JP2008504801A - A method for producing a double low content recovery line of Brassica napus with high agricultural value - Google Patents

Abstract

A method of creating a double low content recovery line of Brassica napus for ogura-type cytoplasmic male sterility (cms), which is deficient in the radish Pgi-2 allele Highly agricultural, characterized by female fertility, high Rfo transmission rate, and high viability, introduced with radish gene having Rfo recovery gene recombined with Pgi-2 gene of Brassica oleracea It has value. A method for forming seeds and their progenies of oilseed rape hybrids. Oilseed rape seeds and use of a combination of PGIol, PGIunt, PGIint, BolJon and CP418 markers for analysis.
[Selected figure] Figure 2

Description

  The present invention relates to a method for producing a double low content recovery line of oilseed rape for ogura-type cytoplasmic male sterility (cms), which line contains the radish Pgi-2 allele. A radish gene that has a deleted Rfo recovery gene recombined with the Pgi-2 gene of Brassica oleracea has been introduced and is characterized by "female fertility, high Rfo transmission rate and high viability The present invention, which has a high agronomic value, also relates to the method of forming seeds and their progeny of Brassica napus hybrids and the use of markers for selection.

Breeding a recovery line for the Ogu-INRA-type cytoplasmic male sterility (cms) system in Brassica napus L. has been a major objective since the past few years. In order to increase the female fertility and obtain a double low-content recovery line, it was necessary to perform a great amount of backcrossing and line breeding. The so-called “double low content” varieties refer to those that have a low erucic acid content in the oil and a low glucosinolate content in the solid flour that remains after the oil has been extracted. However, due to the large size of radish gene transfer, some difficulties may be encountered in breeding these lines (transgene rearrangement, possible linkage with undesirable traits).
Desilores S et al 2003 EMBO reports 4, 6: 588-594

  Therefore, the present inventors aimed to provide a newly improved double low content recovery line with high agricultural value.

  This goal is achieved by a new method that creates a recombinant double low content recovery line for Ogu-INRA cytoplasmic male sterility (cms) in rape.

The first object of the present invention relates to a method for producing a double low content recovery line of oilseed rape for Ogura-type cytoplasmic male sterility (cms), which line is a Pgi-2 allele of Japanese radish. Has been introduced and has a radish gene, which has an Rfo recovery gene recombined with the cabbage Pgi-2 gene, and has high agricultural value characterized by female fertility, high Rfo transmission rate and high viability And the method includes the following steps:
a) Crossing a spring rape double low content cms line inserted with the deleted radish gene with a spring Drakkar double low content line to form a heterozygote recovery plant of rape.
b) Before meiosis, the heterozygote recovered plant obtained in step a) is irradiated with gamma rays,
c) crossing the pollen of the flower obtained in step b) with a spring Wesrona strain with a low cms double content,
d) testing the viability and female fertility of the progeny and the transmission rate of the cms gene;
e) Select progeny lines.

  In the context of the present invention, the term “line (s)” means a plant that is essentially homozygous and can reproduce by self-pollination.

  In the method according to claim 1, the dose in step b) is 65 gray in 6 minutes.

  According to one preferred embodiment relating to the method of the invention, the double low content cms line of spring rape in step a) is R211.

  R211 is a spring recovery line of INRA.

  Drakkar is a French spring registered variety.

  Wesroona is an Australian spring registered variety.

  According to one preferred embodiment relating to the method of the invention, the test is carried out by a combination of five markers selected from PGIol, PGIUNT, PGIint, BolJon and CP418.

  Another object of the present invention relates to a double low content recovery line of Brassica napus for Ogura-type cms, which lacks the radish Pgi-2 allele and has the cabbage Pgi-2. A radish gene having an Rfo recovery gene recombined with the gene has been introduced, and has a high agricultural value characterized by female fertility, high Rfo transmission rate and high viability.

  According to one preferred embodiment, the double low content recovery line has a unique combination of five markers selected from PGIol, PGIUNT, PGIint, BolJon and CP418.

Another object of the present invention relates to a method for forming a hybrid plant of Brassica napus and its progeny through the following procedure, which is obtained by the following procedure.
a) preparing a recovery line produced according to claim 1 and bred to be homozygous,
b) In the field for producing hybrids, the recovered line is used as a pollen-providing plant,
c) In the field for producing hybrids, cms plants are used as hybrid seed producing plants, and d) hybrid seeds are obtained from male sterile plants.

  Another object of the present invention relates to the seeds of Brassica plants obtained by the method of the present invention.

  Yet another object of the present invention is the oilseed rape, deposited with reference number NCIMB41183, July 4, 2003, at NCIMB Limited, 23, St Machar Drive, Aberdeen, Scotland, AB24 3RY, UK. Is related to the seeds.

  Another object of the present invention is for Ogura-type cms, using at least four markers of PGIol, PGIint, BolJon and CP418, or any of those sites including at least one polymorphic site, The present invention relates to analyzing a rape recovery line of Brassica napus, which line has a radish Pgi-2 allele deleted and having an Rfo recovery gene recombined with the cabbage Pgi-2 gene. The gene has been introduced and has high agricultural value characterized by female fertility, high Rfo transmission rate and high viability.

  In a preferred embodiment, the combination consists of five markers: PGIol, PGIUNT, PGIint, BolJon and CP418.

  In the present invention, “any site including at least one polymorphic site” means at least any part of a sequence showing a difference between a cabbage-type sequence and a B. rapa-type sequence. Means that.

  Such markers are shown in the sequence listing described for the following figures and R2000 lines.

According to one advantageous embodiment, the invention relates to:
-Marker PGIol amplified with primers PGIolU and PGIolL:
(PGIolU: 5 ′ TCATTTGATTGTTGCGCCTG3 ′;
PGIolL: 5 'TGTACATCAGACCCGGGTAGAAAA 3')
-Marker PGIint amplified with primers PGIintU and PGIintL:
(PGIintU: 5′CAGCACTAATTCTGCGGTATG3 ′;
PGIintL: 5'CAATAACCCTAAAAGCACCTG3 ')
-Marker PGIUNT amplified with primers PGIolU and PGIintL:
(PGIolU: 5 ′ TCATTTGATTGTTGCGCCTG3 ′;
PGIintL: 5'CAATAACCCTAAAAGCACCTG3 ')
-Marker BolJon amplified using primers BolJonU and BolJonL:
(BolJonU: 5′GATCCGATTCTTCTCCTGTTG3 ′;
BolJonL: 5'GCTCACTCCTCCAAATCACTCT3 ')
-Marker CP418 amplified using primers SG129U and pCP418L:
(SG129U: cf Giancola et al, 2003 Theo Appl. Genet. (In press)
pCP418L: 5 ′ AATTTCTCCATCACAAGGACC3 ′)

  Another object of the present invention relates to PGIol, PGIUNT, PGIint, BolJon and CP418 markers, the sequences of which are as follows.

  PGIol R2000 marker:

  PGIUNT R2000 marker:

  PGIint R2000 marker:

  BolJon R2000 marker:

  CP418L R2000 marker:

  In the accompanying drawings, the following abbreviations are used:

  FIG. 1 shows gamma irradiation and creation of F2.

  FIG. 2 shows the fruiting of R211 and R2000.

  FIG. 3 shows the number of seeds per pod of various lines.

FIG. 4 shows the position of the PGIol primer in the segment of the PGI sequence according to the database. In this figure,
PGIol: -Primer PGIolU (the name in SGAP is BnPGIch1U)
-Primer PGIolL (the name in SGAP is BnPGIch1L)
PGIint: -Primer PGIintU
-Primer PGIintL (this is not included in the sequence)

  FIG. 5 shows an electrophoresis gel of the PCR marker PGI-2 gene (PGIol) and the PCR marker SG34 close to Rfo.

  FIG. 6 shows the Pgi-2 segment of DNA amplified by PCR using the PGIol primer.

FIG. 7 shows the digestion of the PCR product PGIol by Msel.
In this figure,
Sam and Darm have a 75 bp band.
Drak, R211. DK and R2000 show a 70 bp band (15% acrylamide).
8 is similar to Samourai (75 bp); by mixing with Drakkar (70 bp), two bands were visualized.

FIG. 8 shows an electrophoresis agarose gel of PGIUNT marker.
In this figure,
The PGIUNT band (about 980 bp) is present in cabbage, turnip Asko varieties (B. rapa cv Asko), maintenance and recovery lines, but not in 'R211'.
There is no amplification in radish and Arabidopsis.
Only one band was amplified in various Brassica genotypes. The band sizes are similar, but the sequences are different.

FIG. 9 shows an electrophoresis gel of PGIint PCR marker.
In this figure, the PGIint of the radish system 7 is approximately 950 bp. This band is the same as the recovery lines RRH1 and R113. This is not seen with R211. Moreover, it is not seen also in R2000. However, the size of the PGIint band is about the same at about 870 bp in various Brassica species, but the sequence is different.

  FIG. 10 shows an electrophoresis agarose gel of BolJon PCR marker.

FIG. 11 shows an electrophoresis agarose gel of CP418 marker.
In this figure, the CP418 band (approximately 670 bp) is unique to the cabbage genome. This is present in cabbage (B. ol), oilseed rape (Samourai, Drakkar, Pactol and heterozygous R2111 * Dk). This is not present in the rape (RRH, R113 and R211) of the recovery line. It exists in R2000 of the homozygote.

  FIG. 12 is a table showing an outline of the markers.

  FIG. 13 (13 (a), 13 (b)) shows the alignment of the sequence of the PGIol marker among Arabidopsis plants, radish, turnip, cabbage and R2000.

  -Figure 14 (14 (a), 14 (b), 14 (c), 14 (d)) shows the alignment of the sequence of the PGIint-UNT marker among Arabidopsis plants, radish, turnip, cabbage and R2000. It is shown.

  -Figure 15 (15 (a), 15 (b), 15 (c)) shows the alignment of the sequence of the CP418L marker among Arabidopsis plants, radish, turnip, cabbage and R2000.

FIG. 16 (16 and 16bis) shows BolJon markers of Arabidopsis plants, radish and turnips.
These are representative of the band 1 and 2 of the SG129 marker in Arabidopsis plants (terminal of AC007190—the start of AC011000), the end of cabbage EMBH959102 and the start of EMBH448336, and the oilseed rape (in Drakkar and Samourai, respectively). It is aligned with the DB sequence of the consensus sequence.
From the 836 bp point, the AC07190-AC11000 and GCPATpBOJ sequences are no longer highly homologous to those of Brassica plants.
The sequences of radish and turnip (GCPconsen RsRfBOJ and BR) are still highly homologous to that of oilseed rape, from 858 bp to 900 and 981 bp, respectively.
In radish, only partial homology is found further downstream of the Brassica plant sequence.
In turnip Asko varieties, the left side of the BolJon sequence can be further aligned with that of cabbage and turnip in Brassica napus, from the 1057 bp point to the BolJonL primer after deletion of 78 bp.

  FIG. 17 (17 and 17bis) shows the position of the Pgi-2 primer in the MJB 21.12 sequence of Arabidopsis th.

  FIG. 18 shows the position of the BolJon primer in the mipsAtl62850 gene and the overlapping region of the Arabidopsis AC007190 and AC011000 clones. Alignment with the BolJon PCR product (740 bp) of Arabidopsis plants is shown.

  However, it should be understood that the examples shown herein are provided to illustrate the subject of the present invention and are not intended to be limiting.

  Example I: A radish gene has been introduced that has the Rfo recovery gene deleted from the radish Pgi-2 allele and recombined with the cabbage Pgi-2 gene, female fertility, high Rfo transmission rate and A method of creating a double low content recovery line of Brassica napus for Ogura-type cytoplasmic male sterility (cms) with high agronomic value characterized by high viability.

Materials and methods:
Genotype: The 'R211' line into which the deleted radish gene was inserted was crossed with a spring low GLS rapeseed 'Drakar' to create an F1 progeny ('R211 * Dk'). For the subsequent mating, the spring low GLScms line 'Wesroona' (from Australia) was used. As comparative controls in molecular analysis, complete (as in European radish line 7, Asian radish line D81, oilseed rape * wild-type radish hybrids, cabbage, and turnip Asko varieties, Arabidopsis thaliana) Winter recovery lines derived from 'Samourai' with 'RRH1') or incomplete ('R113') gene transfer were used.

  Gamma irradiation: In a controlled area, the entire flowering plant is treated with gamma radiation from a Co60 radiation source. A sublethal dose of 65 gray was irradiated before meiosis.

  Test hybridization and F2 preparation: After removing buds larger than 2 mm, the irradiated plants were transferred to an insect-proof greenhouse. The irradiated F1 progeny was used for artificial pollination of the cms'Wesrona 'line. The resulting recovery line F1 'plants were able to create the F2 family, which was harvested individually and sown precisely in the field analysis as well as those without irradiation.

Phenotypic selection: 1200 F2 progenies plus 44 controls (82330 plants used) in field analysis for the following three visual criteria (1 to 5) over 2 years: Scored).
1-Growth 2-Normal normality of fertile / fertile plants in separation of F2, and 3-female fertility (growth and fruiting of cocoons)

  Homozygous lines (F4) were created for repeated self-pollination, either in the field or in the greenhouse, to obtain progeny of selected families and for further analysis.

  Isozyme analysis was performed using Delorme R.M. and Eber F. 1992. Theor Appl Genet 85: 222-228 and performed as described in marker development (Fourmann M et al 2002. Theor Appl Genet 105: 1196-1206). PCR products are confirmed by sequencing.

  Alignments were performed using Blast Ncbi and Uk Crop Net Brassica DB and INRA's Multilin software in Toulouse.

Method:
'R211', one of the low GLS spring homozygous recovery lines with deletions in the introduced gene, was selected (Delorme R. and Eber F. 1992. Theorl Appl Genet 85: 222-228. Delorme R . et al 1998. Theor Appl Genet 97 :.. 129-134 Delourme R. et al 1999. 10 th Int Rapeseed Congress, Canberra).. Several molecules are missing on both sides of Rfo, such as spATCHIA (Fourmann M et al 2002. Theor Appl. Genet 105: 1196-1206), spSG91 (Giancola S et al 2003 Theor Appl. Genet. . 'R211' not only lost expression of the Pgi-2 allele isozyme of the radish gene, but also lost the isozyme expression of the Pgi-2 allele of the cabbage genome (1, 2).

  In addition, the homozygous 'R211' showed an undesirable trait that was linked, such as low growth and poor fruiting. We hypothesized that such plants lack the rape chromosome fragments. The percentage of fertility of the F2 progeny derived from this material was lower than expected (64% instead of 75%). We started the program from this 'R211' strain and forcedly recombined Rfo into which the gene of this deleted strain was introduced and the rape homologous chromosome obtained from the double low content oilseed rape strain. I tried to do that.

  Ionizing irradiation is known to induce chromosome reorganization by double-strand breaks followed by abnormal recombination. In order to induce chromosomal breakage, gamma irradiation is used for F1 of the heterozygote derived from the 'R211' lineage immediately before meiosis, and recombination of the deleted radish transgene in the rape genome. Aimed.

result:
Of the 1200 F2 families tested, few families scored highest on three criteria.

  Only 'R2000' produces a normal ratio of fertile plants with stable recovery of good agronomic traits such as good female fertility for each progeny obtained by self-pollination. It was found that the fruiting was normal compared to '(Figs. 2 and 3). This family was derived from a 6 minute irradiation treatment at a dose of 65 grays per hour.

  Analysis of glucosinolate confirmed that it was low in content.

  In FIG. 2 (fruiting in 'R211' and 'R2000'), R2000 shows a normal inflorescence and normal appearance structure.

In FIG. 3 (number of seeds per pod), the following were evaluated:
-The best 'R2000' F4 family in self-pollination and test hybridization,
-'Pactol' cms line of rape and 'R211' control.

Example II: Selection of markers in the Pgi-2 gene PGI isozyme analysis: The 'R2000' progeny expressed a rape Pgi-2 allele derived from the cabbage genome that was already lost in 'R211'.

Three PCR markers were defined to analyze the R2000 family in comparison with the known recovery line rapes RRH1 and R113.
1) A PGIol marker was developed from the Brassica DB sequence so as to be specific to the Brassica genome. There is no amplification in either radish or Arabidopsis, but there is only one 248 bp band in Brassica plants.
2) The PGIint marker amplified a long part of the Pgi-2 gene, which made it possible to clearly distinguish between the various species tested, Brassica, Raphanus and Arabidopsis . Turnips and cabbages were indistinguishable by the size of the bands in the agarose gel, but were distinguished by the sequence of their PGINT bands.
3) The PGIUnt marker is a combination of a PGIolU primer and a PGIintL primer.

  This marker has the specificity of the PGIol marker, but for the PGIint marker, it amplifies the long part.

II. No amplification was seen in the 'R211' parent line with the 1 PGIol marker PGIol primer, whereas a 248 bp band was seen in the spring line tested. Its DNA sequence is homologous to the PGI-2 sequence obtained from Crop Net UK DB in Brassica species, and to the PGI-2 sequence obtained in previous studies by our group (referred to as SMAP sequence). Yes (positioning of primer SG PGI chou, FIG. 4).

  It was an ortholog of clone MJB21-12 (34542 bp) on chromosome 5 in Arabidopsis plants (NCBI DB).

PGIol and SG34 for homozygous testing:
In mixed PCR, two sets of primers, PGIol that labels the Pgi-2 gene that is not present in plants of the homozygous recovery line, and SG34 (S. Giancola et al.), A label very close to the Rfo gene. , Giancola S et al 2003 Thor Appl. Genet. (Coming soon), among the fertile plants that are isolated in the F2 progeny derived from 'R211', are homozygous from heterozygous plants The zygote was identified. Instead of using SG34, any other marker close to or in the Rfo gene may be used.

Only one R2000 family showed no difference between the progeny of the homozygote and the progeny of the heterozygote.
The Pgi-2 gene is present in R2000 homozygotes but not in R211 of the parent homozygote.

In FIG. 5 (PGIol marker and SG34 PCR marker):
The 'R2000' family of homozygotes recovered the PGIol band.

  The DNA sequence of the band confirmed the homology with the known Arabidopsis and Brassica Pgi-2 sequences. The control genotypes (Drakar, Pactol and Samourai, Darmor) also showed a similar pattern on the gel. The sequence of this common band confirmed their high degree of homology, which is almost the same except for one base substitution.

  The 'R2000' family of homozygotes recovered cabbage-type PGIol bands. It is different from the known recovery of the Samourai group.

  This amplified portion of Pgi-2 is very well conserved and there is little difference between the various genotypes. The long part of the Pgi-2 gene was examined in detail.

II. 2 Electrophoretic pattern of PGIUNT marker and PGIint marker PCR products:
PGIUNT marker: The second reverse primer, PGIintL, was designed “further downstream” of the Pgi-2 sequence to amplify the variable region as well as the conserved region of the gene. When used with the PGIolU band, it amplifies a 980 bp band only in the Brassica genome.

  No band was seen in R211, and PGIUNT band was seen in the homozygous 'R2000', similar to Drakkar's parent.

In FIG. 8 (PGIUNT marker):
The PGIint marker amplified a segment of PGIUNT. The upper primer PGIint can be amplified in all species tested and can clearly distinguish between Arabidopsis, Radish and Brassica. Turnips and cabbages are distinguished by their PGIint sequence, not the size of the band on the agarose gel. The genotypes of all tested recovery lines, with the exception of the 'R211' line, showed a European radish band and a single Brassica band that were homologous to the turnip band.

  Homozygous 'R2000' did not show a radish PGIint band as in the deleted parental 'R211' parental line, but a single Brassica band similar to the cabbage band. It was.

  FIG. 9 shows electrophoresis of PGIint markers.

Sequence analysis:
Comparison of PGI sequences obtained from the database.

  An approximately 490 bp PGI segment is known.

  The sequence of an approximately 490 bp segment obtained from various genotypes (cabbage, turnip, oilseed rape) has been studied by a group of our labs, but some sequences are described in M.M. Supplied by Fouramnn (4) to Brassica Crop Net DB as EMAF 25875 to 25788. These sequences are very well conserved.

Comparison of turnip and cabbage PGI sequences (Figures 13 and 14):
A comparison between cabbage and turnip PGI sequences obtained from the tested genotypes revealed that they were distinguished by 21 base substitutions. These substitutions distinguish PGIint sequences from other tested genotypes of rape that are homologous to either the turnip Asko varieties (RRH1 and R113) or cabbage (Drakkar, R211 * DK as well as R2000). Is possible.

Example III: Selection of markers in the region close to Rfo In order to facilitate cloning of the Rfo gene, markers surrounding the Rfo gene in the inserted radish gene were determined (Desloires S et al 2003 EMBO reports 4, 6: 588- 594). One of these, the SG129 PCR marker, is located very close to Rfo (Giancola S et al 2003 Theor Appl. Genet. (Coming)): thereby differing in the cabbage and turnip genomes of oilseed rape. The radish band was very difficult to confirm on an agarose gel.

  The target SG129 sequence was an ortholog of a clone in Arabidopsis (AC011000, F16P17 locus). This clone overlaps with an adjacent contig clone of the genus Arabidopsis (AC07190).

  We performed BLAST from the Brassica Crop Net DB at the starting point of A011000 to find one cabbage clone (EMBH448336, 764 bp) and BLAST at the end of AC07190 to give about 300 bp on the Arabidopsis map. A distant second cabbage clone (EMBH53971) was found.

  We designed a new PCR marker, BolJon, between two cabbage clones. We have confirmed that it is possible to amplify unique PCR bands in the various genotypes compared here.

In FIG. 16 (BolJon PCR product electrophoresis gel):
-In Arabidopsis plants, a 815 bp band of BolJon, which is homologous to overlapping segments of the contig, was amplified.
-In the Brassicae diploid species, the BolJon marker showed a different band. One is a 950 bp band in cabbage, and the other is an 870 bp band in turnip. This means that the two cabbage clones (EMBH53971 and EMBH448336) are sequential in the Brassica genome, as is the ortholog sequence in Arabidopsis.
-In Brassica napus, these two bands are co-amplified in the maintenance lines Samourai or Drakkar.
-In radish line 7, one BolJon band was amplified with a length of about 630 bp. The band of cmsRd81, which is a recovery Japanese radish, was slightly small.
-One of the BolJon bands was the same size as radish line 7 in the rape of all recovery lines. BolJon is a marker for radish gene transfer.
-Only the turnip band and the 630 bp radish band were seen in the rapeseed rapeseed 'RRH1', 'R113' and 'R211', which is This indicates that the cabbage ortholog does not exist, or that the cabbage ortholog of the target gene was altered when the radish segment of the chromosome was inserted into the constituent genome of the rape cabbage.

  The 'R2000' homozygous plant shows two BolJon bands of Brassica in addition to the radish BolJon subjected to PCR, which is also lost in 'R211' and other recovery lines. Cabbage band is recovering

  We designed pCP418L, a primer unique to the cabbage genome in the species tested. With the SG129U primer, it amplified only one PCR band (670 bp) in cabbage. (Fig. 17)

  Amplification was not observed in turnips, Japanese radish, or Arabidopsis plants, but a clear CP418 band was observed in the maintenance line of Brassica napus. The sequence was completely homologous to that of EMBH448336. Since this marker was in a very well conserved DNA sequence, there was no polymorphism between genotypes other than the presence or absence.

  There is no CP418 band in RRH1, R113, and R211. This is because the cabbage ortholog of the target gene does not exist or the radish gene is inserted in the cabbage ortholog of the target gene as described above. It shows that it was later modified.

  The homozygous plant of 'R2000' showed a CP418 band, and again, the specific cabbage band was recovered.

  In the present invention, a new recombinant low GLS recovery line excellent in female fertility was selected. The low value of the 'R211' lineage allowed selection of rare recombination events in the field and analysis of the 'R2000' family.

  Homozygous 'R2000' shows a unique combination of PGIol, PGIUNT, PGIint and BolJon markers when compared to the rape recovery line analyzed: PGIint marker is the rape of the homozygous recovery line One RRH1 and R113 shows that one Brassica band homologous to the turnip genome is seen in addition to the European radish band. In ‘R2000’, the lost radish band was not seen as in the parental deleted R211 strain, but one Brassica band homologous to cabbage was found. The ortholog PGIint sequence in this turnip genome is not amplified with this marker in the R211 and Drakkar genetic background.

  The sequences of PGIol and PGIUNT markers in the recovery lines RRH1 and R113 were homologous to those of the turnip Asko variety. In 'R2000', the sequence of PGIUNT is homologous to cabbage. The ortholog PGIUnt sequence in the turnip genome is not amplified with this marker in the R211 and Drakkar genetic backgrounds.

  The BolJon marker showed that a homozygous recovery rape containing 'R211' showed a unique turnip band in addition to the European radish band. In 'R2000', in addition to the two bands of 'R211', you can also see the BolJon band of the cabbage of the recovery line.

  The CP418 marker indicated that 'R2000' recovered this preserved cabbage segment.

  We hypothesized that recombination occurs in pollen mother cells that give rise to 'R2000' plants. And the deleted radish transgene is a cabbage-type Pgi-2 gene characterized by these markers, possibly derived from the Drakkar '00' genome present in 'R211 * DK' of the irradiated heterozygote And integrated into a segment of the normal homologous chromosome with the BolJon target sequence.

  According to the pattern observed in BolJon, the recombination phenomenon results in a special double-stranded region in the 'R2000' family, one from radish and the other from cabbage.

The figure which showed gamma ray irradiation and preparation of F2. The figure which showed the fruit of R211 and R2000. The figure which showed the number of seeds for every cocoon of each system | strain. The figure which showed the position of the PGIol primer in the segment of a PGI sequence by a database. The photograph which showed electrophoresis of PGI-2 gene (PGIol) and SG34. The figure which showed Pgi-2 segment of DNA amplified by PCR using the PGIol primer. The photograph which showed digestion by Msel of PGIol which is a PCR product. The photograph which shows the electrophoresis of a PGIUNT marker. The photograph which shows electrophoresis of a PGIint PCR marker. The photograph which shows the electrophoresis of a BolJon PCR marker. The photograph which shows electrophoresis of CP418 marker. A table showing the outline of the marker. Sequence alignment of PGIol markers among Arabidopsis plants, radish, turnip, cabbage and R2000. Sequence alignment of PGIint-UNT markers among Arabidopsis plants, radish, turnip, cabbage and R2000. Sequence alignment of CP418L marker among Arabidopsis plants, radish, turnip, cabbage and R2000. The figure which showed the BolJon marker of the Arabidopsis genus plant, a Japanese radish, and a turnip. The figure which showed the position of Pgi-2 primer in the MJB21.12 arrangement | sequence of Arabidopsis thaliana. FIG. 18 shows the position of the BolJon primer in the mipsAtl62850 gene and the overlapping region of the Arabidopsis AC007190 and AC011000 clones. Alignment with the BolJon PCR product (740 bp) of Arabidopsis plants is shown.

Claims (18)

The radish Pgi-2 allele has been deleted and the radish gene having the Rfo recovery gene recombined with the Pgi-2 gene of cabbage (Brassica oleracea) has been introduced. “Female fertility, high Rfo transmission rate A method for creating a double low content recovery line of Brassica napus for Ogura cytoplasmic male sterility (cms) with high agronomic value characterized by high viability and includes the following steps: Method.
a) A double low-content cms line of spring rape (Brassica napus) into which the deleted radish gene was inserted was crossed with a double low-content line of Spring Drakkar to form a heterozygote of Brassica napus. Forming a recovery plant,
b) Before meiosis, the heterozygote recovered plant obtained in step a) is irradiated with gamma rays,
c) crossing the pollen of the flower obtained in step b) with a spring Wesrona strain with a low cms double content,
d) testing the viability and female fertility of the progeny and the transmission rate of the cms gene;
e) Select progeny lines.   The method according to claim 1, characterized in that the dose in step b) is 65 grays in 6 minutes.   The method according to claim 1, characterized in that the double low content cms line of Brassica napus in step a) is R211.   The method according to claim 1, characterized in that the test in step d) is performed by a combination of five markers selected from PGIol, PGIUNT, PGIint, BolJon and CP418.   The radish Pgi-2 allele is deleted and the Rfo gene recombined with the cabbage Pgi-2 gene is inserted and is characterized by female fertility, high Rfo transmission rate and high viability Double low content recovery line of Brassica napus for Ogura-type cytoplasmic male sterility (cms) with high agronomic value.   The double low content recovery line of Brassica napus according to claim 5, characterized in that it has a unique combination of five markers selected from PGIol, PGIUNT, PGIint, BolJon and CP418. Brassica napus hybrid plant and its progeny obtained by the following procedure.
a) preparing a recovery line produced according to claim 1 and bred to be homozygous,
b) In the field for producing hybrids, the recovered line is used as a pollen-providing plant,
c) In the field for producing hybrids, cms plants are used as hybrid seed producing plants, and d) hybrid seeds are obtained from male sterile plants.   Seeds of the Brassica plant, characterized in that it is obtained from the Brassica line obtained from claim 1.   Seeds of Brassica napus obtained in claim 7.   Oilseed rape obtained from claims 1 and 2 deposited at NCIMB Limited on July 4, 2003, at NCIMB Limited, 23, St Machar Drive, Aberdeen, Scotland, AB243 RY, UK ( Seeds of Brassica napus.   The radish Pgi-2 allele is deleted and the Rfo gene recombined with the cabbage Pgi-2 gene is inserted and is characterized by female fertility, high Rfo transmission rate and high viability A combination of at least four markers of PGIol, PGIint, BolJon and CP418 to analyze a Brassica napus recombination recovery line for Ogura-type cms with high agronomic value, or , A method of using any site comprising at least one polymorphic site thereof.   12. Use according to claim 11, characterized in that the combination consists of five markers: PGIol, PGIUNT, PGIint, BolJon and CP418. The marker PGIol is amplified using the primers PGIolU and PGIolL,
(PGIolU: 5 ′ TCATTTGATTGTTGCGCCTG3 ′;
PGIolL: 5 'TGTACATCAGACCCGGGTAGAAAA 3')
The marker PGIint is amplified using the primers PGIintU and PGIintL,
(PGIintU: 5′CAGCACTAATTCTGCGGTATG3 ′;
PGIintL: 5'CAATAACCCTAAAAGCACCTG3 ')
The marker PGIUNT is amplified using the primers PGIolU and PGIintL,
(PGIolU: 5 ′ TCATTTGATTGTTGCGCCTG3 ′;
PGIintL: 5'CAATAACCCTAAAAGCACCTG3 ')
The marker BolJon is amplified using the primers BolJonU and BolJonL,
(BolJonU: 5′GATCCGATTCTTCTCCTGTTG3 ′;
BolJonL: 5'GCTCACTCCTCCAAATCACTCT3 ')
The marker CP418 is amplified using the primers SG129U and pCP418L (SG129U: cf Ginacola et al (5);
pCP418L: 5 ′ AATTTCTCCATCACAAGGACC3 ′)
Use according to claim 12, characterized in that. A PGIol marker having the following sequence:

A PGIUNT marker having the following sequence:

PGIint marker having the following sequence:

BolJon marker having the following sequence:

CP418 marker having the following sequence:

Images