JP2008509672A - Method for detecting thyroid cancer - Google Patents

Abstract

  A method of detecting thyroid cancer in a subject comprises obtaining a nucleic acid sample from a body sample of the subject, and the nucleic acid sample comprises at least one of thyroid stimulating hormone receptor (TSHR) mRNA or thyroglobulin (Tg) mRNA. Including determining whether to include.

Description

  The present application relates to a method of detecting thyroid cancer in a subject and a method of detecting thyroid cancer using a nucleic acid based assay.

  It is estimated that between 4-7% of the population has thyroid nodules. The literature reports that 5-30% of these nodules are malignant. The main consideration in these cases in diagnosis is the elimination of malignancy. Currently, the method that provides the best preoperative prediction of the nature of these nodules is fine needle aspiration biopsy (FNA) of the lesion. The use of FNA reduces the number of thyroidectomy performed and increases the malignant yield in the resected lesion. However, cases of inappropriate lesion sampling and duplication of cytological features of benign and malignant thyroid neoplasms are inherent limitations of this technique. A major FNA limitation is that it is impossible to distinguish between fully differentiated follicular carcinoma and benign vesicular adenoma. Patients with follicular thyroid neoplasm usually undergo thyroidectomy and about 15% have malignant lesions. Reliable pre-operative prediction of benign lesions will greatly reduce the number of unnecessary surgery.

  Cancer cells circulate in peripheral blood and lymphatic vessels before metastasis occurs at a distant site. Detection of these cells provides a tool for the initial diagnosis of cancer and its metastatic potential. RT-PCR is a sensitive and powerful technique in detecting the presence of specific cell types in the circulation based on its ability to identify tissue / tumor specific mRNA transcripts. A specific thyroid marker, reverse transcription polymerase chain reaction (RT-PCR) of Tg has been utilized to detect circulating thyroid cancer cells. Many researchers have detected circulating Tg mRNA in normal subjects, and therefore their use is limited only to detect residual / recurrent thyroid cancer in patients undergoing thyroidectomy. ing. The success of a PCR-based assay largely depends on a combination of the following factors: sample processing procedure, RNA purity, PCR primer location, cycling conditions, and signal detection method.

<Related applications>
The present invention claims priority from US Provisional Patent Application No. 60 / 600,589, filed Aug. 11, 2004, which is incorporated herein by reference in its entirety.

  One aspect of the present invention relates to a method of detecting thyroid cancer in a subject. The method includes obtaining a nucleic acid sample from a body sample of the subject, and determining whether the nucleic acid sample contains thyroid stimulating hormone receptor (TSHR) mRNA. THSR mRNA can be determined by amplifying a segment of TSHR mRNA in the nucleic acid sample and detecting the presence of an amplified portion of TSHR mRNA. Amplification can be performed using a pair of primers complementary to the TSHR mRNA transcript. In one embodiment of the invention, the primer pair can have a nucleotide sequence comprising SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

  Another aspect of the invention relates to a pre-operative assay for determining whether a thyroid neoplasm in a subject is benign or malignant. The pre-operative assay includes obtaining a nucleic acid sample from a body sample of a subject and determining whether the nucleic acid sample contains thyroid stimulating hormone receptor (TSHR) mRNA. THSR mRNA can be determined by amplifying a segment of TSHR mRNA in the nucleic acid sample and detecting the presence of an amplified portion of TSHR mRNA. Amplification can be performed using a pair of primers complementary to the TSHR mRNA transcript. In one embodiment of the invention, the primer pair can have a nucleotide sequence comprising SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

  A further aspect of the invention relates to a kit for detecting thyroid cancer in a subject. The kit includes a pair of primers capable of amplifying a segment of TSHR mRNA. The segment to be amplified can comprise at least a portion of exons 6-9 of TSHR mRNA. In one embodiment of the invention, the primer can comprise at least 10 contiguous nucleotides and can have a nucleotide sequence comprising SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

  Another aspect of the invention relates to a pre-operative assay for determining whether a thyroid neoplasm in a subject is benign or malignant. This pre-operative assay involves obtaining a nucleic acid sample from a body sample of a subject and determining whether the nucleic acid sample contains thyroglobulin mRNA. Tg mRNA can be determined by amplifying a segment of Tg mRNA in a nucleic acid sample and detecting the presence of an amplified portion of Tg mRNA. Amplification can be performed using a pair of primers complementary to the Tg mRNA transcript. In one embodiment of the invention, the primer pair can have a nucleotide sequence comprising SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

  A further aspect of the invention relates to a kit for detecting thyroid cancer in a subject. The kit includes a pair of primers capable of amplifying a segment of Tg mRNA. The segment to be amplified can include at least a portion of exons 1-5 of Tg mRNA. In one embodiment of the invention, the primer can comprise at least 10 contiguous nucleotides and can have a nucleotide sequence comprising SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

  These and other aspects of the present invention will become apparent to those skilled in the art to which the present invention relates upon reading the following description with reference to the accompanying drawings.

  The invention can be readily understood by reference to the following detailed description of embodiments of the invention, as well as the Examples and Sequence Listing included herein.

  As used in the specification and claims, the following terms have the meanings ascribed unless expressly stated to the contrary.

  The phrases “specific for”, “specific for” and “unique for” TSHR mRNA or Tg mRNA as used herein in connection with nucleic acids or nucleic acid fragments It means a nucleic acid or nucleic acid fragment that is not common to mRNA.

  The term “fragment” as used herein in connection with nucleic acids, for example, to function properly as a hybridization primer in, for example, polymerase chain reaction (PCR) or another mode characteristic of nucleic acids. It refers to a subsequence of nucleic acids that is of sufficient size and confirmation.

  The term “isolated” refers to the use of nucleic acids or nucleic acid fragments in clinical diagnostic, experimental or other procedures, such as hybridization assays or amplification reactions for TSHR mRNA or Tg mRNA. It is meant to be pure enough to be good and to function properly. Many procedures are known to those skilled in the art for purifying nucleic acids, nucleic acid fragments, and materials with which they can usually accompany prior to their use in various procedures.

  The term “substantially similar” in reference to a nucleic acid sequence of the invention, or a nucleotide sequence complementary to a nucleotide sequence of the invention, refers to a nucleic acid sequence of the invention or a nucleic acid complementary to the nucleic acid sequence of the invention. Similar to the sequence and retains the function of such a nucleic acid, but such by the substitution, deletion and / or addition of one or more nucleotides and / or by the incorporation of some other advantageous feature It refers to a nucleic acid different from a different nucleic acid. Nucleotide sequences of the present invention are those where these percentages are from 100% to 80%, or from 0 base mismatches in 10 nucleotide sequences to 2 base mismatches in 10 nucleotide sequences. Is substantially similar to the nucleic acid sequence. In some embodiments, this percentage is from 100% to 85%. In other embodiments, the percentage is from 90% to 100%, and in still other embodiments, the percentage is from 95% to 100%.

  The present invention provides a method of detecting thyroid cancer in a subject. This method can be used as a pre-operative (eg, pre-thyroidectomy) assay to determine whether a thyroid neoplasm in a subject is benign or malignant. This method can also be used as a post-surgical assay to monitor the recurrence of metastatic thyroid cancer after thyroidectomy.

  In accordance with one aspect of the present invention, the method of the present invention comprises obtaining an appropriate nucleic acid sample from a subject's body sample and whether the nucleic acid sample comprises thyroid stimulating hormone receptor (TSHR) mRNA. The determining step can include detecting thyroid cells circulating in the body sample of the subject.

  As described herein, a “body sample” is any body sample from the subject's body (from which a nucleic acid sample can be obtained to determine whether the nucleic acid sample contains a marker sequence. For example, body fluid). An example of this is blood, specifically peripheral blood. However, one skilled in the art will recognize other body samples such as fine needles that can determine whether a sample contains TSHR mRNA in order to determine whether circulating thyroid cells are present. Aspirate and bronchial fluid can be obtained.

  One skilled in the art will be able to practice the present invention in a variety of subjects, such as animals, but specifically humans.

  The presence of TSHR mRNA can be determined by detecting the target nucleotide sequence of TSHR mRNA. It has been found that at least part of a nucleic acid sequence comprising mRNA corresponding to a reverse transcript of DNA encoding TSHR can be used as a target nucleotide sequence for nucleic acids utilized in the detection and differentiation of thyroid neoplasms. I came. The phrase “target nucleotide sequence” refers to a region of a nucleotide that is amplified, detected, or otherwise analyzed. By way of example, a portion of a nucleic acid sequence comprising TSHR mRNA that can be used as a target nucleotide sequence according to the present invention comprises exons 6-9 of TSHR mRNA.

  In one aspect of the invention, the target nucleotide sequence is obtained by amplifying a target nucleotide sequence of a nucleic acid sequence comprising mRNA corresponding to a reverse transcript of DNA encoding TSHR, and detecting the amplified target sequence. Can be detected. The target nucleotide sequence of the present invention can be amplified by selectively hybridizing with oligonucleotide primers that promote transcription and replication of at least a portion of TSHR mRNA (or reverse transcript of TSHR mRNA). The term “hybridize” as used herein refers to two single-stranded nucleic acids resulting from complete (100%) or less than (less than 100%) complementary base pairing. Refers to the formation of a double-stranded structure. Hybridization occurs between completely complementary nucleic acid strands or between less than perfect complementary nucleic acid strands, including regions of mismatch due to substitution, deletion or addition of one or more nucleotides. Can do.

  The oligonucleotide primers of the present invention serve as priming or starting positions for the action of primer-dependent polymerase activity. The oligonucleotide primer comprises a nucleic acid sequence that is specific for TSHR mRNA and can be used to amplify the target nucleotide sequence. The target nucleotide sequence is defined by the contiguous nucleotides of TSHR mRNA, eg, nucleotides of exons 6-9 of TSHR mRNA.

  The oligonucleotide primers of the present invention comprise a pair of oligonucleotide primers that hybridize to a nucleotide sequence adjacent to the target nucleotide sequence so that synthesis by the action of a polymerase such as Taq polymerase proceeds through the region between the two primers. be able to. This is advantageous because, after several rounds of hybridization and replication, the amplified target nucleotide sequence produced is a segment that has a defined length defined by the site at which both ends hybridize to the primer. It is.

  An oligonucleotide primer capable of specifically (or selectively) hybridizing to TSHR mRNA according to the present invention can comprise at least about 10 nucleotides. As an example, the oligonucleotide primer can comprise about 10 to about 40 nucleotides, more specifically about 15 to about 35 nucleotides. This oligonucleotide primer may be of sufficient length and complementary to a portion of the nucleotide sequence of TSHR mRNA to form a duplex with sufficient stability for the intended purpose. For example, an oligonucleotide primer is of sufficient length and targeted TSHR so that the polymerization agent can continue to replicate from the primer forming a stable duplex with the target sequence under polymerization conditions. It should contain a nucleic acid sequence with complementarity to the mRNA.

  Examples of nucleic acid sequence pairs that can be used in pairs of nucleotide primers include SEQ ID NOs: 1 and 2. SEQ ID NO: 1 is a forward primer comprising the following nucleotide sequence: 5'GCTTTTCAGGGGACTATGCAA-TGAA3 '. SEQ ID NO: 2 is a reverse primer comprising the following nucleotide sequence: 3'AGAGTTTGGTCACAGTGACGGGAA5 '. SEQ ID NOs: 1 and 2 are capable of amplifying a 212 base pair segment of exons 6-9 of TSHR mRNA when used as oligonucleotide primers.

  Other oligonucleotide primers of the invention are substantially complementary to nucleic acid sequences complementary to SEQ ID NOS: 1-2, nucleic acid sequences substantially similar to SEQ ID NOS: 1-2, and nucleic acid sequences complementary to SEQ ID NOS: 1-2. A nucleic acid sequence similar to, a fragment of SEQ ID NO: 1-2 that specifically hybridizes to TSHR mRNA, a fragment of a nucleic acid sequence complementary to SEQ ID NO: 1-2 that specifically hybridizes to TSH mRNA, specific to TSHR mRNA A fragment of a nucleic acid sequence substantially similar to SEQ ID NO: 1-2 that hybridizes to the nucleic acid, and a nucleic acid sequence substantially similar to a nucleic acid sequence complementary to SEQ ID NO: 1-2 that specifically hybridizes to TSHR mRNA Those skilled in the art will recognize that these fragments can be included. It is also recognized that oligonucleotide primers can contain other nucleic acid sequences as long as these nucleic acid sequences specifically hybridize to TSHR mRNA and specifically amplify exons 6-9 of TSHR mRNA. It will be.

  The nucleic acid used to form a TSHR mRNA oligonucleotide primer according to the present invention can be obtained from TSHR mRNA. The resulting nucleic acid need not be physically obtained from TSHR mRNA, and may be generated in any manner, including, for example, chemical synthesis, DNA replication, reverse transcription, or transcription, and RNA and peptide nucleic acids (PMA) May be generated.

  TSHR mRNA oligonucleotide primers according to the present invention may be made by methods well known in the art, eg, chemical synthesis. TSHR mRNA oligonucleotide primers may be synthesized manually or mechanically. They may also be synthesized by recombinant methods using products incorporating viral and bacterial promoters.

  TSHR mRNA oligonucleotide primers can be used in amplification assays that detect at least a portion of TSHR mRNA. In one aspect of the invention, oligonucleotide primers can be used in polymerase chain reaction (PCR) assays. In a PCR assay, the nucleic acid of the body sample is contacted with an oligonucleotide primer that is specific for TSHR mRNA and can be used to amplify the target nucleotide sequence. The target nucleotide sequence can be defined, for example, by consecutive nucleotides from exons 6-9 of TSHR mRNA. PCR amplification is then performed on the resulting mixture with a temperature program and number of temperature cycles sufficient to amplify the target nucleotide sequence of TSHR mRNA, if present. PCR amplification can be performed in any commercially available PCR temperature cycling apparatus. For example, PCR amplification can be performed using rapid temperature cycling techniques. Rapid temperature cycling techniques use high surface area versus volume sample containers, such as capillaries, to contain reaction amplified samples. Using a high surface area to volume sample container allows for rapid temperature response and temperature homogeneity throughout the sample. The resulting rapid temperature cycling is in contrast to conventional temperature cycling in that 30 cycles of amplification can be completed within 15 minutes and the PCR amplification product contains fewer byproducts. Thus, using rapid temperature cycling techniques, the time required for amplification is reduced by a factor of about 10 and specificity is improved.

  One skilled in the art will recognize that TSHR mRNA primers as well as other nucleic acids complementary to TSHR mRNA nucleic acids can also be used in other assays, such as RAPD assays or other amplification assays.

  The amplified target nucleotide sequence, if present, can then be detected using known detection techniques. These detection techniques can be qualitative and / or quantitative. Examples of detection techniques that can be used according to the invention include visualization of restriction enzyme digestion patterns determined by gel electrophoresis, sequencing of amplified target nucleotide sequences, amplified nucleotides using oligonucleotide hybridization probes Sequence detection is included. Copy number and quantification can be performed by standard hybridization procedures such as Southern analysis or Northern analysis. When an oligonucleotide hybridization probe is used for detection, the oligonucleotide hybridization probe can include a pair of nucleic acid sequences that are labeled using a fluorescence resonance energy transfer (FRET) pair.

  If the detection method (eg, melting point analysis) results in the presence of the target nucleotide sequence amplified by the oligonucleotide primer, it is concluded that the original sample contains TSHR mRNA. Conversely, if no evidence of the target nucleotide sequence is detected, it is concluded that the sample does not contain TSHR.

  Optionally, the polymerase chain reaction (PCR) amplification step and the detection step of the method of the invention are performed essentially simultaneously. This essentially simultaneous PCR amplification and detection step is performed in one apparatus comprising a rapid temperature cycler component and a fluorescence detection component. One example of such a device is described in US Pat. No. 6,140,540, the disclosure of which is incorporated herein by reference. A preferred device comprising a rapid temperature cycler component and a fluorescence detection component is commercially available from Roche Molecular Biochemicals, Indianapolis, Indiana, USA under the trademark LIGHTCYCLER.

  The level of TSHR mRNA detected in a body sample obtained from a subject can be compared to a predetermined value. The predetermined value can be based on the level of TSHR mRNA in a comparable sample obtained from a general population of human subjects or from a selected population. For example, the selected population may be composed of visually healthy subjects. By “apparently healthy” as used herein is meant an individual who has not previously shown any signs or symptoms indicative of the presence of a disease such as thyroid cancer. In other words, such individuals will be characterized as being healthy and free of disease symptoms when tested by medical professionals.

  The predetermined value can be related to the value used to characterize the level of TSHR mRNA in a body sample obtained from the subject. Thus, if the level of TSHR mRNA is an absolute value, the predetermined value is also based on the units of TSHR mRNA in the general population or individuals in a selected population of human subjects. Similarly, if the level of TSHR mRNA is a representative value, such as an arbitrary unit, the predetermined value is also based on this representative value.

  The predetermined value can take various forms. The predetermined value may be a single cutoff value, such as median or average. A given value is compared if, for example, the level of systemic marker in one defined group (eg, the level of TSHR mRNA) is twice the level of systemic marker in another defined group. Can be established based on groups. The predetermined value may be a range, where, for example, the general population is divided into equal (or unequal) groups or quadrants, with the lowest quadrant being the individual with the lowest level of systemic marker The highest quadrant is the individual with the highest level of systemic markers.

  The predetermined value can be obtained by determining the level of TSHR mRNA in the general population. Alternatively, the predetermined value can be obtained by determining the level of TSHR mRNA in the selected population. Thus, the predetermined value selected may take into account the category in which the individual is included. Appropriate ranges and categories can be selected using no more than routine experimentation by those skilled in the art.

  Predetermined values of TSHR mRNA, such as mean level, median level, or “cut-off” level, are established by assaying large samples of individuals in the general or selected population and using statistical models. The This statistical model is described, for example, in Knapp, RG and Miller, MC (1992) .Clinical Epidemiology and Biostatistics.William and Wilkins, Harual Publishing Co. Malvern, Pa., Specifically incorporated herein by reference. To select positive criteria or receiver operator characteristic curves that define optimal specificity (maximum true negative ratio) and sensitivity (maximum true positive ratio) Predictive value method. A “cut-off” value can be determined for each systemic marker assayed.

  The level of TSHR mRNA prior to surgery (ie, before thyroidectomy) detected in the subject's body sample is to classify the thyroid neoplasm in the subject, ie, the thyroid neoplasm is benign or A single predetermined value or a range of predetermined values may be compared to determine whether it is malignant and the extent of the disease. A pre-operative level of TSHR mRNA in a body sample of a subject that is higher than a predetermined value or range of predetermined values can indicate that the subject has a malignant lesion. A preoperative level of TSHR mRNA in a subject's body sample that is lower than a predetermined value or range of values indicates that the subject has a benign thyroid neoplasm, such as that associated with a vesicular adenoma be able to.

  The level of TSHR mRNA after surgery (ie, after thyroidectomy) detected in a subject's body sample is also compared to a single predetermined value or a range of predetermined values for recurrence of thyroid cancer. May be. A post-operative level of TSHR mRNA in a body sample of a subject that is higher than a predetermined value or range of predetermined values can indicate recurrent / residual thyroid cancer. A post-operative level of TSHR mRNA in a subject's body sample that is lower than a predetermined value or a range of predetermined values can indicate the absence of thyroid cancer, and the subject has no unnecessary surgical intervention. I can do it.

  The present invention is further directed to kits for identifying and detecting TSHR mRNA in body samples by nucleic acid based assays. The kit includes at least a pair of oligonucleotide primers. The pair of oligonucleotide primers is specific for TSHR mRNA and may be used to amplify a target nucleotide sequence defined by contiguous nucleotides, such as from exons 6-9 of TSHR mRNA. The nucleic acid sequence can be included.

  In one example of the invention, the kit includes a pair of oligonucleotide primers. The oligonucleotide primer comprises at least 10 consecutive nucleotides that are capable of selectively amplifying exons 6-9 of TSHR mRNA. As an example, the oligonucleotide primer can have a nucleic acid sequence comprising SEQ ID NOs: 1 and 2. Optionally, the kit may also include one or all of the reagents necessary to initiate a PCR amplification reaction and fluorescent detection of the oligonucleotide probe.

  In accordance with another aspect of the invention, a method for detecting thyroid cancer in a subject comprises obtaining an appropriate nucleic acid sample from a body sample of the subject and whether the nucleic acid sample contains thyroglobulin (Tg) mRNA. The determining step can include detecting thyroid cells circulating in the body sample of the subject.

  The presence of Tg mRNA can be determined by detecting the target nucleotide sequence of Tg mRNA. By way of example, a portion of a nucleic acid sequence comprising Tg mRNA that can be used as a target nucleotide sequence according to the present invention comprises exons 1-5 of Tg mRNA.

  In one aspect of the invention, the target nucleotide sequence is obtained by amplifying a target nucleotide sequence of a nucleic acid sequence comprising mRNA corresponding to a reverse transcript of DNA encoding Tg and detecting the amplified target sequence. Can be detected. The target nucleotide sequences of the present invention can be amplified by selectively hybridizing with oligonucleotide primers that promote transcription and replication of at least a portion of Tg mRNA (or reverse transcript of Tg mRNA).

  An oligonucleotide primer capable of specifically (or selectively) hybridizing to Tg mRNA according to the present invention can comprise at least about 10 nucleotides. As an example, the oligonucleotide primer can comprise from about 10 to about 40 nucleotides, more particularly from about 15 to about 35 nucleotides. Oligonucleotide primers can be of sufficient length and complementary to a portion of the nucleotide sequence of Tg mRNA to form a duplex with sufficient stability for the intended purpose. For example, an oligonucleotide primer can be of sufficient length and targeted Tg so that the polymerization agent can continue to replicate from the primer forming a stable duplex with the target sequence under polymerization conditions. It should contain a nucleic acid sequence with complementarity to the mRNA.

  Examples of nucleic acid sequence pairs that can be used in pairs of nucleotide primers include SEQ ID NOs: 3 and 4. SEQ ID NO: 3 is a forward primer comprising the following nucleotide sequence: 5 'AGGGAAACGCGCTTTCTGAA 3' (SEQ ID NO: 3). SEQ ID NO: 4 is a reverse primer comprising the following nucleotide sequence: reverse 3 'CTTTAGC-AGC-AGAAGAGGTG5' (SEQ ID NO: 4). SEQ ID NOs: 3 and 4 are capable of amplifying a 407 base pair segment of exons 1-5 of Tg mRNA when used as oligonucleotide primers.

  Other oligonucleotide primers of the invention are substantially complementary to nucleic acid sequences complementary to SEQ ID NOs: 3-4, nucleic acid sequences substantially similar to SEQ ID NOs: 3-4, and nucleic acid sequences complementary to SEQ ID NOs: 3-4. , A fragment of SEQ ID NOs: 3 to 4 specifically hybridizing to Tg mRNA, a fragment of a nucleic acid sequence complementary to SEQ ID NOs: 3 to 4 specifically hybridizing to Tg mRNA, specific to Tg mRNA A fragment of a nucleic acid sequence that is substantially similar to SEQ ID NOs: 3-4 that hybridize specifically, and a nucleic acid sequence complementary to a nucleic acid sequence complementary to SEQ ID NOs: 3-4 that specifically hybridizes to Tg mRNA Those skilled in the art will recognize that these fragments can be included. Oligonucleotide primers may also contain other nucleic acid sequences as long as these nucleic acid sequences specifically hybridize to Tg mRNA and specifically amplify exons 1-5 of Tg mRNA. It will also be recognized.

  The nucleic acid used to form the Tg mRNA oligonucleotide primer according to the present invention can be obtained from Tg mRNA. Tg mRNA oligonucleotide primers according to the present invention can be made by methods well known in the art such as chemical synthesis. Primers may be synthesized manually or by machine. They may also be synthesized by recombinant methods using products incorporating viral and bacterial promoters.

  Oligonucleotide primers can be used in amplification assays that detect at least a portion of Tg mRNA. In one aspect of the invention, oligonucleotide primers can be used in polymerase chain reaction (PCR) assays. One skilled in the art will recognize that Tg mRNA oligonucleotide primers according to the present invention and other nucleic acids complementary to Tg mRNA nucleic acids can also be used in other assays such as RAPD assays or other amplification assays. Will.

  Amplified target nucleotide sequence, if present, is then amplified using visualization of restriction enzyme digestion pattern determined by gel electrophoresis, sequencing of amplified target nucleotide sequence, oligonucleotide hybridization probe It can be detected using known qualitative and / or quantitative detection techniques, such as detection of nucleotide sequences.

  The level of Tg mRNA prior to surgery (ie, prior to thyroidectomy) detected in the subject's body sample classifies the thyroid neoplasm in the subject, ie, the thyroid neoplasm is benign or A single predetermined value or a range of predetermined values may be compared to determine whether it is malignant and the extent of the disease. A pre-operative level of Tg mRNA in a body sample of a subject that is higher than a predetermined value or range of predetermined values can indicate that the subject has a malignant lesion. A preoperative level of Tg mRNA in a body sample of a subject that is lower than a predetermined value or range of predetermined values indicates that the subject has a benign thyroid neoplasm, such as that associated with a vesicular adenoma be able to.

  The level of Tg mRNA after surgery (ie, after thyroidectomy) detected in a subject's body sample is also relative to a single predetermined value or range of values for recurrence of thyroid cancer. May be compared. A post-operative level of Tg mRNA in a body sample of a subject that is higher than a predetermined value or range of predetermined values can indicate recurrent / residual thyroid cancer. A post-operative level of Tg mRNA in a subject's body sample that is lower than a predetermined value or a range of predetermined values can indicate the absence of thyroid cancer, and the subject has no unnecessary surgical intervention. I can do it.

  The present invention is further directed to a kit for identifying and detecting Tg mRNA in a body sample by a nucleic acid based assay. The kit includes at least a pair of oligonucleotide primers. The pair of oligonucleotide primers is specific for Tg mRNA and may be used to amplify a target nucleotide sequence defined by consecutive nucleotides such as from exons 1-5 of Tg mRNA. The nucleic acid sequence can be included.

  In one example of the invention, the kit includes a pair of oligonucleotide primers. The oligonucleotide primer comprises at least 10 consecutive nucleotides that are capable of selectively amplifying exons 1-5 of Tg mRNA. As an example, the oligonucleotide primer can have a nucleic acid sequence comprising SEQ ID NOs: 3 and 4. Optionally, the kit may also include one or all of the reagents necessary to initiate a PCR amplification reaction and fluorescent detection of the oligonucleotide probe.

  Those skilled in the art will understand and appreciate variations of the method according to the present invention. For example, it will be appreciated that the methods of the invention can be used with other detection methods known in the art, such as FNA. It will further be appreciated that the present invention can be used as a means to monitor the efficacy of therapeutic agents used to treat thyroid carcinoma. These therapeutic agents can be administered in combination before and after thyroidectomy.

  The invention is illustrated by the following examples. This example is presented to assist in understanding the present invention, but is not intended to and is interpreted in any way to limit the invention as set forth in the appended claims. Should not be done.

[Example 1]
=== Detection of TSH receptor mRNA and thyroglobulin mRNA transcripts in peripheral blood of patients with thyroid disease: a sensitive and specific marker of the thyroid gland ===
Thyroglobulin production by normal and neoplastic thyroid tissue is both dependent on the presence of functional TSH receptor (TSHR) and affected by TSH levels. We investigated the sensitivity and specificity of detection of TSHR mRNA and Tg mRNA by RT-PCR in peripheral blood from normal subjects and patients with thyroid cancer and patients with benign thyroid disease. .

[Method]
[Subject]
51 normal subjects with no history of thyroid disease (female: male = 1.7; age range 25-60 years), 27 patients with benign thyroid disease (female: male = 3.5; age range) A total of 153 patients were evaluated, including 18 patients (aged 18-77) and 75 patients with differentiated thyroid cancer (DTC) (female: male = 3.2; age range 20-80 years). Among the 27 patients with thyroid disease benign, 3 patients has thyroiditis, 18 patients have solitary thyroid nodules or multi goiter, 3 patients with decompensated T ₄ therapy With 3 primary hypothyroidism and 3 with Graves' disease.

  Of the DTC patients, 67 (89%) had undergone total thyroidectomy and 65 (83%) had undergone radioiodine (RAI) excision at least one year prior to the mRNA test. The remaining 8 patients all had newly diagnosed papillary thyroid cancer and were examined before thyroidectomy. All DTC patients were evaluated during an outpatient visit in the Department of Endocrinology, Diabetes and Metabolism at the Cleveland Clinic Foundation. A chart review was performed to obtain a history of each patient, surgical / pathological reports, and laboratory and radiological studies.

  The pathology, disease status, treatment status, and Tg antibody status of 75 patients with thyroid cancer are listed in Table 1.

[Table 1]
=== Characteristics of patients with thyroid cancer ===

Administration of 49 patients on T ₄ suppression, 7 after T ₄ withdrawal, and recombinant human TSH (rhTSH) (Thyrogen, Genzyme Transgenics Corp., Cambridge, Mass.) 11 example in the 49 patients evaluated during .T ₄ treatments were studied after 41 patients (86%), within 12 months from the date of the test, before 4 patients of the test 24 Received diagnostic radioactive iodine scan within ˜48 months; all were monitored using serum thyroglobulin measurements, and the disease was diagnosed if the scan was negative and / or they had undetectable Tg levels 4 had no available scans; 2 of these had recurrent disease (1 had lung, 1 had nodular metastasis) One example is negative The other had an undetectable graded serum Tg level and no clinical evidence of disease.Patients had three other imaging procedures and pathological tests in 3 cases They did not receive RAI treatment after their last full body scan (WBS) except they had known metastatic disease as confirmed by.

Blood samples for TSHR mRNA and Tg mRNA were collected at various intervals from the first day of surgery. Simultaneous serum levels of TSH (Roche Diagnostics, NJ) and Tg (Quest Diagnostics, CA) were measured by an immuno-chemiluminescent assay (ICMA) and the sensitivity was defined as 1.0 μg / L. Tg antibodies were also measured in most patients in an enzyme immunoassay (EIA; Tosoh Medics Inc., CA). Follow-up WBS (24) for Tg values ≧ 1.0 μg / L in patients tested during T ₄ treatment and ≧ 2.0 μg / L in patients tested after rh-TSH administration or after T ₄ withdrawal. Considered to be a significant indicator for. All patients in the T ₄ suppression, except that between 1.0~2.8mU / L in 5 patients with TSH is <had TSH values 1.0mU / L (61% is TSH < 0.1). All patients studied after T ₄ discontinued, with the exception of one case (TSH of 19mU / L), it had a greater TSH values than 30 mU / L.

Our RAI scanning procedure included cervical uptake 24 hours after administration of a ¹³¹ I tracer dose (100 μCi) and measurement of diagnostic WBS obtained 48 hours after administration of a 5 mCi dose of ¹³¹ I. Was included. Patients tested after rh-TSH (2 days, 0.9 mg intramuscularly) received 5 mCi dose of ¹³¹ I, 24 hours later received a second dose of rhTSH, and then received WBS at 48 hours It was. Blood samples for both TSH / Tg mRNA as well as Tg measurements were taken simultaneously prior to scanning. The scans were reviewed by nuclear medicine physicians and showed positive uptake when they showed visible uptake in the thyroid bed and / or separate local uptake was usually present at sites that did not take up ¹³¹ I Considered. Patients were classified as having evidence of disease if they had positive WBS or had a disease diagnosed by pathology or found by other non-radioactive iodine imaging modalities.

[RT-PCR]
Approximately 3-5 mL of whole blood (collected in EDTA-treated tubes) is mixed with an equal volume of PBS pH 7.4, overlaid with 8 ml Ficoll (Pharmacia) and 400 × 20 min at 4 ° C. for 20 min. c. The mononuclear cell layer was collected, washed and pelleted. RNA was isolated using Trizol reagent (Invitrogen, CA) according to the manufacturer's instructions. A ratio of optical density of A _260/280 was used to assess the quality and quantity of isolated RNA. 1-2 μg of total RNA was reverse transcribed into cDNA using the Superscript Pre-amplification System (Invitrogen, Calif.) According to the manufacturer's instructions.

  PCR was performed using the selected primer pairs. The primer sequences are as follows: TSHR: Forward 5 ′ GCTTTTCAGGGGACTATGCAA-TGAA3 ′ (SEQ ID NO: 1); No. 3); reverse 3 ′ CTTTAGC-AGC-AGAAGAGGTG5 (407 bp) ′ (SEQ ID NO: 4); ubiquitously expressed control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is also RNA extracted And analyzed using previously reported primers to confirm the success of RT and PCR reactions. PCR was performed for 38 cycles (94 ° C. for 1 minute (first cycle is 2 minutes), 62 ° C. for 1 minute, 72 ° C. for 1 minute (last cycle is 10 minutes)). RT-PCR products were separated by 2% gel electrophoresis and visualized by ethidium bromide staining. The estimated sensitivity for these assays was tested by serial dilution of thyroid cancer tissue RNA with RNA obtained from normal peripheral blood mononuclear cells and found to be 10 cancer cells / mL of blood.

[Statistical analysis]
Data were analyzed for diagnostic sensitivity and specificity of TSHR mRNA and Tg mRNA, serum Tg and WBS for detection of recurrent / residual thyroid cancer. Comparison of sensitivity and specificity between markers was performed using Fisher's exact test. P <0.05 was considered significant.

[result]
[TSHR mRNA in normal control and benign thyroid disease]
The results are summarized in Table 2. All 51 normal controls were negative for both TSHR and Tg mRNA. Twenty-four (89%) of 27 patients with benign thyroid disease are negative for both TSHR mRNA and Tg mRNA, including 15 patients with thyroid nodules. Of the 3 positive patients, 2 had massive obstructive goiter (100 and 300 gm, 10 × 8 × 3 cm and 11 × 11 × 5 cm) and the third had follicular adenoma. The diagnosis of all three patients was confirmed by surgical pathology.

＊Ｔ_４治療に対し≧１μｇ／Ｌ；Ｔ_４中止またはｒｈ ＴＳＨ後≧２μｇ／Ｌのカットオフを使用
＊＊２例の患者は塊状の閉塞性甲状腺腫を有し、１例は小胞状腺腫を有する
†ＮＡ＝適用なし [Table 2]
=== TSHR mRNA and Tg mRNA positivity in healthy normal thyroid function subjects, benign thyroid disease patients and thyroid cancer patients with no evidence of disease ===

* ≧ 1 μg / L for T ₄ treatment; use cutoff of ≧ 2 μg / L after T ₄ withdrawal or rh TSH ** Two patients have massive obstructive goiter and one has vesicular adenoma † NA = not applicable

[TSHR mRNA in patients with thyroid cancer]
FIG. 1 shows representative RT-PCR products for TSHR (212 bp), Tg (407 bp) and GAPDH (397 bp) obtained in 9 thyroid cancer patients, 1 normal subject and positive thyroid cancer control. Indicates. Table 3 summarizes the results obtained in 67 previously treated DTC patients and 8 patients with DTC tested prior to surgical resection.

＊Ｔ_４治療に対し≧１μｇ／Ｌ；Ｔ_４中止またはｒｈ ＴＳＨ後≧２μｇ／Ｌのカットオフを使用
＊＊Ｎ＝８；＊＊＊Ｎ＝２９；†ＮＡ＝適用なし [Table 3]
=== TSHR mRNA, Tg mRNA and serum Tg levels in patients with thyroid cancer ===

* ≧ 1 μg / L for T ₄ treatment; use cutoff of ≧ 2 μg / L after T ₄ withdrawal or rh TSH ** N = 8; *** N = 29; † NA = not applicable

49 patients with TC were tested between T ₄ treatment. Eight of these patients had distant metastases, 10 had local recurrence or cervical lymph node disease, and the remaining 31 had no disease. Table 3 lists the% positives obtained with TSHR mRNA, Tg mRNA, serum Tg levels and WBS. Both TSHR mRNA and Tg mRNA were positive in all patients with distant metastases or local disease. Also, serum Tg was detected in all but one case of patients with recurrent disease between T ₄ inhibition. Three of the seven vesicular adenocarcinomas with evidence of disease, and all three patients with Hürtre cell carcinoma were positive for both TSHR and Tg mRNAs.

  In 31 patients with no evidence of disease, no TSH-R mRNA was detected, and Tg mRNA was detected in 2 cases (6%). These two patients had undetectable serum Tg values and negative WBS and remained disease free at 1 year follow-up.

The seven patients were tested after T ₄ discontinued. One case showed evidence of local recurrence in WBS and was positive for both TSH-R and Tg mRNA. Of six patients with no evidence of disease WBS, although one patient was positive for both TSH-R mRNA and Tg mRNA, had undetectable serum Tg values after _{T 4} discontinued. The latter one had a serum Tg value after discontinuation of 55.5 ng / ml (negative antibody; negative for TSH-R mRNA and Tg mRNA), undetectable Tg value, negative WBS and T after 1 year It was found to have negative thyroid ultrasound with ₄ treatments. The cause of this single high Tg level is not clear.

  Eleven patients were tested after rh-TSH. None of them showed evidence of disease. One case was positive for Tg mRNA but negative for TSH-R mRNA and WBS. This patient had a serum Tg value of 2.3 ng / ml after rh-TSH. One year later, serum Tg after rh-TSH was undetectable despite no treatment being given. Three consecutive Tg levels after subsequent WBS and thyroid collection were negative so far, and the patient was considered to have no evidence of disease.

[Tg mRNA in patients with anti-Tg antibodies:]
14 patients (21%) with DTC had anti-Tg antibodies. Eleven of the 14 patients had no evidence of disease; all had undetectable serum Tg levels (measurements were sham in the presence of Tg antibody) and all had TSH -R was negative for mRNA. All three patients with local disease are positive for both TSHR and Tg mRNA, including one that is negative for serum Tg.

[Diagnostic ability of TSH-mRNA]
Table 4 summarizes the diagnostic capabilities of TSHR mRNA and compares those using Tg mRNA, serum Tg levels and WBS to detect recurrent / metastatic disease.

Ｂ．性能の特徴

[Table 4]
=== Diagnostic ability of TSH-R mRNA, Tg mRNA, serum Tg level and ¹³¹ I uptake / WBS in previously treated thyroid cancer patients ===
A. TSHR mRNA positivity: Comparison with Tg mRNA, serum Tg and WBS

B. Performance characteristics

There was no statistically significant difference between these markers and both TSHR mRNA and Tg mRNA had equal sensitivity for detection of residual / recurrent disease (P = 0.209, Fisher's Direct probability test). Two patients with NED (negative scan and subsequent undetectable Tg levels) had elevated serum Tg levels, one after T ₄ withdrawal and another after rh-TSH. Negative for both TSHR and Tg mRNAs. WBS was not performed in 4 patients and was negative in 3 patients with evidence of disease (2 had lung metastases and 1 had nodular metastases (sensitivity = 82% )). The agreement between TSHR mRNA and Tg mRNA, and between TSHR mRNA and serum Tg (in Tg antibody negative patients) was both 95%.

[Discussion]
The primary finding in this report is that the presence of TSHR mRNA signal in the blood is specific to patients with thyroid cancer that are undetectable in healthy subjects and in the majority of patients with benign thyroid disease It is. In addition, we have demonstrated the high specificity of Tg mRNA for thyroid cancer when carefully selected primers are used in the assay. Thyroid carcinoma is known to contain functional TSH receptors. To date, this target has not been utilized for the detection of circulating cancer cells, which indicates the presence of TSHR mRNA transcripts in peripheral blood mononuclear cells and other extrathyroid tissues. Probably due to previous reports. The discovery of these transcripts in extrathyroid tissue can be explained by TSHR splicing variants. Therefore, the selection of primers specific for thyroid cells is of paramount importance in the assay.

  There was a high agreement between TSH-R mRNA and Tg mRNA in our series. These Tg mRNA findings are in contrast to many previous studies that used qualitative and quantitative RT-PCR to detect Tg mRNA signals in many normal subjects. As previously discussed, these differences are probably largely due to the choice of primer pairs, rather than other variables in assay sensitivity or methodology. Indeed, we have previously detected signals in controls using several primer pairs described in the literature as well. With specific primer pairs, it is possible that amplification of pseudogenes can produce false positive results. More likely to explain this discrepancy is the limit of the ability of PCR-based techniques to detect alternatively spliced variants that are amplified by selected primers.

  While other investigators have reported a much higher incidence (20-33%) of Tg mRNA positivity in patients with benign thyroid disease, we have 27 patients From 3 patients (11%) obtained false positive results. One of these false positives was a patient who was found to have a surgical pathological follicular adenoma. The distinction between follicular adenoma and follicular adenocarcinoma is currently possible only after surgical resection and formal histological examination. To date, there is no known marker that can reliably distinguish follicular adenoma from cancer. This is because, like follicular adenocarcinoma, a significant number of vesicular adenomas have Ras mutations and show galectin-3 immunostaining. Therefore, the discovery of circulating thyroid cells in patients with follicular adenoma is not unheard of and supports the notion that one follicular adenoma may represent a premalignant stage of follicular adenocarcinoma. The other two false positives are in patients with massive goiter, indicating that such patients may have circulating thyroid cells. Alternatively, latent DTC may have been overlooked in pathological examination. Nevertheless, most other benign nodules were negative, and 6 from 8 DTC patients tested before surgery were positive, so this study is based on benign thyroid nodules before surgery. May have potential uses in the differential diagnosis of cancer.

Our results indicate by RT-PCR that TSHR mRNA is a sensitive and specific marker in monitoring patients for recurrent or metastatic thyroid cancer. Our data also while the patient is in T ₄ suppressive therapy, exhibit high sensitivity and reliable serum Tg levels to detect most recurrent disease. Therefore, the RT-PCR assay may not prove to be a cost-effective alternative to serum Tg levels as an initial test. Its value is among patients whose Tg measurements are unreliable due to the presence of interfering Tg antibodies, heterophiles or other factors. In series of the present inventors, TSHR mRNA or Tg mRNA is between _{T 4} treatment, or were tested after thyroid hormone discontinuation were detected in all patients with local or distant metastases. Serum Tg levels were elevated (> 2.0 ng / mL) in all but one of these patients (positive Tg antibody) where a positive mRNA test would indicate a need for WBS. Furthermore, the discovery of negative TSHR mRNA or Tg mRNA signal could eliminate the need for WBS in 2 Tg positive patients and all Tg antibody positive patients with no evidence of disease.

  Among 48 DTC patients with no evidence of disease, TSHR mRNA was often less positive (2%) than Tg mRNA (8%). None of these positive patients had disease in a one-year review as evidenced by serum Tg levels and / or WBS. Nevertheless, these patients deserve careful monitoring. This is because they may have microscopic disease that is detected earlier by the Tg mRNA assay.

  Unlike previous reports that found Tg mRNA only in patients with papillary carcinoma but not in other histological types, we found that either Tg mRNA or TSH mRNA results based on tumor histology No difference is found in Among our patients, 3 of the 7 follicular adenocarcinoma patients and 3 of the Hürtre cell carcinoma patients with evidence of disease were positive for both TSHR and Tg mRNA. It was.

  In summary, the presence of either TSHR mRNA or Tg mRNA in peripheral blood is specific for the presence of residual / recurrent DTC disease and is comparable to serum Tg when monitoring Tg antibody-negative patients Sensitivity. However, in Tg antibody positive patients with unreliable serum Tg values, TSHR mRNA or Tg mRNA monitoring proves to be more cost effective by eliminating the need for WBS in mRNA negative patients. Furthermore, the high specificity of the mRNA test combined with our preliminary knowledge of its ability to detect thyroid cancer before surgery suggests a potential role in screening patients with thyroid nodules. To do.

[Example 2]
=== Thyrotropin / thyroglobulin messenger ribonucleic acid and fine needle aspiration cytology in peripheral blood: diagnostic synergy to detect thyroid cancer ===
[Patients and methods]
[patient]
A total of a thyroid disease that was referred to our endocrinology surgery outpatient and signed an informed consent form and was diagnosed with a benign, malignant or undecided malignant potential thyroid disease 72 ongoing patients were included in this study approved by the institutional review board. All 72 patients received pre-operative samples either during a laboratory study before surgery or on the day of surgery. Ultrasound-guided FNA biopsy is performed as a routine diagnostic task in 46 of 72 patients and when not performed at our facility, cytology slides are obtained and used in thyroid cytology. Re-examined by one of our pathologists with extensive expertise. Suitability criteria for FNA samples included a sufficient number of cells, abundant colloids, and at least six groups of benign vesicular cells composed of at least 10 cells each. Results were compared with pathological diagnosis after final surgery.

[RT-PCR]
The method already described in detail in Example 1 was used. Briefly, 5 ml of venous blood was collected and mononuclear cells were separated within 24 hours after collection using a Ficoll Hypaque gradient. RNA is extracted from mononuclear cells using TRIzol reagent (Life Technologies, Carlsbad, Calif.) Immediately after Ficoll separation, and 1 μg of Superscript II preamplification system. Reverse transcription was performed using (Life Technologies). PCR was performed using carefully selected primers based on specificity (no illegitimate transcription) as documented in our previous publication. PCR was performed for a total of 38 cycles [94 ° C. for 1 minute (first cycle 2 minutes), 62 ° C. for 1 minute, and 72 ° C. for 1 minute (last cycle 10 minutes)]. PCR products generated using RNA from thyroid cancer tissue and from peripheral blood samples (DTC patients) using the ABI-PRISM 310 gene analyzer (Applied Biosystems, Foster City, Calif.). They were sequenced using their BigDye Terminator v3.1 sequencing kit. The transcript sequence was identical to the TSHR mRNA sequence, confirming the presence of authentic receptor mRNA. Glyceraldehyde-3-phosphate dehydrogenase was used as a control for successful RNA extraction and transcription and PCR. RT-PCR products were separated on 2% gel electrophoresis and visualized by ethidium bromide staining. Images of the gel were generated using the “Gel-doc 1000” (Bio-Rad, Hercules, Calif.) System and software, “Live Mode” automation settings (embedding / exposure time, 0.2 seconds) I took it in.

[Data analysis]
TSHR mRNA and FNA results were compared to the final pathological diagnosis. The number of patients correctly classified by TSHR / Tg mRNA or by FNA, alone or in combination (diagnostic accuracy), was calculated and compared using the χ2 test.

[result]
A total of 72 patients were included in the study (61 women, 11 men; age range, 18-88 years; average 50 years). Forty-six of these patients performed FNA biopsies prior to surgery. Post-operative pathological diagnosis was used to classify patients into benign and malignant thyroid disease groups (Table 5). 61 patients (25 DTC and 36 benign) were included in the initial diagnosis (no prior thyroid surgery). Eleven patients had recurrent or malignant disease at the time of inclusion, and 10 of these had prior radioiodine removal.

[Table 5]
=== Patients classified according to final pathological diagnosis ===

  There was 100% agreement in the respective RT-PCR results for Tg mRNA and TSH-R mRNA. FIG. 1 shows representative RT-PCR products for TSHR (212 bp) and Tg (408 bp) in 7 patients. A total of 36 patients were positive by RT-PCR, including 29 of 36 cancer patients (sensitivity 80%) and 7 of 36 benign (specificity 80%) benign. Disease patients are included. Of the 25 patients initially diagnosed, 19 were positive by RT-PCR (sensitivity 72%) (Table 5). All false negatives included 3 patients with a pathological diagnosis of papillary thyroid cancer (PTC) and lymph node metastasis. False positives include 2 patients with follicular adenoma (FA), 1 patient with Hürtre cell adenoma, 1 patient with hyperplastic eosinophilic nodule, and very large multinodular goiter Three patients with (MNG) were included.

  Of the 46 patients using FNA, 22 were confirmed surgically as DTC. 18 of these 22 cases (82%) gave a definitive FNA result for PTC, 4 patients including 2 cases of follicular adenocarcinoma (FC) and 2 cases of PTC in MNC Had enough samples, but with no conclusions. Of 24 patients with benign disease confirmed surgically under FNA, 9 were critically benign (including 3 patients with large MNG) and 14 were sufficient No conclusion was reached (Table 6). In total, 18 of the 46 patients (39%) had sufficient samples, but the FNA biopsy results were inconclusive / inconclusive. The diagnostic sensitivity of FNA was 82%, but the overall diagnostic accuracy (efficacy) was only 61%. The results are summarized in Table 6.

[Table 6]
=== Diagnostic ability of FNA and TSHR mRNA in patients who have not previously undergone thyroid surgery ===

  If FNA was indeterminate on sufficient samples for cytological diagnosis (18 patients), RT-PCR was performed in 3 of 4 cancer patients and 14 patients with benign disease 11 cases were correctly classified (sensitivity 75%; specificity 78%). Only one patient with a PTC lesion in MNG was negative (false negative). The actual FNA results and RT-PCR results for these 18 patients with ambiguous FNA are summarized in FIG. Combined diagnostic sensitivity (95%) and diagnostic efficacy (89%) for RT-PCR and FNA were significantly higher than FNA alone (P = 0.001).

[Discussion]
In this study, 39% FNA biopsy was considered indeterminate. According to previous reports, the majority of these (78%) were indeed found to have benign histology. These uncertain thyroid nodules appear to be one of the most frustrating and challenging areas for endocrinologists and endocrine surgeons. Many studies have focused on FNA samples to identify molecular markers or marker combinations as a means to improve the accuracy of the diagnosis made by FNA. A reliable and satisfactory method that can distinguish the preoperative malignant potential in patients with thyroid nodules has not yet been proposed.

  Our results show that 78% (14 of 18) nodules diagnosed with circulating preoperative TSHR / Tg mRNA incorrectly classified as FNA and indeterminate FNA Acts as ancillary test to increase accuracy. Within the FNA indeterminate group, there were only 3 false positive patients and 1 false negative patient with TSHR / Tg mRNA. It is recognized that FNA cytology has a high sensitivity for PTC. Also in this series, FNA correctly identified all but two patients whose results were ambiguous. In comparison, RT-PCR was relatively insensitive to PCT and was negative in 7 patients, including 3 patients with lymph node metastasis. The factors responsible for these false negative results remain currently unknown and may include technical errors and sampling problems, or they may be due to poor reverse transcription or non-specific PCR May be related to inhibitors. Among these factors, technical errors are unlikely because a repeated analysis using a second round of PCR yielded the same results. It is possible that the efficiency of reverse transcription or PCR may be a limiting factor in this assay, and these factors are currently under investigation in our laboratory.

  On the other hand, as expected, FNA cannot distinguish between FC and FA. In this study, 7 patients had follicular neoplasms, and FNA was nondiagnostic for all but one. Thus, follicular neoplasms are often grouped together as thyroid lesions with an indeterminate or follicular pattern, requiring a significant number of FNAs and unnecessary diagnostic thyroid lobectomy. To date, as with FC, there is no known marker that can reliably distinguish FA from cancer because a significant number of FAs have Ras mutations and show galectin-3 immunostaining . It is suggested that some FAs may indicate a pre-malignant stage of FC. We found that circulating TSHR mRNA was high in detecting recurrent / residual disease in patients with all DTCs, regardless of histological type, including follicular cancer and Hürtre cell carcinoma. Sensitivity was demonstrated. In this study, this test detected both patients with FC as positive and 3 out of 5 FA as negative, thus 5 out of 7 follicular neoplasms. Classified correctly. Although the number of follicular neoplasms is low in this series, our results show the high ability of TSHR mRNA to distinguish between FA and FC, awaiting confirmation in future studies with more patients. In addition to 2 cases of FA, other false positives are 1 MNG with hyperplastic nodules, most Hürtre cell types, and 3 patients with extremely large MNG, such patients Suggested that it may have circulating thyroid cells. This may be due to the presence of high hyperplastic activity in the thyroid nodule, or there may be latent DTC that was overlooked in pathological studies.

  In conclusion, our results demonstrate that circulating TSHR / Tg mRNA is less sensitive than FNA to detect PTC in early diagnosis. However, TSHR / Tg mRNA shows promise for detecting FC that is often missed by FNA. Its value is in identifying benign thyroid disease among patients with ambiguous FNA. Overall, this may serve as a valuable adjunct to FNA to identify thyroid cancer from benign disease.

Example 3
=== Clinical Evaluation of Enhanced Qualitative and Quantitative RT-PCR Assay for TSHR mRNA in Peripheral Blood for Malignant Preoperative Diagnosis in Patients with Thyroid Nodular Disease ===
In this study, we used a more sensitive qualitative and quantitative RT-PCR assay for each newly diagnosed thyroid cancer patient entrusted to surgical resection. We will continue to study the clinical utility of this promising molecular marker to detect and quantify levels of TSHR before or after surgery in ongoing patients undergoing FNA for thyroid nodules.

  Our hypothesis is that a more sensitive quantitative measurement of TSH receptor mRNA in peripheral blood may further enhance cancer cell detection. This allows for a more accurate classification of thyroid nodules into benign and malignant lesions when next combined with thyroid FNA biopsy. In addition, the quantitative level may indicate the extent of the disease before surgery and may serve as a marker for residual / metastatic disease after surgery. This should lead to an improved selection of patients for thyroid surgery, thus eliminating the need for unnecessary surgical intervention for many patients.

[Materials and methods]
Blood collection / isolation of mononuclear cells and circulating epithelial cells
6 ml of venous blood is collected in EDTA treated tubes, placed on ice and processed as soon as possible. Whole blood is mixed with an equal volume of PBS pH 7.4 in a 15 ml polystyrene tube and overlaid with 8 ml Ficoll (Pharmacia). Samples are centrifuged at 400 xg for 20 minutes at 4 ° C. Mononuclear cell layers are collected, washed with PBS pH 7.4 and pelleted.

[RNA extraction]
RNA is isolated using Trizol reagent (Life Technologies) according to manufacturer's instructions. Briefly, Trizol reagent is added to the mononuclear cell pellet and incubated for 5 minutes at room temperature. A chloroform extraction is then performed. RNA in the aqueous phase is precipitated with isopropanol, washed with 75% ethanol, dried and resuspended in DEPC-treated water. A ratio of optical density of A _260/280 is used to assess the quality and quantity of isolated RNA.

[Enhanced quantitative one-step reverse transcription (cDNA synthesis) and PCR]
A Superscript III 1-step RT-PCR system using Platinum® Taq DNA polymerase (Invitrogen Inc) is used according to the manufacturer's instructions. Our preliminary data show a significant improvement in sensitivity with this more efficient RT system compared to using the Superscript II two-step procedure previously. Briefly, 25 μl reaction mixture containing 1 μl total RNA, 10 μM primer, Superscript II RT / Platinum Taq high fidelity enzyme mix (1 μl) and 25 μl autoclaved distilled water are placed in a thermocycler. . The first cycle is programmed for cDNA synthesis and pre-denaturation, 30 minutes at 55 ° C, then 2 minutes at 94 ° C. PCR is performed in 40 cycles of denaturation at 94 ° C. for 15 seconds, annealing at 60 ° C. for 30 seconds, and extension at 68 ° C. for 1 minute, and the reaction is completed at 70 ° C. for 5 minutes.

[Real-time PCR assay]
A one-step “Quantitech Syber Green RT-PCR” procedure and reagents from Qiagen Inc., Calif. Are used. Briefly, 25 μL of SYBR Green RT-PCR master mix, 2 μM (1 μL) of each primer and 500 ng (0.5 μL) of RNA template are added to the PCR tube. A thermocycler was prepared for cDNA synthesis at 50 ° C. for 30 minutes and an initial inactivation step at 95 ° C. for 15 minutes, followed by subsequent denaturation at 94 ° C. for 15 seconds, annealing at 60 ° C. for 30 seconds, and 30 at 72 ° C. Program for the first PCR cycle, totaling 40 cycles of extension in seconds. Melting curve analysis of RT-PCR products is performed to confirm specificity and to identify RT-PCR products. Total RNA preparation from thyroid cancer tissue is used as a reference preparation to generate a standard curve and to achieve relative quantification. At the same time, GAPDH, which is a housekeeping gene, is measured as an endogenous control and used to correct for inter-sample variation in RT-PCR efficiency and RNA loading.

[Patient population]
1. Patients with thyroid nodules: 100 consecutive patients with thyroid nodules on whom FNA is performed will be tested before FNA.
2. Newly diagnosed thyroid cancer: Fifty newly diagnosed patients with thyroid cancer referred to our surgical department will be tested before and after surgery.
3. Pediatric thyroid cancer: 10-20 patients younger than 18 years who represent thyroid nodules requiring FNA biopsy are studied before and after surgery.

[Statistical analysis (edited with the aid of Ed Mascha, Dept. of Biostatistics) Sample size calculation]
Based on our previous experience with the less sensitive qualitative RT-PCT, we have obtained about 75% sensitivity and about 90% specificity using this assay. It was. With 50 patients entrusted to surgery (Group 1) and 100 patients endocrinologically showing thyroid nodules, the predicted number of cases of thyroid cancer is about 40-70 patients The number of cases without thyroid cancer is about 80-110 patients. We have an accurate estimate of sensitivity with a 95% confidence interval (CI) of about 0.66-0.90 width, and specificity with a CI of 0.15-0.20 width or better. It is possible to obtain a value.

[Planned data analysis]
For all analyses, the most standard test to determine whether a patient has thyroid cancer or benign thyroid disease is based on pathological diagnosis by FNA biopsy or final histopathology. Group 1 patients have newly diagnosed thyroid cancer (positive or ambiguous FNA). Of these, we estimate that approximately 60-100% are positive using the RT-PCT assay. From this group, we obtain an estimate of sensitivity and a 95% confidence interval. Group 2 are patients who visit a clinic for evaluation of thyroid nodules and undergo FNA biopsy. Within this group, we estimate that about 5-30% can be positive for cancer. Here we obtain an estimate of specificity and a 95% confidence interval. Data from both groups are used to calculate both positive and negative predictive values (PPV, NPV) and the efficiency of TSHR mRNA for thyroid cancer.

Example 4
=== Quantitative reverse transcription polymerase chain reaction (RT-PCR) measurement of thyroid stimulating hormone receptor messenger RNA (TSHR mRNA) in peripheral blood of patients with thyroid cancer ===
An assay method based on RT-PCR of thyroid-specific mRNA may improve monitoring thyroid cancer recurrence. We have previously shown that qualitative RT-PCR for TSHR mRNA can be sensitive and specific for recurrent thyroid cancer. Here we have developed and validated a quantitative RT-PCR assay using an in-cycle fluorescence detection system (SYBR Green 1; Rotorgene 3000 ™). We have 59 patients; 15 healthy subjects; 19 patients with benign thyroid disease, 14 patients with newly diagnosed thyroid cancer (13 with papillary, 1 with Were follicular), and 11 patients (all papillary) with recurrent thyroid cancer were studied. Blood samples were taken before surgery and all diagnoses of thyroid disease were confirmed by surgical pathology. mRNA was extracted from venous blood and quantified using a spectrophotometer. One-step RT-PCR was performed according to the manufacturer's recommendations for the Quantitect SYBR Green Kit (Qiagen) and PCR was performed for 40 cycles. Gel electrophoresis confirmed the identity of the amplified product. Total RNA extracted from a papillary thyroid cancer surgical sample was serially diluted to generate a standard curve to calibrate the assay. The inter-assay coefficient of variation (CV) (n = 8) for the threshold cycle was 1.4% and the average inter-assay CV (n = 12) was 2.7%. Samples were normalized for the amount of RNA loaded into each reaction tube (1 g) and quantified using a thyroid cancer RNA standard curve. Results are reported as pg TSHR mRNA / g thyroid cancer mRNA (Table 7). These results show a significant difference between TSHR mRNA levels in patients without thyroid cancer (normal patients / benign thyroid disease) compared to patients with thyroid cancer (newly diagnosed / relapsed) Suggest.

患者のグループ間の違いは、ウィルキンソン順位和検定を用いて試験した。 [Table 7]

Differences between patient groups were tested using the Wilkinson rank sum test.

Example 5
=== Measurement of TSH receptor mRNA by quantitative RT-PCR in peripheral blood: role of pre- and post-operative levels in monitoring patients with thyroid cancer ===
Quantitative RT-PCR for TSHR mRNA is a sensitive and specific marker for recurrent thyroid cancer. To evaluate its value in monitoring patients after surgery, we measured TSHR mRNA levels by quantitative RT-PCR. A total of 71 subjects (26 normal; 19 benign thyroid disease; 15 newly diagnosed cancer and 11 recurrent thyroid cancer) were studied. TSHR mRNA levels were measured before surgery and on the first day after surgery, and 17 patients had an additional follow-up level (mean follow-up 19.2 ± 10 months). Residual / metastatic disease status was assessed 9-18 months after surgery by stimulated Tg levels (ng / mL) and / or whole body I ¹³¹ scan (WBS). The upper limit of normal subjects (0.78 ng / μg total RNA; median 0.12) defined the cutoff level for positive mRNA testing. The median (range) for pre-operative / post-operative levels for benign disease is 0.22 (0-27.3) /0.23 (0-0.57), and newly diagnosed cancer patients and For patients with recurrent cancer, 29.8 (0.07-69.7) /0.03 (0.01-9.5) and 33.58 (4.8-52.9) / 0, respectively. .15 (0.03-1365). Of the 15 newly diagnosed patients with thyroid cancer, 14 became negative for TSHR mRNA after surgery. All tracked except for one case that had a positive stimulated Tg level (13.6 ng / mL) but was WBS negative and had no clinically relevant disease for further imaging The study remained disease free. One patient (Tg antibody positive) remained positive after surgery, had a clinically relevant disease that was actually missed by WBS and stimulated Tg and was diagnosed by pathology. Of the 11 patients with recurrent thyroid cancer, 7 become negative after surgery by our assay; these 4 remain disease free at follow-up and The remaining 3 cases had increased stimulated Tg levels (≦ 9.3 ng / mL) but were negative WBS and were not treated further. Four of 11 patients remained positive after surgery by assay; all had metastatic disease and elevated Tg ≧ 46 ng / mL and positive WBS. The overall agreement with stimulated Tg was 81% and that with WBS was 96%.

  Our results suggest that TSHR mRNA has a short life span in the circulation and that post-operative levels in patients with thyroid cancer are predictive of residual / metastatic disease.

Thyroglobulin (Tg), TSHR and glycine in 9 patient samples (lanes 1-9), 1 negative control (no reverse transcription; lane 10) and 1 positive control (thyroid cancer tissue RNA; lane 11). Figure 2 depicts a photograph of a representative gel showing RT-PCR results for seraldehyde 3-phosphate dehydrogenase (GAPDH). Lanes 1, 5 and 6 are benign thyroid disease patients; lanes 2 and 4 are thyroid cancer patients with no evidence of disease; lanes 3, 7-9 are thyroid cancer patients with evidence of disease. Figure 3 illustrates representative gel photographs showing RT-PCR results for Tg and TSHR in patients (lanes 2-8). The positive control is lane 1 and the negative control is lane 9. Figure 8 illustrates RT-PCR results in 18 patients using non-diagnostic FNA cytology *. Two are thyroiditis and one is a colloidal nodule. FP, false positive (hyperplastic eosinophilic nodule); HA, Hürtre cell adenoma.

Claims (23)

A method of detecting thyroid cancer in a subject comprising:
Obtaining a nucleic acid sample from a body sample of a subject, and determining whether the nucleic acid sample comprises thyroid stimulating hormone receptor (TSHR) mRNA. 2. The THSR mRNA is determined by amplifying a segment of TSHR mRNA in the nucleic acid sample and detecting the presence of the segment of amplified TSHR mRNA in the body fluid sample. Method.   The method of claim 2, wherein the amplification is performed using a pair of primers complementary to the TSHR mRNA.   4. The method of claim 3, wherein the segment of TSHR mRNA amplified by the primer spans at least a portion of exons 6-9 of TSHR mRNA.   The method of claim 4, wherein the at least one primer comprises SEQ ID NO: 1.   The method of claim 4, wherein the at least one primer comprises SEQ ID NO: 2.   The method of claim 1, wherein the body sample comprises blood. A pre-operative assay for determining whether a thyroid neoplasm in a subject is benign or malignant, comprising:
An assay comprising obtaining a nucleic acid sample from the peripheral blood of a subject, and determining whether the nucleic acid sample contains thyroid stimulating hormone receptor (TSHR) mRNA. 9. The THSR mRNA is determined by amplifying a segment of TSHR mRNA in the nucleic acid sample and detecting the presence of the segment of amplified TSHR mRNA in the body fluid sample. Method.   10. The method of claim 9, wherein the amplification is performed using a pair of primers that are complementary to the TSHR mRNA.   11. The method of claim 10, wherein the segment of TSHR mRNA amplified by the primer spans at least a portion of TSHR mRNA exons 6-9.   The method of claim 11, wherein the at least one primer comprises SEQ ID NO: 1.   12. The method of claim 11, wherein at least one primer comprises SEQ ID NO: 2. A method of detecting thyroid cancer in a subject comprising:
Obtaining a nucleic acid sample from a body sample of the subject;
A method comprising: amplifying a segment of TSHR mRNA in said nucleic acid sample; and detecting the presence of an amplified segment of TSHR mRNA in said body fluid sample.   15. The method of claim 14, wherein the amplification is performed using a pair of primers that are complementary to the TSHR mRNA.   16. The method of claim 15, wherein the segment of TSHR mRNA amplified by the primer spans at least a portion of TSHR mRNA exons 6-9.   15. The method of claim 14, wherein the primer comprises at least one of SEQ ID NO: or SEQ ID NO: 2.   15. The method of claim 14, wherein the TSHR mRNA is detected using gel electrophoresis.   15. The method of claim 14, wherein detection of the TSHR mRNA indicates malignant or metastatic thyroid cancer. A pre-operative assay for determining whether a thyroid neoplasm in a subject is benign or malignant, comprising:
Obtaining a nucleic acid sample from a body sample of the subject;
Amplifying a segment of Tg mRNA in the nucleic acid sample using a pair of primers, at least one of which comprises SEQ ID NO: 3 or SEQ ID NO: 4, and the presence of the amplified Tg mRNA segment in the body fluid sample An assay method comprising the step of detecting.   21. The method of claim 20, wherein the Tg mRNA is detected using gel electrophoresis.   21. The method of claim 20, wherein detection of the Tg mRNA indicates malignant or metastatic thyroid cancer.   21. The method of claim 20, wherein the body sample comprises peripheral blood.

Images