutic agents. The combination can be administered, for example, either simultaneously as a mixture; simultaneously or concurrently but separately; or over time. This includes the presentation that the combined agents are administered together as a therapeutic mixture, and also the procedure where the combined agents are administered separately but simultaneously, eg, through separate intravenous lines to the same individual . Administration in combination further includes separate administration of one of the compounds or agents given first, followed by the second.

(General biochemistry / molecular biology)
(General technology)
Molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described in, for example, Sambrook J. et al. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 3rd Ed. (2001); Ausubel, F .; M.M. (1987). Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience; Ausubel, F .; M.M. (1989). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associate ES and Wiley-Interscience; A. (1990). PCR Protocols: A Guide to Methods and Applications, Academic Press; Ausubel, F .; M.M. (1992). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Ausubel, F .; M.M. (1995). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Greene Pub. Associates; Innis, M .; A. et al. (1995). PCR Strategies, Academic Press; Ausubel, F .; M.M. (1999). Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, and annual updates; J. et al. et al. (1999). PCR Applications: Protocols for Functional Genomics, Academic Press, “Experimental Methods for Gene Transfer & Expression Analysis”, Yodosha, 1997, etc., which are related in this specification (may be all) Is incorporated by reference.

  For DNA synthesis technology and nucleic acid chemistry for producing artificially synthesized genes, see, for example, Gait, M. et al. J. et al. (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPpress; Gait, M .; J. et al. (1990). Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F .; (1991). Oligonucleotides and Analogues: A Practical Approach, IRL Press; Adams, R .; L. etal. (1992). The Biochemistry of the Nucleic Acids, Chapman &Hall; Shabarova, Z. et al. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, G .; M.M. et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, G .; T.A. (I996). Bioconjugate Technologies, Academic Press, etc., which are incorporated herein by reference in the relevant part.

  References such as scientific literature, patents and patent applications cited herein are hereby incorporated by reference in their entirety to the same extent as if each was specifically described.

  The present invention has been described with reference to the preferred embodiments for easy understanding. In the following, the present invention will be described based on examples, but the above description and the following examples are provided only for the purpose of illustration, not for the purpose of limiting the present invention. Accordingly, the scope of the present invention is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims.

  The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to the following examples.

(General example)
(Used strain)
As sake yeast in the present invention, Saccharomyces cerevisiae sake Kyokai No. 7 (a / α ura3Δ :: LYS4 / ura3Δ :: LYS4 his3 / his3; RAK2359) (Association No. 7 mutant, hereinafter referred to as K7-RAK2359) was used. Moreover, as a comparison target of the novel mutant yeast strain of the present invention, FERMP-19715 strain (available from the National Institute of Advanced Industrial Science and Technology, Patent Biological Consignment Center) in which the SAH1 ^T279I mutation was introduced into laboratory yeast was used.

(Culture method)
As a seed culture, YPD (20 g / L glucose, 20 g / L polypeptone, and 10 g / L yeast extract) was spread on a YPD agar flat medium in which agar was added at 20 g / L. Agar flat medium grown at 28 ° C. for 1 day or longer was stored at 4 ° C. (˜1 week). As a preculture, one colony grown on a flat agar medium was inoculated into a test tube containing 2 mL of YPD and cultured at 28 ° C. for 24 hours using a test tube rotator. As the main culture, 1 mL of the preculture medium was inoculated into a 500 mL Erlenmeyer flask containing 100 mL of YPD, and cultured with shaking at 28 ° C. and 150 rpm.

(Measurement of the amount of cells and glucose)
About 2 mL of a sample was appropriately collected, and the turbidity (OD660) of the diluted culture solution was measured with a spectrophotometer (U-2800 manufactured by HITACHI) (turbidity is a conversion factor f = 0 obtained from the results so far). .Converted to dry cell weight (cDCW) using .6581). 1 mL of the culture solution was centrifuged (12,000 rpm, 10 minutes), and the cells were washed with 1 mL of deionized water, then dried overnight at 105 ° C., and the dry cell weight (DCW) was measured. Further, the residual glucose concentration (RGC) in the supernatant was measured using a glucose analyzer (GLU-11 manufactured by TOA).

(Measurement of AdoMet and AdoHcy levels)
After adding 375 μL of a 10% perchloric acid solution to the cells separated from 1 mL of the culture solution, the mixture was extracted at room temperature for 1 hour using a test tube shaker, and AdoMet in the supernatant obtained by centrifugation. Concentration and AdoHcy concentration were measured using HPLC (10AD vp system manufactured by SHIMADZU). The HPLC conditions were as follows: Column; UK-C18 (manufactured by Intakt), column temperature; 40 ° C., detection wavelength: 260 nm, flow rate: 0.4 mL / min, mobile phase: 20 mM KH ₂ PO ₄ : Methanol = 92: 8, sample amount: 10 μL.

(Isolation of yeast chromosomal DNA)
Pick a single colony of yeast strain cultured for 18 hours at 28 ° C. and incubate it in YPD plate medium or 3 ml YPD liquid medium at 28 ° C. for 18-24 hours. When cultured in a liquid medium, the cells are precipitated by centrifugation at 12,000 rpm for 3 minutes. 300 μl of SET (1.2 M sorbitol, 20 mM Tris-HCl, and 10 mM EDTA (pH 7.5)) was added to the cells collected from the plate medium or the cells precipitated by this centrifugation, followed by 20 μl. Add Zymo solution (3 mg / ml Zymolase 100T in SET-10% β-MeOH; 3 mg Zymolase 100T, 0.9 ml SET and 0.1 ml β-mercaptoethanol) and vortex. Leave at 37 ° C. for 30 minutes, add 50 μl SDS and mix by hand. Add 200 μl of phenol / chloroform (Phe / Chl) and vortex for 20-30 seconds. Centrifuge at 12,000 rpm for 3 minutes, transfer the supernatant to a tube containing 800 μl of 99.5% ethanol and 34.8 μl of 3M NaOAc and mix by hand. To the precipitate from which the supernatant has been removed, 200 to 300 μl of TE (10 mM TRIS-HCl, 1 mM EDTA, pH 7.5) is added, and then 2 μl of 10 mg / ml RNase is added and left at 37 ° C. for 15 minutes. Add 200 μl Phe / Chl to this and vortex for 20-30 seconds. Centrifuge at 12,000 rpm for 3 minutes, transfer the supernatant to a tube containing 500 μl of 99.5% ethanol and 20 μl of 3M NaOAc and mix by hand. Precipitation is performed by centrifuging at 12,000 rpm for 3 minutes, the supernatant is discarded, and 100 to 200 μl of TE is added to the precipitate to obtain a yeast chromosomal DNA solution.

(Yeast transformation)
The cells are collected from the refrigerator stock of the host strain, and are rotated and cultured in 2 ml of YPD medium at 28 ° C. for 24 hours. 1 ml of the culture solution is inoculated into 9 ml of YPD medium, and cultured with shaking at 28 ° C. for 5 hours. The culture is centrifuged at 8,000 rpm for 1 minute and the supernatant is discarded. Add 10 ml of distilled water to the precipitate and vortex. Subsequently, it is made to precipitate by centrifuging at 8,000 rpm for 1 minute, and this is made into Cell solution. 120 μL of 60% PEG3350, 5 μl of 4M LiOAc, 10 μl of 10 μg / ml carrier DNA, 5 μl of DNA (PCR product or plasmid), and 60 μl of Cell solution (total 200 μl) (where PEG and LiOAc and Are premixed and the carrier and DNA are premixed) and vortexed. Here, 10 μg / ml carrier DNA was heat-treated at 97 ° C. for 3 minutes and then immersed in ice water for 5 minutes. Leave at 42 ° C. for 60 minutes, add 100 μl of distilled water, apply to an appropriate selective medium plate and leave at 28 ° C. for 3 days. A single colony is streaked on a selective medium plate and allowed to stand at 28 ° C. for 1 day to be used as a transformant.

(Purification of DNA)
Phenol / chloroform method Dissolve DNA in 50 μl of distilled water and add 50 μl of Phe / Chl to it. Vortex and centrifuge at 6,000 rpm for 2 minutes. Transfer the supernatant to another tube and vortex it with 5 μl 3M NaOAc and 120 μl 99% EtOH. This is incubated at −20 ° C. for 10 minutes and vortexed. This is then precipitated by centrifuging at 12,000 rpm for 2 minutes. To this precipitate, 200 μl of 70% EtOH is added and this is centrifuged at 12,000 rpm for 2 minutes. The resulting precipitate is dried and dissolved in 10 μl of distilled water to obtain a DNA solution.

Ethanol precipitation Dissolve DNA in 10 μl of distilled water, add 1 μl of 3M NaOAc and 20 μl of 99% EtOH and vortex. This is incubated at −20 ° C. for 10 minutes and then centrifuged at 12,000 rpm for 5 minutes. Add 200 μl of 70% ethanol to the precipitate and centrifuge it at 12,000 rpm for 5 minutes. The resulting precipitate is dried and dissolved in 10 μl of distilled water to obtain a DNA solution.

(Example 1: Introduction of AdoMet hyperaccumulation mutation into K7 strain)
・ Synthesis of Mutant Gene Fragment Amplification of the mutated gene site was performed ^using pUC119-SAH1 ^T279I (Mizunuma et al., PNAS, April 20, 2004, vol. 101, No. 16, p. ^6086-6091 containing the AdoMet high accumulation mutant gene. ) As a template,
Forward primer;
SAH1-282: AAGTATCCCCTACTCTCTCCTCTC (SEQ ID NO: 3), or SAH1atg50-ERV: ATGTCTGCTCCCAGCTCAAAACTACAAAATCCGCTGAATTTTCTTTGCTGC (SEQ ID NO: 4)
Reverse primer;
SAH1-1350c: TCAATCTCTGTAGTGTCGGCCCTTG (SEQ ID NO: 5), or SAH1-1450c: ATTGCAATTTTATTTATGATCTTTTT (SEQ ID NO: 6),
Using KOD plus (manufactured by TOYOBO), amplification was performed under the PCR conditions shown below.
First denaturation (94 ° C. for 1 minute);
30 cycles of denaturation (94 ° C. for 20 seconds), annealing (55 ° C. for 30 seconds) and extension (68 ° C. for 1.5 minutes).
(This condition is referred to as PCR condition 1 in this specification.) From the obtained PCR product, only the target band was cut out by electrophoresis to obtain a mutant gene fragment.

-Synthesis of selectable marker 1 Amplification of selectable marker 1 is carried out by using pSc HIS3TDH3p (Akada et al., Yamaguchi University; Hashimoto et al., Appl. Environ. Microbiol., 2005, 71, 312- when HIS3 is used as selectable marker 1. 319) as a template and URA3 as the selectable marker 1 when pST106 (Akada et al., Yamaguchi University; Kakihara et al., ITE Lett., 2005, 135-139. In this paper, it is called pScURA3TDH3p) As a template
Forward primer;
SAH1 + 1350 + ASC: CCATTCAGGGCCGACCACTACAGATATTGAGGCGCGCCCG (SEQ ID NO: 7), or SAH1 + 1450 + ASC: ATCAAAAAAGATCATAAATAAATTGCAAATGGCGCGCCCG (SEQ ID NO: 8),
Reverse primer;
SAH1d100-40cTDHu1: GTATTAATACTGTGATAGGATTGTTAGCTGTTTTTTTTAGGCAGTATTGATAAT (SEQ ID NO: 9)
Was amplified under PCR condition 1 using KOD plus (manufactured by TOYOBO). From the obtained PCR product, only the target band was cut out by electrophoresis and used as a selection marker 1.

Synthesis of mutant gene fragment containing selectable marker 1 A mutant gene fragment containing selectable marker 1 is obtained by using the mutant gene fragment and selectable marker 1 as a template.
Forward primer; SAH1-282 (SEQ ID NO: 3), or SAH1atg50-ERV (SEQ ID NO: 4),
Reverse primer; SAH1d100-40cTDHu1 (SEQ ID NO: 9)
Was amplified under the following PCR conditions using KOD plus (manufactured by TOYOBO).
First denaturation (94 ° C. for 1 minute);
30 cycles of denaturation (94 ° C. for 20 seconds), annealing (55 ° C. for 30 seconds) and extension (68 ° C. for 3 minutes).
(This condition is referred to herein as PCR condition 2.) It was confirmed by electrophoresis that a mutant gene fragment containing the selection marker 1 was obtained, and this was transformed into the K7 strain. The number of transformants obtained is shown in Table 1.

Using the resulting chromosomal DNA of the transformant (see the general examples above) as a template,
Forward primer;
SAH1 + 304: GCCTGGAAGGGTGGAAACTGAAG (SEQ ID NO: 10)
Reverse primer;
SAH1-1350c (SEQ ID NO: 5)
Was amplified under PCR condition 1 using KOD plus (manufactured by TOYOBO). The PCR product was purified by Phe / Chl treatment (see general example above) and treated with restriction enzyme BsrI (65 ° C., 3 h). After DNA purification (see general examples above), bands were confirmed by electrophoresis (not shown). In Wild Type (SAH1), there are two BsrI sites and three bands of 536, 226 and 225 bp are observed during electrophoresis, but the mutant gene fragment (SAH1T279I) has a mutation in one BsrI site 761 , 226 bp two bands can be seen. Therefore, in the K7 strain which is a diploid, when the mutation is introduced, four bands of 761, 536, 226 and 225 bp are observed.

  Regarding the transformants shown in Table 1, as a result of electrophoresis of PCR products and BsrI-treated PCR products, introduction of mutant gene fragments containing markers was confirmed in all combinations.

(Example 2: disruption of paired gene (SAH1 wild type))
1. Disruption of SAH1 by substitution with selectable marker 2 Amplification of selectable marker 2 can be achieved by using pSc HIS3TDH3p (Akada et al., Yamaguchi University; Hashimoto et al., Appl. Environ. Microbiol., 2005) when HIS3 is used as selectable marker 2. 71, 312-319) as a template and URA3 as a selectable marker 2 when pST106 (Akada et al., Yamaguchi University; Kakihara et al., ITE Lett., 2005, 135-139. In this paper, it is called pScURA3TDH3p. Forward primer as a template;
SAH1-401: CTCTCTCGAAAATAACCCAACTGACAAAAAGAAACAATTCCCAGGCGGCCCCG (SEQ ID NO: 11),
Reverse primer;
SAH1d100-40cTDHu1 (SEQ ID NO: 9)
Was amplified under PCR condition 1 using KOD plus (manufactured by TOYOBO). After confirming that the target selectable marker 2 was obtained by electrophoresis, the strain obtained above was transformed into the introduced strain. Here, HIS3 was used for selection marker 2 for those using URA3 for selection marker 1, and URA3 was used for selection marker 2 for those using HIS3 for selection marker 1.

2. Destruction by insertion of selectable marker 2 into SAH1 Amplification of selectable marker 2 is performed using pScHIS3TDH3p as a template for HIS3 and pST106 as a template for URA3.
Forward primer;
SAH1-501-401: ATACAGAATGGTCAAAGAAGGCAAGTTAAAGGTTCCTGCCGGCCGCGCCCG (SEQ ID NO: 12),
Reverse primer;
SAH1-500c-TDHu1: AAGTGGTGAACACCGGTGGGTAGTTCTTCGGGAAAGCCAAGGCAGATTATTATATAAT (SEQ ID NO: 13)
1. Transformation was performed in the same manner as described above.

  Above 1. And 2. Table 2 shows the number of the novel yeast mutants of the present invention obtained in (1).

Using the chromosomal DNA of the obtained transformant as a template, a forward primer; SAH1 + 304 (SEQ ID NO: 10) and a reverse primer; SAH1-1350c (SEQ ID NO: 5) are used, and amplified under PCR condition 1 using KOD plus. The PCR product was purified by Phe / Chl treatment and then treated with restriction enzyme BsrI (65 ° C., 3 h). The DNA was purified by EtOH precipitation and the band was confirmed by electrophoresis (not shown). In the wild type (SAH1), there are two BsrI sites and three bands of 536, 226 and 225 bp are seen during electrophoresis, but in the mutant gene fragment (SAH1T279I), a mutation is introduced into one BsrI site 761 , 226 bp two bands can be seen. Therefore, when the paired gene is destroyed by substitution or insertion, two bands of 761, 226 bp are observed.

A transformant (S-U (2) /) which was disrupted by amplifying a mutant gene fragment using URA3 as marker 1 by the method of (2) in Table 1 and inserting it into a counter gene using HIS3 as marker 2 ^Hin ; sah1 ^T279I- URA3 (2) / HIS3 (in)) and HIS3 for marker 1 and the mutant gene fragment was amplified by the method of (10) in Table 1 and replaced with URA3 for marker 2 (SH (10) / U rep; sahl ^T279I- HIS3 (10) / URA3 (rep)), and those destroyed by insertion into a paired gene (SH (10) / U in; sah1 ^T279) It was confirmed that 16 strains such as I-HIS3 (10) / URA3 (in)) were obtained. S-H (10) / U rep; sah1 ^T279I- HIS3 (10) / URA3 (replacement) was deposited with the National Institute of Advanced Industrial Science and Technology, Patent Biological Consignment Center (deposition number FERM P-21305 (deposit date: June 14, 2007)). However, the present invention is not limited to this FERM P-21305 strain, and all AdoMet high-producing yeast strains produced by the method of the present invention are within the scope of the present invention.

(Example 3: AdoMet productivity comparison)
1. Comparison of AdoMet production ability between the new yeast mutant and K7 (parent) strain Using the parent K7 strain as a control, the mutant gene fragment containing the selectable marker 1 is transformed, and the counter gene (SAH1 wild type) remains (S-U (2) / WT (U (2) / WT); sah1 ^T279I- URA3 (2) / SAH1, SH- (10) / WT (H (10) / WT); sah1 ^T279I- HIS3 ( 10) / SAH1), and a mutant gene fragment containing three types of acquired selectable marker 1 and transformed with the selectable marker 2 disrupted (SU (2) / ^Hin ; sah1 ^T279I − ^{URA3 (2) / HIS3 (in} ), S-H (10) / U rep; sah1 T279I -HIS3 (10) / URA3 (rep), S-H (10) / ^{in; sah1 T279 I-HIS3 (} 10) / URA3 a culture compared to a total of 6 strains of (in)) was carried out. Moreover, it has been reported that the mutant gene fragment (sah1 ^T279I ) exhibits temperature sensitivity (Japanese Patent Laid-Open No. 2005-261361, Mizunuma et al., PNAS, April 20, 2004, vol. 101, No. 16, p. The main culture is started at 28 ° C., and the culture temperature is increased to 37 ° C. from the time when the amount of residual sugar is depleted. It was verified whether it also appeared in yeast strains.

  When cultured at 28 ° C., the strain transformed with the mutant gene fragment containing the selectable marker 1 did not change much in the AdoMet content, but it was expected to have an AdoMet content of 8-9 times by disrupting the paired genes. A large increase was confirmed outside. Furthermore, in the culture in which the culture temperature was shifted from 28 ° C. to 37 ° C., the AdoMet content increased by 1.2 to 1.5 times for each strain. From these results, the AdoMet content could be increased up to about 12 times that of the parent strain. Similar results can be obtained for the other 13 strains.

2. Comparison of AdoMet Content between New Yeast Mutant and FERMP-19715 Strain AdoMet between the novel yeast mutant of the present invention and FERMP-19715 strain (available from the National Institute of Advanced Industrial Science and Technology (AIST)) Content and AdoHcy content were compared as described above.

From the above results, the yeast (FERMP-19715 strain) having a mutant S-adenosylhomocysteine hydrolase gene, about 8 times to about 12 times that of sake yeast having no S-adenosylhomocysteine hydrolase gene mutation. It was revealed that a novel yeast strain producing a large amount of AdoMet was produced approximately 74 to 90 times as large as). Similar results can be obtained for the other 13 strains. Since the novel yeast strain of the present invention is prepared by self-cloning, AdoMet produced by this yeast strain is very safe for human consumption.

  Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and the disclosed embodiments. The specification and examples are to be regarded as illustrative only, with the true scope and spirit of the invention being indicated only by the appended claims.

FIG. 1A shows the dry cell weight (upper), AdoMet content and AdoHcy content (lower) of the control K7 strain. FIGS. 1B and C show that the mutant gene fragment containing the selectable marker 1 was transformed and the counter gene (SAH1 wild type) remained, but the dry cell weight (upper), AdoMet content and AdoHcy content (lower) ). FIGS. 1D to F show that the mutant gene fragment containing the obtained selectable marker 1 was transformed and the counter gene was disrupted with the selectable marker 2, but the dry cell weight (upper), the AdoMet content and the AdoHcy content ( (Lower). FIG. 2 shows an outline of the production pathway of S-adenosylmethionine in cells.

SEQ ID NO: 1 = Nucleic acid sequence of wild-type S-adenosylhomocysteine hydrolase SEQ ID NO: 2 = Amino acid sequence of wild-type S-adenosylhomocysteine hydrolase SEQ ID NO: 3 = Primer SAH1-282
SEQ ID NO: 4 = Primer SAH1atg50-ERV
SEQ ID NO: 5 = primer SAH1-1350c
SEQ ID NO: 6 = primer SAH1-1450c
Sequence number 7 = primer SAH1 + 1350 + ASC
SEQ ID NO: 8 = primer SAH1 + 1450 + ASC
SEQ ID NO: 9 = primer SAH1d100-40cTDHu1
SEQ ID NO: 10 = primer SAH1 + 304
SEQ ID NO: 11 = Primer SAH1-401
SEQ ID NO: 12 = primer SAH1-501-401
SEQ ID NO: 13 = primer SAH1-500c-TDHu1

Claims (23)

A yeast having a mutant S-adenosylhomocysteine hydrolase gene introduced by a self-cloning method, wherein the mutant gene is a substitution, deletion or insertion of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2. And / or a yeast encoding a protein having an amino acid sequence comprising an addition, wherein the protein has reduced S-adenosylhomocysteine hydrolysis activity compared to a protein having the amino acid sequence shown in SEQ ID NO: 2. The yeast according to claim 1, wherein the yeast is sake yeast. The yeast according to claim 2, wherein the sake yeast is FERM P-21305. The yeast according to claim 1, wherein the yeast is diploid. The yeast according to claim 1, comprising the marker gene for self-cloning. The yeast of claim 1, wherein the yeast is diploid or higher polyploid,
(I) a mutated gene encoding a protein having reduced S-adenosylhomocysteine hydrolyzing activity compared to a protein having the amino acid sequence shown in SEQ ID NO: 2, wherein the mutated gene is represented by SEQ ID NO: 2 A mutant gene encoding an amino acid sequence comprising one or more amino acid substitutions, deletions, insertions and / or additions in the amino acid sequence shown; and (ii) a disrupted S-adenosylhomocysteine hydrolase gene. The protein encoded by the disrupted gene is a protein that does not have S-adenosylhomocysteine hydrolyzing activity, wherein the gene has one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2. Disrupted genetics that encode amino acid sequences containing substitutions, deletions, insertions and / or additions ,
Having yeast. The yeast of claim 1, wherein the yeast is diploid or higher polyploid,
(I) a mutated gene encoding a protein having reduced S-adenosylhomocysteine hydrolyzing activity compared to a protein having the amino acid sequence shown in SEQ ID NO: 2, wherein the mutated gene is represented by SEQ ID NO: 2 A mutant gene encoding an amino acid sequence comprising one or more amino acid substitutions, deletions, insertions and / or additions in the amino acid sequence shown; and (ii) a nucleic acid encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2. A nucleic acid whose S-adenosyl homocysteine hydrolysis activity of the encoded protein is equivalent to the S-adenosyl homocysteine hydrolysis activity of a protein having the amino acid sequence shown in SEQ ID NO: 2,
Having yeast. The yeast according to claim 1, wherein the mutation is a T279I point mutation. A method for producing a yeast that accumulates metabolites, comprising a step of introducing mutations into an enzyme gene that degrades metabolites using a self-cloning method,
Wherein the metabolite-degrading activity of the protein encoded by the mutant gene is reduced as compared to the protein encoded by the wild-type enzyme gene. The method according to claim 9, wherein at least two kinds of markers for self-cloning are used.
(I) transforming the yeast using a first self-cloning method with a first marker and a first mutant gene; and (ii) a second self with a second marker and a second mutant gene. Further transforming the yeast transformant obtained in (i) using a cloning method,
Including the method. The method according to claim 10, wherein the first mutant gene and the second mutant gene are the same. The method according to claim 10, wherein the first mutant gene and the second mutant gene are different. The method according to claim 9, wherein at least two kinds of markers for self-cloning are used.
(I) transforming the yeast using a first self-cloning method with a first marker and a first mutant gene; and (ii) using a second self-cloning method with a second marker, A step of further transforming the yeast transformant obtained in (i),
Including the method. The method of claim 9, wherein the metabolite is S-adenosylmethionine. The method according to claim 9, wherein the yeast is sake yeast. 15. The method of claim 14, wherein the mutation is a substitution, deletion, insertion and / or addition of one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2. 17. The method of claim 16, wherein the mutation is a T279I point mutation. A yeast produced by the method according to any one of claims 9 to 17. The composition for eating and drinking containing the yeast of any one of Claims 1-8 or Claim 18. A pharmaceutical composition comprising the yeast according to any one of claims 1 to 8 or claim 18. The culture liquid of the yeast of any one of Claims 1-8 or Claim 18. A composition for eating and drinking comprising the culture solution according to claim 21. A pharmaceutical composition comprising the culture medium of claim 21.